>Feature sequence001 77 382 gene locus_tag LOCUS_00010 77 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 455 763 gene locus_tag LOCUS_00020 455 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 943 2325 gene locus_tag LOCUS_00030 943 2325 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 protein_id gnl|my_center|LOCUS_00030 4780 2300 gene locus_tag LOCUS_00040 4780 2300 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108984.1 protein_id gnl|my_center|LOCUS_00040 5294 7330 gene locus_tag LOCUS_00050 5294 7330 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_00050 7443 8432 gene locus_tag LOCUS_00060 7443 8432 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_00060 8489 9148 gene locus_tag LOCUS_00070 8489 9148 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359485.1 protein_id gnl|my_center|LOCUS_00070 9637 9158 gene locus_tag LOCUS_00080 9637 9158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964454.1 protein_id gnl|my_center|LOCUS_00080 9741 10217 gene locus_tag LOCUS_00090 gene greA 9741 10217 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_00090 10231 10620 gene locus_tag LOCUS_00100 10231 10620 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964456.1 protein_id gnl|my_center|LOCUS_00100 10968 10627 gene locus_tag LOCUS_00110 10968 10627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185787975.1 protein_id gnl|my_center|LOCUS_00110 12167 11019 gene locus_tag LOCUS_00120 12167 11019 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_00120 12289 13197 gene locus_tag LOCUS_00130 12289 13197 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_00130 13288 13956 gene locus_tag LOCUS_00140 13288 13956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14071 14448 gene locus_tag LOCUS_00150 14071 14448 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_00150 14541 15221 gene locus_tag LOCUS_00160 gene aat 14541 15221 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964441.1 protein_id gnl|my_center|LOCUS_00160 15878 15192 gene locus_tag LOCUS_00170 15878 15192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 16392 15859 gene locus_tag LOCUS_00180 16392 15859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17032 16469 gene locus_tag LOCUS_00190 17032 16469 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_00190 17188 18318 gene locus_tag LOCUS_00200 17188 18318 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929131.1 protein_id gnl|my_center|LOCUS_00200 18489 19124 gene locus_tag LOCUS_00210 18489 19124 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_00210 19832 19101 gene locus_tag LOCUS_00220 19832 19101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 20615 19902 gene locus_tag LOCUS_00230 gene truB 20615 19902 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964446.1 protein_id gnl|my_center|LOCUS_00230 21450 20656 gene locus_tag LOCUS_00240 21450 20656 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_00240 21722 21453 gene locus_tag LOCUS_00250 21722 21453 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_00250 22689 21811 gene locus_tag LOCUS_00260 22689 21811 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964449.1 protein_id gnl|my_center|LOCUS_00260 22771 25854 gene locus_tag LOCUS_00270 22771 25854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 25890 26144 gene locus_tag LOCUS_00280 25890 26144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 26357 27052 gene locus_tag LOCUS_00290 26357 27052 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_00290 27656 27144 gene locus_tag LOCUS_00300 27656 27144 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963890.1 protein_id gnl|my_center|LOCUS_00300 28092 27766 gene locus_tag LOCUS_00310 28092 27766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 28603 28133 gene locus_tag LOCUS_00320 28603 28133 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964461.1 protein_id gnl|my_center|LOCUS_00320 30076 28697 gene locus_tag LOCUS_00330 30076 28697 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_00330 30158 30544 gene locus_tag LOCUS_00340 30158 30544 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_00340 30630 32228 gene locus_tag LOCUS_00350 gene pckA 30630 32228 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108802.1 protein_id gnl|my_center|LOCUS_00350 33019 32315 gene locus_tag LOCUS_00360 33019 32315 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_00360 35391 33724 gene locus_tag LOCUS_00370 35391 33724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 35555 36283 gene locus_tag LOCUS_00380 35555 36283 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962342.1 protein_id gnl|my_center|LOCUS_00380 36285 37619 gene locus_tag LOCUS_00390 36285 37619 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_00390 37621 38043 gene locus_tag LOCUS_00400 37621 38043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 39031 38024 gene locus_tag LOCUS_00410 39031 38024 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_00410 39134 40429 gene locus_tag LOCUS_00420 gene tyrS 39134 40429 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962338.1 protein_id gnl|my_center|LOCUS_00420 40518 41048 gene locus_tag LOCUS_00430 40518 41048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 42022 41045 gene locus_tag LOCUS_00440 42022 41045 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_00440 42294 42725 gene locus_tag LOCUS_00450 42294 42725 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933554.1 protein_id gnl|my_center|LOCUS_00450 43172 42849 gene locus_tag LOCUS_00460 43172 42849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 43706 43398 gene locus_tag LOCUS_00470 43706 43398 CDS product T9SS type A sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962299.1 protein_id gnl|my_center|LOCUS_00470 44639 43914 gene locus_tag LOCUS_00480 44639 43914 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_00480 44799 46289 gene locus_tag LOCUS_00490 44799 46289 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118829.1 protein_id gnl|my_center|LOCUS_00490 47183 46302 gene locus_tag LOCUS_00500 47183 46302 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_00500 48680 47184 gene locus_tag LOCUS_00510 48680 47184 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118829.1 protein_id gnl|my_center|LOCUS_00510 49671 48703 gene locus_tag LOCUS_00520 49671 48703 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209999.1 protein_id gnl|my_center|LOCUS_00520 51214 49694 gene locus_tag LOCUS_00530 51214 49694 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210000.1 protein_id gnl|my_center|LOCUS_00530 52309 51254 gene locus_tag LOCUS_00540 52309 51254 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975981.1 protein_id gnl|my_center|LOCUS_00540 53244 52348 gene locus_tag LOCUS_00550 53244 52348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 53497 54234 gene locus_tag LOCUS_00560 53497 54234 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107446.1 protein_id gnl|my_center|LOCUS_00560 54426 56288 gene locus_tag LOCUS_00570 54426 56288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 56301 56966 gene locus_tag LOCUS_00580 56301 56966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 57046 57291 gene locus_tag LOCUS_00590 57046 57291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 57505 60897 gene locus_tag LOCUS_00600 57505 60897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 61183 61109 gene locus_tag LOCUS_t00010 61183 61109 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 62185 61256 gene locus_tag LOCUS_00610 62185 61256 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_00610 62624 62307 gene locus_tag LOCUS_00620 gene trxA 62624 62307 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962434.1 protein_id gnl|my_center|LOCUS_00620 67201 62765 gene locus_tag LOCUS_00630 gene dnaE 67201 62765 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962512.1 protein_id gnl|my_center|LOCUS_00630 67509 68054 gene locus_tag LOCUS_00640 67509 68054 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962515.1 protein_id gnl|my_center|LOCUS_00640 68071 68601 gene locus_tag LOCUS_00650 gene rimM 68071 68601 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962516.1 protein_id gnl|my_center|LOCUS_00650 69687 68644 gene locus_tag LOCUS_00660 69687 68644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 69834 71303 gene locus_tag LOCUS_00670 69834 71303 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_00670 71300 72010 gene locus_tag LOCUS_00680 71300 72010 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962517.1 protein_id gnl|my_center|LOCUS_00680 72066 73244 gene locus_tag LOCUS_00690 72066 73244 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_00690 76364 73584 gene locus_tag LOCUS_00700 76364 73584 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107553.1 protein_id gnl|my_center|LOCUS_00700 76628 77779 gene locus_tag LOCUS_00710 76628 77779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 79300 77795 gene locus_tag LOCUS_00720 79300 77795 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_00720 81475 79307 gene locus_tag LOCUS_00730 81475 79307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 83104 81626 gene locus_tag LOCUS_00740 83104 81626 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_00740 83402 86134 gene locus_tag LOCUS_00750 83402 86134 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_00750 87611 86223 gene locus_tag LOCUS_00760 87611 86223 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921851.1 protein_id gnl|my_center|LOCUS_00760 89079 87739 gene locus_tag LOCUS_00770 89079 87739 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_00770 91212 89095 gene locus_tag LOCUS_00780 91212 89095 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119288.1 protein_id gnl|my_center|LOCUS_00780 93127 91244 gene locus_tag LOCUS_00790 93127 91244 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764450.1 protein_id gnl|my_center|LOCUS_00790 95057 93288 gene locus_tag LOCUS_00800 95057 93288 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764450.1 protein_id gnl|my_center|LOCUS_00800 96605 95124 gene locus_tag LOCUS_00810 96605 95124 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921496.1 protein_id gnl|my_center|LOCUS_00810 100103 96771 gene locus_tag LOCUS_00820 100103 96771 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_00820 101709 100180 gene locus_tag LOCUS_00830 101709 100180 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_00830 103406 101868 gene locus_tag LOCUS_00840 103406 101868 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769526.1 protein_id gnl|my_center|LOCUS_00840 106548 103429 gene locus_tag LOCUS_00850 106548 103429 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789829.1 protein_id gnl|my_center|LOCUS_00850 107752 106886 gene locus_tag LOCUS_00860 107752 106886 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121747.1 protein_id gnl|my_center|LOCUS_00860 108419 107856 gene locus_tag LOCUS_00870 108419 107856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 110134 108422 gene locus_tag LOCUS_00880 110134 108422 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_00880 111622 110174 gene locus_tag LOCUS_00890 111622 110174 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922831.1 protein_id gnl|my_center|LOCUS_00890 113268 111691 gene locus_tag LOCUS_00900 113268 111691 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921851.1 protein_id gnl|my_center|LOCUS_00900 114823 113378 gene locus_tag LOCUS_00910 114823 113378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 116543 114831 gene locus_tag LOCUS_00920 116543 114831 CDS product glycoside hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764376.1 protein_id gnl|my_center|LOCUS_00920 117309 116557 gene locus_tag LOCUS_00930 117309 116557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 118894 117326 gene locus_tag LOCUS_00940 118894 117326 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427770.1 protein_id gnl|my_center|LOCUS_00940 120386 118923 gene locus_tag LOCUS_00950 120386 118923 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_00950 121997 120441 gene locus_tag LOCUS_00960 121997 120441 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_00960 122535 122071 gene locus_tag LOCUS_00970 122535 122071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202439.1 protein_id gnl|my_center|LOCUS_00970 124366 122564 gene locus_tag LOCUS_00980 124366 122564 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786237.1 protein_id gnl|my_center|LOCUS_00980 127478 124383 gene locus_tag LOCUS_00990 127478 124383 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202438.1 protein_id gnl|my_center|LOCUS_00990 132082 127862 gene locus_tag LOCUS_01000 132082 127862 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_01000 133263 132199 gene locus_tag LOCUS_01010 133263 132199 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_01010 134198 133263 gene locus_tag LOCUS_01020 134198 133263 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_01020 134350 135951 gene locus_tag LOCUS_01030 134350 135951 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_01030 135985 136347 gene locus_tag LOCUS_01040 135985 136347 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_01040 137332 136370 gene locus_tag LOCUS_01050 137332 136370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 138524 137499 gene locus_tag LOCUS_01060 138524 137499 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 protein_id gnl|my_center|LOCUS_01060 138720 141398 gene locus_tag LOCUS_01070 138720 141398 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037795.1 protein_id gnl|my_center|LOCUS_01070 141499 142809 gene locus_tag LOCUS_01080 141499 142809 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228344.1 protein_id gnl|my_center|LOCUS_01080 143102 144706 gene locus_tag LOCUS_01090 143102 144706 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882525.1 protein_id gnl|my_center|LOCUS_01090 144717 145841 gene locus_tag LOCUS_01100 144717 145841 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176863.1 protein_id gnl|my_center|LOCUS_01100 146000 146506 gene locus_tag LOCUS_01110 146000 146506 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886701.1 protein_id gnl|my_center|LOCUS_01110 146517 146726 gene locus_tag LOCUS_01120 146517 146726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 146821 148182 gene locus_tag LOCUS_01130 gene hemN 146821 148182 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963301.1 protein_id gnl|my_center|LOCUS_01130 148215 149036 gene locus_tag LOCUS_01140 148215 149036 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_01140 150493 149102 gene locus_tag LOCUS_01150 150493 149102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 150730 151191 gene locus_tag LOCUS_01160 150730 151191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 151689 151366 gene locus_tag LOCUS_01170 151689 151366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 152062 151715 gene locus_tag LOCUS_01180 152062 151715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 152847 152128 gene locus_tag LOCUS_01190 gene ric 152847 152128 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_01190 153352 152918 gene locus_tag LOCUS_01200 153352 152918 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_01200 153832 153434 gene locus_tag LOCUS_01210 153832 153434 CDS product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920892.1 protein_id gnl|my_center|LOCUS_01210 155140 153848 gene locus_tag LOCUS_01220 155140 153848 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_01220 156758 155256 gene locus_tag LOCUS_01230 156758 155256 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089742.1 protein_id gnl|my_center|LOCUS_01230 157265 156774 gene locus_tag LOCUS_01240 157265 156774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 157997 157293 gene locus_tag LOCUS_01250 157997 157293 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_01250 158451 158005 gene locus_tag LOCUS_01260 158451 158005 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_01260 159932 158469 gene locus_tag LOCUS_01270 gene ccoG 159932 158469 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_01270 160740 159934 gene locus_tag LOCUS_01280 160740 159934 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963296.1 protein_id gnl|my_center|LOCUS_01280 163285 161081 gene locus_tag LOCUS_01290 gene ccoN 163285 161081 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_01290 163497 163288 gene locus_tag LOCUS_01300 gene ccoS 163497 163288 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963292.1 protein_id gnl|my_center|LOCUS_01300 164140 163706 gene locus_tag LOCUS_01310 164140 163706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 166673 164277 gene locus_tag LOCUS_01320 166673 164277 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_01320 166851 167486 gene locus_tag LOCUS_01330 166851 167486 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_01330 167576 168493 gene locus_tag LOCUS_01340 167576 168493 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_01340 168604 169881 gene locus_tag LOCUS_01350 168604 169881 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_01350 170532 171689 gene locus_tag LOCUS_01360 170532 171689 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_01360 171780 172334 gene locus_tag LOCUS_01370 171780 172334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 173665 172349 gene locus_tag LOCUS_01380 173665 172349 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962461.1 protein_id gnl|my_center|LOCUS_01380 174194 173679 gene locus_tag LOCUS_01390 174194 173679 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962389.1 protein_id gnl|my_center|LOCUS_01390 174406 174786 gene locus_tag LOCUS_01400 174406 174786 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_01400 174930 176762 gene locus_tag LOCUS_01410 174930 176762 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109009.1 protein_id gnl|my_center|LOCUS_01410 176788 177903 gene locus_tag LOCUS_01420 176788 177903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 178033 178503 gene locus_tag LOCUS_01430 178033 178503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962388.1 protein_id gnl|my_center|LOCUS_01430 178514 179068 gene locus_tag LOCUS_01440 gene ruvC 178514 179068 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_01440 179283 180341 gene locus_tag LOCUS_01450 gene hemW 179283 180341 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_01450 180443 181210 gene locus_tag LOCUS_01460 180443 181210 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_01460 181207 181557 gene locus_tag LOCUS_01470 181207 181557 CDS product DUF4260 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172038.1 protein_id gnl|my_center|LOCUS_01470 181560 182183 gene locus_tag LOCUS_01480 181560 182183 CDS product DUF4230 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964057.1 protein_id gnl|my_center|LOCUS_01480 182211 182609 gene locus_tag LOCUS_01490 182211 182609 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640452.1 protein_id gnl|my_center|LOCUS_01490 182614 183147 gene locus_tag LOCUS_01500 182614 183147 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919345.1 protein_id gnl|my_center|LOCUS_01500 183161 183523 gene locus_tag LOCUS_01510 183161 183523 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_01510 183568 185340 gene locus_tag LOCUS_01520 183568 185340 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_01520 185365 186366 gene locus_tag LOCUS_01530 185365 186366 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_01530 186636 186983 gene locus_tag LOCUS_01540 186636 186983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 188089 186989 gene locus_tag LOCUS_01550 188089 186989 CDS product DUF4407 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_01550 190190 188379 gene locus_tag LOCUS_01560 190190 188379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 190558 190193 gene locus_tag LOCUS_01570 190558 190193 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_01570 191313 191891 gene locus_tag LOCUS_01580 191313 191891 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962319.1 protein_id gnl|my_center|LOCUS_01580 193432 192044 gene locus_tag LOCUS_01590 193432 192044 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_01590 193546 193628 gene locus_tag LOCUS_t00020 193546 193628 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 193917 194933 gene locus_tag LOCUS_01600 193917 194933 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767365.1 protein_id gnl|my_center|LOCUS_01600 194927 196294 gene locus_tag LOCUS_01610 194927 196294 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922611.1 protein_id gnl|my_center|LOCUS_01610 196591 197316 gene locus_tag LOCUS_01620 196591 197316 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_01620 197349 198227 gene locus_tag LOCUS_01630 197349 198227 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_01630 198382 199962 gene locus_tag LOCUS_01640 198382 199962 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_01640 200004 201641 gene locus_tag LOCUS_01650 200004 201641 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962719.1 protein_id gnl|my_center|LOCUS_01650 202711 201701 gene locus_tag LOCUS_01660 202711 201701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 204081 202798 gene locus_tag LOCUS_01670 204081 202798 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766603.1 protein_id gnl|my_center|LOCUS_01670 207274 204155 gene locus_tag LOCUS_01680 207274 204155 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141271555.1 protein_id gnl|my_center|LOCUS_01680 208373 207282 gene locus_tag LOCUS_01690 208373 207282 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016444.1 protein_id gnl|my_center|LOCUS_01690 208535 209431 gene locus_tag LOCUS_01700 208535 209431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 212557 209540 gene locus_tag LOCUS_01710 212557 209540 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962806.1 protein_id gnl|my_center|LOCUS_01710 213770 212607 gene locus_tag LOCUS_01720 213770 212607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 213866 214417 gene locus_tag LOCUS_01730 213866 214417 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766886.1 protein_id gnl|my_center|LOCUS_01730 215602 214403 gene locus_tag LOCUS_01740 215602 214403 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967132.1 protein_id gnl|my_center|LOCUS_01740 215841 216692 gene locus_tag LOCUS_01750 215841 216692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 218007 217066 gene locus_tag LOCUS_01760 218007 217066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01760 218397 219551 gene locus_tag LOCUS_01770 218397 219551 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_01770 219649 220665 gene locus_tag LOCUS_01780 gene galE 219649 220665 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 protein_id gnl|my_center|LOCUS_01780 220753 221106 gene locus_tag LOCUS_01790 220753 221106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964494.1 protein_id gnl|my_center|LOCUS_01790 >Feature sequence002 548 1006 gene locus_tag LOCUS_01800 548 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 1085 3259 gene locus_tag LOCUS_01810 1085 3259 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963184.1 protein_id gnl|my_center|LOCUS_01810 3350 3757 gene locus_tag LOCUS_01820 3350 3757 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962927.1 protein_id gnl|my_center|LOCUS_01820 3857 4642 gene locus_tag LOCUS_01830 3857 4642 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118502.1 protein_id gnl|my_center|LOCUS_01830 5980 4655 gene locus_tag LOCUS_01840 5980 4655 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_01840 7150 6080 gene locus_tag LOCUS_01850 gene aroC 7150 6080 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962924.1 protein_id gnl|my_center|LOCUS_01850 7501 8274 gene locus_tag LOCUS_01860 7501 8274 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_01860 11283 8374 gene locus_tag LOCUS_01870 11283 8374 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_01870 11371 11889 gene locus_tag LOCUS_01880 11371 11889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 11992 13110 gene locus_tag LOCUS_01890 11992 13110 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_01890 14818 13181 gene locus_tag LOCUS_01900 14818 13181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 15651 15001 gene locus_tag LOCUS_01910 15651 15001 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963018.1 protein_id gnl|my_center|LOCUS_01910 15807 16028 gene locus_tag LOCUS_01920 15807 16028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 15958 16596 gene locus_tag LOCUS_01930 15958 16596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 18461 17073 gene locus_tag LOCUS_01940 gene glmM 18461 17073 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_01940 18480 19121 gene locus_tag LOCUS_01950 18480 19121 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_01950 19178 20881 gene locus_tag LOCUS_01960 gene ggt 19178 20881 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_01960 20908 21618 gene locus_tag LOCUS_01970 20908 21618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 22758 21625 gene locus_tag LOCUS_01980 22758 21625 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037063.1 protein_id gnl|my_center|LOCUS_01980 23236 22919 gene locus_tag LOCUS_01990 23236 22919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 23677 23318 gene locus_tag LOCUS_02000 23677 23318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 25370 23715 gene locus_tag LOCUS_02010 25370 23715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 26592 25525 gene locus_tag LOCUS_02020 26592 25525 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245931.1 protein_id gnl|my_center|LOCUS_02020 27301 26840 gene locus_tag LOCUS_02030 27301 26840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 28230 27502 gene locus_tag LOCUS_02040 28230 27502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 29101 28247 gene locus_tag LOCUS_02050 29101 28247 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120208.1 protein_id gnl|my_center|LOCUS_02050 29844 29218 gene locus_tag LOCUS_02060 29844 29218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 30043 29846 gene locus_tag LOCUS_02070 30043 29846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 30678 30052 gene locus_tag LOCUS_02080 30678 30052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 31312 30848 gene locus_tag LOCUS_02090 31312 30848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 32272 31388 gene locus_tag LOCUS_02100 32272 31388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 33472 32324 gene locus_tag LOCUS_02110 33472 32324 CDS product histidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369839.1 protein_id gnl|my_center|LOCUS_02110 33611 34063 gene locus_tag LOCUS_02120 33611 34063 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963844.1 protein_id gnl|my_center|LOCUS_02120 34451 34074 gene locus_tag LOCUS_02130 34451 34074 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962885.1 protein_id gnl|my_center|LOCUS_02130 34897 35550 gene locus_tag LOCUS_02140 34897 35550 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268743.1 protein_id gnl|my_center|LOCUS_02140 35557 36363 gene locus_tag LOCUS_02150 35557 36363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 37673 36390 gene locus_tag LOCUS_02160 37673 36390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 37903 39111 gene locus_tag LOCUS_02170 37903 39111 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073991.1 protein_id gnl|my_center|LOCUS_02170 39212 40102 gene locus_tag LOCUS_02180 39212 40102 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470046.1 protein_id gnl|my_center|LOCUS_02180 40216 41061 gene locus_tag LOCUS_02190 40216 41061 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923261.1 protein_id gnl|my_center|LOCUS_02190 41198 41695 gene locus_tag LOCUS_02200 41198 41695 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_02200 41855 42715 gene locus_tag LOCUS_02210 41855 42715 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206134.1 protein_id gnl|my_center|LOCUS_02210 43204 42821 gene locus_tag LOCUS_02220 43204 42821 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206336.1 protein_id gnl|my_center|LOCUS_02220 43381 44112 gene locus_tag LOCUS_02230 43381 44112 CDS product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028480.1 protein_id gnl|my_center|LOCUS_02230 44144 44767 gene locus_tag LOCUS_02240 44144 44767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 44768 45658 gene locus_tag LOCUS_02250 gene budA 44768 45658 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958007.1 protein_id gnl|my_center|LOCUS_02250 45682 46623 gene locus_tag LOCUS_02260 45682 46623 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722809.1 protein_id gnl|my_center|LOCUS_02260 46647 48137 gene locus_tag LOCUS_02270 46647 48137 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107137.1 protein_id gnl|my_center|LOCUS_02270 48392 48940 gene locus_tag LOCUS_02280 48392 48940 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932168.1 protein_id gnl|my_center|LOCUS_02280 48969 49346 gene locus_tag LOCUS_02290 48969 49346 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902347.1 protein_id gnl|my_center|LOCUS_02290 49472 49906 gene locus_tag LOCUS_02300 49472 49906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 50677 49913 gene locus_tag LOCUS_02310 50677 49913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 50848 52116 gene locus_tag LOCUS_02320 50848 52116 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207773.1 protein_id gnl|my_center|LOCUS_02320 52160 52933 gene locus_tag LOCUS_02330 52160 52933 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 protein_id gnl|my_center|LOCUS_02330 53126 55966 gene locus_tag LOCUS_02340 gene uvrA 53126 55966 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963005.1 protein_id gnl|my_center|LOCUS_02340 56179 56865 gene locus_tag LOCUS_02350 56179 56865 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_02350 56922 59729 gene locus_tag LOCUS_02360 56922 59729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962879.1 protein_id gnl|my_center|LOCUS_02360 59895 62306 gene locus_tag LOCUS_02370 59895 62306 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_02370 62451 62825 gene locus_tag LOCUS_02380 62451 62825 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 protein_id gnl|my_center|LOCUS_02380 63828 62827 gene locus_tag LOCUS_02390 gene holA 63828 62827 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_02390 63855 64301 gene locus_tag LOCUS_02400 63855 64301 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_02400 64314 65315 gene locus_tag LOCUS_02410 64314 65315 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_02410 65419 66273 gene locus_tag LOCUS_02420 65419 66273 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_02420 66980 66360 gene locus_tag LOCUS_02430 66980 66360 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_02430 67167 69071 gene locus_tag LOCUS_02440 67167 69071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 71501 69174 gene locus_tag LOCUS_02450 71501 69174 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963024.1 protein_id gnl|my_center|LOCUS_02450 72812 71718 gene locus_tag LOCUS_02460 gene ychF 72812 71718 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962805.1 protein_id gnl|my_center|LOCUS_02460 73095 73682 gene locus_tag LOCUS_02470 73095 73682 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762480.1 protein_id gnl|my_center|LOCUS_02470 73729 74724 gene locus_tag LOCUS_02480 73729 74724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 74736 77954 gene locus_tag LOCUS_02490 74736 77954 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038161.1 protein_id gnl|my_center|LOCUS_02490 78564 78211 gene locus_tag LOCUS_02500 78564 78211 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_02500 78696 79736 gene locus_tag LOCUS_02510 78696 79736 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_02510 79811 80875 gene locus_tag LOCUS_02520 gene serC 79811 80875 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962801.1 protein_id gnl|my_center|LOCUS_02520 80977 81927 gene locus_tag LOCUS_02530 80977 81927 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_02530 82192 82824 gene locus_tag LOCUS_02540 82192 82824 CDS product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962799.1 protein_id gnl|my_center|LOCUS_02540 82918 83376 gene locus_tag LOCUS_02550 82918 83376 CDS product DUF6146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962798.1 protein_id gnl|my_center|LOCUS_02550 84157 86550 gene locus_tag LOCUS_02560 84157 86550 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_02560 86569 87135 gene locus_tag LOCUS_02570 86569 87135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 88059 87175 gene locus_tag LOCUS_02580 88059 87175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 88590 88099 gene locus_tag LOCUS_02590 88590 88099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 89811 88591 gene locus_tag LOCUS_02600 89811 88591 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 protein_id gnl|my_center|LOCUS_02600 90411 90106 gene locus_tag LOCUS_02610 90411 90106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962796.1 protein_id gnl|my_center|LOCUS_02610 91113 90514 gene locus_tag LOCUS_02620 gene folE 91113 90514 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932463.1 protein_id gnl|my_center|LOCUS_02620 91318 92010 gene locus_tag LOCUS_02630 91318 92010 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962793.1 protein_id gnl|my_center|LOCUS_02630 92036 92800 gene locus_tag LOCUS_02640 92036 92800 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_02640 93697 92822 gene locus_tag LOCUS_02650 93697 92822 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_02650 94731 94276 gene locus_tag LOCUS_02660 94731 94276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 95032 96078 gene locus_tag LOCUS_02670 95032 96078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 96455 96099 gene locus_tag LOCUS_02680 96455 96099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 99111 96730 gene locus_tag LOCUS_02690 99111 96730 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797093.1 protein_id gnl|my_center|LOCUS_02690 100186 99329 gene locus_tag LOCUS_02700 100186 99329 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368543.1 protein_id gnl|my_center|LOCUS_02700 100362 100757 gene locus_tag LOCUS_02710 100362 100757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 100824 101633 gene locus_tag LOCUS_02720 100824 101633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 101711 102322 gene locus_tag LOCUS_02730 101711 102322 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683439.1 protein_id gnl|my_center|LOCUS_02730 103848 102427 gene locus_tag LOCUS_02740 103848 102427 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767327.1 protein_id gnl|my_center|LOCUS_02740 104369 104596 gene locus_tag LOCUS_02750 104369 104596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 104717 104965 gene locus_tag LOCUS_02760 104717 104965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 105112 105027 gene locus_tag LOCUS_t00030 105112 105027 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 105245 106252 gene locus_tag LOCUS_02770 105245 106252 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257679.1 protein_id gnl|my_center|LOCUS_02770 106550 108286 gene locus_tag LOCUS_02780 106550 108286 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_02780 108283 109542 gene locus_tag LOCUS_02790 108283 109542 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_02790 109502 109879 gene locus_tag LOCUS_02800 109502 109879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 109967 110287 gene locus_tag LOCUS_02810 109967 110287 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963234.1 protein_id gnl|my_center|LOCUS_02810 110287 110946 gene locus_tag LOCUS_02820 110287 110946 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_02820 111363 110947 gene locus_tag LOCUS_02830 111363 110947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 112238 111462 gene locus_tag LOCUS_02840 112238 111462 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_02840 112316 113779 gene locus_tag LOCUS_02850 112316 113779 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_02850 114302 113847 gene locus_tag LOCUS_02860 gene bcp 114302 113847 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 protein_id gnl|my_center|LOCUS_02860 114353 115015 gene locus_tag LOCUS_02870 114353 115015 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963240.1 protein_id gnl|my_center|LOCUS_02870 115833 115252 gene locus_tag LOCUS_02880 115833 115252 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_02880 117050 116469 gene locus_tag LOCUS_02890 117050 116469 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_02890 117296 120073 gene locus_tag LOCUS_02900 gene uvrA 117296 120073 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963246.1 protein_id gnl|my_center|LOCUS_02900 120298 121482 gene locus_tag LOCUS_02910 120298 121482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 123865 121562 gene locus_tag LOCUS_02920 123865 121562 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729998.1 protein_id gnl|my_center|LOCUS_02920 124249 123881 gene locus_tag LOCUS_02930 124249 123881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 125098 124304 gene locus_tag LOCUS_02940 125098 124304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 126660 125194 gene locus_tag LOCUS_02950 126660 125194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 127931 126660 gene locus_tag LOCUS_02960 127931 126660 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_02960 130430 127974 gene locus_tag LOCUS_02970 130430 127974 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_02970 130817 130614 gene locus_tag LOCUS_02980 130817 130614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 131128 132207 gene locus_tag LOCUS_02990 131128 132207 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963908.1 protein_id gnl|my_center|LOCUS_02990 132302 133420 gene locus_tag LOCUS_03000 132302 133420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963909.1 protein_id gnl|my_center|LOCUS_03000 133371 133571 gene locus_tag LOCUS_03010 133371 133571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 134785 133526 gene locus_tag LOCUS_03020 134785 133526 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_03020 135954 134911 gene locus_tag LOCUS_03030 135954 134911 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098105.1 protein_id gnl|my_center|LOCUS_03030 138281 136215 gene locus_tag LOCUS_03040 138281 136215 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_03040 138424 138750 gene locus_tag LOCUS_03050 138424 138750 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963031.1 protein_id gnl|my_center|LOCUS_03050 138792 139235 gene locus_tag LOCUS_03060 138792 139235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 140407 139328 gene locus_tag LOCUS_03070 140407 139328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 140727 141041 gene locus_tag LOCUS_03080 140727 141041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 142058 141036 gene locus_tag LOCUS_03090 142058 141036 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_03090 142304 143767 gene locus_tag LOCUS_03100 142304 143767 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_03100 143825 144778 gene locus_tag LOCUS_03110 143825 144778 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_03110 144845 145702 gene locus_tag LOCUS_03120 144845 145702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 145959 146900 gene locus_tag LOCUS_03130 gene prfB 145959 146900 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117386928.1 protein_id gnl|my_center|LOCUS_03130 146952 147293 gene locus_tag LOCUS_03140 gene arsC 146952 147293 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 protein_id gnl|my_center|LOCUS_03140 147486 147995 gene locus_tag LOCUS_03150 147486 147995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 147997 150492 gene locus_tag LOCUS_03160 147997 150492 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_03160 150950 152347 gene locus_tag LOCUS_03170 gene fumC 150950 152347 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963718.1 protein_id gnl|my_center|LOCUS_03170 153320 152433 gene locus_tag LOCUS_03180 153320 152433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 153483 153944 gene locus_tag LOCUS_03190 153483 153944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 154027 154770 gene locus_tag LOCUS_03200 154027 154770 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_03200 156537 154846 gene locus_tag LOCUS_03210 gene ettA 156537 154846 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963874.1 protein_id gnl|my_center|LOCUS_03210 156765 156583 gene locus_tag LOCUS_03220 156765 156583 CDS product CAL67264 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963197.1 protein_id gnl|my_center|LOCUS_03220 157822 156827 gene locus_tag LOCUS_03230 157822 156827 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_03230 157897 159525 gene locus_tag LOCUS_03240 157897 159525 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_03240 160642 159551 gene locus_tag LOCUS_03250 160642 159551 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_03250 161591 160617 gene locus_tag LOCUS_03260 161591 160617 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 protein_id gnl|my_center|LOCUS_03260 162634 161582 gene locus_tag LOCUS_03270 162634 161582 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962662.1 protein_id gnl|my_center|LOCUS_03270 162680 163477 gene locus_tag LOCUS_03280 162680 163477 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_03280 165452 163482 gene locus_tag LOCUS_03290 165452 163482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 166870 166118 gene locus_tag LOCUS_03300 166870 166118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 167813 166905 gene locus_tag LOCUS_03310 gene menA 167813 166905 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962643.1 protein_id gnl|my_center|LOCUS_03310 168415 167816 gene locus_tag LOCUS_03320 168415 167816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 169427 168597 gene locus_tag LOCUS_03330 169427 168597 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_03330 169850 169512 gene locus_tag LOCUS_03340 169850 169512 CDS product DUF2853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385499.1 protein_id gnl|my_center|LOCUS_03340 171648 169888 gene locus_tag LOCUS_03350 gene menD 171648 169888 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963786.1 protein_id gnl|my_center|LOCUS_03350 172813 171698 gene locus_tag LOCUS_03360 172813 171698 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962818.1 protein_id gnl|my_center|LOCUS_03360 173256 172813 gene locus_tag LOCUS_03370 173256 172813 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_03370 173311 173955 gene locus_tag LOCUS_03380 173311 173955 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_03380 173955 174533 gene locus_tag LOCUS_03390 173955 174533 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680361.1 protein_id gnl|my_center|LOCUS_03390 174530 174919 gene locus_tag LOCUS_03400 174530 174919 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049420.1 protein_id gnl|my_center|LOCUS_03400 175964 174927 gene locus_tag LOCUS_03410 gene cydB 175964 174927 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_03410 177350 175971 gene locus_tag LOCUS_03420 177350 175971 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_03420 178711 177461 gene locus_tag LOCUS_03430 178711 177461 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921846.1 protein_id gnl|my_center|LOCUS_03430 179733 178726 gene locus_tag LOCUS_03440 179733 178726 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975158.1 protein_id gnl|my_center|LOCUS_03440 181350 179764 gene locus_tag LOCUS_03450 181350 179764 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767359.1 protein_id gnl|my_center|LOCUS_03450 182452 181514 gene locus_tag LOCUS_03460 182452 181514 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389819.1 protein_id gnl|my_center|LOCUS_03460 182665 183468 gene locus_tag LOCUS_03470 182665 183468 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762608.1 protein_id gnl|my_center|LOCUS_03470 184658 183465 gene locus_tag LOCUS_03480 184658 183465 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_03480 184809 186377 gene locus_tag LOCUS_03490 184809 186377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 186572 186497 gene locus_tag LOCUS_t00040 186572 186497 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 186825 188915 gene locus_tag LOCUS_03500 186825 188915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 189634 188912 gene locus_tag LOCUS_03510 gene bshB1 189634 188912 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_03510 190852 189677 gene locus_tag LOCUS_03520 190852 189677 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182586238.1 protein_id gnl|my_center|LOCUS_03520 192303 190894 gene locus_tag LOCUS_03530 192303 190894 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_03530 194146 192584 gene locus_tag LOCUS_03540 194146 192584 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767373.1 protein_id gnl|my_center|LOCUS_03540 196727 194199 gene locus_tag LOCUS_03550 196727 194199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 198401 196731 gene locus_tag LOCUS_03560 198401 196731 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785433.1 protein_id gnl|my_center|LOCUS_03560 <200731 198405 gene locus_tag LOCUS_03570 <200731 198405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785431.1:TonB-dependent receptor >Feature sequence003 225 629 gene locus_tag LOCUS_03580 225 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 1199 753 gene locus_tag LOCUS_03590 1199 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 1975 1241 gene locus_tag LOCUS_03600 1975 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 3287 2256 gene locus_tag LOCUS_03610 3287 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 5623 3923 gene locus_tag LOCUS_03620 5623 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 7421 5661 gene locus_tag LOCUS_03630 7421 5661 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681494.1 protein_id gnl|my_center|LOCUS_03630 10456 7433 gene locus_tag LOCUS_03640 10456 7433 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765142.1 protein_id gnl|my_center|LOCUS_03640 12305 10920 gene locus_tag LOCUS_03650 12305 10920 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202216.1 protein_id gnl|my_center|LOCUS_03650 14331 12385 gene locus_tag LOCUS_03660 14331 12385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 15438 14365 gene locus_tag LOCUS_03670 15438 14365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 16835 15450 gene locus_tag LOCUS_03680 gene glmM 16835 15450 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_03680 18777 16849 gene locus_tag LOCUS_03690 18777 16849 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_03690 20133 18799 gene locus_tag LOCUS_03700 20133 18799 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762539.1 protein_id gnl|my_center|LOCUS_03700 21071 20139 gene locus_tag LOCUS_03710 21071 20139 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_03710 22183 21077 gene locus_tag LOCUS_03720 22183 21077 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_03720 23100 22174 gene locus_tag LOCUS_03730 23100 22174 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_03730 23381 24430 gene locus_tag LOCUS_03740 23381 24430 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_03740 25013 25423 gene locus_tag LOCUS_03750 25013 25423 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123131.1 protein_id gnl|my_center|LOCUS_03750 26903 25791 gene locus_tag LOCUS_03760 26903 25791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 27982 27176 gene locus_tag LOCUS_03770 27982 27176 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122039.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03770 28584 28787 gene locus_tag LOCUS_03780 28584 28787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 28954 29160 gene locus_tag LOCUS_03790 28954 29160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 29317 30006 gene locus_tag LOCUS_03800 29317 30006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 30015 30263 gene locus_tag LOCUS_03810 30015 30263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 30861 30265 gene locus_tag LOCUS_03820 30861 30265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 31120 30920 gene locus_tag LOCUS_03830 31120 30920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 31277 31834 gene locus_tag LOCUS_03840 31277 31834 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148770279.1 protein_id gnl|my_center|LOCUS_03840 32991 32317 gene locus_tag LOCUS_03850 32991 32317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 33771 33169 gene locus_tag LOCUS_03860 33771 33169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 34375 33836 gene locus_tag LOCUS_03870 34375 33836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 34950 34462 gene locus_tag LOCUS_03880 34950 34462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 35616 35140 gene locus_tag LOCUS_03890 35616 35140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 35899 39378 gene locus_tag LOCUS_03900 35899 39378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 39858 41177 gene locus_tag LOCUS_03910 gene nhaA 39858 41177 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107366.1 protein_id gnl|my_center|LOCUS_03910 41776 42024 gene locus_tag LOCUS_03920 41776 42024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 42232 44118 gene locus_tag LOCUS_03930 42232 44118 CDS product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061817.1 protein_id gnl|my_center|LOCUS_03930 44118 45167 gene locus_tag LOCUS_03940 44118 45167 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973597.1 protein_id gnl|my_center|LOCUS_03940 45177 46073 gene locus_tag LOCUS_03950 45177 46073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 46516 46115 gene locus_tag LOCUS_03960 46516 46115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 49387 48161 gene locus_tag LOCUS_03970 gene nrfD 49387 48161 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541886.1 protein_id gnl|my_center|LOCUS_03970 50596 49469 gene locus_tag LOCUS_03980 50596 49469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 51236 50607 gene locus_tag LOCUS_03990 51236 50607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 51948 51226 gene locus_tag LOCUS_04000 51948 51226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 54279 51952 gene locus_tag LOCUS_04010 gene napA 54279 51952 CDS product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895543.1 protein_id gnl|my_center|LOCUS_04010 54524 54291 gene locus_tag LOCUS_04020 54524 54291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 54842 56023 gene locus_tag LOCUS_04030 54842 56023 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250233.1 protein_id gnl|my_center|LOCUS_04030 56033 56374 gene locus_tag LOCUS_04040 56033 56374 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546328.1 protein_id gnl|my_center|LOCUS_04040 56469 56909 gene locus_tag LOCUS_04050 56469 56909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 58388 57096 gene locus_tag LOCUS_04060 58388 57096 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201988.1 protein_id gnl|my_center|LOCUS_04060 58922 58473 gene locus_tag LOCUS_04070 58922 58473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 60057 59050 gene locus_tag LOCUS_04080 60057 59050 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_04080 61365 60082 gene locus_tag LOCUS_04090 61365 60082 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_04090 63943 61346 gene locus_tag LOCUS_04100 63943 61346 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205661056.1 protein_id gnl|my_center|LOCUS_04100 64188 63955 gene locus_tag LOCUS_04110 64188 63955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 64421 64206 gene locus_tag LOCUS_04120 64421 64206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 65931 64423 gene locus_tag LOCUS_04130 65931 64423 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_04130 66781 70149 gene locus_tag LOCUS_04140 66781 70149 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_04140 70182 71876 gene locus_tag LOCUS_04150 70182 71876 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_04150 72071 74377 gene locus_tag LOCUS_04160 72071 74377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 74434 75417 gene locus_tag LOCUS_04170 74434 75417 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_04170 75461 76096 gene locus_tag LOCUS_04180 gene gmhA 75461 76096 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566736.1 protein_id gnl|my_center|LOCUS_04180 76247 77542 gene locus_tag LOCUS_04190 76247 77542 CDS product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640236.1 protein_id gnl|my_center|LOCUS_04190 77611 78795 gene locus_tag LOCUS_04200 gene fucP 77611 78795 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_04200 78792 79739 gene locus_tag LOCUS_04210 78792 79739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 81897 79768 gene locus_tag LOCUS_04220 81897 79768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 84170 81945 gene locus_tag LOCUS_04230 84170 81945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 86769 84370 gene locus_tag LOCUS_04240 86769 84370 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202125.1 protein_id gnl|my_center|LOCUS_04240 88406 87252 gene locus_tag LOCUS_04250 88406 87252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 88956 90440 gene locus_tag LOCUS_04260 88956 90440 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_04260 90542 91615 gene locus_tag LOCUS_04270 90542 91615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 91715 92608 gene locus_tag LOCUS_04280 91715 92608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 94256 92679 gene locus_tag LOCUS_04290 94256 92679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 95992 94304 gene locus_tag LOCUS_04300 gene fucI 95992 94304 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_04300 96397 97044 gene locus_tag LOCUS_04310 96397 97044 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963951.1 protein_id gnl|my_center|LOCUS_04310 98629 97073 gene locus_tag LOCUS_04320 98629 97073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 99990 98647 gene locus_tag LOCUS_04330 99990 98647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 101181 100060 gene locus_tag LOCUS_04340 101181 100060 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121884.1 protein_id gnl|my_center|LOCUS_04340 101793 101185 gene locus_tag LOCUS_04350 101793 101185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 101711 101911 gene locus_tag LOCUS_04360 101711 101911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 103169 102141 gene locus_tag LOCUS_04370 103169 102141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 104094 103180 gene locus_tag LOCUS_04380 104094 103180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 105469 104081 gene locus_tag LOCUS_04390 105469 104081 CDS product PhoPQ-activated pathogenicity-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921868.1 protein_id gnl|my_center|LOCUS_04390 106803 105514 gene locus_tag LOCUS_04400 106803 105514 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_04400 107098 108054 gene locus_tag LOCUS_04410 107098 108054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 108174 111509 gene locus_tag LOCUS_04420 108174 111509 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_04420 111527 113173 gene locus_tag LOCUS_04430 111527 113173 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_04430 113392 114315 gene locus_tag LOCUS_04440 113392 114315 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_04440 114408 115778 gene locus_tag LOCUS_04450 114408 115778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 115955 117229 gene locus_tag LOCUS_04460 115955 117229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 118312 117461 gene locus_tag LOCUS_04470 118312 117461 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627596.1 protein_id gnl|my_center|LOCUS_04470 119176 118319 gene locus_tag LOCUS_04480 119176 118319 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089438.1 protein_id gnl|my_center|LOCUS_04480 119316 120236 gene locus_tag LOCUS_04490 119316 120236 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_04490 120308 121786 gene locus_tag LOCUS_04500 120308 121786 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261398.1 protein_id gnl|my_center|LOCUS_04500 121841 122830 gene locus_tag LOCUS_04510 121841 122830 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_04510 122903 124303 gene locus_tag LOCUS_04520 122903 124303 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_04520 125627 124428 gene locus_tag LOCUS_04530 125627 124428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 127812 125833 gene locus_tag LOCUS_04540 127812 125833 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615420.1 protein_id gnl|my_center|LOCUS_04540 128108 130309 gene locus_tag LOCUS_04550 128108 130309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 130361 131221 gene locus_tag LOCUS_04560 130361 131221 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108679.1 protein_id gnl|my_center|LOCUS_04560 131623 135762 gene locus_tag LOCUS_04570 131623 135762 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_04570 136184 135990 gene locus_tag LOCUS_04580 136184 135990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 136451 139549 gene locus_tag LOCUS_04590 136451 139549 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108526.1 protein_id gnl|my_center|LOCUS_04590 139561 141369 gene locus_tag LOCUS_04600 139561 141369 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769526.1 protein_id gnl|my_center|LOCUS_04600 141459 144257 gene locus_tag LOCUS_04610 141459 144257 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021929855.1 protein_id gnl|my_center|LOCUS_04610 144328 146004 gene locus_tag LOCUS_04620 144328 146004 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_04620 146067 147092 gene locus_tag LOCUS_04630 146067 147092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 147102 148691 gene locus_tag LOCUS_04640 147102 148691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 148909 150057 gene locus_tag LOCUS_04650 148909 150057 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964144.1 protein_id gnl|my_center|LOCUS_04650 150354 150896 gene locus_tag LOCUS_04660 150354 150896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 150889 151647 gene locus_tag LOCUS_04670 150889 151647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 154366 151622 gene locus_tag LOCUS_04680 154366 151622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 155905 154415 gene locus_tag LOCUS_04690 155905 154415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 156308 156853 gene locus_tag LOCUS_04700 156308 156853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 156987 157472 gene locus_tag LOCUS_04710 156987 157472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 157588 160110 gene locus_tag LOCUS_04720 157588 160110 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202662.1 protein_id gnl|my_center|LOCUS_04720 160123 160572 gene locus_tag LOCUS_04730 160123 160572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310151.1 protein_id gnl|my_center|LOCUS_04730 160577 161923 gene locus_tag LOCUS_04740 160577 161923 CDS product DUF5458 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787102.1 protein_id gnl|my_center|LOCUS_04740 161977 162720 gene locus_tag LOCUS_04750 161977 162720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 164072 162921 gene locus_tag LOCUS_04760 164072 162921 CDS product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943804.1 protein_id gnl|my_center|LOCUS_04760 164575 164153 gene locus_tag LOCUS_04770 164575 164153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 165188 164577 gene locus_tag LOCUS_04780 165188 164577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 166303 165338 gene locus_tag LOCUS_04790 166303 165338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 166753 166313 gene locus_tag LOCUS_04800 166753 166313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 168383 166755 gene locus_tag LOCUS_04810 168383 166755 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777303.1 protein_id gnl|my_center|LOCUS_04810 168906 168514 gene locus_tag LOCUS_04820 168906 168514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 169384 168998 gene locus_tag LOCUS_04830 169384 168998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 170537 169668 gene locus_tag LOCUS_04840 170537 169668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 171483 170557 gene locus_tag LOCUS_04850 171483 170557 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787052.1 protein_id gnl|my_center|LOCUS_04850 172062 171496 gene locus_tag LOCUS_04860 172062 171496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 172439 172113 gene locus_tag LOCUS_04870 172439 172113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 172450 172599 gene locus_tag LOCUS_04880 172450 172599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 172990 173421 gene locus_tag LOCUS_04890 172990 173421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 173435 175282 gene locus_tag LOCUS_04900 173435 175282 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203023.1 protein_id gnl|my_center|LOCUS_04900 175328 176305 gene locus_tag LOCUS_04910 175328 176305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 176419 177480 gene locus_tag LOCUS_04920 176419 177480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202653.1 protein_id gnl|my_center|LOCUS_04920 177538 178038 gene locus_tag LOCUS_04930 177538 178038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 179831 178194 gene locus_tag LOCUS_04940 179831 178194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090123410.1 protein_id gnl|my_center|LOCUS_04940 180086 181840 gene locus_tag LOCUS_04950 180086 181840 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813188.1 protein_id gnl|my_center|LOCUS_04950 181876 183141 gene locus_tag LOCUS_04960 181876 183141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 185111 183582 gene locus_tag LOCUS_04970 185111 183582 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226064.1 protein_id gnl|my_center|LOCUS_04970 185456 186754 gene locus_tag LOCUS_04980 185456 186754 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_04980 186771 187961 gene locus_tag LOCUS_04990 186771 187961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 189545 188364 gene locus_tag LOCUS_05000 189545 188364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 190790 190398 gene locus_tag LOCUS_05010 190790 190398 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112767.1 protein_id gnl|my_center|LOCUS_05010 191562 190810 gene locus_tag LOCUS_05020 191562 190810 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968036.1 protein_id gnl|my_center|LOCUS_05020 192870 192700 gene locus_tag LOCUS_05030 192870 192700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 193546 193124 gene locus_tag LOCUS_05040 193546 193124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 194621 193617 gene locus_tag LOCUS_05050 194621 193617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 >Feature sequence004 1146 262 gene locus_tag LOCUS_05060 1146 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 1410 2060 gene locus_tag LOCUS_05070 1410 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 2854 2084 gene locus_tag LOCUS_05080 2854 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 3313 2867 gene locus_tag LOCUS_05090 3313 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 4666 3380 gene locus_tag LOCUS_05100 4666 3380 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_05100 5340 4663 gene locus_tag LOCUS_05110 5340 4663 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 protein_id gnl|my_center|LOCUS_05110 6222 5503 gene locus_tag LOCUS_05120 6222 5503 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038927.1 protein_id gnl|my_center|LOCUS_05120 8292 6916 gene locus_tag LOCUS_05130 8292 6916 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_05130 8488 10005 gene locus_tag LOCUS_05140 8488 10005 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_05140 10609 10031 gene locus_tag LOCUS_05150 10609 10031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 10884 12407 gene locus_tag LOCUS_05160 10884 12407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 12482 12892 gene locus_tag LOCUS_05170 12482 12892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 12996 13181 gene locus_tag LOCUS_05180 12996 13181 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391853.1 protein_id gnl|my_center|LOCUS_05180 13565 13245 gene locus_tag LOCUS_05190 13565 13245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 13801 13640 gene locus_tag LOCUS_05200 13801 13640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 14729 14061 gene locus_tag LOCUS_05210 14729 14061 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919369.1 protein_id gnl|my_center|LOCUS_05210 15960 14737 gene locus_tag LOCUS_05220 gene pfp 15960 14737 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870466.1 protein_id gnl|my_center|LOCUS_05220 17018 15978 gene locus_tag LOCUS_05230 17018 15978 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_05230 17164 18198 gene locus_tag LOCUS_05240 17164 18198 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_05240 18996 18235 gene locus_tag LOCUS_05250 18996 18235 CDS product (S)-acetoin forming diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469307.1 protein_id gnl|my_center|LOCUS_05250 20303 19020 gene locus_tag LOCUS_05260 20303 19020 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919382.1 protein_id gnl|my_center|LOCUS_05260 21258 20530 gene locus_tag LOCUS_05270 21258 20530 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_05270 23044 21512 gene locus_tag LOCUS_05280 23044 21512 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_05280 26107 23057 gene locus_tag LOCUS_05290 26107 23057 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098195218.1 protein_id gnl|my_center|LOCUS_05290 28241 26967 gene locus_tag LOCUS_05300 28241 26967 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389568.1 protein_id gnl|my_center|LOCUS_05300 30631 28319 gene locus_tag LOCUS_05310 30631 28319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 31408 30680 gene locus_tag LOCUS_05320 31408 30680 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_05320 32520 31600 gene locus_tag LOCUS_05330 32520 31600 CDS product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029033.1 protein_id gnl|my_center|LOCUS_05330 33498 32587 gene locus_tag LOCUS_05340 33498 32587 CDS product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762942.1 protein_id gnl|my_center|LOCUS_05340 35056 33509 gene locus_tag LOCUS_05350 35056 33509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 36046 35222 gene locus_tag LOCUS_05360 36046 35222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 37510 36065 gene locus_tag LOCUS_05370 37510 36065 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_05370 40661 37527 gene locus_tag LOCUS_05380 40661 37527 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076455918.1 protein_id gnl|my_center|LOCUS_05380 41843 42217 gene locus_tag LOCUS_05390 41843 42217 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108621.1 protein_id gnl|my_center|LOCUS_05390 44761 42506 gene locus_tag LOCUS_05400 44761 42506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 45688 45188 gene locus_tag LOCUS_05410 45688 45188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 45790 46761 gene locus_tag LOCUS_05420 45790 46761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 46783 47505 gene locus_tag LOCUS_05430 46783 47505 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975034.1 protein_id gnl|my_center|LOCUS_05430 48148 51081 gene locus_tag LOCUS_05440 48148 51081 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_05440 51097 52854 gene locus_tag LOCUS_05450 51097 52854 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107292.1 protein_id gnl|my_center|LOCUS_05450 52980 54056 gene locus_tag LOCUS_05460 52980 54056 CDS product phosphatidylinositol-specific phospholipase C1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920762.1 protein_id gnl|my_center|LOCUS_05460 54059 55888 gene locus_tag LOCUS_05470 54059 55888 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969597.1 protein_id gnl|my_center|LOCUS_05470 56475 55891 gene locus_tag LOCUS_05480 56475 55891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 57900 56749 gene locus_tag LOCUS_05490 57900 56749 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203740.1 protein_id gnl|my_center|LOCUS_05490 60351 57952 gene locus_tag LOCUS_05500 60351 57952 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964543.1 protein_id gnl|my_center|LOCUS_05500 61079 61834 gene locus_tag LOCUS_05510 61079 61834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 61899 62891 gene locus_tag LOCUS_05520 61899 62891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 62919 65663 gene locus_tag LOCUS_05530 62919 65663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 65675 67462 gene locus_tag LOCUS_05540 65675 67462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 67475 67963 gene locus_tag LOCUS_05550 67475 67963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 69292 67967 gene locus_tag LOCUS_05560 69292 67967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 70103 69333 gene locus_tag LOCUS_05570 70103 69333 CDS product zinc-dependent metalloprotease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119816.1 protein_id gnl|my_center|LOCUS_05570 73696 70178 gene locus_tag LOCUS_05580 73696 70178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 74361 73966 gene locus_tag LOCUS_05590 74361 73966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 75073 74762 gene locus_tag LOCUS_05600 75073 74762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 75366 75106 gene locus_tag LOCUS_05610 75366 75106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 77179 75428 gene locus_tag LOCUS_05620 77179 75428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 77598 77305 gene locus_tag LOCUS_05630 77598 77305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 79569 77932 gene locus_tag LOCUS_05640 79569 77932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 79937 79575 gene locus_tag LOCUS_05650 79937 79575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 80352 82286 gene locus_tag LOCUS_05660 80352 82286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 82289 83119 gene locus_tag LOCUS_05670 82289 83119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 83151 83993 gene locus_tag LOCUS_05680 83151 83993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 86641 84098 gene locus_tag LOCUS_05690 86641 84098 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_05690 87330 86641 gene locus_tag LOCUS_05700 87330 86641 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_05700 87395 88099 gene locus_tag LOCUS_05710 87395 88099 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839642.1 protein_id gnl|my_center|LOCUS_05710 88343 89596 gene locus_tag LOCUS_05720 88343 89596 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361992.1 protein_id gnl|my_center|LOCUS_05720 89606 90307 gene locus_tag LOCUS_05730 89606 90307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 90517 90813 gene locus_tag LOCUS_05740 90517 90813 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962657.1 protein_id gnl|my_center|LOCUS_05740 90810 91139 gene locus_tag LOCUS_05750 90810 91139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 91136 92341 gene locus_tag LOCUS_05760 91136 92341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 93967 92936 gene locus_tag LOCUS_05770 93967 92936 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921628.1 protein_id gnl|my_center|LOCUS_05770 94521 94069 gene locus_tag LOCUS_05780 94521 94069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 94658 94810 gene locus_tag LOCUS_05790 94658 94810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 96810 95335 gene locus_tag LOCUS_05800 96810 95335 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030661.1 protein_id gnl|my_center|LOCUS_05800 97560 96946 gene locus_tag LOCUS_05810 97560 96946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 98603 97593 gene locus_tag LOCUS_05820 98603 97593 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 protein_id gnl|my_center|LOCUS_05820 99497 98721 gene locus_tag LOCUS_05830 99497 98721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 100953 99649 gene locus_tag LOCUS_05840 100953 99649 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_05840 102531 100960 gene locus_tag LOCUS_05850 102531 100960 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_05850 105942 102550 gene locus_tag LOCUS_05860 105942 102550 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_05860 107189 106050 gene locus_tag LOCUS_05870 107189 106050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 107372 107908 gene locus_tag LOCUS_05880 107372 107908 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767492.1 protein_id gnl|my_center|LOCUS_05880 109331 108639 gene locus_tag LOCUS_05890 109331 108639 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070739.1 protein_id gnl|my_center|LOCUS_05890 112503 109324 gene locus_tag LOCUS_05900 112503 109324 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102936.1 protein_id gnl|my_center|LOCUS_05900 112798 112547 gene locus_tag LOCUS_05910 112798 112547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 114185 112884 gene locus_tag LOCUS_05920 114185 112884 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083500625.1 protein_id gnl|my_center|LOCUS_05920 115825 114182 gene locus_tag LOCUS_05930 115825 114182 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797786.1 protein_id gnl|my_center|LOCUS_05930 116422 116026 gene locus_tag LOCUS_tm00010 116422 116026 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 116563 117762 gene locus_tag LOCUS_05940 116563 117762 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_05940 117844 118113 gene locus_tag LOCUS_05950 117844 118113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 119222 118110 gene locus_tag LOCUS_05960 119222 118110 CDS product Sb-PDE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959405.1 protein_id gnl|my_center|LOCUS_05960 120041 120400 gene locus_tag LOCUS_05970 120041 120400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 121942 120443 gene locus_tag LOCUS_05980 121942 120443 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555796.1 protein_id gnl|my_center|LOCUS_05980 124086 122119 gene locus_tag LOCUS_05990 124086 122119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 125020 124202 gene locus_tag LOCUS_06000 gene kdsA 125020 124202 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962665.1 protein_id gnl|my_center|LOCUS_06000 125196 125669 gene locus_tag LOCUS_06010 125196 125669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 125836 126375 gene locus_tag LOCUS_06020 125836 126375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 126566 128365 gene locus_tag LOCUS_06030 gene typA 126566 128365 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_06030 128470 129366 gene locus_tag LOCUS_06040 128470 129366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840057.1 protein_id gnl|my_center|LOCUS_06040 130164 129415 gene locus_tag LOCUS_06050 130164 129415 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887469.1 protein_id gnl|my_center|LOCUS_06050 131727 130243 gene locus_tag LOCUS_06060 131727 130243 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122845.1 protein_id gnl|my_center|LOCUS_06060 132583 131768 gene locus_tag LOCUS_06070 132583 131768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 133750 132677 gene locus_tag LOCUS_06080 133750 132677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215438250.1 protein_id gnl|my_center|LOCUS_06080 134636 133914 gene locus_tag LOCUS_06090 134636 133914 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_06090 134886 137903 gene locus_tag LOCUS_06100 134886 137903 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_06100 138001 139755 gene locus_tag LOCUS_06110 138001 139755 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_06110 139972 141348 gene locus_tag LOCUS_06120 139972 141348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 141517 142563 gene locus_tag LOCUS_06130 141517 142563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 143361 142573 gene locus_tag LOCUS_06140 143361 142573 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615399.1 protein_id gnl|my_center|LOCUS_06140 143526 144290 gene locus_tag LOCUS_06150 143526 144290 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_06150 144379 144807 gene locus_tag LOCUS_06160 144379 144807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 144906 146522 gene locus_tag LOCUS_06170 144906 146522 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_06170 147147 146599 gene locus_tag LOCUS_06180 147147 146599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 147387 149051 gene locus_tag LOCUS_06190 gene asnB 147387 149051 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_06190 149411 151363 gene locus_tag LOCUS_06200 gene gyrB 149411 151363 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962691.1 protein_id gnl|my_center|LOCUS_06200 151450 152190 gene locus_tag LOCUS_06210 151450 152190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 152393 153334 gene locus_tag LOCUS_06220 152393 153334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_06220 153383 154483 gene locus_tag LOCUS_06230 153383 154483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 154495 155337 gene locus_tag LOCUS_06240 154495 155337 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061282.1 protein_id gnl|my_center|LOCUS_06240 155836 155459 gene locus_tag LOCUS_06250 155836 155459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 156187 157113 gene locus_tag LOCUS_06260 156187 157113 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962692.1 protein_id gnl|my_center|LOCUS_06260 157271 160267 gene locus_tag LOCUS_06270 gene secDF 157271 160267 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962693.1 protein_id gnl|my_center|LOCUS_06270 161633 160392 gene locus_tag LOCUS_06280 gene modF 161633 160392 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816802.1 protein_id gnl|my_center|LOCUS_06280 162148 161630 gene locus_tag LOCUS_06290 162148 161630 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408018.1 protein_id gnl|my_center|LOCUS_06290 162643 162155 gene locus_tag LOCUS_06300 162643 162155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 163701 162739 gene locus_tag LOCUS_06310 gene lgt 163701 162739 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962761.1 protein_id gnl|my_center|LOCUS_06310 164575 164198 gene locus_tag LOCUS_06320 164575 164198 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070936545.1 protein_id gnl|my_center|LOCUS_06320 166097 164577 gene locus_tag LOCUS_06330 166097 164577 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889607.1 protein_id gnl|my_center|LOCUS_06330 166319 167242 gene locus_tag LOCUS_06340 166319 167242 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112904003.1 protein_id gnl|my_center|LOCUS_06340 168723 167245 gene locus_tag LOCUS_06350 gene cysS 168723 167245 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962759.1 protein_id gnl|my_center|LOCUS_06350 169419 168739 gene locus_tag LOCUS_06360 gene folE 169419 168739 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962758.1 protein_id gnl|my_center|LOCUS_06360 169620 171422 gene locus_tag LOCUS_06370 169620 171422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 171543 172967 gene locus_tag LOCUS_06380 171543 172967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 174529 173018 gene locus_tag LOCUS_06390 174529 173018 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_06390 174913 174551 gene locus_tag LOCUS_06400 174913 174551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 175393 175049 gene locus_tag LOCUS_06410 175393 175049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 175904 177382 gene locus_tag LOCUS_06420 gene proS 175904 177382 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963521.1 protein_id gnl|my_center|LOCUS_06420 177452 177524 gene locus_tag LOCUS_t00050 177452 177524 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 177608 177680 gene locus_tag LOCUS_t00060 177608 177680 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 177743 177994 gene locus_tag LOCUS_06430 gene rpsT 177743 177994 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963520.1 protein_id gnl|my_center|LOCUS_06430 179540 178788 gene locus_tag LOCUS_06440 179540 178788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 181435 179816 gene locus_tag LOCUS_06450 gene rho 181435 179816 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962876.1 protein_id gnl|my_center|LOCUS_06450 181630 182040 gene locus_tag LOCUS_06460 181630 182040 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_06460 182306 182791 gene locus_tag LOCUS_06470 182306 182791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 182961 183776 gene locus_tag LOCUS_06480 182961 183776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 184317 183823 gene locus_tag LOCUS_06490 184317 183823 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962868.1 protein_id gnl|my_center|LOCUS_06490 184458 185183 gene locus_tag LOCUS_06500 gene truA 184458 185183 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963544.1 protein_id gnl|my_center|LOCUS_06500 185176 186942 gene locus_tag LOCUS_06510 185176 186942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_06510 187727 186939 gene locus_tag LOCUS_06520 gene cdaA 187727 186939 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_06520 188545 187769 gene locus_tag LOCUS_06530 gene folP 188545 187769 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963546.1 protein_id gnl|my_center|LOCUS_06530 188703 189251 gene locus_tag LOCUS_06540 188703 189251 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_06540 189253 190338 gene locus_tag LOCUS_06550 189253 190338 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188467563.1 protein_id gnl|my_center|LOCUS_06550 >Feature sequence005 2146 32 gene locus_tag LOCUS_06560 2146 32 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964518.1 protein_id gnl|my_center|LOCUS_06560 3446 2217 gene locus_tag LOCUS_06570 3446 2217 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_06570 4313 3705 gene locus_tag LOCUS_06580 4313 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 5661 4318 gene locus_tag LOCUS_06590 5661 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785453.1 protein_id gnl|my_center|LOCUS_06590 7218 5932 gene locus_tag LOCUS_06600 7218 5932 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_06600 7946 7218 gene locus_tag LOCUS_06610 7946 7218 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964522.1 protein_id gnl|my_center|LOCUS_06610 8028 9161 gene locus_tag LOCUS_06620 8028 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 8049 8122 gene locus_tag LOCUS_t00070 8049 8122 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 9158 10462 gene locus_tag LOCUS_06630 9158 10462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 10529 11026 gene locus_tag LOCUS_06640 10529 11026 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403994.1 protein_id gnl|my_center|LOCUS_06640 11085 11762 gene locus_tag LOCUS_06650 11085 11762 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986925.1 protein_id gnl|my_center|LOCUS_06650 11759 12574 gene locus_tag LOCUS_06660 11759 12574 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_06660 12667 13437 gene locus_tag LOCUS_06670 12667 13437 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261101.1 protein_id gnl|my_center|LOCUS_06670 13424 14128 gene locus_tag LOCUS_06680 13424 14128 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045801381.1 protein_id gnl|my_center|LOCUS_06680 15225 14125 gene locus_tag LOCUS_06690 15225 14125 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797797.1 protein_id gnl|my_center|LOCUS_06690 16266 15385 gene locus_tag LOCUS_06700 16266 15385 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108071.1 protein_id gnl|my_center|LOCUS_06700 17371 16328 gene locus_tag LOCUS_06710 17371 16328 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091411521.1 protein_id gnl|my_center|LOCUS_06710 18213 17467 gene locus_tag LOCUS_06720 18213 17467 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444218.1 protein_id gnl|my_center|LOCUS_06720 18348 18995 gene locus_tag LOCUS_06730 18348 18995 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804203.1 protein_id gnl|my_center|LOCUS_06730 19004 19804 gene locus_tag LOCUS_06740 19004 19804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771186.1 protein_id gnl|my_center|LOCUS_06740 19815 20345 gene locus_tag LOCUS_06750 gene def 19815 20345 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116243.1 protein_id gnl|my_center|LOCUS_06750 21617 20346 gene locus_tag LOCUS_06760 21617 20346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 22416 21697 gene locus_tag LOCUS_06770 22416 21697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 23419 22418 gene locus_tag LOCUS_06780 23419 22418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_06780 24355 23465 gene locus_tag LOCUS_06790 24355 23465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 25159 24386 gene locus_tag LOCUS_06800 25159 24386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 25343 26689 gene locus_tag LOCUS_06810 25343 26689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 26701 28281 gene locus_tag LOCUS_06820 26701 28281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 28422 28883 gene locus_tag LOCUS_06830 28422 28883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 28883 31282 gene locus_tag LOCUS_06840 28883 31282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 31292 31987 gene locus_tag LOCUS_06850 31292 31987 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_06850 31989 33473 gene locus_tag LOCUS_06860 31989 33473 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_06860 33553 34914 gene locus_tag LOCUS_06870 33553 34914 CDS product DUF2029 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838851.1 protein_id gnl|my_center|LOCUS_06870 35133 35756 gene locus_tag LOCUS_06880 35133 35756 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_06880 35810 37000 gene locus_tag LOCUS_06890 35810 37000 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_06890 36993 37403 gene locus_tag LOCUS_06900 36993 37403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 37400 38374 gene locus_tag LOCUS_06910 gene argC 37400 38374 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_06910 38447 39247 gene locus_tag LOCUS_06920 gene proC 38447 39247 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962247.1 protein_id gnl|my_center|LOCUS_06920 39266 40426 gene locus_tag LOCUS_06930 39266 40426 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_06930 40426 41625 gene locus_tag LOCUS_06940 40426 41625 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287452.1 protein_id gnl|my_center|LOCUS_06940 41671 42459 gene locus_tag LOCUS_06950 41671 42459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 42518 43456 gene locus_tag LOCUS_06960 42518 43456 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_06960 43463 44215 gene locus_tag LOCUS_06970 43463 44215 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_06970 44217 44996 gene locus_tag LOCUS_06980 gene argB 44217 44996 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783875.1 protein_id gnl|my_center|LOCUS_06980 44999 46063 gene locus_tag LOCUS_06990 44999 46063 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767146.1 protein_id gnl|my_center|LOCUS_06990 46142 47422 gene locus_tag LOCUS_07000 gene argH 46142 47422 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766984.1 protein_id gnl|my_center|LOCUS_07000 48161 47838 gene locus_tag LOCUS_07010 48161 47838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 48292 48828 gene locus_tag LOCUS_07020 48292 48828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 48896 50500 gene locus_tag LOCUS_07030 48896 50500 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839369.1 protein_id gnl|my_center|LOCUS_07030 50547 51167 gene locus_tag LOCUS_07040 50547 51167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 51626 51832 gene locus_tag LOCUS_07050 51626 51832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 52178 53188 gene locus_tag LOCUS_07060 52178 53188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 53295 60932 gene locus_tag LOCUS_07070 53295 60932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 60937 61869 gene locus_tag LOCUS_07080 60937 61869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 61879 62424 gene locus_tag LOCUS_07090 61879 62424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 63438 62590 gene locus_tag LOCUS_07100 63438 62590 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962486.1 protein_id gnl|my_center|LOCUS_07100 64414 63464 gene locus_tag LOCUS_07110 64414 63464 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730493.1 protein_id gnl|my_center|LOCUS_07110 65320 64415 gene locus_tag LOCUS_07120 65320 64415 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 protein_id gnl|my_center|LOCUS_07120 66270 65332 gene locus_tag LOCUS_07130 66270 65332 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_07130 67637 66552 gene locus_tag LOCUS_07140 gene mvaD 67637 66552 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_07140 68751 68212 gene locus_tag LOCUS_07150 68751 68212 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921635.1 protein_id gnl|my_center|LOCUS_07150 70035 68752 gene locus_tag LOCUS_07160 70035 68752 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_07160 70730 70035 gene locus_tag LOCUS_07170 70730 70035 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070923.1 protein_id gnl|my_center|LOCUS_07170 72569 70791 gene locus_tag LOCUS_07180 72569 70791 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072207.1 protein_id gnl|my_center|LOCUS_07180 74876 72573 gene locus_tag LOCUS_07190 74876 72573 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_07190 75573 74911 gene locus_tag LOCUS_07200 gene pgmB 75573 74911 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_07200 76678 75647 gene locus_tag LOCUS_07210 76678 75647 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_07210 77024 80134 gene locus_tag LOCUS_07220 77024 80134 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838102.1 protein_id gnl|my_center|LOCUS_07220 80145 81719 gene locus_tag LOCUS_07230 80145 81719 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_07230 82061 85033 gene locus_tag LOCUS_07240 82061 85033 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_07240 85033 86250 gene locus_tag LOCUS_07250 gene dinB 85033 86250 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_07250 87975 86323 gene locus_tag LOCUS_07260 87975 86323 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087177.1 protein_id gnl|my_center|LOCUS_07260 88147 91470 gene locus_tag LOCUS_07270 88147 91470 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_07270 91472 94831 gene locus_tag LOCUS_07280 91472 94831 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_07280 94955 99496 gene locus_tag LOCUS_07290 94955 99496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 99502 100401 gene locus_tag LOCUS_07300 99502 100401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 100440 101306 gene locus_tag LOCUS_07310 100440 101306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 105062 101337 gene locus_tag LOCUS_07320 105062 101337 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163515044.1 protein_id gnl|my_center|LOCUS_07320 105102 106304 gene locus_tag LOCUS_07330 105102 106304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 108685 106301 gene locus_tag LOCUS_07340 108685 106301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 108780 109697 gene locus_tag LOCUS_07350 108780 109697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 109743 110393 gene locus_tag LOCUS_07360 109743 110393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 110506 112038 gene locus_tag LOCUS_07370 110506 112038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 112134 112685 gene locus_tag LOCUS_07380 112134 112685 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366315.1 protein_id gnl|my_center|LOCUS_07380 112691 113119 gene locus_tag LOCUS_07390 112691 113119 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 protein_id gnl|my_center|LOCUS_07390 113211 113726 gene locus_tag LOCUS_07400 113211 113726 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337215.1 protein_id gnl|my_center|LOCUS_07400 113802 114404 gene locus_tag LOCUS_07410 113802 114404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 114460 115260 gene locus_tag LOCUS_07420 114460 115260 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263006.1 protein_id gnl|my_center|LOCUS_07420 115273 116007 gene locus_tag LOCUS_07430 115273 116007 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121677.1 protein_id gnl|my_center|LOCUS_07430 116169 117734 gene locus_tag LOCUS_07440 116169 117734 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144042.1 protein_id gnl|my_center|LOCUS_07440 117834 119648 gene locus_tag LOCUS_07450 117834 119648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 119713 120765 gene locus_tag LOCUS_07460 119713 120765 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918429.1 protein_id gnl|my_center|LOCUS_07460 123167 120933 gene locus_tag LOCUS_07470 123167 120933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 126061 123218 gene locus_tag LOCUS_07480 126061 123218 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109087.1 protein_id gnl|my_center|LOCUS_07480 126240 126926 gene locus_tag LOCUS_07490 126240 126926 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_07490 127091 128116 gene locus_tag LOCUS_07500 127091 128116 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072879556.1 protein_id gnl|my_center|LOCUS_07500 128127 128795 gene locus_tag LOCUS_07510 gene trmB 128127 128795 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_07510 128798 129106 gene locus_tag LOCUS_07520 128798 129106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07520 129205 129426 gene locus_tag LOCUS_07530 129205 129426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 129426 129761 gene locus_tag LOCUS_07540 129426 129761 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_07540 131117 129771 gene locus_tag LOCUS_07550 131117 129771 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202760.1 protein_id gnl|my_center|LOCUS_07550 132497 131130 gene locus_tag LOCUS_07560 132497 131130 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_07560 132750 134096 gene locus_tag LOCUS_07570 132750 134096 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_07570 134137 135387 gene locus_tag LOCUS_07580 134137 135387 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_07580 135435 136148 gene locus_tag LOCUS_07590 135435 136148 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_07590 136231 138660 gene locus_tag LOCUS_07600 136231 138660 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_07600 138695 141130 gene locus_tag LOCUS_07610 138695 141130 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_07610 141166 143565 gene locus_tag LOCUS_07620 141166 143565 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_07620 143596 144258 gene locus_tag LOCUS_07630 143596 144258 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_07630 144388 145527 gene locus_tag LOCUS_07640 144388 145527 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963780.1 protein_id gnl|my_center|LOCUS_07640 145529 145771 gene locus_tag LOCUS_07650 145529 145771 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_07650 145844 146902 gene locus_tag LOCUS_07660 145844 146902 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963782.1 protein_id gnl|my_center|LOCUS_07660 146974 147348 gene locus_tag LOCUS_07670 146974 147348 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123903.1 protein_id gnl|my_center|LOCUS_07670 147373 147702 gene locus_tag LOCUS_07680 147373 147702 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_07680 149435 147699 gene locus_tag LOCUS_07690 149435 147699 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990058.1 protein_id gnl|my_center|LOCUS_07690 150165 149560 gene locus_tag LOCUS_07700 150165 149560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963870.1 protein_id gnl|my_center|LOCUS_07700 151020 150286 gene locus_tag LOCUS_07710 151020 150286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 152358 151042 gene locus_tag LOCUS_07720 gene gntT 152358 151042 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174795.1 protein_id gnl|my_center|LOCUS_07720 152866 152465 gene locus_tag LOCUS_07730 152866 152465 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112767.1 protein_id gnl|my_center|LOCUS_07730 153976 153098 gene locus_tag LOCUS_07740 153976 153098 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444152.1 protein_id gnl|my_center|LOCUS_07740 154638 154045 gene locus_tag LOCUS_07750 154638 154045 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_07750 155857 154739 gene locus_tag LOCUS_07760 155857 154739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 156529 156146 gene locus_tag LOCUS_07770 156529 156146 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817730.1 protein_id gnl|my_center|LOCUS_07770 157298 156519 gene locus_tag LOCUS_07780 157298 156519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766739.1 protein_id gnl|my_center|LOCUS_07780 158275 157412 gene locus_tag LOCUS_07790 158275 157412 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122363.1 protein_id gnl|my_center|LOCUS_07790 159008 158445 gene locus_tag LOCUS_07800 159008 158445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 159254 159173 gene locus_tag LOCUS_t00080 159254 159173 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 159404 160345 gene locus_tag LOCUS_07810 159404 160345 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_07810 160396 161031 gene locus_tag LOCUS_07820 160396 161031 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962325.1 protein_id gnl|my_center|LOCUS_07820 161167 161799 gene locus_tag LOCUS_07830 gene pth 161167 161799 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100438.1 protein_id gnl|my_center|LOCUS_07830 162466 161786 gene locus_tag LOCUS_07840 162466 161786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162987949.1 protein_id gnl|my_center|LOCUS_07840 166155 162463 gene locus_tag LOCUS_07850 166155 162463 CDS product zinc-dependent metalloprotease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962407.1 protein_id gnl|my_center|LOCUS_07850 166301 167227 gene locus_tag LOCUS_07860 166301 167227 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_07860 167228 168559 gene locus_tag LOCUS_07870 167228 168559 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_07870 168933 168556 gene locus_tag LOCUS_07880 168933 168556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 169013 170284 gene locus_tag LOCUS_07890 gene serS 169013 170284 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_07890 170668 170354 gene locus_tag LOCUS_07900 170668 170354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 170869 172653 gene locus_tag LOCUS_07910 170869 172653 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_07910 173262 174341 gene locus_tag LOCUS_07920 173262 174341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 174354 174665 gene locus_tag LOCUS_07930 174354 174665 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_07930 174672 174974 gene locus_tag LOCUS_07940 174672 174974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 174984 175847 gene locus_tag LOCUS_07950 gene rsmA 174984 175847 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962249.1 protein_id gnl|my_center|LOCUS_07950 176018 177370 gene locus_tag LOCUS_07960 gene mgtE 176018 177370 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962248.1 protein_id gnl|my_center|LOCUS_07960 177532 178506 gene locus_tag LOCUS_07970 177532 178506 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_07970 178554 178964 gene locus_tag LOCUS_07980 178554 178964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 178966 179427 gene locus_tag LOCUS_07990 178966 179427 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_07990 179486 179872 gene locus_tag LOCUS_08000 179486 179872 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_08000 179925 180323 gene locus_tag LOCUS_08010 179925 180323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 180347 180847 gene locus_tag LOCUS_08020 180347 180847 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205378591.1 protein_id gnl|my_center|LOCUS_08020 182672 180861 gene locus_tag LOCUS_08030 182672 180861 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_08030 184012 182762 gene locus_tag LOCUS_08040 184012 182762 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_08040 184415 184080 gene locus_tag LOCUS_08050 184415 184080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 184909 184433 gene locus_tag LOCUS_08060 184909 184433 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100451.1 protein_id gnl|my_center|LOCUS_08060 185020 186030 gene locus_tag LOCUS_08070 gene fbp 185020 186030 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962470.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence006 2929 119 gene locus_tag LOCUS_08080 2929 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 3998 3099 gene locus_tag LOCUS_08090 3998 3099 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962226.1 protein_id gnl|my_center|LOCUS_08090 4196 5452 gene locus_tag LOCUS_08100 gene hemA 4196 5452 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962225.1 protein_id gnl|my_center|LOCUS_08100 5449 7032 gene locus_tag LOCUS_08110 5449 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 7093 8127 gene locus_tag LOCUS_08120 gene hemE 7093 8127 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962222.1 protein_id gnl|my_center|LOCUS_08120 8109 8696 gene locus_tag LOCUS_08130 8109 8696 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962220.1 protein_id gnl|my_center|LOCUS_08130 8815 9717 gene locus_tag LOCUS_08140 gene hemF 8815 9717 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962218.1 protein_id gnl|my_center|LOCUS_08140 9736 9906 gene locus_tag LOCUS_08150 9736 9906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 9959 10549 gene locus_tag LOCUS_08160 9959 10549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 13073 10536 gene locus_tag LOCUS_08170 13073 10536 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406189.1 protein_id gnl|my_center|LOCUS_08170 13248 14237 gene locus_tag LOCUS_08180 gene hemB 13248 14237 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962216.1 protein_id gnl|my_center|LOCUS_08180 14258 15589 gene locus_tag LOCUS_08190 14258 15589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 15641 16747 gene locus_tag LOCUS_08200 15641 16747 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_08200 16794 17270 gene locus_tag LOCUS_08210 16794 17270 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962214.1 protein_id gnl|my_center|LOCUS_08210 18765 19394 gene locus_tag LOCUS_08220 18765 19394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 19531 20244 gene locus_tag LOCUS_08230 19531 20244 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_08230 21226 20252 gene locus_tag LOCUS_08240 21226 20252 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 protein_id gnl|my_center|LOCUS_08240 21303 22514 gene locus_tag LOCUS_08250 gene hflX 21303 22514 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964502.1 protein_id gnl|my_center|LOCUS_08250 24326 23406 gene locus_tag LOCUS_08260 24326 23406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 24899 24393 gene locus_tag LOCUS_08270 24899 24393 CDS product DUF2480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_08270 25237 24908 gene locus_tag LOCUS_08280 25237 24908 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_08280 25713 25291 gene locus_tag LOCUS_08290 25713 25291 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_08290 27002 25788 gene locus_tag LOCUS_08300 27002 25788 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964478.1 protein_id gnl|my_center|LOCUS_08300 27732 27166 gene locus_tag LOCUS_08310 27732 27166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 29191 27875 gene locus_tag LOCUS_08320 gene sufD 29191 27875 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_08320 30016 29264 gene locus_tag LOCUS_08330 gene sufC 30016 29264 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_08330 31512 30067 gene locus_tag LOCUS_08340 gene sufB 31512 30067 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_08340 31910 31575 gene locus_tag LOCUS_08350 31910 31575 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_08350 32233 33111 gene locus_tag LOCUS_08360 32233 33111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 33285 34334 gene locus_tag LOCUS_08370 gene thiL 33285 34334 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964415.1 protein_id gnl|my_center|LOCUS_08370 34344 35381 gene locus_tag LOCUS_08380 34344 35381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 35796 35578 gene locus_tag LOCUS_08390 35796 35578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 36183 37481 gene locus_tag LOCUS_08400 gene brnQ 36183 37481 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948515.1 protein_id gnl|my_center|LOCUS_08400 38719 37490 gene locus_tag LOCUS_08410 38719 37490 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_08410 39165 38992 gene locus_tag LOCUS_08420 39165 38992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 39263 42016 gene locus_tag LOCUS_08430 39263 42016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 42951 42406 gene locus_tag LOCUS_08440 42951 42406 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148770279.1 protein_id gnl|my_center|LOCUS_08440 43514 43044 gene locus_tag LOCUS_08450 43514 43044 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690774.1 protein_id gnl|my_center|LOCUS_08450 44351 43605 gene locus_tag LOCUS_08460 44351 43605 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_08460 46361 44358 gene locus_tag LOCUS_08470 46361 44358 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_08470 47032 46364 gene locus_tag LOCUS_08480 47032 46364 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_08480 47294 48184 gene locus_tag LOCUS_08490 gene rimK 47294 48184 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261388.1 protein_id gnl|my_center|LOCUS_08490 48225 49214 gene locus_tag LOCUS_08500 48225 49214 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_08500 49867 49478 gene locus_tag LOCUS_08510 49867 49478 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071530.1 protein_id gnl|my_center|LOCUS_08510 50808 49870 gene locus_tag LOCUS_08520 50808 49870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 50956 52116 gene locus_tag LOCUS_08530 50956 52116 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_08530 52627 52106 gene locus_tag LOCUS_08540 52627 52106 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814588.1 protein_id gnl|my_center|LOCUS_08540 53654 53001 gene locus_tag LOCUS_08550 53654 53001 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_08550 54049 53696 gene locus_tag LOCUS_08560 54049 53696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 54779 54081 gene locus_tag LOCUS_08570 54779 54081 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_08570 57236 54894 gene locus_tag LOCUS_08580 57236 54894 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_08580 57782 57240 gene locus_tag LOCUS_08590 57782 57240 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962205.1 protein_id gnl|my_center|LOCUS_08590 58968 57718 gene locus_tag LOCUS_08600 gene ricT 58968 57718 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_08600 59144 60313 gene locus_tag LOCUS_08610 59144 60313 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048405.1 protein_id gnl|my_center|LOCUS_08610 61348 60317 gene locus_tag LOCUS_08620 61348 60317 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962203.1 protein_id gnl|my_center|LOCUS_08620 61871 62878 gene locus_tag LOCUS_08630 gene recA 61871 62878 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_08630 63069 63458 gene locus_tag LOCUS_08640 63069 63458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 63662 64114 gene locus_tag LOCUS_08650 63662 64114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 64171 65763 gene locus_tag LOCUS_08660 64171 65763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 65874 66758 gene locus_tag LOCUS_08670 65874 66758 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785776.1 protein_id gnl|my_center|LOCUS_08670 66836 67756 gene locus_tag LOCUS_08680 66836 67756 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764761.1 protein_id gnl|my_center|LOCUS_08680 68349 67768 gene locus_tag LOCUS_08690 68349 67768 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_08690 68584 69552 gene locus_tag LOCUS_08700 gene trpS 68584 69552 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_08700 70838 69735 gene locus_tag LOCUS_08710 gene dprA 70838 69735 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_08710 70944 71903 gene locus_tag LOCUS_08720 70944 71903 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964525.1 protein_id gnl|my_center|LOCUS_08720 72033 72545 gene locus_tag LOCUS_08730 72033 72545 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_08730 73396 72554 gene locus_tag LOCUS_08740 gene pgoN 73396 72554 CDS product glyoxal/methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243374.1 protein_id gnl|my_center|LOCUS_08740 74633 73404 gene locus_tag LOCUS_08750 74633 73404 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_08750 75336 74623 gene locus_tag LOCUS_08760 75336 74623 CDS product DUF4292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964528.1 protein_id gnl|my_center|LOCUS_08760 76373 75432 gene locus_tag LOCUS_08770 76373 75432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 76849 76415 gene locus_tag LOCUS_08780 gene dut 76849 76415 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964537.1 protein_id gnl|my_center|LOCUS_08780 78414 76927 gene locus_tag LOCUS_08790 78414 76927 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_08790 78920 78474 gene locus_tag LOCUS_08800 78920 78474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 79870 79061 gene locus_tag LOCUS_08810 gene atpG 79870 79061 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964544.1 protein_id gnl|my_center|LOCUS_08810 81601 80021 gene locus_tag LOCUS_08820 gene atpA 81601 80021 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964545.1 protein_id gnl|my_center|LOCUS_08820 82195 81656 gene locus_tag LOCUS_08830 gene atpH 82195 81656 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_08830 82763 82263 gene locus_tag LOCUS_08840 82763 82263 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_08840 83046 82852 gene locus_tag LOCUS_08850 83046 82852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 84263 83085 gene locus_tag LOCUS_08860 gene atpB 84263 83085 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964549.1 protein_id gnl|my_center|LOCUS_08860 84972 84748 gene locus_tag LOCUS_08870 84972 84748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 85396 84950 gene locus_tag LOCUS_08880 85396 84950 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_08880 87955 85400 gene locus_tag LOCUS_08890 87955 85400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_08890 89111 88383 gene locus_tag LOCUS_08900 89111 88383 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_08900 90580 89165 gene locus_tag LOCUS_08910 90580 89165 CDS product DUF5687 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079703094.1 protein_id gnl|my_center|LOCUS_08910 90902 91951 gene locus_tag LOCUS_08920 90902 91951 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_08920 92778 91993 gene locus_tag LOCUS_08930 92778 91993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 93741 92821 gene locus_tag LOCUS_08940 93741 92821 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969295.1 protein_id gnl|my_center|LOCUS_08940 94492 93773 gene locus_tag LOCUS_08950 94492 93773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 96109 95255 gene locus_tag LOCUS_08960 96109 95255 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973969.1 protein_id gnl|my_center|LOCUS_08960 97343 96099 gene locus_tag LOCUS_08970 97343 96099 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948768.1 protein_id gnl|my_center|LOCUS_08970 98874 97405 gene locus_tag LOCUS_08980 98874 97405 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_08980 102024 98887 gene locus_tag LOCUS_08990 102024 98887 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_08990 102907 102197 gene locus_tag LOCUS_09000 102907 102197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 103271 103888 gene locus_tag LOCUS_09010 103271 103888 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 protein_id gnl|my_center|LOCUS_09010 104898 103897 gene locus_tag LOCUS_09020 104898 103897 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043924886.1 protein_id gnl|my_center|LOCUS_09020 105535 104933 gene locus_tag LOCUS_09030 105535 104933 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_09030 106414 105569 gene locus_tag LOCUS_09040 106414 105569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 106711 106932 gene locus_tag LOCUS_09050 106711 106932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 108256 106985 gene locus_tag LOCUS_09060 gene purD 108256 106985 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964560.1 protein_id gnl|my_center|LOCUS_09060 109717 108350 gene locus_tag LOCUS_09070 109717 108350 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963376.1 protein_id gnl|my_center|LOCUS_09070 110215 109733 gene locus_tag LOCUS_09080 110215 109733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09080 110498 110259 gene locus_tag LOCUS_09090 110498 110259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09090 111405 110611 gene locus_tag LOCUS_09100 111405 110611 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083199050.1 protein_id gnl|my_center|LOCUS_09100 111814 111392 gene locus_tag LOCUS_09110 111814 111392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 115047 113917 gene locus_tag LOCUS_09120 115047 113917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064737.1 protein_id gnl|my_center|LOCUS_09120 115643 115131 gene locus_tag LOCUS_09130 115643 115131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 116978 115701 gene locus_tag LOCUS_09140 116978 115701 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066597.1 protein_id gnl|my_center|LOCUS_09140 118036 116987 gene locus_tag LOCUS_09150 gene wecB 118036 116987 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_09150 118987 118049 gene locus_tag LOCUS_09160 gene wbpB 118987 118049 CDS product UDP-N-acetyl-2-amino-2-deoxy-D-glucuronate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113428.1 protein_id gnl|my_center|LOCUS_09160 120082 118988 gene locus_tag LOCUS_09170 gene wlbC 120082 118988 CDS product O-antigen biosynthesis protein WlbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929614.1 protein_id gnl|my_center|LOCUS_09170 120680 120099 gene locus_tag LOCUS_09180 120680 120099 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_09180 121475 120699 gene locus_tag LOCUS_09190 gene rfbD 121475 120699 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 protein_id gnl|my_center|LOCUS_09190 122017 121472 gene locus_tag LOCUS_09200 gene rfbC 122017 121472 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_09200 122890 122036 gene locus_tag LOCUS_09210 gene rfbA 122890 122036 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 protein_id gnl|my_center|LOCUS_09210 123917 122895 gene locus_tag LOCUS_09220 gene rfbB 123917 122895 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723092.1 protein_id gnl|my_center|LOCUS_09220 124932 123928 gene locus_tag LOCUS_09230 124932 123928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 126622 124937 gene locus_tag LOCUS_09240 126622 124937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_09240 128271 126775 gene locus_tag LOCUS_09250 128271 126775 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_09250 129218 128352 gene locus_tag LOCUS_09260 129218 128352 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_09260 129415 129597 gene locus_tag LOCUS_09270 129415 129597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 129959 132541 gene locus_tag LOCUS_09280 129959 132541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 134150 133149 gene locus_tag LOCUS_09290 134150 133149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 135806 134163 gene locus_tag LOCUS_09300 135806 134163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 137143 135953 gene locus_tag LOCUS_09310 137143 135953 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962199.1 protein_id gnl|my_center|LOCUS_09310 137285 138436 gene locus_tag LOCUS_09320 137285 138436 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 protein_id gnl|my_center|LOCUS_09320 138500 138898 gene locus_tag LOCUS_09330 138500 138898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962191.1 protein_id gnl|my_center|LOCUS_09330 139461 138955 gene locus_tag LOCUS_09340 139461 138955 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962186.1 protein_id gnl|my_center|LOCUS_09340 140671 139841 gene locus_tag LOCUS_09350 140671 139841 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_09350 140861 140649 gene locus_tag LOCUS_09360 140861 140649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 143352 141484 gene locus_tag LOCUS_09370 gene mnmG 143352 141484 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_09370 143848 143429 gene locus_tag LOCUS_09380 gene ybeY 143848 143429 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_09380 147293 143841 gene locus_tag LOCUS_09390 147293 143841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215436752.1 protein_id gnl|my_center|LOCUS_09390 147426 148934 gene locus_tag LOCUS_09400 gene gltX 147426 148934 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964585.1 protein_id gnl|my_center|LOCUS_09400 149115 150044 gene locus_tag LOCUS_09410 149115 150044 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_09410 150680 150330 gene locus_tag LOCUS_09420 150680 150330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 151013 150684 gene locus_tag LOCUS_09430 151013 150684 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964581.1 protein_id gnl|my_center|LOCUS_09430 153108 151426 gene locus_tag LOCUS_09440 153108 151426 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964580.1 protein_id gnl|my_center|LOCUS_09440 153330 155585 gene locus_tag LOCUS_09450 153330 155585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 155596 157743 gene locus_tag LOCUS_09460 155596 157743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 157745 172315 gene locus_tag LOCUS_09470 157745 172315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 172347 173300 gene locus_tag LOCUS_09480 172347 173300 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962198.1 protein_id gnl|my_center|LOCUS_09480 173399 173767 gene locus_tag LOCUS_09490 gene folB 173399 173767 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964579.1 protein_id gnl|my_center|LOCUS_09490 173915 173986 gene locus_tag LOCUS_t00090 173915 173986 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 174757 174089 gene locus_tag LOCUS_09500 174757 174089 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_09500 175490 174879 gene locus_tag LOCUS_09510 175490 174879 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964577.1 protein_id gnl|my_center|LOCUS_09510 177812 175623 gene locus_tag LOCUS_09520 gene rnr 177812 175623 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964576.1 protein_id gnl|my_center|LOCUS_09520 178464 178895 gene locus_tag LOCUS_09530 gene rpiB 178464 178895 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_09530 179329 179769 gene locus_tag LOCUS_09540 179329 179769 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962201.1 protein_id gnl|my_center|LOCUS_09540 180191 179817 gene locus_tag LOCUS_09550 180191 179817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 180948 180451 gene locus_tag LOCUS_09560 180948 180451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 182321 181095 gene locus_tag LOCUS_09570 gene dcm 182321 181095 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962895.1 protein_id gnl|my_center|LOCUS_09570 182362 183573 gene locus_tag LOCUS_09580 182362 183573 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_09580 184158 183676 gene locus_tag LOCUS_09590 184158 183676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 184927 184148 gene locus_tag LOCUS_09600 184927 184148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 185613 185065 gene locus_tag LOCUS_09610 185613 185065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09610 185928 185653 gene locus_tag LOCUS_09620 185928 185653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence007 <1 896 gene locus_tag LOCUS_09630 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202205.1:DUF5107 domain-containing protein 916 1686 gene locus_tag LOCUS_09640 916 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 2856 1696 gene locus_tag LOCUS_09650 gene dgoD 2856 1696 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528179.1 protein_id gnl|my_center|LOCUS_09650 4189 2885 gene locus_tag LOCUS_09660 4189 2885 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769658.1 protein_id gnl|my_center|LOCUS_09660 4735 5967 gene locus_tag LOCUS_09670 4735 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 8555 6039 gene locus_tag LOCUS_09680 8555 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 9703 8687 gene locus_tag LOCUS_09690 gene rhaT 9703 8687 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767241.1 protein_id gnl|my_center|LOCUS_09690 10806 9763 gene locus_tag LOCUS_09700 10806 9763 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_09700 11937 10843 gene locus_tag LOCUS_09710 11937 10843 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525264.1 protein_id gnl|my_center|LOCUS_09710 13392 11938 gene locus_tag LOCUS_09720 gene aldA 13392 11938 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066669.1 protein_id gnl|my_center|LOCUS_09720 14793 13399 gene locus_tag LOCUS_09730 14793 13399 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921292.1 protein_id gnl|my_center|LOCUS_09730 15610 14840 gene locus_tag LOCUS_09740 gene kduD 15610 14840 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210830.1 protein_id gnl|my_center|LOCUS_09740 16651 15635 gene locus_tag LOCUS_09750 16651 15635 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383135.1 protein_id gnl|my_center|LOCUS_09750 17891 16668 gene locus_tag LOCUS_09760 17891 16668 CDS product glycosyhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029020.1 protein_id gnl|my_center|LOCUS_09760 18396 17938 gene locus_tag LOCUS_09770 18396 17938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 20144 18396 gene locus_tag LOCUS_09780 20144 18396 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_09780 23345 20163 gene locus_tag LOCUS_09790 23345 20163 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106133626.1 protein_id gnl|my_center|LOCUS_09790 24615 23818 gene locus_tag LOCUS_09800 24615 23818 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_09800 26354 24711 gene locus_tag LOCUS_09810 26354 24711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090123410.1 protein_id gnl|my_center|LOCUS_09810 29738 26358 gene locus_tag LOCUS_09820 29738 26358 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_09820 29932 30516 gene locus_tag LOCUS_09830 29932 30516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 31785 30520 gene locus_tag LOCUS_09840 31785 30520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 33805 32132 gene locus_tag LOCUS_09850 33805 32132 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203622.1 protein_id gnl|my_center|LOCUS_09850 36751 33809 gene locus_tag LOCUS_09860 36751 33809 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203621.1 protein_id gnl|my_center|LOCUS_09860 39045 37480 gene locus_tag LOCUS_09870 39045 37480 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_09870 40127 39243 gene locus_tag LOCUS_09880 40127 39243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 40986 40192 gene locus_tag LOCUS_09890 40986 40192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 42111 40993 gene locus_tag LOCUS_09900 42111 40993 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920865.1 protein_id gnl|my_center|LOCUS_09900 43410 42154 gene locus_tag LOCUS_09910 43410 42154 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086617.1 protein_id gnl|my_center|LOCUS_09910 43724 43416 gene locus_tag LOCUS_09920 43724 43416 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_09920 44893 43730 gene locus_tag LOCUS_09930 44893 43730 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113169.1 protein_id gnl|my_center|LOCUS_09930 45079 45918 gene locus_tag LOCUS_09940 45079 45918 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_09940 46089 47630 gene locus_tag LOCUS_09950 46089 47630 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922831.1 protein_id gnl|my_center|LOCUS_09950 47806 48822 gene locus_tag LOCUS_09960 47806 48822 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972587.1 protein_id gnl|my_center|LOCUS_09960 48874 50526 gene locus_tag LOCUS_09970 48874 50526 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311047.1 protein_id gnl|my_center|LOCUS_09970 50623 52014 gene locus_tag LOCUS_09980 50623 52014 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212691688.1 protein_id gnl|my_center|LOCUS_09980 52041 52868 gene locus_tag LOCUS_09990 52041 52868 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922282.1 protein_id gnl|my_center|LOCUS_09990 52946 53740 gene locus_tag LOCUS_10000 52946 53740 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_10000 53765 55108 gene locus_tag LOCUS_10010 53765 55108 CDS product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694544.1 protein_id gnl|my_center|LOCUS_10010 55113 55454 gene locus_tag LOCUS_10020 55113 55454 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184933.1 protein_id gnl|my_center|LOCUS_10020 57225 55546 gene locus_tag LOCUS_10030 57225 55546 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_10030 58494 57391 gene locus_tag LOCUS_10040 58494 57391 CDS product peptidylglycine monooxygenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663621.1 protein_id gnl|my_center|LOCUS_10040 59960 58560 gene locus_tag LOCUS_10050 59960 58560 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_10050 63352 60104 gene locus_tag LOCUS_10060 63352 60104 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_10060 63584 64447 gene locus_tag LOCUS_10070 63584 64447 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767033.1 protein_id gnl|my_center|LOCUS_10070 65774 64452 gene locus_tag LOCUS_10080 65774 64452 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_10080 67599 65779 gene locus_tag LOCUS_10090 67599 65779 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117792.1 protein_id gnl|my_center|LOCUS_10090 71788 67607 gene locus_tag LOCUS_10100 71788 67607 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_10100 75366 72025 gene locus_tag LOCUS_10110 75366 72025 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_10110 78732 75382 gene locus_tag LOCUS_10120 78732 75382 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_10120 80351 78873 gene locus_tag LOCUS_10130 80351 78873 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_10130 83418 80356 gene locus_tag LOCUS_10140 83418 80356 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_10140 83845 84651 gene locus_tag LOCUS_10150 83845 84651 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766741.1 protein_id gnl|my_center|LOCUS_10150 84697 85899 gene locus_tag LOCUS_10160 gene uxuA 84697 85899 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171409.1 protein_id gnl|my_center|LOCUS_10160 86410 86123 gene locus_tag LOCUS_10170 86410 86123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10170 87857 86760 gene locus_tag LOCUS_10180 87857 86760 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486810.1 protein_id gnl|my_center|LOCUS_10180 88304 87873 gene locus_tag LOCUS_10190 88304 87873 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268377.1 protein_id gnl|my_center|LOCUS_10190 89240 88338 gene locus_tag LOCUS_10200 89240 88338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 90970 89471 gene locus_tag LOCUS_10210 90970 89471 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770856.1 protein_id gnl|my_center|LOCUS_10210 92535 91003 gene locus_tag LOCUS_10220 92535 91003 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150090626.1 protein_id gnl|my_center|LOCUS_10220 96041 92547 gene locus_tag LOCUS_10230 96041 92547 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121850300.1 protein_id gnl|my_center|LOCUS_10230 97177 96173 gene locus_tag LOCUS_10240 97177 96173 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765756.1 protein_id gnl|my_center|LOCUS_10240 97442 98032 gene locus_tag LOCUS_10250 97442 98032 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796768.1 protein_id gnl|my_center|LOCUS_10250 98284 98961 gene locus_tag LOCUS_10260 98284 98961 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009901.1 protein_id gnl|my_center|LOCUS_10260 99051 99482 gene locus_tag LOCUS_10270 99051 99482 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070531.1 protein_id gnl|my_center|LOCUS_10270 100404 99526 gene locus_tag LOCUS_10280 100404 99526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 102488 100581 gene locus_tag LOCUS_10290 gene dnaK 102488 100581 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963020.1 protein_id gnl|my_center|LOCUS_10290 102806 104233 gene locus_tag LOCUS_10300 102806 104233 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_10300 104380 105159 gene locus_tag LOCUS_10310 104380 105159 CDS product DUF3050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091901756.1 protein_id gnl|my_center|LOCUS_10310 105298 106095 gene locus_tag LOCUS_10320 105298 106095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 107124 106156 gene locus_tag LOCUS_10330 107124 106156 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921772.1 protein_id gnl|my_center|LOCUS_10330 108110 107214 gene locus_tag LOCUS_10340 108110 107214 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425940.1 protein_id gnl|my_center|LOCUS_10340 108285 109751 gene locus_tag LOCUS_10350 108285 109751 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_10350 110231 109812 gene locus_tag LOCUS_10360 110231 109812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 110418 111236 gene locus_tag LOCUS_10370 gene panB 110418 111236 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_10370 111268 111966 gene locus_tag LOCUS_10380 111268 111966 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_10380 112000 112542 gene locus_tag LOCUS_10390 112000 112542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 112646 113236 gene locus_tag LOCUS_10400 112646 113236 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 protein_id gnl|my_center|LOCUS_10400 113767 114069 gene locus_tag LOCUS_10410 113767 114069 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 protein_id gnl|my_center|LOCUS_10410 114167 114376 gene locus_tag LOCUS_10420 114167 114376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 115278 114415 gene locus_tag LOCUS_10430 115278 114415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 116826 115282 gene locus_tag LOCUS_10440 116826 115282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761961.1 protein_id gnl|my_center|LOCUS_10440 117136 118308 gene locus_tag LOCUS_10450 117136 118308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 118449 119567 gene locus_tag LOCUS_10460 gene leuB 118449 119567 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767701.1 protein_id gnl|my_center|LOCUS_10460 120755 119571 gene locus_tag LOCUS_10470 120755 119571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 120922 123348 gene locus_tag LOCUS_10480 gene pheT 120922 123348 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963186.1 protein_id gnl|my_center|LOCUS_10480 123950 123387 gene locus_tag LOCUS_10490 123950 123387 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439348.1 protein_id gnl|my_center|LOCUS_10490 125338 124166 gene locus_tag LOCUS_10500 125338 124166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 127079 125448 gene locus_tag LOCUS_10510 127079 125448 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963187.1 protein_id gnl|my_center|LOCUS_10510 127260 128444 gene locus_tag LOCUS_10520 127260 128444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10520 128375 128641 gene locus_tag LOCUS_10530 128375 128641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 129400 128747 gene locus_tag LOCUS_10540 gene fsa 129400 128747 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963193.1 protein_id gnl|my_center|LOCUS_10540 130284 129475 gene locus_tag LOCUS_10550 130284 129475 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 protein_id gnl|my_center|LOCUS_10550 130686 131690 gene locus_tag LOCUS_10560 130686 131690 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 protein_id gnl|my_center|LOCUS_10560 131691 132086 gene locus_tag LOCUS_10570 131691 132086 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207371.1 protein_id gnl|my_center|LOCUS_10570 132164 133708 gene locus_tag LOCUS_10580 132164 133708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_10580 133997 134728 gene locus_tag LOCUS_10590 133997 134728 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_10590 134870 135184 gene locus_tag LOCUS_10600 134870 135184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 135259 137331 gene locus_tag LOCUS_10610 135259 137331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 137367 138038 gene locus_tag LOCUS_10620 gene vraR 137367 138038 CDS product two-component system response regulator VraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153535.1 protein_id gnl|my_center|LOCUS_10620 138198 138854 gene locus_tag LOCUS_10630 138198 138854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 140277 139003 gene locus_tag LOCUS_10640 140277 139003 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962841.1 protein_id gnl|my_center|LOCUS_10640 140390 141682 gene locus_tag LOCUS_10650 gene fahA 140390 141682 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_10650 142136 141741 gene locus_tag LOCUS_10660 gene ytxJ 142136 141741 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_10660 142303 144903 gene locus_tag LOCUS_10670 gene clpB 142303 144903 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963875.1 protein_id gnl|my_center|LOCUS_10670 145025 145621 gene locus_tag LOCUS_10680 145025 145621 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963700.1 protein_id gnl|my_center|LOCUS_10680 147447 145720 gene locus_tag LOCUS_10690 147447 145720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 147627 148184 gene locus_tag LOCUS_10700 147627 148184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 148300 148764 gene locus_tag LOCUS_10710 gene smpB 148300 148764 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963988.1 protein_id gnl|my_center|LOCUS_10710 149388 148774 gene locus_tag LOCUS_10720 149388 148774 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_10720 149579 150538 gene locus_tag LOCUS_10730 149579 150538 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_10730 150557 151444 gene locus_tag LOCUS_10740 150557 151444 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_10740 151490 152143 gene locus_tag LOCUS_10750 151490 152143 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_10750 152195 153565 gene locus_tag LOCUS_10760 152195 153565 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_10760 153569 154417 gene locus_tag LOCUS_10770 153569 154417 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_10770 154417 155358 gene locus_tag LOCUS_10780 gene miaA 154417 155358 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964020.1 protein_id gnl|my_center|LOCUS_10780 155348 155839 gene locus_tag LOCUS_10790 155348 155839 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174793.1 protein_id gnl|my_center|LOCUS_10790 156608 155898 gene locus_tag LOCUS_10800 156608 155898 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_10800 158167 156620 gene locus_tag LOCUS_10810 158167 156620 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_10810 158874 158287 gene locus_tag LOCUS_10820 gene coaE 158874 158287 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963935.1 protein_id gnl|my_center|LOCUS_10820 159839 158871 gene locus_tag LOCUS_10830 159839 158871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 160841 159840 gene locus_tag LOCUS_10840 160841 159840 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963936.1 protein_id gnl|my_center|LOCUS_10840 161775 160960 gene locus_tag LOCUS_10850 161775 160960 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_10850 163581 161929 gene locus_tag LOCUS_10860 gene recN 163581 161929 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963946.1 protein_id gnl|my_center|LOCUS_10860 164524 163637 gene locus_tag LOCUS_10870 164524 163637 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_10870 165722 164517 gene locus_tag LOCUS_10880 gene coaBC 165722 164517 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_10880 166058 165726 gene locus_tag LOCUS_10890 166058 165726 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963943.1 protein_id gnl|my_center|LOCUS_10890 166859 166071 gene locus_tag LOCUS_10900 gene bamD 166859 166071 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_10900 167903 167016 gene locus_tag LOCUS_10910 gene dapA 167903 167016 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963941.1 protein_id gnl|my_center|LOCUS_10910 168436 167903 gene locus_tag LOCUS_10920 168436 167903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 168539 169306 gene locus_tag LOCUS_10930 168539 169306 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963939.1 protein_id gnl|my_center|LOCUS_10930 169323 170234 gene locus_tag LOCUS_10940 169323 170234 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_10940 170237 170689 gene locus_tag LOCUS_10950 170237 170689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 170992 170690 gene locus_tag LOCUS_10960 170992 170690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087848.1 protein_id gnl|my_center|LOCUS_10960 174325 172328 gene locus_tag LOCUS_10970 gene ligA 174325 172328 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963952.1 protein_id gnl|my_center|LOCUS_10970 175243 174383 gene locus_tag LOCUS_10980 gene prmC 175243 174383 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964123.1 protein_id gnl|my_center|LOCUS_10980 175748 175263 gene locus_tag LOCUS_10990 175748 175263 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_10990 175838 176923 gene locus_tag LOCUS_11000 gene ribD 175838 176923 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964125.1 protein_id gnl|my_center|LOCUS_11000 176916 177521 gene locus_tag LOCUS_11010 176916 177521 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964126.1 protein_id gnl|my_center|LOCUS_11010 177666 177538 gene locus_tag LOCUS_11020 177666 177538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 177655 178386 gene locus_tag LOCUS_11030 177655 178386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 178386 178991 gene locus_tag LOCUS_11040 178386 178991 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964127.1 protein_id gnl|my_center|LOCUS_11040 179490 179080 gene locus_tag LOCUS_11050 179490 179080 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_11050 179697 181121 gene locus_tag LOCUS_11060 gene dnaA 179697 181121 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_11060 181179 181574 gene locus_tag LOCUS_11070 181179 181574 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100664.1 protein_id gnl|my_center|LOCUS_11070 181589 182314 gene locus_tag LOCUS_11080 181589 182314 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_11080 182514 183044 gene locus_tag LOCUS_11090 182514 183044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 183257 184294 gene locus_tag LOCUS_11100 183257 184294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence008 1449 1144 gene locus_tag LOCUS_11110 1449 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 2130 1825 gene locus_tag LOCUS_11120 2130 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 3899 2361 gene locus_tag LOCUS_11130 3899 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11130 4467 3880 gene locus_tag LOCUS_11140 4467 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11140 5060 4422 gene locus_tag LOCUS_11150 gene pnuC 5060 4422 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_11150 5304 5044 gene locus_tag LOCUS_11160 5304 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 5999 5367 gene locus_tag LOCUS_11170 5999 5367 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962365.1 protein_id gnl|my_center|LOCUS_11170 6081 7397 gene locus_tag LOCUS_11180 gene ahcY 6081 7397 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962366.1 protein_id gnl|my_center|LOCUS_11180 7840 7580 gene locus_tag LOCUS_11190 gene rpmA 7840 7580 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964306.1 protein_id gnl|my_center|LOCUS_11190 8566 7919 gene locus_tag LOCUS_11200 gene rplU 8566 7919 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964307.1 protein_id gnl|my_center|LOCUS_11200 9216 8752 gene locus_tag LOCUS_11210 9216 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 9384 10706 gene locus_tag LOCUS_11220 9384 10706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 10780 12849 gene locus_tag LOCUS_11230 10780 12849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 13915 13145 gene locus_tag LOCUS_11240 13915 13145 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_11240 14238 14648 gene locus_tag LOCUS_11250 14238 14648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 14760 15179 gene locus_tag LOCUS_11260 14760 15179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 16468 15215 gene locus_tag LOCUS_11270 16468 15215 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964378.1 protein_id gnl|my_center|LOCUS_11270 16677 18215 gene locus_tag LOCUS_11280 16677 18215 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964377.1 protein_id gnl|my_center|LOCUS_11280 18212 19339 gene locus_tag LOCUS_11290 18212 19339 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964376.1 protein_id gnl|my_center|LOCUS_11290 19449 20204 gene locus_tag LOCUS_11300 gene fabG 19449 20204 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964375.1 protein_id gnl|my_center|LOCUS_11300 20221 21438 gene locus_tag LOCUS_11310 20221 21438 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964374.1 protein_id gnl|my_center|LOCUS_11310 21445 21693 gene locus_tag LOCUS_11320 21445 21693 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964373.1 protein_id gnl|my_center|LOCUS_11320 21717 22604 gene locus_tag LOCUS_11330 21717 22604 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964372.1 protein_id gnl|my_center|LOCUS_11330 22674 23597 gene locus_tag LOCUS_11340 22674 23597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964370.1 protein_id gnl|my_center|LOCUS_11340 23607 24740 gene locus_tag LOCUS_11350 23607 24740 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964369.1 protein_id gnl|my_center|LOCUS_11350 24742 25179 gene locus_tag LOCUS_11360 24742 25179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964368.1 protein_id gnl|my_center|LOCUS_11360 25181 25633 gene locus_tag LOCUS_11370 25181 25633 CDS product flexirubin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964367.1 protein_id gnl|my_center|LOCUS_11370 25671 26069 gene locus_tag LOCUS_11380 25671 26069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964366.1 protein_id gnl|my_center|LOCUS_11380 26078 27073 gene locus_tag LOCUS_11390 26078 27073 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964365.1 protein_id gnl|my_center|LOCUS_11390 27149 27892 gene locus_tag LOCUS_11400 27149 27892 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100836.1 protein_id gnl|my_center|LOCUS_11400 27885 29153 gene locus_tag LOCUS_11410 27885 29153 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099434.1 protein_id gnl|my_center|LOCUS_11410 29143 29583 gene locus_tag LOCUS_11420 29143 29583 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964360.1 protein_id gnl|my_center|LOCUS_11420 29576 30724 gene locus_tag LOCUS_11430 29576 30724 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964359.1 protein_id gnl|my_center|LOCUS_11430 30721 31329 gene locus_tag LOCUS_11440 30721 31329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964358.1 protein_id gnl|my_center|LOCUS_11440 31326 31583 gene locus_tag LOCUS_11450 31326 31583 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_11450 31710 32915 gene locus_tag LOCUS_11460 31710 32915 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179058.1 protein_id gnl|my_center|LOCUS_11460 32912 33976 gene locus_tag LOCUS_11470 32912 33976 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964354.1 protein_id gnl|my_center|LOCUS_11470 33970 34746 gene locus_tag LOCUS_11480 33970 34746 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964353.1 protein_id gnl|my_center|LOCUS_11480 34739 35356 gene locus_tag LOCUS_11490 34739 35356 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964352.1 protein_id gnl|my_center|LOCUS_11490 35373 35948 gene locus_tag LOCUS_11500 35373 35948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503758.1 protein_id gnl|my_center|LOCUS_11500 35945 36532 gene locus_tag LOCUS_11510 35945 36532 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964350.1 protein_id gnl|my_center|LOCUS_11510 36537 36905 gene locus_tag LOCUS_11520 36537 36905 CDS product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964349.1 protein_id gnl|my_center|LOCUS_11520 36956 37414 gene locus_tag LOCUS_11530 36956 37414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964348.1 protein_id gnl|my_center|LOCUS_11530 37508 38263 gene locus_tag LOCUS_11540 37508 38263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11540 38257 38676 gene locus_tag LOCUS_11550 38257 38676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11550 38669 42355 gene locus_tag LOCUS_11560 38669 42355 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964346.1 protein_id gnl|my_center|LOCUS_11560 42355 43902 gene locus_tag LOCUS_11570 42355 43902 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964345.1 protein_id gnl|my_center|LOCUS_11570 43902 44783 gene locus_tag LOCUS_11580 43902 44783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 44887 46497 gene locus_tag LOCUS_11590 44887 46497 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964344.1 protein_id gnl|my_center|LOCUS_11590 46497 47786 gene locus_tag LOCUS_11600 46497 47786 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_11600 48381 47998 gene locus_tag LOCUS_11610 48381 47998 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089378.1 protein_id gnl|my_center|LOCUS_11610 50479 48383 gene locus_tag LOCUS_11620 gene recQ 50479 48383 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229616.1 protein_id gnl|my_center|LOCUS_11620 50924 50592 gene locus_tag LOCUS_11630 gene ssb 50924 50592 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_11630 51290 52060 gene locus_tag LOCUS_11640 51290 52060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 53416 52229 gene locus_tag LOCUS_11650 53416 52229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 53489 53710 gene locus_tag LOCUS_11660 53489 53710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 55157 54084 gene locus_tag LOCUS_11670 55157 54084 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771258.1 protein_id gnl|my_center|LOCUS_11670 55532 56155 gene locus_tag LOCUS_11680 55532 56155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 57953 56601 gene locus_tag LOCUS_11690 57953 56601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 58698 59315 gene locus_tag LOCUS_11700 58698 59315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 59411 60067 gene locus_tag LOCUS_11710 59411 60067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 60472 60293 gene locus_tag LOCUS_11720 60472 60293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 60535 62250 gene locus_tag LOCUS_11730 60535 62250 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_11730 62418 62924 gene locus_tag LOCUS_11740 62418 62924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 63446 64258 gene locus_tag LOCUS_11750 63446 64258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 64394 65041 gene locus_tag LOCUS_11760 64394 65041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 65052 65381 gene locus_tag LOCUS_11770 65052 65381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 65454 66212 gene locus_tag LOCUS_11780 65454 66212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 66407 67006 gene locus_tag LOCUS_11790 66407 67006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 67078 67707 gene locus_tag LOCUS_11800 67078 67707 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_11800 67704 68153 gene locus_tag LOCUS_11810 67704 68153 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208269.1 protein_id gnl|my_center|LOCUS_11810 68150 68893 gene locus_tag LOCUS_11820 68150 68893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 69132 69749 gene locus_tag LOCUS_11830 69132 69749 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765580.1 protein_id gnl|my_center|LOCUS_11830 70305 69766 gene locus_tag LOCUS_11840 70305 69766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964495.1 protein_id gnl|my_center|LOCUS_11840 72218 70569 gene locus_tag LOCUS_11850 72218 70569 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763976.1 protein_id gnl|my_center|LOCUS_11850 75213 72229 gene locus_tag LOCUS_11860 75213 72229 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_11860 75536 75748 gene locus_tag LOCUS_11870 75536 75748 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335899.1 protein_id gnl|my_center|LOCUS_11870 75835 76410 gene locus_tag LOCUS_11880 75835 76410 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_11880 76473 76961 gene locus_tag LOCUS_11890 76473 76961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 76966 77316 gene locus_tag LOCUS_11900 76966 77316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_11900 77874 77407 gene locus_tag LOCUS_11910 77874 77407 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377741.1 protein_id gnl|my_center|LOCUS_11910 78152 80365 gene locus_tag LOCUS_11920 78152 80365 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228011.1 protein_id gnl|my_center|LOCUS_11920 80358 81161 gene locus_tag LOCUS_11930 80358 81161 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962265.1 protein_id gnl|my_center|LOCUS_11930 81369 81650 gene locus_tag LOCUS_11940 81369 81650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 81805 82545 gene locus_tag LOCUS_11950 81805 82545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 82707 84008 gene locus_tag LOCUS_11960 82707 84008 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388984.1 protein_id gnl|my_center|LOCUS_11960 84531 84073 gene locus_tag LOCUS_11970 84531 84073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 84632 85573 gene locus_tag LOCUS_11980 84632 85573 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_11980 87579 85627 gene locus_tag LOCUS_11990 87579 85627 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_11990 88413 87592 gene locus_tag LOCUS_12000 88413 87592 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_12000 91581 88558 gene locus_tag LOCUS_12010 91581 88558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 92393 91941 gene locus_tag LOCUS_12020 92393 91941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 94305 92911 gene locus_tag LOCUS_12030 gene rimK 94305 92911 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962905.1 protein_id gnl|my_center|LOCUS_12030 95812 94283 gene locus_tag LOCUS_12040 95812 94283 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_12040 96253 95927 gene locus_tag LOCUS_12050 96253 95927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 97224 96250 gene locus_tag LOCUS_12060 97224 96250 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_12060 98155 97214 gene locus_tag LOCUS_12070 gene speB 98155 97214 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_12070 99629 98172 gene locus_tag LOCUS_12080 99629 98172 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_12080 100080 100811 gene locus_tag LOCUS_12090 100080 100811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 101196 101124 gene locus_tag LOCUS_t00100 101196 101124 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 102566 101292 gene locus_tag LOCUS_12100 102566 101292 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969469.1 protein_id gnl|my_center|LOCUS_12100 103027 102563 gene locus_tag LOCUS_12110 103027 102563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 104027 103017 gene locus_tag LOCUS_12120 104027 103017 CDS product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017179.1 protein_id gnl|my_center|LOCUS_12120 104567 104031 gene locus_tag LOCUS_12130 104567 104031 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_12130 105754 104687 gene locus_tag LOCUS_12140 105754 104687 CDS product peptidylglycine monooxygenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663621.1 protein_id gnl|my_center|LOCUS_12140 107238 105760 gene locus_tag LOCUS_12150 107238 105760 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_12150 110437 107249 gene locus_tag LOCUS_12160 110437 107249 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_12160 110599 111789 gene locus_tag LOCUS_12170 110599 111789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 113300 111795 gene locus_tag LOCUS_12180 gene araA 113300 111795 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210591.1 protein_id gnl|my_center|LOCUS_12180 114886 113321 gene locus_tag LOCUS_12190 114886 113321 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087114.1 protein_id gnl|my_center|LOCUS_12190 115612 114908 gene locus_tag LOCUS_12200 115612 114908 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262722.1 protein_id gnl|my_center|LOCUS_12200 117299 115605 gene locus_tag LOCUS_12210 gene araB 117299 115605 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951845.1 protein_id gnl|my_center|LOCUS_12210 118078 117401 gene locus_tag LOCUS_12220 118078 117401 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_12220 118464 119462 gene locus_tag LOCUS_12230 118464 119462 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_12230 119468 120802 gene locus_tag LOCUS_12240 119468 120802 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921284.1 protein_id gnl|my_center|LOCUS_12240 120804 121769 gene locus_tag LOCUS_12250 120804 121769 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229150.1 protein_id gnl|my_center|LOCUS_12250 121961 123025 gene locus_tag LOCUS_12260 121961 123025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 123038 124327 gene locus_tag LOCUS_12270 123038 124327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 124993 124373 gene locus_tag LOCUS_12280 124993 124373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 128273 125121 gene locus_tag LOCUS_12290 128273 125121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 129515 128445 gene locus_tag LOCUS_12300 129515 128445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 130775 129828 gene locus_tag LOCUS_12310 130775 129828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 131983 130871 gene locus_tag LOCUS_12320 131983 130871 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225996815.1 protein_id gnl|my_center|LOCUS_12320 133147 132047 gene locus_tag LOCUS_12330 133147 132047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 134323 133211 gene locus_tag LOCUS_12340 134323 133211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 135592 134405 gene locus_tag LOCUS_12350 135592 134405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 137041 135680 gene locus_tag LOCUS_12360 137041 135680 CDS product O-antigen export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107240.1 protein_id gnl|my_center|LOCUS_12360 138441 137056 gene locus_tag LOCUS_12370 138441 137056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 140992 138476 gene locus_tag LOCUS_12380 140992 138476 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_12380 141916 141095 gene locus_tag LOCUS_12390 141916 141095 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_12390 143322 142015 gene locus_tag LOCUS_12400 143322 142015 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910880.1 protein_id gnl|my_center|LOCUS_12400 144410 145672 gene locus_tag LOCUS_12410 144410 145672 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890748.1 protein_id gnl|my_center|LOCUS_12410 145677 146771 gene locus_tag LOCUS_12420 145677 146771 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223493.1 protein_id gnl|my_center|LOCUS_12420 147534 146896 gene locus_tag LOCUS_12430 147534 146896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 147835 147761 gene locus_tag LOCUS_t00110 147835 147761 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 149270 147912 gene locus_tag LOCUS_12440 gene rseP 149270 147912 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_12440 149575 150126 gene locus_tag LOCUS_12450 149575 150126 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099939.1 protein_id gnl|my_center|LOCUS_12450 150315 150560 gene locus_tag LOCUS_12460 150315 150560 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962269.1 protein_id gnl|my_center|LOCUS_12460 150557 152794 gene locus_tag LOCUS_12470 gene feoB 150557 152794 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_12470 153231 154625 gene locus_tag LOCUS_12480 153231 154625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 155008 154622 gene locus_tag LOCUS_12490 155008 154622 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_12490 155474 155106 gene locus_tag LOCUS_12500 155474 155106 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532858.1 protein_id gnl|my_center|LOCUS_12500 156008 155577 gene locus_tag LOCUS_12510 156008 155577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 156238 158871 gene locus_tag LOCUS_12520 156238 158871 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_12520 160140 158911 gene locus_tag LOCUS_12530 160140 158911 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628869.1 protein_id gnl|my_center|LOCUS_12530 161165 160344 gene locus_tag LOCUS_12540 161165 160344 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_12540 161823 161167 gene locus_tag LOCUS_12550 161823 161167 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_12550 161902 164175 gene locus_tag LOCUS_12560 161902 164175 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768395.1 protein_id gnl|my_center|LOCUS_12560 164236 165387 gene locus_tag LOCUS_12570 164236 165387 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963565.1 protein_id gnl|my_center|LOCUS_12570 166358 165384 gene locus_tag LOCUS_12580 166358 165384 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_12580 166503 167045 gene locus_tag LOCUS_12590 166503 167045 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366547.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence009 <1 1377 gene locus_tag LOCUS_12600 <1 1377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006285466.1:DASS family sodium-coupled anion symporter 1610 2707 gene locus_tag LOCUS_12610 1610 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 2708 3394 gene locus_tag LOCUS_12620 2708 3394 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_12620 3927 3520 gene locus_tag LOCUS_12630 3927 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 4373 6868 gene locus_tag LOCUS_12640 4373 6868 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839988.1 protein_id gnl|my_center|LOCUS_12640 6865 7449 gene locus_tag LOCUS_12650 6865 7449 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_12650 7573 7887 gene locus_tag LOCUS_12660 7573 7887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 7901 8344 gene locus_tag LOCUS_12670 7901 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 8432 8998 gene locus_tag LOCUS_12680 8432 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 9190 9345 gene locus_tag LOCUS_12690 9190 9345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 9520 9963 gene locus_tag LOCUS_12700 9520 9963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 10062 10559 gene locus_tag LOCUS_12710 10062 10559 CDS product MepB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779367.1 protein_id gnl|my_center|LOCUS_12710 10583 10822 gene locus_tag LOCUS_12720 10583 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803898.1 protein_id gnl|my_center|LOCUS_12720 12123 10843 gene locus_tag LOCUS_12730 gene hemL 12123 10843 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963336.1 protein_id gnl|my_center|LOCUS_12730 12984 12124 gene locus_tag LOCUS_12740 12984 12124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 13892 12981 gene locus_tag LOCUS_12750 13892 12981 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_12750 14293 13964 gene locus_tag LOCUS_12760 14293 13964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964062.1 protein_id gnl|my_center|LOCUS_12760 14735 15292 gene locus_tag LOCUS_12770 14735 15292 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964059.1 protein_id gnl|my_center|LOCUS_12770 15433 17196 gene locus_tag LOCUS_12780 15433 17196 CDS product aromatic amino acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964058.1 protein_id gnl|my_center|LOCUS_12780 17277 18491 gene locus_tag LOCUS_12790 17277 18491 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_12790 19120 18506 gene locus_tag LOCUS_12800 19120 18506 CDS product DUF4230 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964057.1 protein_id gnl|my_center|LOCUS_12800 20146 19169 gene locus_tag LOCUS_12810 20146 19169 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964056.1 protein_id gnl|my_center|LOCUS_12810 20991 20143 gene locus_tag LOCUS_12820 20991 20143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 21487 21062 gene locus_tag LOCUS_12830 21487 21062 CDS product DUF3995 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905438.1 protein_id gnl|my_center|LOCUS_12830 22131 21577 gene locus_tag LOCUS_12840 22131 21577 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_12840 22899 22225 gene locus_tag LOCUS_12850 22899 22225 CDS product DUF5995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_12850 25790 23175 gene locus_tag LOCUS_12860 gene alaS 25790 23175 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964045.1 protein_id gnl|my_center|LOCUS_12860 25892 26869 gene locus_tag LOCUS_12870 25892 26869 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_12870 26869 27198 gene locus_tag LOCUS_12880 26869 27198 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_12880 27284 27883 gene locus_tag LOCUS_12890 27284 27883 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_12890 27885 28322 gene locus_tag LOCUS_12900 27885 28322 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_12900 28291 29100 gene locus_tag LOCUS_12910 28291 29100 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964050.1 protein_id gnl|my_center|LOCUS_12910 30637 29333 gene locus_tag LOCUS_12920 gene der 30637 29333 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964065.1 protein_id gnl|my_center|LOCUS_12920 32314 30782 gene locus_tag LOCUS_12930 32314 30782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 33306 32422 gene locus_tag LOCUS_12940 gene era 33306 32422 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964066.1 protein_id gnl|my_center|LOCUS_12940 33781 33317 gene locus_tag LOCUS_12950 33781 33317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 35132 33768 gene locus_tag LOCUS_12960 35132 33768 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262174.1 protein_id gnl|my_center|LOCUS_12960 35325 35398 gene locus_tag LOCUS_t00120 35325 35398 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 35724 36014 gene locus_tag LOCUS_12970 35724 36014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 36011 36514 gene locus_tag LOCUS_12980 36011 36514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_12980 37986 36613 gene locus_tag LOCUS_12990 37986 36613 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362017.1 protein_id gnl|my_center|LOCUS_12990 38458 39579 gene locus_tag LOCUS_13000 38458 39579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 39767 42277 gene locus_tag LOCUS_13010 39767 42277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703527.1 protein_id gnl|my_center|LOCUS_13010 43872 44297 gene locus_tag LOCUS_13020 43872 44297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 44355 45743 gene locus_tag LOCUS_13030 44355 45743 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 protein_id gnl|my_center|LOCUS_13030 45824 46351 gene locus_tag LOCUS_13040 45824 46351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 47508 46876 gene locus_tag LOCUS_13050 47508 46876 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459566.1 protein_id gnl|my_center|LOCUS_13050 49178 47520 gene locus_tag LOCUS_13060 49178 47520 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877102.1 protein_id gnl|my_center|LOCUS_13060 49606 49181 gene locus_tag LOCUS_13070 49606 49181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 50011 49613 gene locus_tag LOCUS_13080 50011 49613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 50460 50143 gene locus_tag LOCUS_13090 50460 50143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 51312 52262 gene locus_tag LOCUS_13100 51312 52262 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226896.1 protein_id gnl|my_center|LOCUS_13100 53914 52496 gene locus_tag LOCUS_13110 53914 52496 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132123697.1 protein_id gnl|my_center|LOCUS_13110 55642 54260 gene locus_tag LOCUS_13120 55642 54260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 57719 55827 gene locus_tag LOCUS_13130 57719 55827 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767669.1 protein_id gnl|my_center|LOCUS_13130 59237 57789 gene locus_tag LOCUS_13140 59237 57789 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_13140 61312 59825 gene locus_tag LOCUS_13150 61312 59825 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_13150 64571 61299 gene locus_tag LOCUS_13160 64571 61299 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_13160 65891 64725 gene locus_tag LOCUS_13170 65891 64725 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_13170 66004 66603 gene locus_tag LOCUS_13180 66004 66603 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796768.1 protein_id gnl|my_center|LOCUS_13180 68519 67464 gene locus_tag LOCUS_13190 68519 67464 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 protein_id gnl|my_center|LOCUS_13190 70770 68785 gene locus_tag LOCUS_13200 70770 68785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 71395 72855 gene locus_tag LOCUS_13210 71395 72855 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922487.1 protein_id gnl|my_center|LOCUS_13210 74223 73222 gene locus_tag LOCUS_13220 74223 73222 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643877.1 protein_id gnl|my_center|LOCUS_13220 75224 74367 gene locus_tag LOCUS_13230 75224 74367 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812933.1 protein_id gnl|my_center|LOCUS_13230 76204 75251 gene locus_tag LOCUS_13240 76204 75251 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 protein_id gnl|my_center|LOCUS_13240 76322 76152 gene locus_tag LOCUS_13250 76322 76152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 78743 76407 gene locus_tag LOCUS_13260 78743 76407 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066875.1 protein_id gnl|my_center|LOCUS_13260 79096 79281 gene locus_tag LOCUS_13270 79096 79281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 80040 79465 gene locus_tag LOCUS_13280 80040 79465 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764900.1 protein_id gnl|my_center|LOCUS_13280 80885 80199 gene locus_tag LOCUS_13290 80885 80199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 82301 81126 gene locus_tag LOCUS_13300 82301 81126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 82641 83417 gene locus_tag LOCUS_13310 gene speB 82641 83417 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_13310 83445 84164 gene locus_tag LOCUS_13320 83445 84164 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_13320 84547 87378 gene locus_tag LOCUS_13330 84547 87378 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184173497.1 protein_id gnl|my_center|LOCUS_13330 87320 87970 gene locus_tag LOCUS_13340 87320 87970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13340 87960 91244 gene locus_tag LOCUS_13350 87960 91244 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184173497.1 protein_id gnl|my_center|LOCUS_13350 91264 92838 gene locus_tag LOCUS_13360 91264 92838 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 protein_id gnl|my_center|LOCUS_13360 92953 94020 gene locus_tag LOCUS_13370 92953 94020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 94119 94637 gene locus_tag LOCUS_13380 94119 94637 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464022.1 protein_id gnl|my_center|LOCUS_13380 95903 94887 gene locus_tag LOCUS_13390 95903 94887 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085979762.1 protein_id gnl|my_center|LOCUS_13390 97573 95966 gene locus_tag LOCUS_13400 97573 95966 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_13400 98752 97577 gene locus_tag LOCUS_13410 98752 97577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 99503 98733 gene locus_tag LOCUS_13420 99503 98733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 101068 99506 gene locus_tag LOCUS_13430 101068 99506 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_13430 101487 101173 gene locus_tag LOCUS_13440 gene rhaM 101487 101173 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099341.1 protein_id gnl|my_center|LOCUS_13440 102389 103510 gene locus_tag LOCUS_13450 102389 103510 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809304.1 protein_id gnl|my_center|LOCUS_13450 103725 104660 gene locus_tag LOCUS_13460 103725 104660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 104812 105555 gene locus_tag LOCUS_13470 104812 105555 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970102.1 protein_id gnl|my_center|LOCUS_13470 105609 105848 gene locus_tag LOCUS_13480 105609 105848 CDS product Rho termination factor N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_13480 105902 106924 gene locus_tag LOCUS_13490 105902 106924 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202490.1 protein_id gnl|my_center|LOCUS_13490 107120 107725 gene locus_tag LOCUS_13500 107120 107725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 107785 108426 gene locus_tag LOCUS_13510 107785 108426 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039531.1 protein_id gnl|my_center|LOCUS_13510 108468 108767 gene locus_tag LOCUS_13520 108468 108767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 109012 110841 gene locus_tag LOCUS_13530 109012 110841 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_13530 110853 111746 gene locus_tag LOCUS_13540 110853 111746 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 protein_id gnl|my_center|LOCUS_13540 111776 112876 gene locus_tag LOCUS_13550 111776 112876 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_13550 113106 112921 gene locus_tag LOCUS_13560 113106 112921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 113336 114406 gene locus_tag LOCUS_13570 113336 114406 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247147.1 protein_id gnl|my_center|LOCUS_13570 114605 115054 gene locus_tag LOCUS_13580 114605 115054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 115132 115875 gene locus_tag LOCUS_13590 115132 115875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 116230 116421 gene locus_tag LOCUS_13600 116230 116421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 117074 116532 gene locus_tag LOCUS_13610 117074 116532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 117242 117805 gene locus_tag LOCUS_13620 117242 117805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 117815 118261 gene locus_tag LOCUS_13630 117815 118261 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_13630 118267 121260 gene locus_tag LOCUS_13640 118267 121260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 121392 121613 gene locus_tag LOCUS_13650 121392 121613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 121664 122692 gene locus_tag LOCUS_13660 121664 122692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 123980 122874 gene locus_tag LOCUS_13670 123980 122874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 124569 124078 gene locus_tag LOCUS_13680 124569 124078 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435461.1 protein_id gnl|my_center|LOCUS_13680 124787 125290 gene locus_tag LOCUS_13690 124787 125290 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142813.1 protein_id gnl|my_center|LOCUS_13690 125807 125370 gene locus_tag LOCUS_13700 125807 125370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 128268 126019 gene locus_tag LOCUS_13710 128268 126019 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766928.1 protein_id gnl|my_center|LOCUS_13710 133222 128342 gene locus_tag LOCUS_13720 133222 128342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 134236 133481 gene locus_tag LOCUS_13730 134236 133481 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928911.1 protein_id gnl|my_center|LOCUS_13730 134680 134237 gene locus_tag LOCUS_13740 134680 134237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 135358 134849 gene locus_tag LOCUS_13750 135358 134849 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 protein_id gnl|my_center|LOCUS_13750 135590 136408 gene locus_tag LOCUS_13760 135590 136408 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267572.1 protein_id gnl|my_center|LOCUS_13760 136446 137264 gene locus_tag LOCUS_13770 136446 137264 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777089.1 protein_id gnl|my_center|LOCUS_13770 137310 137786 gene locus_tag LOCUS_13780 137310 137786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 138877 140232 gene locus_tag LOCUS_13790 138877 140232 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_13790 140673 142952 gene locus_tag LOCUS_13800 140673 142952 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202999.1 protein_id gnl|my_center|LOCUS_13800 143061 144428 gene locus_tag LOCUS_13810 143061 144428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 144425 145600 gene locus_tag LOCUS_13820 144425 145600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 145597 146406 gene locus_tag LOCUS_13830 145597 146406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 146413 147444 gene locus_tag LOCUS_13840 146413 147444 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113398.1 protein_id gnl|my_center|LOCUS_13840 148203 148808 gene locus_tag LOCUS_13850 148203 148808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 148805 149926 gene locus_tag LOCUS_13860 148805 149926 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797323.1 protein_id gnl|my_center|LOCUS_13860 150008 151189 gene locus_tag LOCUS_13870 150008 151189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 151186 151626 gene locus_tag LOCUS_13880 151186 151626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 151630 152892 gene locus_tag LOCUS_13890 gene wcaI 151630 152892 CDS product colanic acid biosynthesis fucosyltransferase WcaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699650.1 protein_id gnl|my_center|LOCUS_13890 153078 154406 gene locus_tag LOCUS_13900 153078 154406 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964561.1 protein_id gnl|my_center|LOCUS_13900 154418 155479 gene locus_tag LOCUS_13910 154418 155479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 156401 155496 gene locus_tag LOCUS_13920 156401 155496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 156946 156401 gene locus_tag LOCUS_13930 gene wcaF 156946 156401 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153566.1 protein_id gnl|my_center|LOCUS_13930 158108 156939 gene locus_tag LOCUS_13940 158108 156939 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974187.1 protein_id gnl|my_center|LOCUS_13940 158977 158105 gene locus_tag LOCUS_13950 158977 158105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 161628 159424 gene locus_tag LOCUS_13960 161628 159424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 162392 161652 gene locus_tag LOCUS_13970 162392 161652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence010 905 48 gene locus_tag LOCUS_13980 905 48 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963505.1 protein_id gnl|my_center|LOCUS_13980 1484 957 gene locus_tag LOCUS_13990 1484 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1766 1530 gene locus_tag LOCUS_14000 1766 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14000 2586 1726 gene locus_tag LOCUS_14010 2586 1726 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14010 5637 2752 gene locus_tag LOCUS_14020 gene gcvP 5637 2752 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963500.1 protein_id gnl|my_center|LOCUS_14020 5730 6554 gene locus_tag LOCUS_14030 5730 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362021.1 protein_id gnl|my_center|LOCUS_14030 6778 6551 gene locus_tag LOCUS_14040 6778 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 7426 6782 gene locus_tag LOCUS_14050 7426 6782 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706006.1 protein_id gnl|my_center|LOCUS_14050 7457 7816 gene locus_tag LOCUS_14060 7457 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 8334 7813 gene locus_tag LOCUS_14070 8334 7813 CDS product 5'-3'-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468869.1 protein_id gnl|my_center|LOCUS_14070 10601 8583 gene locus_tag LOCUS_14080 10601 8583 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_14080 11025 10624 gene locus_tag LOCUS_14090 11025 10624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 11544 11053 gene locus_tag LOCUS_14100 gene purE 11544 11053 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963493.1 protein_id gnl|my_center|LOCUS_14100 12721 11549 gene locus_tag LOCUS_14110 12721 11549 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963492.1 protein_id gnl|my_center|LOCUS_14110 12832 13938 gene locus_tag LOCUS_14120 12832 13938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 14103 15104 gene locus_tag LOCUS_14130 gene obgE 14103 15104 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963487.1 protein_id gnl|my_center|LOCUS_14130 15114 15635 gene locus_tag LOCUS_14140 15114 15635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 15835 16194 gene locus_tag LOCUS_14150 15835 16194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 22214 16203 gene locus_tag LOCUS_14160 22214 16203 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_14160 23365 22580 gene locus_tag LOCUS_14170 23365 22580 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062386982.1 protein_id gnl|my_center|LOCUS_14170 23712 23401 gene locus_tag LOCUS_14180 23712 23401 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_14180 26005 23861 gene locus_tag LOCUS_14190 26005 23861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 26946 26008 gene locus_tag LOCUS_14200 26946 26008 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_14200 29757 26950 gene locus_tag LOCUS_14210 29757 26950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 30063 31451 gene locus_tag LOCUS_14220 30063 31451 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_14220 31563 32261 gene locus_tag LOCUS_14230 gene radC 31563 32261 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_14230 32386 33633 gene locus_tag LOCUS_14240 32386 33633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 33626 34315 gene locus_tag LOCUS_14250 33626 34315 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_14250 34371 34919 gene locus_tag LOCUS_14260 34371 34919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 34967 36346 gene locus_tag LOCUS_14270 34967 36346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 36461 37315 gene locus_tag LOCUS_14280 36461 37315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963480.1 protein_id gnl|my_center|LOCUS_14280 38589 37312 gene locus_tag LOCUS_14290 38589 37312 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_14290 38735 39478 gene locus_tag LOCUS_14300 38735 39478 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963478.1 protein_id gnl|my_center|LOCUS_14300 40261 39515 gene locus_tag LOCUS_14310 gene rlmB 40261 39515 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 protein_id gnl|my_center|LOCUS_14310 41239 40349 gene locus_tag LOCUS_14320 41239 40349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 42795 41251 gene locus_tag LOCUS_14330 42795 41251 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963330.1 protein_id gnl|my_center|LOCUS_14330 45915 42808 gene locus_tag LOCUS_14340 45915 42808 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963331.1 protein_id gnl|my_center|LOCUS_14340 48739 47234 gene locus_tag LOCUS_14350 48739 47234 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_14350 51966 48751 gene locus_tag LOCUS_14360 51966 48751 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106605886.1 protein_id gnl|my_center|LOCUS_14360 52540 52998 gene locus_tag LOCUS_14370 gene rpsL 52540 52998 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963473.1 protein_id gnl|my_center|LOCUS_14370 53073 53549 gene locus_tag LOCUS_14380 gene rpsG 53073 53549 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963472.1 protein_id gnl|my_center|LOCUS_14380 53556 55691 gene locus_tag LOCUS_14390 gene fusA 53556 55691 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963471.1 protein_id gnl|my_center|LOCUS_14390 55704 56009 gene locus_tag LOCUS_14400 gene rpsJ 55704 56009 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963470.1 protein_id gnl|my_center|LOCUS_14400 56198 56815 gene locus_tag LOCUS_14410 gene rplC 56198 56815 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963469.1 protein_id gnl|my_center|LOCUS_14410 56815 57444 gene locus_tag LOCUS_14420 gene rplD 56815 57444 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963468.1 protein_id gnl|my_center|LOCUS_14420 57451 57741 gene locus_tag LOCUS_14430 gene rplW 57451 57741 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963467.1 protein_id gnl|my_center|LOCUS_14430 57751 58575 gene locus_tag LOCUS_14440 gene rplB 57751 58575 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963466.1 protein_id gnl|my_center|LOCUS_14440 58703 58867 gene locus_tag LOCUS_14450 58703 58867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 58871 59278 gene locus_tag LOCUS_14460 gene rplV 58871 59278 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963465.1 protein_id gnl|my_center|LOCUS_14460 59280 60002 gene locus_tag LOCUS_14470 gene rpsC 59280 60002 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963464.1 protein_id gnl|my_center|LOCUS_14470 60022 60453 gene locus_tag LOCUS_14480 gene rplP 60022 60453 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963463.1 protein_id gnl|my_center|LOCUS_14480 60462 60653 gene locus_tag LOCUS_14490 gene rpmC 60462 60653 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963462.1 protein_id gnl|my_center|LOCUS_14490 60667 60927 gene locus_tag LOCUS_14500 gene rpsQ 60667 60927 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963461.1 protein_id gnl|my_center|LOCUS_14500 60929 61297 gene locus_tag LOCUS_14510 gene rplN 60929 61297 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963460.1 protein_id gnl|my_center|LOCUS_14510 61311 61625 gene locus_tag LOCUS_14520 gene rplX 61311 61625 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963459.1 protein_id gnl|my_center|LOCUS_14520 61629 62180 gene locus_tag LOCUS_14530 gene rplE 61629 62180 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963458.1 protein_id gnl|my_center|LOCUS_14530 62182 62451 gene locus_tag LOCUS_14540 gene rpsN 62182 62451 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_14540 62517 62915 gene locus_tag LOCUS_14550 gene rpsH 62517 62915 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963456.1 protein_id gnl|my_center|LOCUS_14550 62934 63476 gene locus_tag LOCUS_14560 gene rplF 62934 63476 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963455.1 protein_id gnl|my_center|LOCUS_14560 63486 63842 gene locus_tag LOCUS_14570 gene rplR 63486 63842 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963454.1 protein_id gnl|my_center|LOCUS_14570 63851 64375 gene locus_tag LOCUS_14580 gene rpsE 63851 64375 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963453.1 protein_id gnl|my_center|LOCUS_14580 64387 64569 gene locus_tag LOCUS_14590 gene rpmD 64387 64569 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963452.1 protein_id gnl|my_center|LOCUS_14590 64583 65035 gene locus_tag LOCUS_14600 gene rplO 64583 65035 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963451.1 protein_id gnl|my_center|LOCUS_14600 65048 66391 gene locus_tag LOCUS_14610 gene secY 65048 66391 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963450.1 protein_id gnl|my_center|LOCUS_14610 66395 66610 gene locus_tag LOCUS_14620 gene infA 66395 66610 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963449.1 protein_id gnl|my_center|LOCUS_14620 66754 67128 gene locus_tag LOCUS_14630 gene rpsM 66754 67128 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963448.1 protein_id gnl|my_center|LOCUS_14630 67142 67546 gene locus_tag LOCUS_14640 gene rpsK 67142 67546 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963447.1 protein_id gnl|my_center|LOCUS_14640 67633 68238 gene locus_tag LOCUS_14650 gene rpsD 67633 68238 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963446.1 protein_id gnl|my_center|LOCUS_14650 68257 69249 gene locus_tag LOCUS_14660 68257 69249 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_14660 69311 69874 gene locus_tag LOCUS_14670 gene rplQ 69311 69874 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963444.1 protein_id gnl|my_center|LOCUS_14670 69969 71090 gene locus_tag LOCUS_14680 gene carA 69969 71090 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963443.1 protein_id gnl|my_center|LOCUS_14680 71210 72502 gene locus_tag LOCUS_14690 gene eno 71210 72502 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963441.1 protein_id gnl|my_center|LOCUS_14690 72635 74170 gene locus_tag LOCUS_14700 72635 74170 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925847.1 protein_id gnl|my_center|LOCUS_14700 74300 75586 gene locus_tag LOCUS_14710 74300 75586 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963440.1 protein_id gnl|my_center|LOCUS_14710 75704 76618 gene locus_tag LOCUS_14720 75704 76618 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 protein_id gnl|my_center|LOCUS_14720 76799 77683 gene locus_tag LOCUS_14730 76799 77683 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_14730 78944 77697 gene locus_tag LOCUS_14740 78944 77697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840093.1 protein_id gnl|my_center|LOCUS_14740 80250 78937 gene locus_tag LOCUS_14750 80250 78937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 80492 81490 gene locus_tag LOCUS_14760 80492 81490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 81491 81895 gene locus_tag LOCUS_14770 81491 81895 CDS product DUF4907 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107979.1 protein_id gnl|my_center|LOCUS_14770 82035 82934 gene locus_tag LOCUS_14780 82035 82934 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_14780 82937 83671 gene locus_tag LOCUS_14790 82937 83671 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107985.1 protein_id gnl|my_center|LOCUS_14790 84542 83787 gene locus_tag LOCUS_14800 84542 83787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 85226 84549 gene locus_tag LOCUS_14810 85226 84549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 85773 85204 gene locus_tag LOCUS_14820 85773 85204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 86585 85815 gene locus_tag LOCUS_14830 86585 85815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 87277 86726 gene locus_tag LOCUS_14840 87277 86726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 88426 87377 gene locus_tag LOCUS_14850 88426 87377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 88738 88460 gene locus_tag LOCUS_14860 88738 88460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 88989 89960 gene locus_tag LOCUS_14870 88989 89960 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_14870 89947 90636 gene locus_tag LOCUS_14880 89947 90636 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_14880 90928 90779 gene locus_tag LOCUS_14890 90928 90779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 92670 91180 gene locus_tag LOCUS_14900 gene opuD 92670 91180 CDS product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229220.1 protein_id gnl|my_center|LOCUS_14900 93588 92680 gene locus_tag LOCUS_14910 93588 92680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 95012 93585 gene locus_tag LOCUS_14920 95012 93585 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_14920 95453 95028 gene locus_tag LOCUS_14930 95453 95028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 95594 97378 gene locus_tag LOCUS_14940 gene argS 95594 97378 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963616.1 protein_id gnl|my_center|LOCUS_14940 97486 98259 gene locus_tag LOCUS_14950 97486 98259 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039642892.1 protein_id gnl|my_center|LOCUS_14950 99258 98269 gene locus_tag LOCUS_14960 99258 98269 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597675.1 protein_id gnl|my_center|LOCUS_14960 101864 99345 gene locus_tag LOCUS_14970 101864 99345 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_14970 102756 101845 gene locus_tag LOCUS_14980 102756 101845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 103410 102898 gene locus_tag LOCUS_14990 103410 102898 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992764.1 protein_id gnl|my_center|LOCUS_14990 103570 104889 gene locus_tag LOCUS_15000 103570 104889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 105063 106400 gene locus_tag LOCUS_15010 gene ffh 105063 106400 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963594.1 protein_id gnl|my_center|LOCUS_15010 106454 107338 gene locus_tag LOCUS_15020 106454 107338 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963593.1 protein_id gnl|my_center|LOCUS_15020 107490 108572 gene locus_tag LOCUS_15030 107490 108572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 108890 109969 gene locus_tag LOCUS_15040 108890 109969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 111385 111251 gene locus_tag LOCUS_15050 111385 111251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 111831 112589 gene locus_tag LOCUS_15060 111831 112589 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_15060 112649 114070 gene locus_tag LOCUS_15070 112649 114070 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 protein_id gnl|my_center|LOCUS_15070 114232 115203 gene locus_tag LOCUS_15080 114232 115203 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_15080 115701 115276 gene locus_tag LOCUS_15090 115701 115276 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 protein_id gnl|my_center|LOCUS_15090 116553 115714 gene locus_tag LOCUS_15100 116553 115714 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 protein_id gnl|my_center|LOCUS_15100 117532 116567 gene locus_tag LOCUS_15110 117532 116567 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 protein_id gnl|my_center|LOCUS_15110 118120 117572 gene locus_tag LOCUS_15120 118120 117572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 119674 118169 gene locus_tag LOCUS_15130 119674 118169 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_15130 119878 120510 gene locus_tag LOCUS_15140 119878 120510 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_15140 121458 120526 gene locus_tag LOCUS_15150 121458 120526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 122220 121513 gene locus_tag LOCUS_15160 122220 121513 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964288.1 protein_id gnl|my_center|LOCUS_15160 122296 122790 gene locus_tag LOCUS_15170 122296 122790 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_15170 122812 123294 gene locus_tag LOCUS_15180 122812 123294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 123350 124198 gene locus_tag LOCUS_15190 123350 124198 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_15190 125423 124206 gene locus_tag LOCUS_15200 125423 124206 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100706.1 protein_id gnl|my_center|LOCUS_15200 125472 126713 gene locus_tag LOCUS_15210 125472 126713 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_15210 126792 127772 gene locus_tag LOCUS_15220 126792 127772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 127831 128607 gene locus_tag LOCUS_15230 127831 128607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 128619 129251 gene locus_tag LOCUS_15240 128619 129251 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_15240 129346 129897 gene locus_tag LOCUS_15250 129346 129897 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020425.1 protein_id gnl|my_center|LOCUS_15250 129973 130833 gene locus_tag LOCUS_15260 129973 130833 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214567418.1 protein_id gnl|my_center|LOCUS_15260 130983 132122 gene locus_tag LOCUS_15270 130983 132122 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_15270 132199 133929 gene locus_tag LOCUS_15280 gene sulP 132199 133929 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_15280 134055 135464 gene locus_tag LOCUS_15290 134055 135464 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_15290 135976 135548 gene locus_tag LOCUS_15300 135976 135548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence011 1035 37 gene locus_tag LOCUS_15310 1035 37 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962232.1 protein_id gnl|my_center|LOCUS_15310 1824 1099 gene locus_tag LOCUS_15320 1824 1099 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962317.1 protein_id gnl|my_center|LOCUS_15320 2906 1821 gene locus_tag LOCUS_15330 2906 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384883.1 protein_id gnl|my_center|LOCUS_15330 4100 2967 gene locus_tag LOCUS_15340 4100 2967 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337358.1 protein_id gnl|my_center|LOCUS_15340 4405 7620 gene locus_tag LOCUS_15350 4405 7620 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763977.1 protein_id gnl|my_center|LOCUS_15350 7641 9452 gene locus_tag LOCUS_15360 7641 9452 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763976.1 protein_id gnl|my_center|LOCUS_15360 9746 10693 gene locus_tag LOCUS_15370 9746 10693 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246640.1 protein_id gnl|my_center|LOCUS_15370 11839 10703 gene locus_tag LOCUS_15380 11839 10703 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038509176.1 protein_id gnl|my_center|LOCUS_15380 12591 11836 gene locus_tag LOCUS_15390 12591 11836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 13478 12603 gene locus_tag LOCUS_15400 13478 12603 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246655.1 protein_id gnl|my_center|LOCUS_15400 13636 14637 gene locus_tag LOCUS_15410 13636 14637 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_15410 14727 15593 gene locus_tag LOCUS_15420 14727 15593 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_15420 15593 17257 gene locus_tag LOCUS_15430 15593 17257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962312.1 protein_id gnl|my_center|LOCUS_15430 17258 18256 gene locus_tag LOCUS_15440 17258 18256 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_15440 18317 19363 gene locus_tag LOCUS_15450 18317 19363 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_15450 19365 20219 gene locus_tag LOCUS_15460 19365 20219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 20261 22003 gene locus_tag LOCUS_15470 20261 22003 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099968.1 protein_id gnl|my_center|LOCUS_15470 22040 22798 gene locus_tag LOCUS_15480 22040 22798 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_15480 22930 23154 gene locus_tag LOCUS_15490 22930 23154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 23230 24822 gene locus_tag LOCUS_15500 23230 24822 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444186.1 protein_id gnl|my_center|LOCUS_15500 24828 25676 gene locus_tag LOCUS_15510 24828 25676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 25691 26317 gene locus_tag LOCUS_15520 25691 26317 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947903.1 protein_id gnl|my_center|LOCUS_15520 26416 27042 gene locus_tag LOCUS_15530 gene can 26416 27042 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964129.1 protein_id gnl|my_center|LOCUS_15530 27097 28977 gene locus_tag LOCUS_15540 27097 28977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 29055 30074 gene locus_tag LOCUS_15550 gene pheS 29055 30074 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962303.1 protein_id gnl|my_center|LOCUS_15550 30084 30335 gene locus_tag LOCUS_15560 30084 30335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 30720 31199 gene locus_tag LOCUS_15570 30720 31199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 31302 32387 gene locus_tag LOCUS_15580 31302 32387 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108070.1 protein_id gnl|my_center|LOCUS_15580 32425 35571 gene locus_tag LOCUS_15590 32425 35571 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783792.1 protein_id gnl|my_center|LOCUS_15590 35579 36982 gene locus_tag LOCUS_15600 35579 36982 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303116.1 protein_id gnl|my_center|LOCUS_15600 36998 37597 gene locus_tag LOCUS_15610 36998 37597 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_15610 38073 37594 gene locus_tag LOCUS_15620 38073 37594 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962372.1 protein_id gnl|my_center|LOCUS_15620 38740 38066 gene locus_tag LOCUS_15630 38740 38066 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042743.1 protein_id gnl|my_center|LOCUS_15630 38769 39869 gene locus_tag LOCUS_15640 gene dinB 38769 39869 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974700.1 protein_id gnl|my_center|LOCUS_15640 40091 40912 gene locus_tag LOCUS_15650 40091 40912 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268470.1 protein_id gnl|my_center|LOCUS_15650 41024 43462 gene locus_tag LOCUS_15660 41024 43462 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840170.1 protein_id gnl|my_center|LOCUS_15660 43931 43527 gene locus_tag LOCUS_15670 gene arfB 43931 43527 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_15670 44915 43935 gene locus_tag LOCUS_15680 44915 43935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963622.1 protein_id gnl|my_center|LOCUS_15680 47122 44993 gene locus_tag LOCUS_15690 47122 44993 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479228.1 protein_id gnl|my_center|LOCUS_15690 48209 47220 gene locus_tag LOCUS_15700 48209 47220 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_15700 48820 48416 gene locus_tag LOCUS_15710 gene mscL 48820 48416 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399960.1 protein_id gnl|my_center|LOCUS_15710 50025 48916 gene locus_tag LOCUS_15720 50025 48916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 50662 50009 gene locus_tag LOCUS_15730 50662 50009 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963208.1 protein_id gnl|my_center|LOCUS_15730 50833 51543 gene locus_tag LOCUS_15740 50833 51543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963207.1 protein_id gnl|my_center|LOCUS_15740 51661 52017 gene locus_tag LOCUS_15750 51661 52017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 52023 52694 gene locus_tag LOCUS_15760 gene rsmI 52023 52694 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963206.1 protein_id gnl|my_center|LOCUS_15760 52700 53044 gene locus_tag LOCUS_15770 52700 53044 CDS product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 protein_id gnl|my_center|LOCUS_15770 53051 53626 gene locus_tag LOCUS_15780 53051 53626 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529221.1 protein_id gnl|my_center|LOCUS_15780 53787 54215 gene locus_tag LOCUS_15790 53787 54215 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546540.1 protein_id gnl|my_center|LOCUS_15790 54322 56010 gene locus_tag LOCUS_15800 gene recJ 54322 56010 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_15800 56007 56393 gene locus_tag LOCUS_15810 56007 56393 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112904553.1 protein_id gnl|my_center|LOCUS_15810 56726 57985 gene locus_tag LOCUS_15820 gene nreB 56726 57985 CDS product nickel resistance MFS transporter NreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 protein_id gnl|my_center|LOCUS_15820 58748 57975 gene locus_tag LOCUS_15830 58748 57975 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_15830 59270 58788 gene locus_tag LOCUS_15840 59270 58788 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_15840 59328 59969 gene locus_tag LOCUS_15850 59328 59969 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025312.1 protein_id gnl|my_center|LOCUS_15850 60916 60149 gene locus_tag LOCUS_15860 60916 60149 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_15860 62290 60956 gene locus_tag LOCUS_15870 62290 60956 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_15870 62801 62301 gene locus_tag LOCUS_15880 62801 62301 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964325.1 protein_id gnl|my_center|LOCUS_15880 62853 63653 gene locus_tag LOCUS_15890 62853 63653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 63729 63803 gene locus_tag LOCUS_t00130 63729 63803 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 64614 69656 gene locus_tag LOCUS_15900 64614 69656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 69707 70534 gene locus_tag LOCUS_15910 69707 70534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 70547 75127 gene locus_tag LOCUS_15920 70547 75127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 75845 76114 gene locus_tag LOCUS_15930 75845 76114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 77640 79904 gene locus_tag LOCUS_15940 77640 79904 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201930.1 protein_id gnl|my_center|LOCUS_15940 79964 80854 gene locus_tag LOCUS_15950 79964 80854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 80861 82198 gene locus_tag LOCUS_15960 80861 82198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 83553 82351 gene locus_tag LOCUS_15970 83553 82351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 85078 83807 gene locus_tag LOCUS_15980 85078 83807 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_15980 86803 85538 gene locus_tag LOCUS_15990 86803 85538 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890996.1 protein_id gnl|my_center|LOCUS_15990 88259 86814 gene locus_tag LOCUS_16000 88259 86814 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130286390.1 protein_id gnl|my_center|LOCUS_16000 89528 88260 gene locus_tag LOCUS_16010 89528 88260 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893249.1 protein_id gnl|my_center|LOCUS_16010 90583 89528 gene locus_tag LOCUS_16020 90583 89528 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018757434.1 protein_id gnl|my_center|LOCUS_16020 92984 90657 gene locus_tag LOCUS_16030 92984 90657 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044346855.1 protein_id gnl|my_center|LOCUS_16030 93135 94370 gene locus_tag LOCUS_16040 93135 94370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 94604 95815 gene locus_tag LOCUS_16050 94604 95815 CDS product DUF5690 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918537.1 protein_id gnl|my_center|LOCUS_16050 95812 96972 gene locus_tag LOCUS_16060 95812 96972 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921907.1 protein_id gnl|my_center|LOCUS_16060 96974 97651 gene locus_tag LOCUS_16070 96974 97651 CDS product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921908.1 protein_id gnl|my_center|LOCUS_16070 98306 97740 gene locus_tag LOCUS_16080 98306 97740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 98579 101797 gene locus_tag LOCUS_16090 98579 101797 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_16090 101829 103274 gene locus_tag LOCUS_16100 101829 103274 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_16100 103353 104999 gene locus_tag LOCUS_16110 103353 104999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 105000 106271 gene locus_tag LOCUS_16120 105000 106271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 106258 107625 gene locus_tag LOCUS_16130 106258 107625 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481438.1 protein_id gnl|my_center|LOCUS_16130 107628 109223 gene locus_tag LOCUS_16140 107628 109223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 109220 110305 gene locus_tag LOCUS_16150 109220 110305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 110684 111568 gene locus_tag LOCUS_16160 110684 111568 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_16160 111569 112582 gene locus_tag LOCUS_16170 111569 112582 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480521.1 protein_id gnl|my_center|LOCUS_16170 112583 113998 gene locus_tag LOCUS_16180 112583 113998 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_16180 115530 114235 gene locus_tag LOCUS_16190 115530 114235 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_16190 115994 115536 gene locus_tag LOCUS_16200 115994 115536 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577041.1 protein_id gnl|my_center|LOCUS_16200 116976 115996 gene locus_tag LOCUS_16210 116976 115996 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_16210 118386 116989 gene locus_tag LOCUS_16220 gene uxaC 118386 116989 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_16220 118696 119406 gene locus_tag LOCUS_16230 118696 119406 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_16230 122183 119427 gene locus_tag LOCUS_16240 122183 119427 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_16240 122676 123031 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccgtcaccgtcagcatcaggacaacc 124911 123718 gene locus_tag LOCUS_16250 gene kbl 124911 123718 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962334.1 protein_id gnl|my_center|LOCUS_16250 128023 124916 gene locus_tag LOCUS_16260 128023 124916 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962336.1 protein_id gnl|my_center|LOCUS_16260 128143 128751 gene locus_tag LOCUS_16270 128143 128751 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_16270 >Feature sequence012 1792 680 gene locus_tag LOCUS_16280 1792 680 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963995.1 protein_id gnl|my_center|LOCUS_16280 2388 1843 gene locus_tag LOCUS_16290 gene gldI 2388 1843 CDS product gliding motility-associated peptidyl-prolyl isomerase GldI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963996.1 protein_id gnl|my_center|LOCUS_16290 3401 2385 gene locus_tag LOCUS_16300 3401 2385 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_16300 3570 4529 gene locus_tag LOCUS_16310 3570 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 4602 4997 gene locus_tag LOCUS_16320 4602 4997 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963530.1 protein_id gnl|my_center|LOCUS_16320 5351 5055 gene locus_tag LOCUS_16330 5351 5055 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_16330 5769 5353 gene locus_tag LOCUS_16340 5769 5353 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963536.1 protein_id gnl|my_center|LOCUS_16340 6867 5788 gene locus_tag LOCUS_16350 gene recF 6867 5788 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_16350 6982 7749 gene locus_tag LOCUS_16360 6982 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_16360 7749 8231 gene locus_tag LOCUS_16370 gene ribH 7749 8231 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964104.1 protein_id gnl|my_center|LOCUS_16370 8438 8737 gene locus_tag LOCUS_16380 8438 8737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 8737 10587 gene locus_tag LOCUS_16390 gene mutL 8737 10587 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_16390 10588 11331 gene locus_tag LOCUS_16400 10588 11331 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_16400 11333 12199 gene locus_tag LOCUS_16410 11333 12199 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963287.1 protein_id gnl|my_center|LOCUS_16410 12203 13225 gene locus_tag LOCUS_16420 12203 13225 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_16420 13528 13208 gene locus_tag LOCUS_16430 13528 13208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 14150 13521 gene locus_tag LOCUS_16440 14150 13521 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963263.1 protein_id gnl|my_center|LOCUS_16440 14953 14177 gene locus_tag LOCUS_16450 14953 14177 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084806.1 protein_id gnl|my_center|LOCUS_16450 16010 14937 gene locus_tag LOCUS_16460 gene moeB 16010 14937 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058235.1 protein_id gnl|my_center|LOCUS_16460 16603 16007 gene locus_tag LOCUS_16470 16603 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16470 17060 16587 gene locus_tag LOCUS_16480 gene moaC 17060 16587 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036201.1 protein_id gnl|my_center|LOCUS_16480 17964 17065 gene locus_tag LOCUS_16490 gene moaA 17964 17065 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101426.1 protein_id gnl|my_center|LOCUS_16490 18534 18124 gene locus_tag LOCUS_16500 18534 18124 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722669.1 protein_id gnl|my_center|LOCUS_16500 18786 18544 gene locus_tag LOCUS_16510 gene moaD 18786 18544 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880693.1 protein_id gnl|my_center|LOCUS_16510 19629 18835 gene locus_tag LOCUS_16520 19629 18835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840057.1 protein_id gnl|my_center|LOCUS_16520 19692 20504 gene locus_tag LOCUS_16530 19692 20504 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_16530 20559 21785 gene locus_tag LOCUS_16540 20559 21785 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_16540 21889 24093 gene locus_tag LOCUS_16550 21889 24093 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_16550 24149 24604 gene locus_tag LOCUS_16560 24149 24604 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_16560 24617 25888 gene locus_tag LOCUS_16570 24617 25888 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964006.1 protein_id gnl|my_center|LOCUS_16570 25943 27793 gene locus_tag LOCUS_16580 25943 27793 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 protein_id gnl|my_center|LOCUS_16580 27790 28971 gene locus_tag LOCUS_16590 27790 28971 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_16590 29069 30469 gene locus_tag LOCUS_16600 29069 30469 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 protein_id gnl|my_center|LOCUS_16600 30585 31499 gene locus_tag LOCUS_16610 30585 31499 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_16610 31512 32540 gene locus_tag LOCUS_16620 31512 32540 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_16620 32571 33311 gene locus_tag LOCUS_16630 32571 33311 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_16630 33499 35649 gene locus_tag LOCUS_16640 33499 35649 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963876.1 protein_id gnl|my_center|LOCUS_16640 35827 37254 gene locus_tag LOCUS_16650 35827 37254 CDS product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119388.1 protein_id gnl|my_center|LOCUS_16650 37284 37865 gene locus_tag LOCUS_16660 37284 37865 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_16660 38014 38682 gene locus_tag LOCUS_16670 38014 38682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 38777 40189 gene locus_tag LOCUS_16680 38777 40189 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120624.1 protein_id gnl|my_center|LOCUS_16680 41673 40267 gene locus_tag LOCUS_16690 41673 40267 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_16690 42908 41670 gene locus_tag LOCUS_16700 42908 41670 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_16700 44687 43026 gene locus_tag LOCUS_16710 44687 43026 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_16710 45366 44680 gene locus_tag LOCUS_16720 45366 44680 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_16720 45939 47711 gene locus_tag LOCUS_16730 45939 47711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 47930 48460 gene locus_tag LOCUS_16740 47930 48460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 48751 49650 gene locus_tag LOCUS_16750 48751 49650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 50351 52060 gene locus_tag LOCUS_16760 50351 52060 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_16760 52319 53935 gene locus_tag LOCUS_16770 52319 53935 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_16770 55023 54022 gene locus_tag LOCUS_16780 55023 54022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 56099 55362 gene locus_tag LOCUS_16790 56099 55362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 58060 56099 gene locus_tag LOCUS_16800 58060 56099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 58278 58802 gene locus_tag LOCUS_16810 58278 58802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 58843 59364 gene locus_tag LOCUS_16820 58843 59364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 59435 59869 gene locus_tag LOCUS_16830 59435 59869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 60505 60098 gene locus_tag LOCUS_16840 60505 60098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 61304 60498 gene locus_tag LOCUS_16850 61304 60498 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941673.1 protein_id gnl|my_center|LOCUS_16850 62643 61309 gene locus_tag LOCUS_16860 gene fabB 62643 61309 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382947.1 protein_id gnl|my_center|LOCUS_16860 62950 62690 gene locus_tag LOCUS_16870 62950 62690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 63520 62963 gene locus_tag LOCUS_16880 63520 62963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 64193 63507 gene locus_tag LOCUS_16890 64193 63507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 64965 64231 gene locus_tag LOCUS_16900 gene fabG 64965 64231 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881113.1 protein_id gnl|my_center|LOCUS_16900 65735 64983 gene locus_tag LOCUS_16910 65735 64983 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 protein_id gnl|my_center|LOCUS_16910 66224 67816 gene locus_tag LOCUS_16920 66224 67816 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026811032.1 protein_id gnl|my_center|LOCUS_16920 67960 68721 gene locus_tag LOCUS_16930 67960 68721 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_16930 68736 69650 gene locus_tag LOCUS_16940 68736 69650 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_16940 69730 70293 gene locus_tag LOCUS_16950 69730 70293 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764900.1 protein_id gnl|my_center|LOCUS_16950 70362 70688 gene locus_tag LOCUS_16960 70362 70688 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764901.1 protein_id gnl|my_center|LOCUS_16960 70755 71627 gene locus_tag LOCUS_16970 70755 71627 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941331.1 protein_id gnl|my_center|LOCUS_16970 72751 71645 gene locus_tag LOCUS_16980 gene thiH 72751 71645 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_16980 73532 72762 gene locus_tag LOCUS_16990 73532 72762 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962601.1 protein_id gnl|my_center|LOCUS_16990 74188 73535 gene locus_tag LOCUS_17000 74188 73535 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962600.1 protein_id gnl|my_center|LOCUS_17000 74784 74185 gene locus_tag LOCUS_17010 74784 74185 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761321.1 protein_id gnl|my_center|LOCUS_17010 76795 74936 gene locus_tag LOCUS_17020 gene thiC 76795 74936 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962597.1 protein_id gnl|my_center|LOCUS_17020 77100 76897 gene locus_tag LOCUS_17030 77100 76897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 79380 77443 gene locus_tag LOCUS_17040 79380 77443 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_17040 80331 79399 gene locus_tag LOCUS_17050 80331 79399 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_17050 80957 81757 gene locus_tag LOCUS_17060 gene thiD 80957 81757 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765649.1 protein_id gnl|my_center|LOCUS_17060 81809 82111 gene locus_tag LOCUS_17070 81809 82111 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226731.1 protein_id gnl|my_center|LOCUS_17070 82157 82426 gene locus_tag LOCUS_17080 82157 82426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 82438 83040 gene locus_tag LOCUS_17090 82438 83040 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183259.1 protein_id gnl|my_center|LOCUS_17090 83204 83938 gene locus_tag LOCUS_17100 83204 83938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 83960 85471 gene locus_tag LOCUS_17110 83960 85471 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922831.1 protein_id gnl|my_center|LOCUS_17110 85491 86882 gene locus_tag LOCUS_17120 85491 86882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 86925 88607 gene locus_tag LOCUS_17130 86925 88607 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921847.1 protein_id gnl|my_center|LOCUS_17130 91167 89164 gene locus_tag LOCUS_17140 91167 89164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 93030 91189 gene locus_tag LOCUS_17150 93030 91189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 96245 93111 gene locus_tag LOCUS_17160 96245 93111 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_17160 96977 101158 gene locus_tag LOCUS_17170 96977 101158 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_17170 101438 102844 gene locus_tag LOCUS_17180 101438 102844 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_17180 104612 103056 gene locus_tag LOCUS_17190 104612 103056 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922831.1 protein_id gnl|my_center|LOCUS_17190 104977 107451 gene locus_tag LOCUS_17200 gene galB 104977 107451 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_17200 107457 108860 gene locus_tag LOCUS_17210 107457 108860 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109132.1 protein_id gnl|my_center|LOCUS_17210 108895 110250 gene locus_tag LOCUS_17220 108895 110250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 110255 111823 gene locus_tag LOCUS_17230 110255 111823 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804122.1 protein_id gnl|my_center|LOCUS_17230 111941 113491 gene locus_tag LOCUS_17240 111941 113491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 113504 114769 gene locus_tag LOCUS_17250 113504 114769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 114800 117421 gene locus_tag LOCUS_17260 114800 117421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 117476 118738 gene locus_tag LOCUS_17270 117476 118738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 118753 119925 gene locus_tag LOCUS_17280 118753 119925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922607.1 protein_id gnl|my_center|LOCUS_17280 119976 120965 gene locus_tag LOCUS_17290 119976 120965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence013 504 37 gene locus_tag LOCUS_17300 504 37 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530093.1 protein_id gnl|my_center|LOCUS_17300 1337 498 gene locus_tag LOCUS_17310 1337 498 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073321.1 protein_id gnl|my_center|LOCUS_17310 2056 1475 gene locus_tag LOCUS_17320 2056 1475 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_17320 2848 2192 gene locus_tag LOCUS_17330 2848 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 3455 3039 gene locus_tag LOCUS_17340 3455 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 3736 4146 gene locus_tag LOCUS_17350 3736 4146 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_17350 4326 4589 gene locus_tag LOCUS_17360 4326 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 4597 5220 gene locus_tag LOCUS_17370 4597 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 5293 6195 gene locus_tag LOCUS_17380 gene cysD 5293 6195 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002735002.1 protein_id gnl|my_center|LOCUS_17380 6275 7522 gene locus_tag LOCUS_17390 6275 7522 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_17390 7644 9734 gene locus_tag LOCUS_17400 7644 9734 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_17400 9737 10531 gene locus_tag LOCUS_17410 gene cobA 9737 10531 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_17410 10555 11664 gene locus_tag LOCUS_17420 10555 11664 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963782.1 protein_id gnl|my_center|LOCUS_17420 12053 13063 gene locus_tag LOCUS_17430 12053 13063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 13065 13346 gene locus_tag LOCUS_17440 13065 13346 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234413.1 protein_id gnl|my_center|LOCUS_17440 13347 16052 gene locus_tag LOCUS_17450 13347 16052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 16045 16296 gene locus_tag LOCUS_17460 16045 16296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112513.1 protein_id gnl|my_center|LOCUS_17460 16441 17394 gene locus_tag LOCUS_17470 gene metF 16441 17394 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766920.1 protein_id gnl|my_center|LOCUS_17470 17498 18562 gene locus_tag LOCUS_17480 17498 18562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 18576 19394 gene locus_tag LOCUS_17490 18576 19394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 19480 20736 gene locus_tag LOCUS_17500 19480 20736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 20847 21314 gene locus_tag LOCUS_17510 20847 21314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 22271 21375 gene locus_tag LOCUS_17520 gene gldA 22271 21375 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_17520 22713 23540 gene locus_tag LOCUS_17530 22713 23540 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_17530 23537 24682 gene locus_tag LOCUS_17540 23537 24682 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962425.1 protein_id gnl|my_center|LOCUS_17540 24706 25566 gene locus_tag LOCUS_17550 24706 25566 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_17550 25566 26648 gene locus_tag LOCUS_17560 25566 26648 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_17560 27153 26710 gene locus_tag LOCUS_17570 27153 26710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 27317 28291 gene locus_tag LOCUS_17580 gene rsgA 27317 28291 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962423.1 protein_id gnl|my_center|LOCUS_17580 28330 28782 gene locus_tag LOCUS_17590 gene dtd 28330 28782 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962422.1 protein_id gnl|my_center|LOCUS_17590 28863 30773 gene locus_tag LOCUS_17600 28863 30773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 30847 32865 gene locus_tag LOCUS_17610 30847 32865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 32831 33157 gene locus_tag LOCUS_17620 32831 33157 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_17620 33297 34490 gene locus_tag LOCUS_17630 33297 34490 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962416.1 protein_id gnl|my_center|LOCUS_17630 34662 35711 gene locus_tag LOCUS_17640 gene queA 34662 35711 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_17640 35799 36839 gene locus_tag LOCUS_17650 gene rlmN 35799 36839 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964179.1 protein_id gnl|my_center|LOCUS_17650 37063 37998 gene locus_tag LOCUS_17660 37063 37998 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_17660 38673 38110 gene locus_tag LOCUS_17670 38673 38110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 39201 38776 gene locus_tag LOCUS_17680 39201 38776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253510.1 protein_id gnl|my_center|LOCUS_17680 39413 40684 gene locus_tag LOCUS_17690 39413 40684 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 protein_id gnl|my_center|LOCUS_17690 40703 42724 gene locus_tag LOCUS_17700 gene dnaG 40703 42724 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964171.1 protein_id gnl|my_center|LOCUS_17700 43451 42822 gene locus_tag LOCUS_17710 43451 42822 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964170.1 protein_id gnl|my_center|LOCUS_17710 44407 43619 gene locus_tag LOCUS_17720 gene nadE 44407 43619 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964169.1 protein_id gnl|my_center|LOCUS_17720 44479 45462 gene locus_tag LOCUS_17730 gene gldB 44479 45462 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_17730 45464 45796 gene locus_tag LOCUS_17740 gene gldC 45464 45796 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_17740 46518 45805 gene locus_tag LOCUS_17750 46518 45805 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766240.1 protein_id gnl|my_center|LOCUS_17750 48151 46538 gene locus_tag LOCUS_17760 48151 46538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118540.1 protein_id gnl|my_center|LOCUS_17760 48942 48178 gene locus_tag LOCUS_17770 gene bla2 48942 48178 CDS product BcII family subclass B1 metallo-beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799227.1 protein_id gnl|my_center|LOCUS_17770 48968 49348 gene locus_tag LOCUS_17780 48968 49348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 49962 49345 gene locus_tag LOCUS_17790 gene yihA 49962 49345 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964166.1 protein_id gnl|my_center|LOCUS_17790 50765 50001 gene locus_tag LOCUS_17800 50765 50001 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_17800 51173 51493 gene locus_tag LOCUS_17810 51173 51493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 51483 52376 gene locus_tag LOCUS_17820 gene rsmH 51483 52376 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172605046.1 protein_id gnl|my_center|LOCUS_17820 52415 52741 gene locus_tag LOCUS_17830 52415 52741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 52741 54747 gene locus_tag LOCUS_17840 52741 54747 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_17840 54744 56207 gene locus_tag LOCUS_17850 54744 56207 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964160.1 protein_id gnl|my_center|LOCUS_17850 56245 57465 gene locus_tag LOCUS_17860 gene mraY 56245 57465 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_17860 57467 58801 gene locus_tag LOCUS_17870 gene murD 57467 58801 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964158.1 protein_id gnl|my_center|LOCUS_17870 58815 60014 gene locus_tag LOCUS_17880 58815 60014 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_17880 60001 61104 gene locus_tag LOCUS_17890 gene murG 60001 61104 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964156.1 protein_id gnl|my_center|LOCUS_17890 61125 62477 gene locus_tag LOCUS_17900 gene murC 61125 62477 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964155.1 protein_id gnl|my_center|LOCUS_17900 62467 63186 gene locus_tag LOCUS_17910 62467 63186 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964154.1 protein_id gnl|my_center|LOCUS_17910 63190 64530 gene locus_tag LOCUS_17920 gene ftsA 63190 64530 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_17920 64566 66536 gene locus_tag LOCUS_17930 gene ftsZ 64566 66536 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964152.1 protein_id gnl|my_center|LOCUS_17930 66635 67081 gene locus_tag LOCUS_17940 66635 67081 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_17940 67086 67160 gene locus_tag LOCUS_t00140 67086 67160 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 68254 67295 gene locus_tag LOCUS_17950 68254 67295 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767537.1 protein_id gnl|my_center|LOCUS_17950 68528 69706 gene locus_tag LOCUS_17960 68528 69706 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112330.1 protein_id gnl|my_center|LOCUS_17960 69913 70185 gene locus_tag LOCUS_17970 69913 70185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 70313 74650 gene locus_tag LOCUS_17980 70313 74650 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_17980 74700 75854 gene locus_tag LOCUS_17990 74700 75854 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_17990 75999 77999 gene locus_tag LOCUS_18000 75999 77999 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962595.1 protein_id gnl|my_center|LOCUS_18000 78134 80515 gene locus_tag LOCUS_18010 78134 80515 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_18010 80536 81045 gene locus_tag LOCUS_18020 80536 81045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 81690 81046 gene locus_tag LOCUS_18030 81690 81046 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_18030 83596 81680 gene locus_tag LOCUS_18040 83596 81680 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202190.1 protein_id gnl|my_center|LOCUS_18040 84173 83679 gene locus_tag LOCUS_18050 84173 83679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 85253 84273 gene locus_tag LOCUS_18060 85253 84273 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_18060 85912 85232 gene locus_tag LOCUS_18070 gene rpe 85912 85232 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964149.1 protein_id gnl|my_center|LOCUS_18070 87030 86011 gene locus_tag LOCUS_18080 87030 86011 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206182.1 protein_id gnl|my_center|LOCUS_18080 87614 87162 gene locus_tag LOCUS_18090 gene trmL 87614 87162 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356826.1 protein_id gnl|my_center|LOCUS_18090 87862 87623 gene locus_tag LOCUS_18100 87862 87623 CDS product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076091.1 protein_id gnl|my_center|LOCUS_18100 88950 88087 gene locus_tag LOCUS_18110 88950 88087 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_18110 91345 89114 gene locus_tag LOCUS_18120 91345 89114 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964146.1 protein_id gnl|my_center|LOCUS_18120 91806 91537 gene locus_tag LOCUS_18130 gene rpsO 91806 91537 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964145.1 protein_id gnl|my_center|LOCUS_18130 92397 91912 gene locus_tag LOCUS_18140 92397 91912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 93278 92394 gene locus_tag LOCUS_18150 gene accD 93278 92394 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962493.1 protein_id gnl|my_center|LOCUS_18150 94368 93301 gene locus_tag LOCUS_18160 gene fbaA 94368 93301 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_18160 97186 94574 gene locus_tag LOCUS_18170 97186 94574 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962495.1 protein_id gnl|my_center|LOCUS_18170 97371 98093 gene locus_tag LOCUS_18180 97371 98093 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_18180 98819 98100 gene locus_tag LOCUS_18190 98819 98100 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_18190 99626 98898 gene locus_tag LOCUS_18200 gene ubiE 99626 98898 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024980308.1 protein_id gnl|my_center|LOCUS_18200 99840 101189 gene locus_tag LOCUS_18210 gene trkA 99840 101189 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_18210 101189 102679 gene locus_tag LOCUS_18220 101189 102679 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658690.1 protein_id gnl|my_center|LOCUS_18220 103043 105196 gene locus_tag LOCUS_18230 103043 105196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 106483 105275 gene locus_tag LOCUS_18240 106483 105275 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962581.1 protein_id gnl|my_center|LOCUS_18240 106955 106575 gene locus_tag LOCUS_18250 106955 106575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 >Feature sequence014 1010 1555 gene locus_tag LOCUS_18260 1010 1555 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810105.1 protein_id gnl|my_center|LOCUS_18260 3273 1621 gene locus_tag LOCUS_18270 3273 1621 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921866.1 protein_id gnl|my_center|LOCUS_18270 3619 7449 gene locus_tag LOCUS_18280 3619 7449 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108846.1 protein_id gnl|my_center|LOCUS_18280 7776 8624 gene locus_tag LOCUS_18290 7776 8624 CDS product peptidylglycine monooxygenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663621.1 protein_id gnl|my_center|LOCUS_18290 8628 10931 gene locus_tag LOCUS_18300 8628 10931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 10948 12402 gene locus_tag LOCUS_18310 10948 12402 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_18310 12527 14512 gene locus_tag LOCUS_18320 12527 14512 CDS product chitobiase/beta-hexosaminidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222583402.1 protein_id gnl|my_center|LOCUS_18320 15546 14509 gene locus_tag LOCUS_18330 15546 14509 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963682.1 protein_id gnl|my_center|LOCUS_18330 15879 17363 gene locus_tag LOCUS_18340 15879 17363 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_18340 17365 18690 gene locus_tag LOCUS_18350 gene xylA 17365 18690 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_18350 18696 19352 gene locus_tag LOCUS_18360 gene fsa 18696 19352 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963193.1 protein_id gnl|my_center|LOCUS_18360 19504 19983 gene locus_tag LOCUS_18370 19504 19983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 20136 24275 gene locus_tag LOCUS_18380 20136 24275 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_18380 24394 24816 gene locus_tag LOCUS_18390 24394 24816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 24749 25294 gene locus_tag LOCUS_18400 24749 25294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 25341 25724 gene locus_tag LOCUS_18410 25341 25724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 27143 26274 gene locus_tag LOCUS_18420 27143 26274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 27279 27626 gene locus_tag LOCUS_18430 27279 27626 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435954.1 protein_id gnl|my_center|LOCUS_18430 27782 28531 gene locus_tag LOCUS_18440 27782 28531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 29464 28589 gene locus_tag LOCUS_18450 29464 28589 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_18450 29605 30300 gene locus_tag LOCUS_18460 29605 30300 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218129451.1 protein_id gnl|my_center|LOCUS_18460 30346 31506 gene locus_tag LOCUS_18470 30346 31506 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_18470 31526 32413 gene locus_tag LOCUS_18480 31526 32413 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492432.1 protein_id gnl|my_center|LOCUS_18480 32426 33214 gene locus_tag LOCUS_18490 32426 33214 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527760.1 protein_id gnl|my_center|LOCUS_18490 33311 33871 gene locus_tag LOCUS_18500 33311 33871 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764449.1 protein_id gnl|my_center|LOCUS_18500 33998 34477 gene locus_tag LOCUS_18510 33998 34477 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038076.1 protein_id gnl|my_center|LOCUS_18510 34762 35901 gene locus_tag LOCUS_18520 34762 35901 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275490.1 protein_id gnl|my_center|LOCUS_18520 35907 37364 gene locus_tag LOCUS_18530 35907 37364 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039190.1 protein_id gnl|my_center|LOCUS_18530 37393 38415 gene locus_tag LOCUS_18540 37393 38415 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_18540 41767 38441 gene locus_tag LOCUS_18550 41767 38441 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_18550 43375 41888 gene locus_tag LOCUS_18560 43375 41888 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_18560 45656 43386 gene locus_tag LOCUS_18570 45656 43386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18570 46417 45710 gene locus_tag LOCUS_18580 46417 45710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18580 48169 46925 gene locus_tag LOCUS_18590 48169 46925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 48667 50007 gene locus_tag LOCUS_18600 48667 50007 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_18600 50151 51293 gene locus_tag LOCUS_18610 50151 51293 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_18610 51306 52433 gene locus_tag LOCUS_18620 gene galK 51306 52433 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_18620 53189 52488 gene locus_tag LOCUS_18630 53189 52488 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963957.1 protein_id gnl|my_center|LOCUS_18630 53452 54297 gene locus_tag LOCUS_18640 53452 54297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 55009 54311 gene locus_tag LOCUS_18650 55009 54311 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963957.1 protein_id gnl|my_center|LOCUS_18650 55266 56231 gene locus_tag LOCUS_18660 gene trxB 55266 56231 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_18660 56749 56300 gene locus_tag LOCUS_18670 56749 56300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 57274 56828 gene locus_tag LOCUS_18680 57274 56828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 57464 57649 gene locus_tag LOCUS_18690 57464 57649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 58710 57667 gene locus_tag LOCUS_18700 58710 57667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 59720 58710 gene locus_tag LOCUS_18710 59720 58710 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922169.1 protein_id gnl|my_center|LOCUS_18710 60689 59883 gene locus_tag LOCUS_18720 60689 59883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 62575 60734 gene locus_tag LOCUS_18730 62575 60734 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_18730 63038 62637 gene locus_tag LOCUS_18740 63038 62637 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_18740 63634 63182 gene locus_tag LOCUS_18750 63634 63182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 64113 63634 gene locus_tag LOCUS_18760 64113 63634 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962834.1 protein_id gnl|my_center|LOCUS_18760 64331 64702 gene locus_tag LOCUS_18770 64331 64702 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_18770 64778 65575 gene locus_tag LOCUS_18780 64778 65575 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147838.1 protein_id gnl|my_center|LOCUS_18780 65617 66273 gene locus_tag LOCUS_18790 65617 66273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 66370 66789 gene locus_tag LOCUS_18800 66370 66789 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_18800 66852 67436 gene locus_tag LOCUS_18810 gene nudK 66852 67436 CDS product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037689.1 protein_id gnl|my_center|LOCUS_18810 68733 67465 gene locus_tag LOCUS_18820 68733 67465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 68887 69084 gene locus_tag LOCUS_18830 68887 69084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 70116 69178 gene locus_tag LOCUS_18840 70116 69178 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_18840 70110 70703 gene locus_tag LOCUS_18850 70110 70703 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_18850 71129 70740 gene locus_tag LOCUS_18860 71129 70740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 71319 72302 gene locus_tag LOCUS_18870 71319 72302 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_18870 72913 72308 gene locus_tag LOCUS_18880 gene paiB 72913 72308 CDS product protease synthase/sporulation negative transcriptional regulator PaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244329.1 protein_id gnl|my_center|LOCUS_18880 73055 73888 gene locus_tag LOCUS_18890 73055 73888 CDS product bromoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074319.1 protein_id gnl|my_center|LOCUS_18890 74797 73964 gene locus_tag LOCUS_18900 74797 73964 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_18900 76290 74995 gene locus_tag LOCUS_18910 76290 74995 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_18910 77902 76349 gene locus_tag LOCUS_18920 77902 76349 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_18920 80367 77986 gene locus_tag LOCUS_18930 gene metE 80367 77986 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216166.1 protein_id gnl|my_center|LOCUS_18930 80434 80931 gene locus_tag LOCUS_18940 80434 80931 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_18940 81060 82403 gene locus_tag LOCUS_18950 81060 82403 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963763.1 protein_id gnl|my_center|LOCUS_18950 82553 82846 gene locus_tag LOCUS_18960 82553 82846 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963761.1 protein_id gnl|my_center|LOCUS_18960 82887 83222 gene locus_tag LOCUS_18970 82887 83222 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438991.1 protein_id gnl|my_center|LOCUS_18970 83256 84011 gene locus_tag LOCUS_18980 83256 84011 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_18980 85278 84091 gene locus_tag LOCUS_18990 85278 84091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 85573 86253 gene locus_tag LOCUS_19000 85573 86253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 86279 87082 gene locus_tag LOCUS_19010 86279 87082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 87252 88460 gene locus_tag LOCUS_19020 87252 88460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 91139 88965 gene locus_tag LOCUS_19030 91139 88965 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_19030 91351 92403 gene locus_tag LOCUS_19040 91351 92403 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107637.1 protein_id gnl|my_center|LOCUS_19040 93126 92413 gene locus_tag LOCUS_19050 93126 92413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 93300 94064 gene locus_tag LOCUS_19060 93300 94064 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933083.1 protein_id gnl|my_center|LOCUS_19060 94076 95122 gene locus_tag LOCUS_19070 94076 95122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 96016 95213 gene locus_tag LOCUS_19080 96016 95213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 96555 96007 gene locus_tag LOCUS_19090 96555 96007 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027261.1 protein_id gnl|my_center|LOCUS_19090 97241 96630 gene locus_tag LOCUS_19100 97241 96630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 98079 97441 gene locus_tag LOCUS_19110 98079 97441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 99430 98210 gene locus_tag LOCUS_19120 99430 98210 CDS product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826550.1 protein_id gnl|my_center|LOCUS_19120 100164 99469 gene locus_tag LOCUS_19130 100164 99469 CDS product DUF2490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964078.1 protein_id gnl|my_center|LOCUS_19130 101454 100435 gene locus_tag LOCUS_19140 101454 100435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 protein_id gnl|my_center|LOCUS_19140 102478 101429 gene locus_tag LOCUS_19150 102478 101429 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_19150 103353 102553 gene locus_tag LOCUS_19160 103353 102553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962739.1 protein_id gnl|my_center|LOCUS_19160 103938 103561 gene locus_tag LOCUS_19170 103938 103561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 104636 104043 gene locus_tag LOCUS_19180 104636 104043 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence015 <1 1071 gene locus_tag LOCUS_19190 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021039.1:alkene reductase 1108 2499 gene locus_tag LOCUS_19200 1108 2499 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958071.1 protein_id gnl|my_center|LOCUS_19200 2740 3465 gene locus_tag LOCUS_19210 2740 3465 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964451.1 protein_id gnl|my_center|LOCUS_19210 3629 3991 gene locus_tag LOCUS_19220 3629 3991 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461673.1 protein_id gnl|my_center|LOCUS_19220 3992 4939 gene locus_tag LOCUS_19230 3992 4939 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387478.1 protein_id gnl|my_center|LOCUS_19230 4979 5533 gene locus_tag LOCUS_19240 4979 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937679.1 protein_id gnl|my_center|LOCUS_19240 5530 6735 gene locus_tag LOCUS_19250 5530 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 6753 8072 gene locus_tag LOCUS_19260 6753 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 9553 8198 gene locus_tag LOCUS_19270 9553 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 9894 11360 gene locus_tag LOCUS_19280 9894 11360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 11659 12990 gene locus_tag LOCUS_19290 11659 12990 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_19290 12996 14216 gene locus_tag LOCUS_19300 12996 14216 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794794.1 protein_id gnl|my_center|LOCUS_19300 14219 14962 gene locus_tag LOCUS_19310 14219 14962 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786909.1 protein_id gnl|my_center|LOCUS_19310 14965 16185 gene locus_tag LOCUS_19320 14965 16185 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_19320 16255 17226 gene locus_tag LOCUS_19330 16255 17226 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_19330 17227 17961 gene locus_tag LOCUS_19340 17227 17961 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_19340 18102 18608 gene locus_tag LOCUS_19350 gene greB 18102 18608 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_19350 18776 19225 gene locus_tag LOCUS_19360 18776 19225 CDS product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964067.1 protein_id gnl|my_center|LOCUS_19360 19348 20679 gene locus_tag LOCUS_19370 19348 20679 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963093.1 protein_id gnl|my_center|LOCUS_19370 20685 21998 gene locus_tag LOCUS_19380 20685 21998 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817866.1 protein_id gnl|my_center|LOCUS_19380 22267 22458 gene locus_tag LOCUS_19390 22267 22458 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_19390 22830 23417 gene locus_tag LOCUS_19400 22830 23417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 23656 25206 gene locus_tag LOCUS_19410 23656 25206 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983276.1 protein_id gnl|my_center|LOCUS_19410 25830 25219 gene locus_tag LOCUS_19420 25830 25219 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962826.1 protein_id gnl|my_center|LOCUS_19420 26245 27066 gene locus_tag LOCUS_19430 26245 27066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 27071 27292 gene locus_tag LOCUS_19440 27071 27292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 28250 27351 gene locus_tag LOCUS_19450 28250 27351 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658736.1 protein_id gnl|my_center|LOCUS_19450 28474 29688 gene locus_tag LOCUS_19460 28474 29688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 29829 31409 gene locus_tag LOCUS_19470 29829 31409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 31406 33094 gene locus_tag LOCUS_19480 31406 33094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261758.1 protein_id gnl|my_center|LOCUS_19480 34006 33314 gene locus_tag LOCUS_19490 34006 33314 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_19490 34404 35369 gene locus_tag LOCUS_19500 34404 35369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 35394 36080 gene locus_tag LOCUS_19510 35394 36080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 37021 36161 gene locus_tag LOCUS_19520 37021 36161 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_19520 37289 39247 gene locus_tag LOCUS_19530 37289 39247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 39461 39619 gene locus_tag LOCUS_19540 39461 39619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 39643 39963 gene locus_tag LOCUS_19550 39643 39963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 40610 40050 gene locus_tag LOCUS_19560 40610 40050 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964064.1 protein_id gnl|my_center|LOCUS_19560 40774 40944 gene locus_tag LOCUS_19570 40774 40944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 41034 41453 gene locus_tag LOCUS_19580 41034 41453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 41465 41536 gene locus_tag LOCUS_t00150 41465 41536 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 43016 41886 gene locus_tag LOCUS_19590 43016 41886 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_19590 43593 43075 gene locus_tag LOCUS_19600 43593 43075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19600 43990 43628 gene locus_tag LOCUS_19610 43990 43628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19610 44179 44904 gene locus_tag LOCUS_19620 44179 44904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 44952 46067 gene locus_tag LOCUS_19630 44952 46067 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859695.1 protein_id gnl|my_center|LOCUS_19630 46040 46552 gene locus_tag LOCUS_19640 46040 46552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 46563 47333 gene locus_tag LOCUS_19650 46563 47333 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477521.1 protein_id gnl|my_center|LOCUS_19650 47347 47811 gene locus_tag LOCUS_19660 47347 47811 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020469.1 protein_id gnl|my_center|LOCUS_19660 49208 47868 gene locus_tag LOCUS_19670 49208 47868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 50646 49210 gene locus_tag LOCUS_19680 50646 49210 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038799.1 protein_id gnl|my_center|LOCUS_19680 53156 50649 gene locus_tag LOCUS_19690 53156 50649 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530098.1 protein_id gnl|my_center|LOCUS_19690 53851 53162 gene locus_tag LOCUS_19700 53851 53162 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_19700 56442 54784 gene locus_tag LOCUS_19710 56442 54784 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669835.1 protein_id gnl|my_center|LOCUS_19710 57967 56666 gene locus_tag LOCUS_19720 57967 56666 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017139.1 protein_id gnl|my_center|LOCUS_19720 58851 58474 gene locus_tag LOCUS_19730 58851 58474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 60998 59253 gene locus_tag LOCUS_19740 60998 59253 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030693.1 protein_id gnl|my_center|LOCUS_19740 61781 61047 gene locus_tag LOCUS_19750 61781 61047 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 protein_id gnl|my_center|LOCUS_19750 62212 61796 gene locus_tag LOCUS_19760 62212 61796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 62774 64117 gene locus_tag LOCUS_19770 62774 64117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 64171 64806 gene locus_tag LOCUS_19780 64171 64806 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_19780 65098 65709 gene locus_tag LOCUS_19790 65098 65709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 65955 66914 gene locus_tag LOCUS_19800 65955 66914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 67023 67622 gene locus_tag LOCUS_19810 67023 67622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963138.1 protein_id gnl|my_center|LOCUS_19810 67746 68318 gene locus_tag LOCUS_19820 67746 68318 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108257.1 protein_id gnl|my_center|LOCUS_19820 68437 68919 gene locus_tag LOCUS_19830 68437 68919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 68951 70048 gene locus_tag LOCUS_19840 68951 70048 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072052.1 protein_id gnl|my_center|LOCUS_19840 70182 71120 gene locus_tag LOCUS_19850 70182 71120 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 protein_id gnl|my_center|LOCUS_19850 71146 72354 gene locus_tag LOCUS_19860 71146 72354 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973720.1 protein_id gnl|my_center|LOCUS_19860 72367 73305 gene locus_tag LOCUS_19870 72367 73305 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_19870 73364 74323 gene locus_tag LOCUS_19880 73364 74323 CDS product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973721.1 protein_id gnl|my_center|LOCUS_19880 74715 75206 gene locus_tag LOCUS_19890 74715 75206 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107186.1 protein_id gnl|my_center|LOCUS_19890 75190 75846 gene locus_tag LOCUS_19900 75190 75846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 75960 76406 gene locus_tag LOCUS_19910 75960 76406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 77187 77849 gene locus_tag LOCUS_19920 77187 77849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 78123 78362 gene locus_tag LOCUS_19930 78123 78362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 78878 79447 gene locus_tag LOCUS_19940 78878 79447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 80422 79451 gene locus_tag LOCUS_19950 80422 79451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 81231 82439 gene locus_tag LOCUS_19960 81231 82439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 82693 83124 gene locus_tag LOCUS_19970 82693 83124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 84071 83736 gene locus_tag LOCUS_19980 84071 83736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 84531 84190 gene locus_tag LOCUS_19990 84531 84190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 85299 84976 gene locus_tag LOCUS_20000 85299 84976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 85451 85966 gene locus_tag LOCUS_20010 85451 85966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 86107 87072 gene locus_tag LOCUS_20020 86107 87072 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962707.1 protein_id gnl|my_center|LOCUS_20020 87526 87083 gene locus_tag LOCUS_20030 87526 87083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 87782 87528 gene locus_tag LOCUS_20040 87782 87528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 89107 87833 gene locus_tag LOCUS_20050 89107 87833 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770365.1 protein_id gnl|my_center|LOCUS_20050 89552 89100 gene locus_tag LOCUS_20060 gene fabZ 89552 89100 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670104.1 protein_id gnl|my_center|LOCUS_20060 90345 89566 gene locus_tag LOCUS_20070 90345 89566 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_20070 91422 90367 gene locus_tag LOCUS_20080 91422 90367 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_20080 92143 91439 gene locus_tag LOCUS_20090 92143 91439 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804100.1 protein_id gnl|my_center|LOCUS_20090 93267 92143 gene locus_tag LOCUS_20100 93267 92143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 94049 93354 gene locus_tag LOCUS_20110 94049 93354 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963625.1 protein_id gnl|my_center|LOCUS_20110 94543 94061 gene locus_tag LOCUS_20120 94543 94061 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963626.1 protein_id gnl|my_center|LOCUS_20120 96663 94687 gene locus_tag LOCUS_20130 96663 94687 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_20130 96795 97745 gene locus_tag LOCUS_20140 96795 97745 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_20140 97748 98077 gene locus_tag LOCUS_20150 97748 98077 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963176.1 protein_id gnl|my_center|LOCUS_20150 98197 99129 gene locus_tag LOCUS_20160 98197 99129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 99134 100006 gene locus_tag LOCUS_20170 99134 100006 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence016 5567 2247 gene locus_tag LOCUS_20180 5567 2247 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_20180 8452 5621 gene locus_tag LOCUS_20190 8452 5621 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_20190 9190 8465 gene locus_tag LOCUS_20200 9190 8465 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921342.1 protein_id gnl|my_center|LOCUS_20200 10587 9187 gene locus_tag LOCUS_20210 10587 9187 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109239.1 protein_id gnl|my_center|LOCUS_20210 12219 10624 gene locus_tag LOCUS_20220 12219 10624 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_20220 13804 12281 gene locus_tag LOCUS_20230 13804 12281 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107897.1 protein_id gnl|my_center|LOCUS_20230 15725 13971 gene locus_tag LOCUS_20240 15725 13971 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801846.1 protein_id gnl|my_center|LOCUS_20240 19050 15751 gene locus_tag LOCUS_20250 19050 15751 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108905.1 protein_id gnl|my_center|LOCUS_20250 19451 20332 gene locus_tag LOCUS_20260 19451 20332 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801276.1 protein_id gnl|my_center|LOCUS_20260 20572 23661 gene locus_tag LOCUS_20270 20572 23661 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_20270 23679 25268 gene locus_tag LOCUS_20280 23679 25268 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681494.1 protein_id gnl|my_center|LOCUS_20280 25372 28932 gene locus_tag LOCUS_20290 25372 28932 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_20290 28992 31838 gene locus_tag LOCUS_20300 28992 31838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 31862 33379 gene locus_tag LOCUS_20310 31862 33379 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123415.1 protein_id gnl|my_center|LOCUS_20310 33410 34294 gene locus_tag LOCUS_20320 33410 34294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 34307 35701 gene locus_tag LOCUS_20330 34307 35701 CDS product ribonuclease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141613167.1 protein_id gnl|my_center|LOCUS_20330 35767 37119 gene locus_tag LOCUS_20340 35767 37119 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029645128.1 protein_id gnl|my_center|LOCUS_20340 38651 37416 gene locus_tag LOCUS_20350 38651 37416 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_20350 38988 38914 gene locus_tag LOCUS_t00160 38988 38914 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 39969 39055 gene locus_tag LOCUS_20360 39969 39055 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103676442.1 protein_id gnl|my_center|LOCUS_20360 40688 39984 gene locus_tag LOCUS_20370 40688 39984 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963735.1 protein_id gnl|my_center|LOCUS_20370 42661 40796 gene locus_tag LOCUS_20380 42661 40796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 42876 44633 gene locus_tag LOCUS_20390 42876 44633 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671072.1 protein_id gnl|my_center|LOCUS_20390 45583 44756 gene locus_tag LOCUS_20400 45583 44756 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_20400 46374 45655 gene locus_tag LOCUS_20410 46374 45655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 48095 46377 gene locus_tag LOCUS_20420 48095 46377 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_20420 50265 48193 gene locus_tag LOCUS_20430 50265 48193 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_20430 51762 50374 gene locus_tag LOCUS_20440 51762 50374 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_20440 51942 53255 gene locus_tag LOCUS_20450 51942 53255 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_20450 53464 54576 gene locus_tag LOCUS_20460 gene gmd 53464 54576 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167740.1 protein_id gnl|my_center|LOCUS_20460 54578 55663 gene locus_tag LOCUS_20470 54578 55663 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763415.1 protein_id gnl|my_center|LOCUS_20470 56902 55751 gene locus_tag LOCUS_20480 56902 55751 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_20480 57754 56942 gene locus_tag LOCUS_20490 57754 56942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 58648 57842 gene locus_tag LOCUS_20500 58648 57842 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402925.1 protein_id gnl|my_center|LOCUS_20500 59701 58673 gene locus_tag LOCUS_20510 59701 58673 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_20510 61005 59794 gene locus_tag LOCUS_20520 61005 59794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_20520 62093 61023 gene locus_tag LOCUS_20530 62093 61023 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787054.1 protein_id gnl|my_center|LOCUS_20530 64816 62129 gene locus_tag LOCUS_20540 64816 62129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 65362 66246 gene locus_tag LOCUS_20550 65362 66246 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762608.1 protein_id gnl|my_center|LOCUS_20550 66435 67700 gene locus_tag LOCUS_20560 66435 67700 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392414.1 protein_id gnl|my_center|LOCUS_20560 67780 68856 gene locus_tag LOCUS_20570 gene rhaT 67780 68856 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767241.1 protein_id gnl|my_center|LOCUS_20570 68891 70057 gene locus_tag LOCUS_20580 68891 70057 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_20580 70032 71474 gene locus_tag LOCUS_20590 70032 71474 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531228.1 protein_id gnl|my_center|LOCUS_20590 71480 72433 gene locus_tag LOCUS_20600 71480 72433 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094784.1 protein_id gnl|my_center|LOCUS_20600 72423 73070 gene locus_tag LOCUS_20610 gene eda 72423 73070 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_20610 73099 75174 gene locus_tag LOCUS_20620 73099 75174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 75348 76997 gene locus_tag LOCUS_20630 75348 76997 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189567672.1 protein_id gnl|my_center|LOCUS_20630 77247 79328 gene locus_tag LOCUS_20640 77247 79328 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120386.1 protein_id gnl|my_center|LOCUS_20640 79368 80942 gene locus_tag LOCUS_20650 79368 80942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 81012 82982 gene locus_tag LOCUS_20660 81012 82982 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120386.1 protein_id gnl|my_center|LOCUS_20660 83302 84729 gene locus_tag LOCUS_20670 83302 84729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 86370 84802 gene locus_tag LOCUS_20680 gene rny 86370 84802 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963284.1 protein_id gnl|my_center|LOCUS_20680 86955 86659 gene locus_tag LOCUS_20690 86955 86659 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963283.1 protein_id gnl|my_center|LOCUS_20690 87261 86971 gene locus_tag LOCUS_20700 87261 86971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963282.1 protein_id gnl|my_center|LOCUS_20700 87455 89146 gene locus_tag LOCUS_20710 87455 89146 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_20710 89154 91622 gene locus_tag LOCUS_20720 89154 91622 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_20720 91634 92287 gene locus_tag LOCUS_20730 91634 92287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 93465 92317 gene locus_tag LOCUS_20740 93465 92317 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_20740 93568 94581 gene locus_tag LOCUS_20750 93568 94581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 95180 94578 gene locus_tag LOCUS_20760 95180 94578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963034.1 protein_id gnl|my_center|LOCUS_20760 95501 95830 gene locus_tag LOCUS_20770 95501 95830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 95835 96143 gene locus_tag LOCUS_20780 95835 96143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 97443 96199 gene locus_tag LOCUS_20790 gene rocD 97443 96199 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_20790 97799 99208 gene locus_tag LOCUS_20800 gene rlmD 97799 99208 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962893.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence017 165 2990 gene locus_tag LOCUS_20810 165 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2987 3700 gene locus_tag LOCUS_20820 2987 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162987949.1 protein_id gnl|my_center|LOCUS_20820 4943 3774 gene locus_tag LOCUS_20830 4943 3774 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_20830 8367 4981 gene locus_tag LOCUS_20840 8367 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 9716 8442 gene locus_tag LOCUS_20850 9716 8442 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962432.1 protein_id gnl|my_center|LOCUS_20850 11286 10030 gene locus_tag LOCUS_20860 gene metK 11286 10030 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962442.1 protein_id gnl|my_center|LOCUS_20860 14196 11551 gene locus_tag LOCUS_20870 14196 11551 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_20870 14871 14281 gene locus_tag LOCUS_20880 14871 14281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20880 15136 14861 gene locus_tag LOCUS_20890 15136 14861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 15333 15947 gene locus_tag LOCUS_20900 15333 15947 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_20900 16961 15954 gene locus_tag LOCUS_20910 16961 15954 CDS product DUF2183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119948.1 protein_id gnl|my_center|LOCUS_20910 17231 17854 gene locus_tag LOCUS_20920 17231 17854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 20283 17908 gene locus_tag LOCUS_20930 20283 17908 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_20930 20919 20392 gene locus_tag LOCUS_20940 20919 20392 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962510.1 protein_id gnl|my_center|LOCUS_20940 23589 21127 gene locus_tag LOCUS_20950 23589 21127 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 protein_id gnl|my_center|LOCUS_20950 24822 23845 gene locus_tag LOCUS_20960 24822 23845 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_20960 24996 25736 gene locus_tag LOCUS_20970 24996 25736 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_20970 25845 26813 gene locus_tag LOCUS_20980 25845 26813 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_20980 26899 27528 gene locus_tag LOCUS_20990 26899 27528 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_20990 27547 28995 gene locus_tag LOCUS_21000 27547 28995 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_21000 29103 29927 gene locus_tag LOCUS_21010 29103 29927 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962504.1 protein_id gnl|my_center|LOCUS_21010 30002 31162 gene locus_tag LOCUS_21020 gene egtB 30002 31162 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339021.1 protein_id gnl|my_center|LOCUS_21020 31213 32184 gene locus_tag LOCUS_21030 gene egtD 31213 32184 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967207.1 protein_id gnl|my_center|LOCUS_21030 32241 32522 gene locus_tag LOCUS_21040 32241 32522 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_21040 32942 32643 gene locus_tag LOCUS_21050 32942 32643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 34200 33112 gene locus_tag LOCUS_21060 34200 33112 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980220.1 protein_id gnl|my_center|LOCUS_21060 34259 34648 gene locus_tag LOCUS_21070 34259 34648 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962500.1 protein_id gnl|my_center|LOCUS_21070 34645 35142 gene locus_tag LOCUS_21080 34645 35142 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962499.1 protein_id gnl|my_center|LOCUS_21080 35919 35131 gene locus_tag LOCUS_21090 gene murI 35919 35131 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964198.1 protein_id gnl|my_center|LOCUS_21090 37592 35931 gene locus_tag LOCUS_21100 37592 35931 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_21100 37741 38445 gene locus_tag LOCUS_21110 37741 38445 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_21110 38442 39209 gene locus_tag LOCUS_21120 38442 39209 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_21120 40703 39222 gene locus_tag LOCUS_21130 40703 39222 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762895.1 protein_id gnl|my_center|LOCUS_21130 41795 40713 gene locus_tag LOCUS_21140 41795 40713 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963509.1 protein_id gnl|my_center|LOCUS_21140 42502 41891 gene locus_tag LOCUS_21150 42502 41891 CDS product SprT-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_21150 43299 42619 gene locus_tag LOCUS_21160 43299 42619 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_21160 44348 43299 gene locus_tag LOCUS_21170 44348 43299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 46079 44436 gene locus_tag LOCUS_21180 46079 44436 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963512.1 protein_id gnl|my_center|LOCUS_21180 47083 46088 gene locus_tag LOCUS_21190 gene pdhA 47083 46088 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963513.1 protein_id gnl|my_center|LOCUS_21190 47723 47241 gene locus_tag LOCUS_21200 gene cdd 47723 47241 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_21200 48951 47800 gene locus_tag LOCUS_21210 gene porV 48951 47800 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_21210 49415 51085 gene locus_tag LOCUS_21220 gene gldJ 49415 51085 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_21220 51126 52433 gene locus_tag LOCUS_21230 51126 52433 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963518.1 protein_id gnl|my_center|LOCUS_21230 53318 52494 gene locus_tag LOCUS_21240 53318 52494 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087830.1 protein_id gnl|my_center|LOCUS_21240 53528 53337 gene locus_tag LOCUS_21250 53528 53337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 54073 53528 gene locus_tag LOCUS_21260 54073 53528 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084757677.1 protein_id gnl|my_center|LOCUS_21260 54577 54365 gene locus_tag LOCUS_21270 54577 54365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 55139 55064 gene locus_tag LOCUS_t00170 55139 55064 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 55573 56943 gene locus_tag LOCUS_21280 55573 56943 CDS product ribonuclease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141613167.1 protein_id gnl|my_center|LOCUS_21280 57391 57314 gene locus_tag LOCUS_t00180 57391 57314 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 58661 57450 gene locus_tag LOCUS_21290 58661 57450 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_21290 59599 58658 gene locus_tag LOCUS_21300 59599 58658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 59985 59599 gene locus_tag LOCUS_21310 59985 59599 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760840.1 protein_id gnl|my_center|LOCUS_21310 60688 59996 gene locus_tag LOCUS_21320 60688 59996 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_21320 62107 60740 gene locus_tag LOCUS_21330 gene nhaD 62107 60740 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_21330 63351 62119 gene locus_tag LOCUS_21340 63351 62119 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_21340 63529 64767 gene locus_tag LOCUS_21350 63529 64767 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_21350 65082 69590 gene locus_tag LOCUS_21360 gene gltB 65082 69590 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964980.1 protein_id gnl|my_center|LOCUS_21360 69600 71066 gene locus_tag LOCUS_21370 69600 71066 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480842.1 protein_id gnl|my_center|LOCUS_21370 71180 72034 gene locus_tag LOCUS_21380 71180 72034 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385500.1 protein_id gnl|my_center|LOCUS_21380 73406 72063 gene locus_tag LOCUS_21390 73406 72063 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_21390 75044 73644 gene locus_tag LOCUS_21400 75044 73644 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120094.1 protein_id gnl|my_center|LOCUS_21400 76755 75304 gene locus_tag LOCUS_21410 76755 75304 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_21410 80181 76774 gene locus_tag LOCUS_21420 80181 76774 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098195218.1 protein_id gnl|my_center|LOCUS_21420 81492 80356 gene locus_tag LOCUS_21430 81492 80356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 81677 82216 gene locus_tag LOCUS_21440 81677 82216 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_21440 83372 82251 gene locus_tag LOCUS_21450 83372 82251 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_21450 84239 83394 gene locus_tag LOCUS_21460 84239 83394 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967715.1 protein_id gnl|my_center|LOCUS_21460 85327 84446 gene locus_tag LOCUS_21470 85327 84446 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194105476.1 protein_id gnl|my_center|LOCUS_21470 85695 88829 gene locus_tag LOCUS_21480 85695 88829 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663427.1 protein_id gnl|my_center|LOCUS_21480 89525 92545 gene locus_tag LOCUS_21490 89525 92545 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_21490 92566 94074 gene locus_tag LOCUS_21500 92566 94074 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_21500 >Feature sequence018 571 56 gene locus_tag LOCUS_21510 571 56 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964088.1 protein_id gnl|my_center|LOCUS_21510 1482 577 gene locus_tag LOCUS_21520 1482 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 1955 4810 gene locus_tag LOCUS_21530 gene carB 1955 4810 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964089.1 protein_id gnl|my_center|LOCUS_21530 8171 4899 gene locus_tag LOCUS_21540 8171 4899 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_21540 10109 8484 gene locus_tag LOCUS_21550 10109 8484 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980180.1 protein_id gnl|my_center|LOCUS_21550 10551 10201 gene locus_tag LOCUS_21560 10551 10201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 12794 10566 gene locus_tag LOCUS_21570 12794 10566 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_21570 13497 12940 gene locus_tag LOCUS_21580 13497 12940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 14959 13547 gene locus_tag LOCUS_21590 gene gndA 14959 13547 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413557.1 protein_id gnl|my_center|LOCUS_21590 15132 16664 gene locus_tag LOCUS_21600 gene zwf 15132 16664 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694154.1 protein_id gnl|my_center|LOCUS_21600 16719 17444 gene locus_tag LOCUS_21610 gene pgl 16719 17444 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464630.1 protein_id gnl|my_center|LOCUS_21610 17970 17425 gene locus_tag LOCUS_21620 17970 17425 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_21620 18338 17970 gene locus_tag LOCUS_21630 18338 17970 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964092.1 protein_id gnl|my_center|LOCUS_21630 19678 18335 gene locus_tag LOCUS_21640 19678 18335 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_21640 20433 19744 gene locus_tag LOCUS_21650 20433 19744 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964096.1 protein_id gnl|my_center|LOCUS_21650 21412 20537 gene locus_tag LOCUS_21660 21412 20537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 22578 21547 gene locus_tag LOCUS_21670 22578 21547 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963582.1 protein_id gnl|my_center|LOCUS_21670 23859 22579 gene locus_tag LOCUS_21680 23859 22579 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963581.1 protein_id gnl|my_center|LOCUS_21680 23945 24415 gene locus_tag LOCUS_21690 23945 24415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 24795 26669 gene locus_tag LOCUS_21700 gene btuB 24795 26669 CDS product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591381.1 protein_id gnl|my_center|LOCUS_21700 26701 27606 gene locus_tag LOCUS_21710 26701 27606 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_21710 28178 27717 gene locus_tag LOCUS_21720 28178 27717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 31706 28191 gene locus_tag LOCUS_21730 31706 28191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 33596 32109 gene locus_tag LOCUS_21740 33596 32109 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108185.1 protein_id gnl|my_center|LOCUS_21740 35190 33679 gene locus_tag LOCUS_21750 35190 33679 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 protein_id gnl|my_center|LOCUS_21750 35427 35936 gene locus_tag LOCUS_21760 35427 35936 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_21760 35923 36372 gene locus_tag LOCUS_21770 35923 36372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963572.1 protein_id gnl|my_center|LOCUS_21770 36383 36928 gene locus_tag LOCUS_21780 36383 36928 CDS product DUF4252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963571.1 protein_id gnl|my_center|LOCUS_21780 36985 37530 gene locus_tag LOCUS_21790 36985 37530 CDS product DUF4252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963571.1 protein_id gnl|my_center|LOCUS_21790 37605 38120 gene locus_tag LOCUS_21800 37605 38120 CDS product DUF4252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963570.1 protein_id gnl|my_center|LOCUS_21800 38264 39079 gene locus_tag LOCUS_21810 gene mscS 38264 39079 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 protein_id gnl|my_center|LOCUS_21810 40505 39162 gene locus_tag LOCUS_21820 gene purB 40505 39162 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963912.1 protein_id gnl|my_center|LOCUS_21820 41197 40625 gene locus_tag LOCUS_21830 41197 40625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963491.1 protein_id gnl|my_center|LOCUS_21830 41907 41215 gene locus_tag LOCUS_21840 41907 41215 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_21840 41943 42614 gene locus_tag LOCUS_21850 41943 42614 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963914.1 protein_id gnl|my_center|LOCUS_21850 42715 43242 gene locus_tag LOCUS_21860 42715 43242 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045629.1 protein_id gnl|my_center|LOCUS_21860 45007 43292 gene locus_tag LOCUS_21870 45007 43292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 45846 45058 gene locus_tag LOCUS_21880 45846 45058 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963924.1 protein_id gnl|my_center|LOCUS_21880 47738 45936 gene locus_tag LOCUS_21890 47738 45936 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 protein_id gnl|my_center|LOCUS_21890 48448 47879 gene locus_tag LOCUS_21900 48448 47879 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963926.1 protein_id gnl|my_center|LOCUS_21900 48534 48986 gene locus_tag LOCUS_21910 48534 48986 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462646.1 protein_id gnl|my_center|LOCUS_21910 49070 49678 gene locus_tag LOCUS_21920 49070 49678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 49679 50377 gene locus_tag LOCUS_21930 49679 50377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 50364 51164 gene locus_tag LOCUS_21940 50364 51164 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971721.1 protein_id gnl|my_center|LOCUS_21940 51333 53225 gene locus_tag LOCUS_21950 51333 53225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 53766 53293 gene locus_tag LOCUS_21960 gene rlmH 53766 53293 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963965.1 protein_id gnl|my_center|LOCUS_21960 53897 54754 gene locus_tag LOCUS_21970 gene nadC 53897 54754 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963961.1 protein_id gnl|my_center|LOCUS_21970 54755 55723 gene locus_tag LOCUS_21980 54755 55723 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_21980 55720 56160 gene locus_tag LOCUS_21990 55720 56160 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179084.1 protein_id gnl|my_center|LOCUS_21990 56176 58632 gene locus_tag LOCUS_22000 gene priA 56176 58632 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963958.1 protein_id gnl|my_center|LOCUS_22000 59392 58700 gene locus_tag LOCUS_22010 59392 58700 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963957.1 protein_id gnl|my_center|LOCUS_22010 59622 59960 gene locus_tag LOCUS_22020 gene rpsF 59622 59960 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963956.1 protein_id gnl|my_center|LOCUS_22020 60020 60262 gene locus_tag LOCUS_22030 gene rpsR 60020 60262 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963955.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22030 60276 60728 gene locus_tag LOCUS_22040 gene rplI 60276 60728 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963954.1 protein_id gnl|my_center|LOCUS_22040 60831 63968 gene locus_tag LOCUS_22050 60831 63968 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_22050 64031 64504 gene locus_tag LOCUS_22060 64031 64504 CDS product DUF6495 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963953.1 protein_id gnl|my_center|LOCUS_22060 64621 65997 gene locus_tag LOCUS_22070 gene hisS 64621 65997 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964121.1 protein_id gnl|my_center|LOCUS_22070 66540 65992 gene locus_tag LOCUS_22080 66540 65992 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141357.1 protein_id gnl|my_center|LOCUS_22080 67674 66586 gene locus_tag LOCUS_22090 67674 66586 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_22090 67768 68460 gene locus_tag LOCUS_22100 67768 68460 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963216.1 protein_id gnl|my_center|LOCUS_22100 68709 68464 gene locus_tag LOCUS_22110 68709 68464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 69559 68744 gene locus_tag LOCUS_22120 69559 68744 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 protein_id gnl|my_center|LOCUS_22120 72005 69606 gene locus_tag LOCUS_22130 72005 69606 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_22130 74347 72128 gene locus_tag LOCUS_22140 74347 72128 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225341.1 protein_id gnl|my_center|LOCUS_22140 75402 75052 gene locus_tag LOCUS_22150 gene rplS 75402 75052 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963978.1 protein_id gnl|my_center|LOCUS_22150 76216 75542 gene locus_tag LOCUS_22160 gene trmD 76216 75542 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963979.1 protein_id gnl|my_center|LOCUS_22160 76671 76228 gene locus_tag LOCUS_22170 76671 76228 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223856.1 protein_id gnl|my_center|LOCUS_22170 77334 76714 gene locus_tag LOCUS_22180 77334 76714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 78930 77482 gene locus_tag LOCUS_22190 78930 77482 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963349.1 protein_id gnl|my_center|LOCUS_22190 80436 79045 gene locus_tag LOCUS_22200 80436 79045 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_22200 80624 81400 gene locus_tag LOCUS_22210 gene dapF 80624 81400 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963347.1 protein_id gnl|my_center|LOCUS_22210 81394 81918 gene locus_tag LOCUS_22220 81394 81918 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_22220 81918 82961 gene locus_tag LOCUS_22230 gene mltG 81918 82961 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_22230 83108 83737 gene locus_tag LOCUS_22240 83108 83737 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963343.1 protein_id gnl|my_center|LOCUS_22240 84383 85696 gene locus_tag LOCUS_22250 84383 85696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 86394 86206 gene locus_tag LOCUS_22260 86394 86206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 86635 86802 gene locus_tag LOCUS_22270 86635 86802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 86808 87020 gene locus_tag LOCUS_22280 86808 87020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence019 19 822 gene locus_tag LOCUS_22290 19 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2258 840 gene locus_tag LOCUS_22300 2258 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921337.1 protein_id gnl|my_center|LOCUS_22300 3422 2274 gene locus_tag LOCUS_22310 3422 2274 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220815.1 protein_id gnl|my_center|LOCUS_22310 4805 3432 gene locus_tag LOCUS_22320 4805 3432 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974440.1 protein_id gnl|my_center|LOCUS_22320 6096 4816 gene locus_tag LOCUS_22330 gene rhaI 6096 4816 CDS product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973080.1 protein_id gnl|my_center|LOCUS_22330 8280 6175 gene locus_tag LOCUS_22340 8280 6175 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973081.1 protein_id gnl|my_center|LOCUS_22340 8457 9503 gene locus_tag LOCUS_22350 8457 9503 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_22350 10430 9519 gene locus_tag LOCUS_22360 10430 9519 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_22360 10850 12406 gene locus_tag LOCUS_22370 10850 12406 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785070.1 protein_id gnl|my_center|LOCUS_22370 12917 16012 gene locus_tag LOCUS_22380 12917 16012 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_22380 16026 17567 gene locus_tag LOCUS_22390 16026 17567 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_22390 17803 18618 gene locus_tag LOCUS_22400 17803 18618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 18650 19225 gene locus_tag LOCUS_22410 18650 19225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 19395 22916 gene locus_tag LOCUS_22420 19395 22916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 23107 24444 gene locus_tag LOCUS_22430 23107 24444 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_22430 25998 24535 gene locus_tag LOCUS_22440 25998 24535 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263817.1 protein_id gnl|my_center|LOCUS_22440 27654 26167 gene locus_tag LOCUS_22450 27654 26167 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_22450 31094 27720 gene locus_tag LOCUS_22460 31094 27720 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_22460 32384 31251 gene locus_tag LOCUS_22470 32384 31251 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_22470 33066 32506 gene locus_tag LOCUS_22480 33066 32506 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_22480 35977 33215 gene locus_tag LOCUS_22490 35977 33215 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671005.1 protein_id gnl|my_center|LOCUS_22490 36586 38226 gene locus_tag LOCUS_22500 36586 38226 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767323.1 protein_id gnl|my_center|LOCUS_22500 38388 42560 gene locus_tag LOCUS_22510 38388 42560 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_22510 44481 42691 gene locus_tag LOCUS_22520 44481 42691 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760460.1 protein_id gnl|my_center|LOCUS_22520 47757 44509 gene locus_tag LOCUS_22530 47757 44509 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461656.1 protein_id gnl|my_center|LOCUS_22530 47842 48039 gene locus_tag LOCUS_22540 47842 48039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 48527 49678 gene locus_tag LOCUS_22550 48527 49678 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107138.1 protein_id gnl|my_center|LOCUS_22550 49838 50674 gene locus_tag LOCUS_22560 49838 50674 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_22560 50680 52158 gene locus_tag LOCUS_22570 50680 52158 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120117.1 protein_id gnl|my_center|LOCUS_22570 52211 54202 gene locus_tag LOCUS_22580 52211 54202 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766740.1 protein_id gnl|my_center|LOCUS_22580 54220 55740 gene locus_tag LOCUS_22590 54220 55740 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_22590 55815 58604 gene locus_tag LOCUS_22600 55815 58604 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107129.1 protein_id gnl|my_center|LOCUS_22600 58620 60992 gene locus_tag LOCUS_22610 58620 60992 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203206.1 protein_id gnl|my_center|LOCUS_22610 61051 62994 gene locus_tag LOCUS_22620 61051 62994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 63334 65607 gene locus_tag LOCUS_22630 63334 65607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 65600 67279 gene locus_tag LOCUS_22640 65600 67279 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669835.1 protein_id gnl|my_center|LOCUS_22640 67281 68006 gene locus_tag LOCUS_22650 67281 68006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 68013 69845 gene locus_tag LOCUS_22660 68013 69845 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117792.1 protein_id gnl|my_center|LOCUS_22660 69944 70702 gene locus_tag LOCUS_22670 69944 70702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 70710 71927 gene locus_tag LOCUS_22680 70710 71927 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201856.1 protein_id gnl|my_center|LOCUS_22680 71934 73247 gene locus_tag LOCUS_22690 71934 73247 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_22690 73267 74097 gene locus_tag LOCUS_22700 gene kduI 73267 74097 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098576.1 protein_id gnl|my_center|LOCUS_22700 74127 74894 gene locus_tag LOCUS_22710 gene kduD 74127 74894 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_22710 74971 76413 gene locus_tag LOCUS_22720 74971 76413 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922522.1 protein_id gnl|my_center|LOCUS_22720 76501 78090 gene locus_tag LOCUS_22730 76501 78090 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203728.1 protein_id gnl|my_center|LOCUS_22730 78293 79162 gene locus_tag LOCUS_22740 78293 79162 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193211.1 protein_id gnl|my_center|LOCUS_22740 79424 80764 gene locus_tag LOCUS_22750 79424 80764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 80911 82620 gene locus_tag LOCUS_22760 80911 82620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 82711 84306 gene locus_tag LOCUS_22770 82711 84306 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666312.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence020 434 12 gene locus_tag LOCUS_22780 434 12 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962635.1 protein_id gnl|my_center|LOCUS_22780 583 1617 gene locus_tag LOCUS_22790 583 1617 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337473.1 protein_id gnl|my_center|LOCUS_22790 1614 3281 gene locus_tag LOCUS_22800 1614 3281 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_22800 3289 5757 gene locus_tag LOCUS_22810 3289 5757 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_22810 6278 5841 gene locus_tag LOCUS_22820 6278 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 6436 7023 gene locus_tag LOCUS_22830 gene pdeM 6436 7023 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764871.1 protein_id gnl|my_center|LOCUS_22830 7167 7895 gene locus_tag LOCUS_22840 7167 7895 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 protein_id gnl|my_center|LOCUS_22840 9260 7911 gene locus_tag LOCUS_22850 9260 7911 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163428.1 protein_id gnl|my_center|LOCUS_22850 9565 12957 gene locus_tag LOCUS_22860 gene mfd 9565 12957 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_22860 13040 14338 gene locus_tag LOCUS_22870 13040 14338 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303078.1 protein_id gnl|my_center|LOCUS_22870 14425 16314 gene locus_tag LOCUS_22880 14425 16314 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_22880 16369 17688 gene locus_tag LOCUS_22890 16369 17688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 18351 17692 gene locus_tag LOCUS_22900 18351 17692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 18861 18502 gene locus_tag LOCUS_22910 18861 18502 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_22910 19057 20550 gene locus_tag LOCUS_22920 19057 20550 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196631.1 protein_id gnl|my_center|LOCUS_22920 20561 22273 gene locus_tag LOCUS_22930 20561 22273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 22550 22374 gene locus_tag LOCUS_22940 22550 22374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 22755 24833 gene locus_tag LOCUS_22950 gene metG 22755 24833 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962236.1 protein_id gnl|my_center|LOCUS_22950 24901 27024 gene locus_tag LOCUS_22960 24901 27024 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964572.1 protein_id gnl|my_center|LOCUS_22960 27675 27052 gene locus_tag LOCUS_22970 27675 27052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 28240 29142 gene locus_tag LOCUS_22980 28240 29142 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921475.1 protein_id gnl|my_center|LOCUS_22980 29249 30145 gene locus_tag LOCUS_22990 29249 30145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 31791 30142 gene locus_tag LOCUS_23000 31791 30142 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087177.1 protein_id gnl|my_center|LOCUS_23000 32395 31838 gene locus_tag LOCUS_23010 32395 31838 CDS product maltose acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026426.1 protein_id gnl|my_center|LOCUS_23010 34175 32406 gene locus_tag LOCUS_23020 34175 32406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 36275 34749 gene locus_tag LOCUS_23030 36275 34749 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_23030 39396 36298 gene locus_tag LOCUS_23040 39396 36298 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_23040 40788 39775 gene locus_tag LOCUS_23050 40788 39775 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766583.1 protein_id gnl|my_center|LOCUS_23050 41574 41056 gene locus_tag LOCUS_23060 gene gldD 41574 41056 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_23060 42916 41597 gene locus_tag LOCUS_23070 42916 41597 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_23070 43559 43095 gene locus_tag LOCUS_23080 gene ssb 43559 43095 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963776.1 protein_id gnl|my_center|LOCUS_23080 44634 43696 gene locus_tag LOCUS_23090 gene mutY 44634 43696 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_23090 44915 45205 gene locus_tag LOCUS_23100 44915 45205 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_23100 45489 47036 gene locus_tag LOCUS_23110 45489 47036 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_23110 47167 47640 gene locus_tag LOCUS_23120 47167 47640 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_23120 48152 47655 gene locus_tag LOCUS_23130 48152 47655 CDS product OmpA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962318.1 protein_id gnl|my_center|LOCUS_23130 49052 48192 gene locus_tag LOCUS_23140 49052 48192 CDS product cupin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202112.1 protein_id gnl|my_center|LOCUS_23140 50214 49120 gene locus_tag LOCUS_23150 gene bioB 50214 49120 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962410.1 protein_id gnl|my_center|LOCUS_23150 51789 50356 gene locus_tag LOCUS_23160 51789 50356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 52372 51794 gene locus_tag LOCUS_23170 52372 51794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 53623 52439 gene locus_tag LOCUS_23180 53623 52439 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964416.1 protein_id gnl|my_center|LOCUS_23180 54934 53633 gene locus_tag LOCUS_23190 gene bioA 54934 53633 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_23190 56287 56631 gene locus_tag LOCUS_23200 56287 56631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 57255 56638 gene locus_tag LOCUS_23210 gene bioD 57255 56638 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964418.1 protein_id gnl|my_center|LOCUS_23210 57640 57257 gene locus_tag LOCUS_23220 57640 57257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 58832 57642 gene locus_tag LOCUS_23230 58832 57642 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_23230 58938 60746 gene locus_tag LOCUS_23240 58938 60746 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920396.1 protein_id gnl|my_center|LOCUS_23240 60725 61273 gene locus_tag LOCUS_23250 60725 61273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 61516 62997 gene locus_tag LOCUS_23260 61516 62997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 63102 63950 gene locus_tag LOCUS_23270 63102 63950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 64046 69616 gene locus_tag LOCUS_23280 64046 69616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 69621 70310 gene locus_tag LOCUS_23290 69621 70310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 70379 75319 gene locus_tag LOCUS_23300 70379 75319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 75454 77409 gene locus_tag LOCUS_23310 75454 77409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence021 4334 2814 gene locus_tag LOCUS_23320 4334 2814 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555796.1 protein_id gnl|my_center|LOCUS_23320 6631 4466 gene locus_tag LOCUS_23330 gene bglX 6631 4466 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_23330 8246 6852 gene locus_tag LOCUS_23340 8246 6852 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791295.1 protein_id gnl|my_center|LOCUS_23340 9606 8239 gene locus_tag LOCUS_23350 9606 8239 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108887.1 protein_id gnl|my_center|LOCUS_23350 11441 9648 gene locus_tag LOCUS_23360 11441 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 13005 11467 gene locus_tag LOCUS_23370 13005 11467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 16004 13017 gene locus_tag LOCUS_23380 16004 13017 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_23380 19006 16319 gene locus_tag LOCUS_23390 19006 16319 CDS product triple tyrosine motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091372500.1 protein_id gnl|my_center|LOCUS_23390 19405 19887 gene locus_tag LOCUS_23400 gene guaD 19405 19887 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245084.1 protein_id gnl|my_center|LOCUS_23400 19947 20291 gene locus_tag LOCUS_23410 19947 20291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23410 21715 20519 gene locus_tag LOCUS_23420 21715 20519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 22514 21720 gene locus_tag LOCUS_23430 22514 21720 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965895.1 protein_id gnl|my_center|LOCUS_23430 23356 22517 gene locus_tag LOCUS_23440 gene kduI 23356 22517 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201855.1 protein_id gnl|my_center|LOCUS_23440 23578 27678 gene locus_tag LOCUS_23450 23578 27678 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_23450 27815 29038 gene locus_tag LOCUS_23460 27815 29038 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108782.1 protein_id gnl|my_center|LOCUS_23460 29028 30614 gene locus_tag LOCUS_23470 29028 30614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 30627 32189 gene locus_tag LOCUS_23480 30627 32189 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841405.1 protein_id gnl|my_center|LOCUS_23480 35351 32391 gene locus_tag LOCUS_23490 35351 32391 CDS product DUF5060 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922984.1 protein_id gnl|my_center|LOCUS_23490 35857 36753 gene locus_tag LOCUS_23500 35857 36753 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059223299.1 protein_id gnl|my_center|LOCUS_23500 36750 36962 gene locus_tag LOCUS_23510 36750 36962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 36974 38293 gene locus_tag LOCUS_23520 36974 38293 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963601.1 protein_id gnl|my_center|LOCUS_23520 42193 38318 gene locus_tag LOCUS_23530 42193 38318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 43124 42378 gene locus_tag LOCUS_23540 43124 42378 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142845.1 protein_id gnl|my_center|LOCUS_23540 47124 43099 gene locus_tag LOCUS_23550 47124 43099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 48404 47145 gene locus_tag LOCUS_23560 48404 47145 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_23560 48815 50362 gene locus_tag LOCUS_23570 48815 50362 CDS product D-alanine--poly(phosphoribitol) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030516.1 protein_id gnl|my_center|LOCUS_23570 50359 50613 gene locus_tag LOCUS_23580 50359 50613 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399878.1 protein_id gnl|my_center|LOCUS_23580 50619 54758 gene locus_tag LOCUS_23590 50619 54758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 54794 55276 gene locus_tag LOCUS_23600 54794 55276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 55382 57613 gene locus_tag LOCUS_23610 55382 57613 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_23610 57807 58547 gene locus_tag LOCUS_23620 57807 58547 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_23620 65005 58634 gene locus_tag LOCUS_23630 65005 58634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 67733 65352 gene locus_tag LOCUS_23640 67733 65352 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_23640 68564 67764 gene locus_tag LOCUS_23650 68564 67764 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_23650 70536 68605 gene locus_tag LOCUS_23660 70536 68605 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_23660 71626 70541 gene locus_tag LOCUS_23670 71626 70541 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 protein_id gnl|my_center|LOCUS_23670 73052 72066 gene locus_tag LOCUS_23680 73052 72066 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_23680 73442 74839 gene locus_tag LOCUS_23690 73442 74839 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963427.1 protein_id gnl|my_center|LOCUS_23690 74836 75852 gene locus_tag LOCUS_23700 74836 75852 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931922.1 protein_id gnl|my_center|LOCUS_23700 76924 77439 gene locus_tag LOCUS_23710 76924 77439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 77443 78354 gene locus_tag LOCUS_23720 77443 78354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 78683 79681 gene locus_tag LOCUS_23730 78683 79681 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence022 416 500 gene locus_tag LOCUS_t00190 416 500 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 654 1553 gene locus_tag LOCUS_23740 654 1553 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_23740 1574 3031 gene locus_tag LOCUS_23750 gene crtI 1574 3031 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_23750 3043 3882 gene locus_tag LOCUS_23760 3043 3882 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_23760 3884 4339 gene locus_tag LOCUS_23770 3884 4339 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_23770 4809 4345 gene locus_tag LOCUS_23780 gene resA 4809 4345 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742200.1 protein_id gnl|my_center|LOCUS_23780 5366 4902 gene locus_tag LOCUS_23790 5366 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 7803 5536 gene locus_tag LOCUS_23800 7803 5536 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_23800 8941 7988 gene locus_tag LOCUS_23810 8941 7988 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_23810 10406 8946 gene locus_tag LOCUS_23820 10406 8946 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963305.1 protein_id gnl|my_center|LOCUS_23820 11229 10390 gene locus_tag LOCUS_23830 11229 10390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 11543 11788 gene locus_tag LOCUS_23840 11543 11788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963364.1 protein_id gnl|my_center|LOCUS_23840 11822 12973 gene locus_tag LOCUS_23850 11822 12973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 13152 15515 gene locus_tag LOCUS_23860 13152 15515 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065451001.1 protein_id gnl|my_center|LOCUS_23860 15550 16722 gene locus_tag LOCUS_23870 15550 16722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 16813 17544 gene locus_tag LOCUS_23880 gene rluF 16813 17544 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963354.1 protein_id gnl|my_center|LOCUS_23880 17811 19073 gene locus_tag LOCUS_23890 17811 19073 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818018.1 protein_id gnl|my_center|LOCUS_23890 19161 20213 gene locus_tag LOCUS_23900 19161 20213 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_23900 22511 20301 gene locus_tag LOCUS_23910 gene recQ 22511 20301 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963365.1 protein_id gnl|my_center|LOCUS_23910 22768 23733 gene locus_tag LOCUS_23920 22768 23733 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099197.1 protein_id gnl|my_center|LOCUS_23920 23733 24587 gene locus_tag LOCUS_23930 gene tatC 23733 24587 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963367.1 protein_id gnl|my_center|LOCUS_23930 24677 25417 gene locus_tag LOCUS_23940 gene lptB 24677 25417 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_23940 26163 25420 gene locus_tag LOCUS_23950 26163 25420 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099200.1 protein_id gnl|my_center|LOCUS_23950 26267 27445 gene locus_tag LOCUS_23960 26267 27445 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_23960 27450 29330 gene locus_tag LOCUS_23970 27450 29330 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_23970 29518 29889 gene locus_tag LOCUS_23980 29518 29889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 29917 30075 gene locus_tag LOCUS_23990 29917 30075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 30118 30702 gene locus_tag LOCUS_24000 30118 30702 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_24000 30874 31098 gene locus_tag LOCUS_24010 30874 31098 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_24010 31299 34661 gene locus_tag LOCUS_24020 gene secA 31299 34661 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962742.1 protein_id gnl|my_center|LOCUS_24020 35083 36168 gene locus_tag LOCUS_24030 35083 36168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 36410 37627 gene locus_tag LOCUS_24040 36410 37627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 37750 39102 gene locus_tag LOCUS_24050 37750 39102 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844973.1 protein_id gnl|my_center|LOCUS_24050 39234 40448 gene locus_tag LOCUS_24060 39234 40448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 40891 40598 gene locus_tag LOCUS_24070 40891 40598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 41482 41243 gene locus_tag LOCUS_24080 41482 41243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 42263 42024 gene locus_tag LOCUS_24090 42263 42024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 42869 43831 gene locus_tag LOCUS_24100 42869 43831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 43956 44639 gene locus_tag LOCUS_24110 gene msrA 43956 44639 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013187310.1 protein_id gnl|my_center|LOCUS_24110 44985 45890 gene locus_tag LOCUS_24120 44985 45890 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181039975.1 protein_id gnl|my_center|LOCUS_24120 46375 45950 gene locus_tag LOCUS_24130 46375 45950 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232570.1 protein_id gnl|my_center|LOCUS_24130 46530 47090 gene locus_tag LOCUS_24140 46530 47090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 47329 48135 gene locus_tag LOCUS_24150 47329 48135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 48176 49138 gene locus_tag LOCUS_24160 48176 49138 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932054.1 protein_id gnl|my_center|LOCUS_24160 50754 49162 gene locus_tag LOCUS_24170 50754 49162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 51382 50801 gene locus_tag LOCUS_24180 51382 50801 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_24180 51619 51392 gene locus_tag LOCUS_24190 51619 51392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962732.1 protein_id gnl|my_center|LOCUS_24190 52925 51621 gene locus_tag LOCUS_24200 52925 51621 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_24200 53845 53063 gene locus_tag LOCUS_24210 gene mazG 53845 53063 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_24210 53946 54785 gene locus_tag LOCUS_24220 53946 54785 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_24220 54788 55699 gene locus_tag LOCUS_24230 54788 55699 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_24230 57229 55802 gene locus_tag LOCUS_24240 57229 55802 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_24240 60481 57233 gene locus_tag LOCUS_24250 60481 57233 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_24250 61473 60508 gene locus_tag LOCUS_24260 61473 60508 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_24260 62153 61722 gene locus_tag LOCUS_24270 62153 61722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 62348 62800 gene locus_tag LOCUS_24280 62348 62800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 62901 63626 gene locus_tag LOCUS_24290 62901 63626 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189870.1 protein_id gnl|my_center|LOCUS_24290 63645 64520 gene locus_tag LOCUS_24300 63645 64520 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_24300 64527 65165 gene locus_tag LOCUS_24310 64527 65165 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784172.1 protein_id gnl|my_center|LOCUS_24310 65315 66817 gene locus_tag LOCUS_24320 65315 66817 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028586.1 protein_id gnl|my_center|LOCUS_24320 67257 66871 gene locus_tag LOCUS_24330 67257 66871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 68366 67278 gene locus_tag LOCUS_24340 68366 67278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 69118 68675 gene locus_tag LOCUS_24350 69118 68675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 69780 69361 gene locus_tag LOCUS_24360 69780 69361 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963864.1 protein_id gnl|my_center|LOCUS_24360 70431 69841 gene locus_tag LOCUS_24370 gene def 70431 69841 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963863.1 protein_id gnl|my_center|LOCUS_24370 70842 70432 gene locus_tag LOCUS_24380 gene ruvX 70842 70432 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963861.1 protein_id gnl|my_center|LOCUS_24380 71040 71855 gene locus_tag LOCUS_24390 71040 71855 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_24390 71952 72764 gene locus_tag LOCUS_24400 71952 72764 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111408924.1 protein_id gnl|my_center|LOCUS_24400 73086 74132 gene locus_tag LOCUS_24410 73086 74132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 74217 75329 gene locus_tag LOCUS_24420 74217 75329 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence023 59 1507 gene locus_tag LOCUS_24430 59 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 1514 2449 gene locus_tag LOCUS_24440 1514 2449 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_24440 2452 4380 gene locus_tag LOCUS_24450 2452 4380 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_24450 4462 5496 gene locus_tag LOCUS_24460 4462 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 5524 6018 gene locus_tag LOCUS_24470 5524 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963768.1 protein_id gnl|my_center|LOCUS_24470 6134 7192 gene locus_tag LOCUS_24480 6134 7192 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_24480 8338 7253 gene locus_tag LOCUS_24490 8338 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 8497 21285 gene locus_tag LOCUS_24500 8497 21285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 21412 22314 gene locus_tag LOCUS_24510 21412 22314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_24510 22320 23153 gene locus_tag LOCUS_24520 22320 23153 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 protein_id gnl|my_center|LOCUS_24520 23284 24861 gene locus_tag LOCUS_24530 23284 24861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 24996 27755 gene locus_tag LOCUS_24540 24996 27755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 27815 29803 gene locus_tag LOCUS_24550 gene uvrB 27815 29803 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963054.1 protein_id gnl|my_center|LOCUS_24550 30612 30229 gene locus_tag LOCUS_24560 30612 30229 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_24560 30539 30727 gene locus_tag LOCUS_24570 30539 30727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 30899 31279 gene locus_tag LOCUS_24580 30899 31279 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963057.1 protein_id gnl|my_center|LOCUS_24580 31662 31327 gene locus_tag LOCUS_24590 31662 31327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 32260 31799 gene locus_tag LOCUS_24600 gene asnC 32260 31799 CDS product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649540.1 protein_id gnl|my_center|LOCUS_24600 32859 35765 gene locus_tag LOCUS_24610 32859 35765 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890684.1 protein_id gnl|my_center|LOCUS_24610 35799 36299 gene locus_tag LOCUS_24620 35799 36299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 36333 37520 gene locus_tag LOCUS_24630 gene hisC 36333 37520 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_24630 37991 37662 gene locus_tag LOCUS_24640 37991 37662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 38597 38091 gene locus_tag LOCUS_24650 38597 38091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 38491 38799 gene locus_tag LOCUS_24660 38491 38799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 38843 39949 gene locus_tag LOCUS_24670 gene ald 38843 39949 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 protein_id gnl|my_center|LOCUS_24670 40346 40005 gene locus_tag LOCUS_24680 40346 40005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 41806 40613 gene locus_tag LOCUS_24690 gene sucC 41806 40613 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963059.1 protein_id gnl|my_center|LOCUS_24690 42634 41996 gene locus_tag LOCUS_24700 42634 41996 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_24700 42742 44040 gene locus_tag LOCUS_24710 gene lysA 42742 44040 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_24710 44100 44633 gene locus_tag LOCUS_24720 44100 44633 CDS product thioredoxin fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_24720 44802 47384 gene locus_tag LOCUS_24730 44802 47384 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_24730 48880 47408 gene locus_tag LOCUS_24740 gene guaB 48880 47408 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963927.1 protein_id gnl|my_center|LOCUS_24740 51576 49102 gene locus_tag LOCUS_24750 51576 49102 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_24750 52924 51557 gene locus_tag LOCUS_24760 52924 51557 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_24760 54067 52928 gene locus_tag LOCUS_24770 54067 52928 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_24770 55404 54181 gene locus_tag LOCUS_24780 55404 54181 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_24780 55686 56051 gene locus_tag LOCUS_24790 55686 56051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 56914 56048 gene locus_tag LOCUS_24800 56914 56048 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_24800 57599 56973 gene locus_tag LOCUS_24810 57599 56973 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192730530.1 protein_id gnl|my_center|LOCUS_24810 57817 58236 gene locus_tag LOCUS_24820 57817 58236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 59310 58273 gene locus_tag LOCUS_24830 59310 58273 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_24830 59874 59437 gene locus_tag LOCUS_24840 59874 59437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 62878 60020 gene locus_tag LOCUS_24850 62878 60020 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890684.1 protein_id gnl|my_center|LOCUS_24850 63021 64250 gene locus_tag LOCUS_24860 gene pepT 63021 64250 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964023.1 protein_id gnl|my_center|LOCUS_24860 64301 64900 gene locus_tag LOCUS_24870 64301 64900 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115312706.1 protein_id gnl|my_center|LOCUS_24870 66220 64949 gene locus_tag LOCUS_24880 66220 64949 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_24880 66699 66412 gene locus_tag LOCUS_24890 gene yajC 66699 66412 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962700.1 protein_id gnl|my_center|LOCUS_24890 67153 66722 gene locus_tag LOCUS_24900 67153 66722 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_24900 68146 67232 gene locus_tag LOCUS_24910 gene nusB 68146 67232 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962698.1 protein_id gnl|my_center|LOCUS_24910 68503 70257 gene locus_tag LOCUS_24920 68503 70257 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_24920 70331 70711 gene locus_tag LOCUS_24930 70331 70711 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_24930 71833 70790 gene locus_tag LOCUS_24940 71833 70790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 72750 71830 gene locus_tag LOCUS_24950 72750 71830 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_24950 73093 72755 gene locus_tag LOCUS_24960 73093 72755 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962694.1 protein_id gnl|my_center|LOCUS_24960 73230 73766 gene locus_tag LOCUS_24970 73230 73766 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_24970 74332 73790 gene locus_tag LOCUS_24980 gene bstA 74332 73790 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243944.1 protein_id gnl|my_center|LOCUS_24980 >Feature sequence024 575 393 gene locus_tag LOCUS_24990 575 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 2981 819 gene locus_tag LOCUS_25000 2981 819 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257598.1 protein_id gnl|my_center|LOCUS_25000 3478 2981 gene locus_tag LOCUS_25010 3478 2981 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174739.1 protein_id gnl|my_center|LOCUS_25010 4071 3496 gene locus_tag LOCUS_25020 4071 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339093.1 protein_id gnl|my_center|LOCUS_25020 5641 4208 gene locus_tag LOCUS_25030 5641 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 7105 5645 gene locus_tag LOCUS_25040 7105 5645 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_25040 9442 7109 gene locus_tag LOCUS_25050 9442 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 10816 9629 gene locus_tag LOCUS_25060 10816 9629 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_25060 11407 10874 gene locus_tag LOCUS_25070 11407 10874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 12504 11455 gene locus_tag LOCUS_25080 12504 11455 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 protein_id gnl|my_center|LOCUS_25080 12721 13401 gene locus_tag LOCUS_25090 12721 13401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 13586 13404 gene locus_tag LOCUS_25100 13586 13404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 14615 13596 gene locus_tag LOCUS_25110 14615 13596 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_25110 16084 14720 gene locus_tag LOCUS_25120 16084 14720 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784703.1 protein_id gnl|my_center|LOCUS_25120 19395 16099 gene locus_tag LOCUS_25130 19395 16099 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_25130 20531 19395 gene locus_tag LOCUS_25140 20531 19395 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932152.1 protein_id gnl|my_center|LOCUS_25140 21576 20704 gene locus_tag LOCUS_25150 21576 20704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 23669 21759 gene locus_tag LOCUS_25160 23669 21759 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_25160 23808 24224 gene locus_tag LOCUS_25170 23808 24224 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_25170 25254 24202 gene locus_tag LOCUS_25180 25254 24202 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_25180 26248 25346 gene locus_tag LOCUS_25190 gene gldN 26248 25346 CDS product gliding motility protein GldN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_25190 27867 26308 gene locus_tag LOCUS_25200 gene gldM 27867 26308 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_25200 28577 27921 gene locus_tag LOCUS_25210 gene gldL 28577 27921 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_25210 29958 28726 gene locus_tag LOCUS_25220 gene gldK 29958 28726 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_25220 31362 30205 gene locus_tag LOCUS_25230 31362 30205 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_25230 33980 31473 gene locus_tag LOCUS_25240 gene topA 33980 31473 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964077.1 protein_id gnl|my_center|LOCUS_25240 35376 34102 gene locus_tag LOCUS_25250 35376 34102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 35813 37258 gene locus_tag LOCUS_25260 gene miaB 35813 37258 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964081.1 protein_id gnl|my_center|LOCUS_25260 37288 38562 gene locus_tag LOCUS_25270 37288 38562 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_25270 38616 39134 gene locus_tag LOCUS_25280 38616 39134 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 protein_id gnl|my_center|LOCUS_25280 39197 40117 gene locus_tag LOCUS_25290 39197 40117 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_25290 40124 40486 gene locus_tag LOCUS_25300 gene secG 40124 40486 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964085.1 protein_id gnl|my_center|LOCUS_25300 40631 40909 gene locus_tag LOCUS_25310 40631 40909 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_25310 41014 42645 gene locus_tag LOCUS_25320 gene groL 41014 42645 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964087.1 protein_id gnl|my_center|LOCUS_25320 42962 42825 gene locus_tag LOCUS_25330 42962 42825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 43425 43069 gene locus_tag LOCUS_25340 43425 43069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 45733 43445 gene locus_tag LOCUS_25350 45733 43445 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 protein_id gnl|my_center|LOCUS_25350 46319 45906 gene locus_tag LOCUS_25360 46319 45906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 46691 47779 gene locus_tag LOCUS_25370 46691 47779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 47868 48326 gene locus_tag LOCUS_25380 47868 48326 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964137.1 protein_id gnl|my_center|LOCUS_25380 48503 50032 gene locus_tag LOCUS_25390 gene purH 48503 50032 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964504.1 protein_id gnl|my_center|LOCUS_25390 50100 51128 gene locus_tag LOCUS_25400 50100 51128 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_25400 51278 52039 gene locus_tag LOCUS_25410 gene mreC 51278 52039 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099559.1 protein_id gnl|my_center|LOCUS_25410 52029 52538 gene locus_tag LOCUS_25420 52029 52538 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 protein_id gnl|my_center|LOCUS_25420 52583 54508 gene locus_tag LOCUS_25430 gene mrdA 52583 54508 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 protein_id gnl|my_center|LOCUS_25430 54515 55798 gene locus_tag LOCUS_25440 gene rodA 54515 55798 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_25440 56659 55841 gene locus_tag LOCUS_25450 56659 55841 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 protein_id gnl|my_center|LOCUS_25450 56818 57270 gene locus_tag LOCUS_25460 gene msrB 56818 57270 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935885.1 protein_id gnl|my_center|LOCUS_25460 57272 57829 gene locus_tag LOCUS_25470 gene msrA 57272 57829 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421586.1 protein_id gnl|my_center|LOCUS_25470 58402 58908 gene locus_tag LOCUS_25480 gene msrA 58402 58908 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870242.1 protein_id gnl|my_center|LOCUS_25480 61104 58960 gene locus_tag LOCUS_25490 61104 58960 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_25490 61296 62072 gene locus_tag LOCUS_25500 gene surE 61296 62072 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_25500 62122 62421 gene locus_tag LOCUS_25510 62122 62421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964420.1 protein_id gnl|my_center|LOCUS_25510 62509 63621 gene locus_tag LOCUS_25520 gene lpxB 62509 63621 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_25520 63668 64219 gene locus_tag LOCUS_25530 63668 64219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 64610 66247 gene locus_tag LOCUS_25540 64610 66247 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 protein_id gnl|my_center|LOCUS_25540 67776 66244 gene locus_tag LOCUS_25550 67776 66244 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246610.1 protein_id gnl|my_center|LOCUS_25550 70088 67899 gene locus_tag LOCUS_25560 70088 67899 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_25560 70242 71564 gene locus_tag LOCUS_25570 70242 71564 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964430.1 protein_id gnl|my_center|LOCUS_25570 71561 72475 gene locus_tag LOCUS_25580 71561 72475 CDS product GYDIA family GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence025 863 33 gene locus_tag LOCUS_25590 863 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 995 1627 gene locus_tag LOCUS_25600 995 1627 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224030.1 protein_id gnl|my_center|LOCUS_25600 1897 2040 gene locus_tag LOCUS_25610 1897 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 2708 2037 gene locus_tag LOCUS_25620 2708 2037 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263006.1 protein_id gnl|my_center|LOCUS_25620 2999 2733 gene locus_tag LOCUS_25630 2999 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 4015 2999 gene locus_tag LOCUS_25640 4015 2999 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065431.1 protein_id gnl|my_center|LOCUS_25640 5291 4206 gene locus_tag LOCUS_25650 5291 4206 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922549.1 protein_id gnl|my_center|LOCUS_25650 5892 5275 gene locus_tag LOCUS_25660 5892 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 6779 5892 gene locus_tag LOCUS_25670 6779 5892 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_25670 9128 6954 gene locus_tag LOCUS_25680 9128 6954 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_25680 9701 9240 gene locus_tag LOCUS_25690 9701 9240 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382916.1 protein_id gnl|my_center|LOCUS_25690 9983 11068 gene locus_tag LOCUS_25700 9983 11068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 11289 12116 gene locus_tag LOCUS_25710 11289 12116 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_25710 12274 12510 gene locus_tag LOCUS_25720 12274 12510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 13991 12525 gene locus_tag LOCUS_25730 13991 12525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 14686 13988 gene locus_tag LOCUS_25740 14686 13988 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356718.1 protein_id gnl|my_center|LOCUS_25740 15099 14683 gene locus_tag LOCUS_25750 15099 14683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 16093 15134 gene locus_tag LOCUS_25760 16093 15134 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921965.1 protein_id gnl|my_center|LOCUS_25760 16298 17518 gene locus_tag LOCUS_25770 16298 17518 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_25770 18644 17802 gene locus_tag LOCUS_25780 18644 17802 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962642.1 protein_id gnl|my_center|LOCUS_25780 18980 21601 gene locus_tag LOCUS_25790 18980 21601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 21608 22024 gene locus_tag LOCUS_25800 21608 22024 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_25800 22127 24370 gene locus_tag LOCUS_25810 22127 24370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 25842 24598 gene locus_tag LOCUS_25820 25842 24598 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 protein_id gnl|my_center|LOCUS_25820 27422 25911 gene locus_tag LOCUS_25830 27422 25911 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963094.1 protein_id gnl|my_center|LOCUS_25830 28550 27621 gene locus_tag LOCUS_25840 28550 27621 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010207549.1 protein_id gnl|my_center|LOCUS_25840 29062 28553 gene locus_tag LOCUS_25850 29062 28553 CDS product DUF6155 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963095.1 protein_id gnl|my_center|LOCUS_25850 29233 30096 gene locus_tag LOCUS_25860 29233 30096 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_25860 30961 32259 gene locus_tag LOCUS_25870 30961 32259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 33596 32271 gene locus_tag LOCUS_25880 33596 32271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 35929 33593 gene locus_tag LOCUS_25890 35929 33593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 37257 35989 gene locus_tag LOCUS_25900 37257 35989 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_25900 40315 37412 gene locus_tag LOCUS_25910 40315 37412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 40688 40317 gene locus_tag LOCUS_25920 40688 40317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 41293 40700 gene locus_tag LOCUS_25930 41293 40700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 41628 42917 gene locus_tag LOCUS_25940 41628 42917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 43312 42914 gene locus_tag LOCUS_25950 43312 42914 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963098.1 protein_id gnl|my_center|LOCUS_25950 44265 43369 gene locus_tag LOCUS_25960 44265 43369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 44981 44382 gene locus_tag LOCUS_25970 44981 44382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 46584 45229 gene locus_tag LOCUS_25980 46584 45229 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958071.1 protein_id gnl|my_center|LOCUS_25980 46747 47154 gene locus_tag LOCUS_25990 46747 47154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 protein_id gnl|my_center|LOCUS_25990 47826 47146 gene locus_tag LOCUS_26000 47826 47146 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932742.1 protein_id gnl|my_center|LOCUS_26000 47920 48714 gene locus_tag LOCUS_26010 47920 48714 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993515.1 protein_id gnl|my_center|LOCUS_26010 48704 49588 gene locus_tag LOCUS_26020 gene cysM 48704 49588 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_26020 50403 49606 gene locus_tag LOCUS_26030 50403 49606 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_26030 51506 50478 gene locus_tag LOCUS_26040 gene corA 51506 50478 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081315.1 protein_id gnl|my_center|LOCUS_26040 52407 51610 gene locus_tag LOCUS_26050 gene truA 52407 51610 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583376.1 protein_id gnl|my_center|LOCUS_26050 52455 52919 gene locus_tag LOCUS_26060 52455 52919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 53291 53602 gene locus_tag LOCUS_26070 53291 53602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 56067 53704 gene locus_tag LOCUS_26080 56067 53704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 56306 57004 gene locus_tag LOCUS_26090 56306 57004 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_26090 57079 58494 gene locus_tag LOCUS_26100 57079 58494 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839831.1 protein_id gnl|my_center|LOCUS_26100 60900 58597 gene locus_tag LOCUS_26110 60900 58597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 61516 61082 gene locus_tag LOCUS_26120 61516 61082 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 protein_id gnl|my_center|LOCUS_26120 62309 61539 gene locus_tag LOCUS_26130 62309 61539 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705502.1 protein_id gnl|my_center|LOCUS_26130 63474 62320 gene locus_tag LOCUS_26140 63474 62320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 64566 63517 gene locus_tag LOCUS_26150 64566 63517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 66915 64597 gene locus_tag LOCUS_26160 66915 64597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 67230 68579 gene locus_tag LOCUS_26170 67230 68579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 >Feature sequence026 1 177 gene locus_tag LOCUS_26180 1 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 210 1469 gene locus_tag LOCUS_26190 210 1469 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_26190 1599 2651 gene locus_tag LOCUS_26200 1599 2651 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763619.1 protein_id gnl|my_center|LOCUS_26200 2766 3470 gene locus_tag LOCUS_26210 2766 3470 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_26210 3460 4689 gene locus_tag LOCUS_26220 3460 4689 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763621.1 protein_id gnl|my_center|LOCUS_26220 4691 5953 gene locus_tag LOCUS_26230 4691 5953 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_26230 6014 7156 gene locus_tag LOCUS_26240 6014 7156 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_26240 7188 8540 gene locus_tag LOCUS_26250 7188 8540 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_26250 8640 9314 gene locus_tag LOCUS_26260 gene tsaB 8640 9314 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_26260 10169 9333 gene locus_tag LOCUS_26270 10169 9333 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_26270 10616 10416 gene locus_tag LOCUS_26280 10616 10416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 11613 10699 gene locus_tag LOCUS_26290 11613 10699 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964201.1 protein_id gnl|my_center|LOCUS_26290 11747 12763 gene locus_tag LOCUS_26300 11747 12763 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964200.1 protein_id gnl|my_center|LOCUS_26300 14029 12842 gene locus_tag LOCUS_26310 14029 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 14326 16230 gene locus_tag LOCUS_26320 14326 16230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 16260 16988 gene locus_tag LOCUS_26330 16260 16988 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_26330 17020 17529 gene locus_tag LOCUS_26340 17020 17529 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_26340 17599 18486 gene locus_tag LOCUS_26350 gene fabD 17599 18486 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_26350 18639 22319 gene locus_tag LOCUS_26360 18639 22319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 22328 23311 gene locus_tag LOCUS_26370 22328 23311 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_26370 23321 25258 gene locus_tag LOCUS_26380 23321 25258 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_26380 26485 25289 gene locus_tag LOCUS_26390 26485 25289 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 protein_id gnl|my_center|LOCUS_26390 27230 26595 gene locus_tag LOCUS_26400 27230 26595 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763153.1 protein_id gnl|my_center|LOCUS_26400 27583 27287 gene locus_tag LOCUS_26410 27583 27287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 28368 46889 gene locus_tag LOCUS_26420 28368 46889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 47829 46987 gene locus_tag LOCUS_26430 47829 46987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 49065 47866 gene locus_tag LOCUS_26440 49065 47866 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287452.1 protein_id gnl|my_center|LOCUS_26440 49851 49066 gene locus_tag LOCUS_26450 49851 49066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 50659 49844 gene locus_tag LOCUS_26460 gene proC 50659 49844 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_26460 51421 51337 gene locus_tag LOCUS_t00200 51421 51337 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 51569 51496 gene locus_tag LOCUS_t00210 51569 51496 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 54285 51703 gene locus_tag LOCUS_26470 gene mutS 54285 51703 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962564.1 protein_id gnl|my_center|LOCUS_26470 54485 55024 gene locus_tag LOCUS_26480 54485 55024 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_26480 56166 55021 gene locus_tag LOCUS_26490 gene folK 56166 55021 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962567.1 protein_id gnl|my_center|LOCUS_26490 56307 58001 gene locus_tag LOCUS_26500 gene sppA 56307 58001 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 protein_id gnl|my_center|LOCUS_26500 60176 58077 gene locus_tag LOCUS_26510 60176 58077 CDS product DUF5723 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964024.1 protein_id gnl|my_center|LOCUS_26510 60283 60993 gene locus_tag LOCUS_26520 60283 60993 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839717.1 protein_id gnl|my_center|LOCUS_26520 61170 63890 gene locus_tag LOCUS_26530 61170 63890 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962569.1 protein_id gnl|my_center|LOCUS_26530 64605 63898 gene locus_tag LOCUS_26540 64605 63898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 65610 64612 gene locus_tag LOCUS_26550 65610 64612 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242607.1 protein_id gnl|my_center|LOCUS_26550 66534 65740 gene locus_tag LOCUS_26560 66534 65740 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_26560 66612 68126 gene locus_tag LOCUS_26570 66612 68126 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_26570 68198 68761 gene locus_tag LOCUS_26580 68198 68761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence027 4074 2503 gene locus_tag LOCUS_26590 4074 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 5809 4148 gene locus_tag LOCUS_26600 5809 4148 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_26600 8965 5855 gene locus_tag LOCUS_26610 8965 5855 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222838248.1 protein_id gnl|my_center|LOCUS_26610 10506 9394 gene locus_tag LOCUS_26620 10506 9394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963733.1 protein_id gnl|my_center|LOCUS_26620 11680 10580 gene locus_tag LOCUS_26630 11680 10580 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_26630 12355 11708 gene locus_tag LOCUS_26640 12355 11708 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116185855.1 protein_id gnl|my_center|LOCUS_26640 13389 12682 gene locus_tag LOCUS_26650 13389 12682 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963729.1 protein_id gnl|my_center|LOCUS_26650 14519 13464 gene locus_tag LOCUS_26660 gene tsaD 14519 13464 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503448.1 protein_id gnl|my_center|LOCUS_26660 14577 19007 gene locus_tag LOCUS_26670 14577 19007 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_26670 19282 20268 gene locus_tag LOCUS_26680 gene pfkA 19282 20268 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963726.1 protein_id gnl|my_center|LOCUS_26680 20290 21291 gene locus_tag LOCUS_26690 gene gap 20290 21291 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963725.1 protein_id gnl|my_center|LOCUS_26690 21374 22225 gene locus_tag LOCUS_26700 21374 22225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_26700 22664 22284 gene locus_tag LOCUS_26710 22664 22284 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_26710 25469 22758 gene locus_tag LOCUS_26720 25469 22758 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_26720 25610 26965 gene locus_tag LOCUS_26730 25610 26965 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962911.1 protein_id gnl|my_center|LOCUS_26730 27066 28037 gene locus_tag LOCUS_26740 27066 28037 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 protein_id gnl|my_center|LOCUS_26740 28038 29363 gene locus_tag LOCUS_26750 28038 29363 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_26750 29415 30206 gene locus_tag LOCUS_26760 29415 30206 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_26760 30246 30728 gene locus_tag LOCUS_26770 30246 30728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_26770 30834 33746 gene locus_tag LOCUS_26780 30834 33746 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_26780 33890 35035 gene locus_tag LOCUS_26790 gene bshA 33890 35035 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_26790 34992 35480 gene locus_tag LOCUS_26800 34992 35480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 35657 36793 gene locus_tag LOCUS_26810 35657 36793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 38724 36799 gene locus_tag LOCUS_26820 38724 36799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 40330 39161 gene locus_tag LOCUS_26830 40330 39161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 41348 40383 gene locus_tag LOCUS_26840 41348 40383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 42712 41354 gene locus_tag LOCUS_26850 42712 41354 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_26850 44115 42871 gene locus_tag LOCUS_26860 44115 42871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 45177 44128 gene locus_tag LOCUS_26870 45177 44128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 46139 45483 gene locus_tag LOCUS_26880 46139 45483 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462476.1 protein_id gnl|my_center|LOCUS_26880 47091 46123 gene locus_tag LOCUS_26890 47091 46123 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462477.1 protein_id gnl|my_center|LOCUS_26890 48107 47088 gene locus_tag LOCUS_26900 48107 47088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 48739 48104 gene locus_tag LOCUS_26910 48739 48104 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_26910 50013 48871 gene locus_tag LOCUS_26920 50013 48871 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895560.1 protein_id gnl|my_center|LOCUS_26920 51107 50016 gene locus_tag LOCUS_26930 51107 50016 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476096.1 protein_id gnl|my_center|LOCUS_26930 52264 51179 gene locus_tag LOCUS_26940 gene pglJ 52264 51179 CDS product N-acetylgalactosamine-N,N'-diacetylbacillosaminyl-diphospho-undecaprenol 4-alpha-N-acetylgalactosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852870.1 protein_id gnl|my_center|LOCUS_26940 52830 52288 gene locus_tag LOCUS_26950 52830 52288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 54027 52924 gene locus_tag LOCUS_26960 54027 52924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 55373 54033 gene locus_tag LOCUS_26970 gene murJ 55373 54033 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582940.1 protein_id gnl|my_center|LOCUS_26970 56491 55370 gene locus_tag LOCUS_26980 56491 55370 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531351.1 protein_id gnl|my_center|LOCUS_26980 58557 56746 gene locus_tag LOCUS_26990 58557 56746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 58856 60142 gene locus_tag LOCUS_27000 58856 60142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 60432 60178 gene locus_tag LOCUS_27010 60432 60178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 64207 60947 gene locus_tag LOCUS_27020 64207 60947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 64196 64426 gene locus_tag LOCUS_27030 64196 64426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 <65600 64714 gene locus_tag LOCUS_27040 <65600 64714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963428.1:nucleotide sugar dehydrogenase >Feature sequence028 686 195 gene locus_tag LOCUS_27050 686 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 934 1614 gene locus_tag LOCUS_27060 934 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 1843 1667 gene locus_tag LOCUS_27070 1843 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 2200 2904 gene locus_tag LOCUS_27080 2200 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 4438 3032 gene locus_tag LOCUS_27090 4438 3032 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_27090 5325 4588 gene locus_tag LOCUS_27100 5325 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 6233 5331 gene locus_tag LOCUS_27110 6233 5331 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107159.1 protein_id gnl|my_center|LOCUS_27110 7685 6297 gene locus_tag LOCUS_27120 7685 6297 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_27120 11180 7698 gene locus_tag LOCUS_27130 11180 7698 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_27130 12299 11307 gene locus_tag LOCUS_27140 12299 11307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 12908 12381 gene locus_tag LOCUS_27150 12908 12381 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681497.1 protein_id gnl|my_center|LOCUS_27150 13581 15029 gene locus_tag LOCUS_27160 13581 15029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 16088 15294 gene locus_tag LOCUS_27170 16088 15294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 17558 16107 gene locus_tag LOCUS_27180 17558 16107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 18659 17922 gene locus_tag LOCUS_27190 18659 17922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 19505 18681 gene locus_tag LOCUS_27200 19505 18681 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226532.1 protein_id gnl|my_center|LOCUS_27200 19775 19533 gene locus_tag LOCUS_27210 19775 19533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 21626 20772 gene locus_tag LOCUS_27220 21626 20772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 22312 21782 gene locus_tag LOCUS_27230 22312 21782 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_27230 22770 22309 gene locus_tag LOCUS_27240 22770 22309 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939462.1 protein_id gnl|my_center|LOCUS_27240 23435 22791 gene locus_tag LOCUS_27250 23435 22791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 24082 23489 gene locus_tag LOCUS_27260 24082 23489 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_27260 24554 24204 gene locus_tag LOCUS_27270 24554 24204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 25650 24916 gene locus_tag LOCUS_27280 25650 24916 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021349.1 protein_id gnl|my_center|LOCUS_27280 26051 25647 gene locus_tag LOCUS_27290 26051 25647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 27324 26254 gene locus_tag LOCUS_27300 27324 26254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 28526 27417 gene locus_tag LOCUS_27310 28526 27417 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898981.1 protein_id gnl|my_center|LOCUS_27310 29396 28863 gene locus_tag LOCUS_27320 29396 28863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 29744 29887 gene locus_tag LOCUS_27330 29744 29887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 30122 31498 gene locus_tag LOCUS_27340 30122 31498 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162263851.1 protein_id gnl|my_center|LOCUS_27340 32314 31586 gene locus_tag LOCUS_27350 32314 31586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 33195 32311 gene locus_tag LOCUS_27360 33195 32311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 34073 33765 gene locus_tag LOCUS_27370 34073 33765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 34481 34209 gene locus_tag LOCUS_27380 34481 34209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 35390 34695 gene locus_tag LOCUS_27390 35390 34695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 36717 35401 gene locus_tag LOCUS_27400 36717 35401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 36845 36771 gene locus_tag LOCUS_t00220 36845 36771 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 36982 37365 gene locus_tag LOCUS_27410 36982 37365 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_27410 37424 38269 gene locus_tag LOCUS_27420 37424 38269 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_27420 38850 38290 gene locus_tag LOCUS_27430 38850 38290 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 protein_id gnl|my_center|LOCUS_27430 39235 38963 gene locus_tag LOCUS_27440 39235 38963 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964108.1 protein_id gnl|my_center|LOCUS_27440 40357 39410 gene locus_tag LOCUS_27450 gene fmt 40357 39410 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964109.1 protein_id gnl|my_center|LOCUS_27450 42294 40396 gene locus_tag LOCUS_27460 42294 40396 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362014.1 protein_id gnl|my_center|LOCUS_27460 42875 42297 gene locus_tag LOCUS_27470 42875 42297 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964111.1 protein_id gnl|my_center|LOCUS_27470 42945 43232 gene locus_tag LOCUS_27480 42945 43232 CDS product DUF493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964112.1 protein_id gnl|my_center|LOCUS_27480 43315 43971 gene locus_tag LOCUS_27490 43315 43971 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_27490 43988 45295 gene locus_tag LOCUS_27500 gene murA 43988 45295 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964114.1 protein_id gnl|my_center|LOCUS_27500 45323 45643 gene locus_tag LOCUS_27510 45323 45643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 46222 45698 gene locus_tag LOCUS_27520 46222 45698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 46540 47508 gene locus_tag LOCUS_27530 46540 47508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 48832 47522 gene locus_tag LOCUS_27540 48832 47522 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_27540 49528 48836 gene locus_tag LOCUS_27550 49528 48836 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_27550 50037 49540 gene locus_tag LOCUS_27560 50037 49540 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_27560 50269 51396 gene locus_tag LOCUS_27570 50269 51396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 51523 52323 gene locus_tag LOCUS_27580 51523 52323 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_27580 55510 52376 gene locus_tag LOCUS_27590 55510 52376 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_27590 <58044 55510 gene locus_tag LOCUS_27600 <58044 55510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024768457.1:VCBS repeat-containing protein >Feature sequence029 3800 846 gene locus_tag LOCUS_27610 3800 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 5017 3956 gene locus_tag LOCUS_27620 gene rhaT 5017 3956 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063521.1 protein_id gnl|my_center|LOCUS_27620 6471 5044 gene locus_tag LOCUS_27630 6471 5044 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976070.1 protein_id gnl|my_center|LOCUS_27630 9572 6468 gene locus_tag LOCUS_27640 9572 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 10785 9676 gene locus_tag LOCUS_27650 10785 9676 CDS product peptidylglycine monooxygenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663621.1 protein_id gnl|my_center|LOCUS_27650 12360 10897 gene locus_tag LOCUS_27660 12360 10897 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_27660 15203 12369 gene locus_tag LOCUS_27670 15203 12369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 16817 15312 gene locus_tag LOCUS_27680 16817 15312 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_27680 19911 16840 gene locus_tag LOCUS_27690 19911 16840 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_27690 20145 21032 gene locus_tag LOCUS_27700 20145 21032 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762705.1 protein_id gnl|my_center|LOCUS_27700 21742 23496 gene locus_tag LOCUS_27710 21742 23496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 23501 23815 gene locus_tag LOCUS_27720 gene rhaM 23501 23815 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619496.1 protein_id gnl|my_center|LOCUS_27720 24002 25369 gene locus_tag LOCUS_27730 24002 25369 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802003.1 protein_id gnl|my_center|LOCUS_27730 26062 25754 gene locus_tag LOCUS_27740 26062 25754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 26664 28985 gene locus_tag LOCUS_27750 26664 28985 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817457.1 protein_id gnl|my_center|LOCUS_27750 29452 30465 gene locus_tag LOCUS_27760 29452 30465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27760 30531 32090 gene locus_tag LOCUS_27770 30531 32090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 32330 33697 gene locus_tag LOCUS_27780 32330 33697 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_27780 33719 35332 gene locus_tag LOCUS_27790 33719 35332 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026811032.1 protein_id gnl|my_center|LOCUS_27790 35345 38503 gene locus_tag LOCUS_27800 35345 38503 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266957.1 protein_id gnl|my_center|LOCUS_27800 38516 40261 gene locus_tag LOCUS_27810 38516 40261 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_27810 40346 41236 gene locus_tag LOCUS_27820 40346 41236 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_27820 42288 41407 gene locus_tag LOCUS_27830 42288 41407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 43388 42777 gene locus_tag LOCUS_27840 43388 42777 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119768.1 protein_id gnl|my_center|LOCUS_27840 43967 43422 gene locus_tag LOCUS_27850 43967 43422 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530731.1 protein_id gnl|my_center|LOCUS_27850 44704 46179 gene locus_tag LOCUS_27860 44704 46179 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921851.1 protein_id gnl|my_center|LOCUS_27860 46313 47671 gene locus_tag LOCUS_27870 46313 47671 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_27870 47692 48699 gene locus_tag LOCUS_27880 47692 48699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 48768 49526 gene locus_tag LOCUS_27890 48768 49526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 49713 53759 gene locus_tag LOCUS_27900 49713 53759 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_27900 >Feature sequence030 3728 3495 gene locus_tag LOCUS_27910 3728 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 4348 3839 gene locus_tag LOCUS_27920 4348 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 5383 4364 gene locus_tag LOCUS_27930 5383 4364 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_27930 6008 5475 gene locus_tag LOCUS_27940 6008 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 7543 6305 gene locus_tag LOCUS_27950 7543 6305 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_27950 8637 7639 gene locus_tag LOCUS_27960 8637 7639 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784757.1 protein_id gnl|my_center|LOCUS_27960 9844 8627 gene locus_tag LOCUS_27970 9844 8627 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202114.1 protein_id gnl|my_center|LOCUS_27970 10577 9837 gene locus_tag LOCUS_27980 10577 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 11452 10580 gene locus_tag LOCUS_27990 11452 10580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 12408 11449 gene locus_tag LOCUS_28000 12408 11449 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108173.1 protein_id gnl|my_center|LOCUS_28000 12441 13157 gene locus_tag LOCUS_28010 12441 13157 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784744.1 protein_id gnl|my_center|LOCUS_28010 13234 13851 gene locus_tag LOCUS_28020 13234 13851 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_28020 14577 13867 gene locus_tag LOCUS_28030 14577 13867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 14576 15220 gene locus_tag LOCUS_28040 14576 15220 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_28040 15246 16061 gene locus_tag LOCUS_28050 15246 16061 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_28050 16708 16058 gene locus_tag LOCUS_28060 16708 16058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964037.1 protein_id gnl|my_center|LOCUS_28060 17212 16718 gene locus_tag LOCUS_28070 17212 16718 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_28070 17536 18858 gene locus_tag LOCUS_28080 17536 18858 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_28080 20546 18843 gene locus_tag LOCUS_28090 gene malL 20546 18843 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_28090 20798 21265 gene locus_tag LOCUS_28100 20798 21265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 22172 21276 gene locus_tag LOCUS_28110 gene xerD 22172 21276 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964120.1 protein_id gnl|my_center|LOCUS_28110 22412 22999 gene locus_tag LOCUS_28120 22412 22999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 23094 23510 gene locus_tag LOCUS_28130 gene aroQ 23094 23510 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964118.1 protein_id gnl|my_center|LOCUS_28130 23688 24206 gene locus_tag LOCUS_28140 23688 24206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 24515 24225 gene locus_tag LOCUS_28150 24515 24225 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963096.1 protein_id gnl|my_center|LOCUS_28150 26023 24632 gene locus_tag LOCUS_28160 gene lpdA 26023 24632 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_28160 26716 26189 gene locus_tag LOCUS_28170 26716 26189 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_28170 27264 26767 gene locus_tag LOCUS_28180 gene msrB 27264 26767 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967753.1 protein_id gnl|my_center|LOCUS_28180 27987 27433 gene locus_tag LOCUS_28190 27987 27433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 28168 30066 gene locus_tag LOCUS_28200 gene glgB 28168 30066 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_28200 30165 32564 gene locus_tag LOCUS_28210 30165 32564 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_28210 32603 33412 gene locus_tag LOCUS_28220 32603 33412 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_28220 33474 34811 gene locus_tag LOCUS_28230 33474 34811 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_28230 35566 34844 gene locus_tag LOCUS_28240 35566 34844 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107567.1 protein_id gnl|my_center|LOCUS_28240 36691 35600 gene locus_tag LOCUS_28250 36691 35600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 37232 36672 gene locus_tag LOCUS_28260 37232 36672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 37749 37234 gene locus_tag LOCUS_28270 37749 37234 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976292.1 protein_id gnl|my_center|LOCUS_28270 37768 37977 gene locus_tag LOCUS_28280 37768 37977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 38002 40470 gene locus_tag LOCUS_28290 gene lon 38002 40470 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_28290 40470 41162 gene locus_tag LOCUS_28300 gene cmk 40470 41162 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963822.1 protein_id gnl|my_center|LOCUS_28300 41606 41226 gene locus_tag LOCUS_28310 41606 41226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 41873 43702 gene locus_tag LOCUS_28320 gene rpsA 41873 43702 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963900.1 protein_id gnl|my_center|LOCUS_28320 43898 44437 gene locus_tag LOCUS_28330 gene pyrR 43898 44437 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_28330 44440 45366 gene locus_tag LOCUS_28340 44440 45366 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_28340 45374 45706 gene locus_tag LOCUS_28350 45374 45706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 45703 46176 gene locus_tag LOCUS_28360 45703 46176 CDS product DUF3291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640509.1 protein_id gnl|my_center|LOCUS_28360 46181 47086 gene locus_tag LOCUS_28370 46181 47086 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963815.1 protein_id gnl|my_center|LOCUS_28370 47157 47804 gene locus_tag LOCUS_28380 gene pdxH 47157 47804 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963814.1 protein_id gnl|my_center|LOCUS_28380 47867 48352 gene locus_tag LOCUS_28390 gene sixA 47867 48352 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_28390 48353 50455 gene locus_tag LOCUS_28400 gene ppk1 48353 50455 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963117.1 protein_id gnl|my_center|LOCUS_28400 51098 50517 gene locus_tag LOCUS_28410 51098 50517 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_28410 51276 52133 gene locus_tag LOCUS_28420 51276 52133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 52135 53043 gene locus_tag LOCUS_28430 52135 53043 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 protein_id gnl|my_center|LOCUS_28430 53043 53945 gene locus_tag LOCUS_28440 53043 53945 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666219.1 protein_id gnl|my_center|LOCUS_28440 53979 55139 gene locus_tag LOCUS_28450 53979 55139 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110716881.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence031 494 2506 gene locus_tag LOCUS_28460 494 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 2507 3790 gene locus_tag LOCUS_28470 2507 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 3859 7509 gene locus_tag LOCUS_28480 3859 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 7509 8132 gene locus_tag LOCUS_28490 7509 8132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 8168 9106 gene locus_tag LOCUS_28500 8168 9106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 9122 9673 gene locus_tag LOCUS_28510 9122 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 9713 10537 gene locus_tag LOCUS_28520 9713 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 10541 10903 gene locus_tag LOCUS_28530 10541 10903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 11048 11542 gene locus_tag LOCUS_28540 11048 11542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036263.1 protein_id gnl|my_center|LOCUS_28540 11536 12231 gene locus_tag LOCUS_28550 11536 12231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015462938.1 protein_id gnl|my_center|LOCUS_28550 12221 15187 gene locus_tag LOCUS_28560 12221 15187 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263395.1 protein_id gnl|my_center|LOCUS_28560 16573 15383 gene locus_tag LOCUS_28570 16573 15383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 16900 16577 gene locus_tag LOCUS_28580 16900 16577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 17233 16910 gene locus_tag LOCUS_28590 17233 16910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 17846 17427 gene locus_tag LOCUS_28600 17846 17427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 18312 17857 gene locus_tag LOCUS_28610 18312 17857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 19438 18302 gene locus_tag LOCUS_28620 19438 18302 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361999.1 protein_id gnl|my_center|LOCUS_28620 19810 19451 gene locus_tag LOCUS_28630 19810 19451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 21450 20053 gene locus_tag LOCUS_28640 gene mnmE 21450 20053 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962791.1 protein_id gnl|my_center|LOCUS_28640 21590 22042 gene locus_tag LOCUS_28650 21590 22042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 22180 22545 gene locus_tag LOCUS_28660 22180 22545 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074087.1 protein_id gnl|my_center|LOCUS_28660 23737 22619 gene locus_tag LOCUS_28670 gene dnaN 23737 22619 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963230.1 protein_id gnl|my_center|LOCUS_28670 25532 23868 gene locus_tag LOCUS_28680 gene gldG 25532 23868 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_28680 26263 25532 gene locus_tag LOCUS_28690 gene gldF 26263 25532 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_28690 27258 26425 gene locus_tag LOCUS_28700 27258 26425 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_28700 27549 28502 gene locus_tag LOCUS_28710 27549 28502 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_28710 28544 29494 gene locus_tag LOCUS_28720 28544 29494 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963218.1 protein_id gnl|my_center|LOCUS_28720 30160 29501 gene locus_tag LOCUS_28730 30160 29501 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932717.1 protein_id gnl|my_center|LOCUS_28730 32082 30157 gene locus_tag LOCUS_28740 32082 30157 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963092.1 protein_id gnl|my_center|LOCUS_28740 32276 34528 gene locus_tag LOCUS_28750 32276 34528 CDS product FUSC family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193403.1 protein_id gnl|my_center|LOCUS_28750 34952 34557 gene locus_tag LOCUS_28760 34952 34557 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_28760 38943 34963 gene locus_tag LOCUS_28770 38943 34963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 39814 39179 gene locus_tag LOCUS_28780 39814 39179 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974526.1 protein_id gnl|my_center|LOCUS_28780 41807 39804 gene locus_tag LOCUS_28790 41807 39804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 42018 42614 gene locus_tag LOCUS_28800 42018 42614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 42936 43265 gene locus_tag LOCUS_28810 42936 43265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 43284 43637 gene locus_tag LOCUS_28820 43284 43637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 43796 44800 gene locus_tag LOCUS_28830 43796 44800 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793314.1 protein_id gnl|my_center|LOCUS_28830 45604 44885 gene locus_tag LOCUS_28840 45604 44885 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818985.1 protein_id gnl|my_center|LOCUS_28840 47148 45619 gene locus_tag LOCUS_28850 47148 45619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 47665 47177 gene locus_tag LOCUS_28860 47665 47177 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 protein_id gnl|my_center|LOCUS_28860 48329 47748 gene locus_tag LOCUS_28870 48329 47748 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_28870 48896 48351 gene locus_tag LOCUS_28880 48896 48351 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_28880 49119 49511 gene locus_tag LOCUS_28890 49119 49511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962736.1 protein_id gnl|my_center|LOCUS_28890 50140 49598 gene locus_tag LOCUS_28900 50140 49598 CDS product DUF4269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495197.1 protein_id gnl|my_center|LOCUS_28900 51101 50259 gene locus_tag LOCUS_28910 51101 50259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 51331 51915 gene locus_tag LOCUS_28920 gene hxlB 51331 51915 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879292.1 protein_id gnl|my_center|LOCUS_28920 51970 52599 gene locus_tag LOCUS_28930 51970 52599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 >Feature sequence032 469 1797 gene locus_tag LOCUS_28940 469 1797 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_28940 4105 1934 gene locus_tag LOCUS_28950 4105 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 5209 4142 gene locus_tag LOCUS_28960 5209 4142 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761511.1 protein_id gnl|my_center|LOCUS_28960 5783 5457 gene locus_tag LOCUS_28970 5783 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 6316 5972 gene locus_tag LOCUS_28980 6316 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 8482 6341 gene locus_tag LOCUS_28990 gene katE 8482 6341 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266295.1 protein_id gnl|my_center|LOCUS_28990 8964 8551 gene locus_tag LOCUS_29000 8964 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 9237 9641 gene locus_tag LOCUS_29010 9237 9641 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082839.1 protein_id gnl|my_center|LOCUS_29010 9711 10232 gene locus_tag LOCUS_29020 9711 10232 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119942.1 protein_id gnl|my_center|LOCUS_29020 10455 10676 gene locus_tag LOCUS_29030 10455 10676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 10799 11248 gene locus_tag LOCUS_29040 10799 11248 CDS product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314059.1 protein_id gnl|my_center|LOCUS_29040 12159 11311 gene locus_tag LOCUS_29050 12159 11311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 13908 12301 gene locus_tag LOCUS_29060 13908 12301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090123410.1 protein_id gnl|my_center|LOCUS_29060 14370 15863 gene locus_tag LOCUS_29070 14370 15863 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922831.1 protein_id gnl|my_center|LOCUS_29070 16874 19915 gene locus_tag LOCUS_29080 16874 19915 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108592.1 protein_id gnl|my_center|LOCUS_29080 19915 21738 gene locus_tag LOCUS_29090 19915 21738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 21806 23419 gene locus_tag LOCUS_29100 21806 23419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 23529 24581 gene locus_tag LOCUS_29110 23529 24581 CDS product family 16 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029010.1 protein_id gnl|my_center|LOCUS_29110 24806 25699 gene locus_tag LOCUS_29120 24806 25699 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107998.1 protein_id gnl|my_center|LOCUS_29120 25704 25994 gene locus_tag LOCUS_29130 25704 25994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 26327 28195 gene locus_tag LOCUS_29140 26327 28195 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664336.1 protein_id gnl|my_center|LOCUS_29140 30223 28517 gene locus_tag LOCUS_29150 30223 28517 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108525.1 protein_id gnl|my_center|LOCUS_29150 33500 30297 gene locus_tag LOCUS_29160 33500 30297 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130856111.1 protein_id gnl|my_center|LOCUS_29160 34470 34069 gene locus_tag LOCUS_29170 34470 34069 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_29170 37132 34475 gene locus_tag LOCUS_29180 37132 34475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 38222 37359 gene locus_tag LOCUS_29190 38222 37359 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_29190 38383 41886 gene locus_tag LOCUS_29200 38383 41886 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090339627.1 protein_id gnl|my_center|LOCUS_29200 41908 42765 gene locus_tag LOCUS_29210 41908 42765 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974400.1 protein_id gnl|my_center|LOCUS_29210 42778 43908 gene locus_tag LOCUS_29220 42778 43908 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_29220 44125 45216 gene locus_tag LOCUS_29230 44125 45216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29230 45219 46541 gene locus_tag LOCUS_29240 45219 46541 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_29240 46736 47146 gene locus_tag LOCUS_29250 46736 47146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 47175 47543 gene locus_tag LOCUS_29260 47175 47543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 47761 47540 gene locus_tag LOCUS_29270 47761 47540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 47874 49166 gene locus_tag LOCUS_29280 47874 49166 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_29280 49178 49594 gene locus_tag LOCUS_29290 49178 49594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 50796 49687 gene locus_tag LOCUS_29300 50796 49687 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357153.1 protein_id gnl|my_center|LOCUS_29300 >Feature sequence033 1137 181 gene locus_tag LOCUS_29310 1137 181 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 protein_id gnl|my_center|LOCUS_29310 1678 1247 gene locus_tag LOCUS_29320 gene mscL 1678 1247 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099017.1 protein_id gnl|my_center|LOCUS_29320 4444 1694 gene locus_tag LOCUS_29330 4444 1694 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_29330 6332 4470 gene locus_tag LOCUS_29340 6332 4470 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_29340 6593 7804 gene locus_tag LOCUS_29350 6593 7804 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29350 8092 9495 gene locus_tag LOCUS_29360 8092 9495 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_29360 9614 10333 gene locus_tag LOCUS_29370 9614 10333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 10409 10930 gene locus_tag LOCUS_29380 10409 10930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_29380 11929 11009 gene locus_tag LOCUS_29390 11929 11009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 13956 11932 gene locus_tag LOCUS_29400 13956 11932 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963153.1 protein_id gnl|my_center|LOCUS_29400 14071 16176 gene locus_tag LOCUS_29410 gene recG 14071 16176 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963155.1 protein_id gnl|my_center|LOCUS_29410 16255 17670 gene locus_tag LOCUS_29420 gene leuC 16255 17670 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763197.1 protein_id gnl|my_center|LOCUS_29420 17710 18306 gene locus_tag LOCUS_29430 gene leuD 17710 18306 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_29430 18435 19949 gene locus_tag LOCUS_29440 18435 19949 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763199.1 protein_id gnl|my_center|LOCUS_29440 19967 21022 gene locus_tag LOCUS_29450 gene leuB 19967 21022 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767701.1 protein_id gnl|my_center|LOCUS_29450 22331 21132 gene locus_tag LOCUS_29460 22331 21132 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222734.1 protein_id gnl|my_center|LOCUS_29460 24189 22609 gene locus_tag LOCUS_29470 24189 22609 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941484.1 protein_id gnl|my_center|LOCUS_29470 25589 24339 gene locus_tag LOCUS_29480 gene ilvA 25589 24339 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962614.1 protein_id gnl|my_center|LOCUS_29480 27077 25668 gene locus_tag LOCUS_29490 gene ilvC 27077 25668 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455226.1 protein_id gnl|my_center|LOCUS_29490 27769 27239 gene locus_tag LOCUS_29500 gene ilvN 27769 27239 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_29500 28491 27910 gene locus_tag LOCUS_29510 28491 27910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 30273 28540 gene locus_tag LOCUS_29520 gene ilvB 30273 28540 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962617.1 protein_id gnl|my_center|LOCUS_29520 32037 30361 gene locus_tag LOCUS_29530 gene ilvD 32037 30361 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962618.1 protein_id gnl|my_center|LOCUS_29530 33314 32475 gene locus_tag LOCUS_29540 33314 32475 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 protein_id gnl|my_center|LOCUS_29540 34044 33307 gene locus_tag LOCUS_29550 gene pxpB 34044 33307 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889166.1 protein_id gnl|my_center|LOCUS_29550 34814 34041 gene locus_tag LOCUS_29560 34814 34041 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868110.1 protein_id gnl|my_center|LOCUS_29560 35066 35509 gene locus_tag LOCUS_29570 35066 35509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 35528 36091 gene locus_tag LOCUS_29580 35528 36091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 38508 36973 gene locus_tag LOCUS_29590 38508 36973 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963722.1 protein_id gnl|my_center|LOCUS_29590 40944 38542 gene locus_tag LOCUS_29600 40944 38542 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964303.1 protein_id gnl|my_center|LOCUS_29600 41193 42407 gene locus_tag LOCUS_29610 41193 42407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 44450 42483 gene locus_tag LOCUS_29620 44450 42483 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_29620 45760 44450 gene locus_tag LOCUS_29630 gene tilS 45760 44450 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_29630 47115 45820 gene locus_tag LOCUS_29640 47115 45820 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_29640 47661 47128 gene locus_tag LOCUS_29650 47661 47128 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690957.1 protein_id gnl|my_center|LOCUS_29650 47945 49066 gene locus_tag LOCUS_29660 47945 49066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 50203 49193 gene locus_tag LOCUS_29670 gene mgrA 50203 49193 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_29670 50407 50634 gene locus_tag LOCUS_29680 50407 50634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 >Feature sequence034 978 37 gene locus_tag LOCUS_29690 978 37 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_29690 2226 1006 gene locus_tag LOCUS_29700 gene mnmA 2226 1006 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963885.1 protein_id gnl|my_center|LOCUS_29700 2423 3793 gene locus_tag LOCUS_29710 2423 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 6034 4181 gene locus_tag LOCUS_29720 gene yidC 6034 4181 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964004.1 protein_id gnl|my_center|LOCUS_29720 7769 6153 gene locus_tag LOCUS_29730 7769 6153 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_29730 8061 7828 gene locus_tag LOCUS_29740 8061 7828 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964002.1 protein_id gnl|my_center|LOCUS_29740 8110 8979 gene locus_tag LOCUS_29750 8110 8979 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_29750 9757 9011 gene locus_tag LOCUS_29760 9757 9011 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_29760 11897 9765 gene locus_tag LOCUS_29770 11897 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 12086 12808 gene locus_tag LOCUS_29780 12086 12808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 12837 13121 gene locus_tag LOCUS_29790 12837 13121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 13744 14424 gene locus_tag LOCUS_29800 13744 14424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 14538 15128 gene locus_tag LOCUS_29810 14538 15128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 15720 15166 gene locus_tag LOCUS_29820 15720 15166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 16112 15708 gene locus_tag LOCUS_29830 16112 15708 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_29830 18390 16207 gene locus_tag LOCUS_29840 18390 16207 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964000.1 protein_id gnl|my_center|LOCUS_29840 19913 18381 gene locus_tag LOCUS_29850 gene guaA 19913 18381 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963998.1 protein_id gnl|my_center|LOCUS_29850 20574 22982 gene locus_tag LOCUS_29860 20574 22982 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_29860 22985 23884 gene locus_tag LOCUS_29870 22985 23884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 24066 24611 gene locus_tag LOCUS_29880 24066 24611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 26229 24628 gene locus_tag LOCUS_29890 gene bshC 26229 24628 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963529.1 protein_id gnl|my_center|LOCUS_29890 26381 28846 gene locus_tag LOCUS_29900 26381 28846 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_29900 28976 29962 gene locus_tag LOCUS_29910 28976 29962 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037063.1 protein_id gnl|my_center|LOCUS_29910 30684 30079 gene locus_tag LOCUS_29920 30684 30079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 30891 31415 gene locus_tag LOCUS_29930 30891 31415 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636204.1 protein_id gnl|my_center|LOCUS_29930 31565 32500 gene locus_tag LOCUS_29940 31565 32500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 32581 32931 gene locus_tag LOCUS_29950 32581 32931 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_29950 32980 33447 gene locus_tag LOCUS_29960 32980 33447 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_29960 33480 34097 gene locus_tag LOCUS_29970 33480 34097 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615927.1 protein_id gnl|my_center|LOCUS_29970 34100 35131 gene locus_tag LOCUS_29980 gene arsB 34100 35131 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826549.1 protein_id gnl|my_center|LOCUS_29980 35973 35218 gene locus_tag LOCUS_29990 35973 35218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 36040 36828 gene locus_tag LOCUS_30000 36040 36828 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836266.1 protein_id gnl|my_center|LOCUS_30000 37114 38574 gene locus_tag LOCUS_30010 37114 38574 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_30010 38687 38986 gene locus_tag LOCUS_30020 38687 38986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 39087 39572 gene locus_tag LOCUS_30030 39087 39572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 40641 39643 gene locus_tag LOCUS_30040 40641 39643 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922558.1 protein_id gnl|my_center|LOCUS_30040 41999 40677 gene locus_tag LOCUS_30050 41999 40677 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086363.1 protein_id gnl|my_center|LOCUS_30050 43227 42070 gene locus_tag LOCUS_30060 gene dgoD 43227 42070 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199088.1 protein_id gnl|my_center|LOCUS_30060 44740 43439 gene locus_tag LOCUS_30070 gene rimO 44740 43439 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_30070 44963 45961 gene locus_tag LOCUS_30080 44963 45961 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_30080 46947 45991 gene locus_tag LOCUS_30090 gene ftsY 46947 45991 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963551.1 protein_id gnl|my_center|LOCUS_30090 47277 47125 gene locus_tag LOCUS_30100 47277 47125 CDS product DUF4295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963552.1 protein_id gnl|my_center|LOCUS_30100 47497 47315 gene locus_tag LOCUS_30110 gene rpmG 47497 47315 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963553.1 protein_id gnl|my_center|LOCUS_30110 47745 47509 gene locus_tag LOCUS_30120 gene rpmB 47745 47509 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963554.1 protein_id gnl|my_center|LOCUS_30120 <48583 47810 gene locus_tag LOCUS_30130 <48583 47810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963555.1:competence/damage-inducible protein A >Feature sequence035 89 733 gene locus_tag LOCUS_30140 89 733 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_30140 734 2098 gene locus_tag LOCUS_30150 734 2098 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_30150 2126 3310 gene locus_tag LOCUS_30160 2126 3310 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_30160 3300 6806 gene locus_tag LOCUS_30170 3300 6806 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_30170 8221 6878 gene locus_tag LOCUS_30180 8221 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 11211 8242 gene locus_tag LOCUS_30190 11211 8242 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 protein_id gnl|my_center|LOCUS_30190 11404 13158 gene locus_tag LOCUS_30200 gene aspS 11404 13158 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962449.1 protein_id gnl|my_center|LOCUS_30200 13303 15003 gene locus_tag LOCUS_30210 13303 15003 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760864.1 protein_id gnl|my_center|LOCUS_30210 15036 15287 gene locus_tag LOCUS_30220 15036 15287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 15381 15575 gene locus_tag LOCUS_30230 15381 15575 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_30230 16092 15643 gene locus_tag LOCUS_30240 16092 15643 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962451.1 protein_id gnl|my_center|LOCUS_30240 17357 16587 gene locus_tag LOCUS_30250 17357 16587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 18291 17551 gene locus_tag LOCUS_30260 18291 17551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 19084 18284 gene locus_tag LOCUS_30270 19084 18284 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530214.1 protein_id gnl|my_center|LOCUS_30270 19207 20982 gene locus_tag LOCUS_30280 19207 20982 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962453.1 protein_id gnl|my_center|LOCUS_30280 21080 22117 gene locus_tag LOCUS_30290 21080 22117 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_30290 23457 22114 gene locus_tag LOCUS_30300 23457 22114 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_30300 23619 24011 gene locus_tag LOCUS_30310 23619 24011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 24409 24089 gene locus_tag LOCUS_30320 24409 24089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962526.1 protein_id gnl|my_center|LOCUS_30320 24817 27066 gene locus_tag LOCUS_30330 24817 27066 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_30330 27187 28140 gene locus_tag LOCUS_30340 27187 28140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 28251 28664 gene locus_tag LOCUS_30350 28251 28664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 28818 29918 gene locus_tag LOCUS_30360 28818 29918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 30505 29921 gene locus_tag LOCUS_30370 gene nadD 30505 29921 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962322.1 protein_id gnl|my_center|LOCUS_30370 31122 30538 gene locus_tag LOCUS_30380 gene gmk 31122 30538 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962519.1 protein_id gnl|my_center|LOCUS_30380 32006 31149 gene locus_tag LOCUS_30390 32006 31149 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_30390 32984 32229 gene locus_tag LOCUS_30400 32984 32229 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_30400 34141 33086 gene locus_tag LOCUS_30410 34141 33086 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383269.1 protein_id gnl|my_center|LOCUS_30410 34297 36000 gene locus_tag LOCUS_30420 34297 36000 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_30420 36128 36592 gene locus_tag LOCUS_30430 36128 36592 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964318.1 protein_id gnl|my_center|LOCUS_30430 36772 39984 gene locus_tag LOCUS_30440 gene lacZ 36772 39984 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_30440 40891 40025 gene locus_tag LOCUS_30450 40891 40025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 42263 41124 gene locus_tag LOCUS_30460 42263 41124 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669535.1 protein_id gnl|my_center|LOCUS_30460 43575 42349 gene locus_tag LOCUS_30470 43575 42349 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859148.1 protein_id gnl|my_center|LOCUS_30470 43944 43585 gene locus_tag LOCUS_30480 43944 43585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 45046 44051 gene locus_tag LOCUS_30490 45046 44051 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335559.1 protein_id gnl|my_center|LOCUS_30490 45187 46899 gene locus_tag LOCUS_30500 45187 46899 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_30500 46899 47546 gene locus_tag LOCUS_30510 46899 47546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 >Feature sequence036 389 628 gene locus_tag LOCUS_30520 389 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 3736 1250 gene locus_tag LOCUS_30530 3736 1250 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962626.1 protein_id gnl|my_center|LOCUS_30530 4953 3859 gene locus_tag LOCUS_30540 4953 3859 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_30540 7805 5136 gene locus_tag LOCUS_30550 7805 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 8193 7810 gene locus_tag LOCUS_30560 8193 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 9279 8812 gene locus_tag LOCUS_30570 9279 8812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 9696 9325 gene locus_tag LOCUS_30580 9696 9325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 10334 9726 gene locus_tag LOCUS_30590 10334 9726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 10707 10354 gene locus_tag LOCUS_30600 10707 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 10900 11427 gene locus_tag LOCUS_30610 10900 11427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 11411 12148 gene locus_tag LOCUS_30620 11411 12148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 14910 12145 gene locus_tag LOCUS_30630 14910 12145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 15662 15045 gene locus_tag LOCUS_30640 15662 15045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 16964 16389 gene locus_tag LOCUS_30650 16964 16389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 17125 16973 gene locus_tag LOCUS_30660 17125 16973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 17502 18236 gene locus_tag LOCUS_30670 17502 18236 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_30670 18245 20227 gene locus_tag LOCUS_30680 18245 20227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 20789 20217 gene locus_tag LOCUS_30690 20789 20217 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_30690 20909 21487 gene locus_tag LOCUS_30700 20909 21487 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962629.1 protein_id gnl|my_center|LOCUS_30700 21524 21730 gene locus_tag LOCUS_30710 21524 21730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 23352 21727 gene locus_tag LOCUS_30720 23352 21727 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 protein_id gnl|my_center|LOCUS_30720 23832 23356 gene locus_tag LOCUS_30730 23832 23356 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_30730 24515 23931 gene locus_tag LOCUS_30740 24515 23931 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_30740 25296 24559 gene locus_tag LOCUS_30750 gene djlA 25296 24559 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073436.1 protein_id gnl|my_center|LOCUS_30750 25501 25911 gene locus_tag LOCUS_30760 25501 25911 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_30760 26279 26737 gene locus_tag LOCUS_30770 26279 26737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 26739 27422 gene locus_tag LOCUS_30780 26739 27422 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 protein_id gnl|my_center|LOCUS_30780 27498 28922 gene locus_tag LOCUS_30790 27498 28922 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_30790 30449 29040 gene locus_tag LOCUS_30800 30449 29040 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726975.1 protein_id gnl|my_center|LOCUS_30800 31404 30844 gene locus_tag LOCUS_30810 31404 30844 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790695.1 protein_id gnl|my_center|LOCUS_30810 32545 31472 gene locus_tag LOCUS_30820 32545 31472 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958153.1 protein_id gnl|my_center|LOCUS_30820 34154 32604 gene locus_tag LOCUS_30830 34154 32604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 34956 34177 gene locus_tag LOCUS_30840 34956 34177 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_30840 36413 35004 gene locus_tag LOCUS_30850 36413 35004 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 protein_id gnl|my_center|LOCUS_30850 37071 36529 gene locus_tag LOCUS_30860 37071 36529 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_30860 37299 38048 gene locus_tag LOCUS_30870 37299 38048 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106675.1 protein_id gnl|my_center|LOCUS_30870 38108 39436 gene locus_tag LOCUS_30880 38108 39436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 40860 39472 gene locus_tag LOCUS_30890 40860 39472 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_30890 41936 40905 gene locus_tag LOCUS_30900 gene hemH 41936 40905 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962227.1 protein_id gnl|my_center|LOCUS_30900 42284 43276 gene locus_tag LOCUS_30910 42284 43276 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521284.1 protein_id gnl|my_center|LOCUS_30910 43404 46928 gene locus_tag LOCUS_30920 43404 46928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 46957 47808 gene locus_tag LOCUS_30930 46957 47808 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794479.1 protein_id gnl|my_center|LOCUS_30930 >Feature sequence037 2558 1575 gene locus_tag LOCUS_30940 2558 1575 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_30940 4160 2886 gene locus_tag LOCUS_30950 4160 2886 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_30950 4617 4306 gene locus_tag LOCUS_30960 4617 4306 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962681.1 protein_id gnl|my_center|LOCUS_30960 4778 5227 gene locus_tag LOCUS_30970 4778 5227 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_30970 5262 5837 gene locus_tag LOCUS_30980 5262 5837 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_30980 6079 7476 gene locus_tag LOCUS_30990 6079 7476 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_30990 7479 8042 gene locus_tag LOCUS_31000 7479 8042 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_31000 8100 9095 gene locus_tag LOCUS_31010 gene trpD 8100 9095 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962675.1 protein_id gnl|my_center|LOCUS_31010 9117 9899 gene locus_tag LOCUS_31020 gene trpC 9117 9899 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962674.1 protein_id gnl|my_center|LOCUS_31020 9916 10608 gene locus_tag LOCUS_31030 9916 10608 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962673.1 protein_id gnl|my_center|LOCUS_31030 10640 11830 gene locus_tag LOCUS_31040 gene trpB 10640 11830 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_31040 11909 12673 gene locus_tag LOCUS_31050 gene trpA 11909 12673 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_31050 12775 12918 gene locus_tag LOCUS_31060 12775 12918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 15519 12973 gene locus_tag LOCUS_31070 gene ppc 15519 12973 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058155.1 protein_id gnl|my_center|LOCUS_31070 16473 15808 gene locus_tag LOCUS_31080 16473 15808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 19942 16490 gene locus_tag LOCUS_31090 19942 16490 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943065.1 protein_id gnl|my_center|LOCUS_31090 21027 20266 gene locus_tag LOCUS_31100 gene yaaA 21027 20266 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962877.1 protein_id gnl|my_center|LOCUS_31100 22160 21135 gene locus_tag LOCUS_31110 22160 21135 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962812.1 protein_id gnl|my_center|LOCUS_31110 22661 22164 gene locus_tag LOCUS_31120 22661 22164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 22846 23829 gene locus_tag LOCUS_31130 22846 23829 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962814.1 protein_id gnl|my_center|LOCUS_31130 23875 24330 gene locus_tag LOCUS_31140 gene coaD 23875 24330 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_31140 24541 26388 gene locus_tag LOCUS_31150 24541 26388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 26375 26779 gene locus_tag LOCUS_31160 26375 26779 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_31160 26859 28586 gene locus_tag LOCUS_31170 26859 28586 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_31170 29186 28590 gene locus_tag LOCUS_31180 29186 28590 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_31180 29185 29826 gene locus_tag LOCUS_31190 gene pyrE 29185 29826 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962823.1 protein_id gnl|my_center|LOCUS_31190 29834 30226 gene locus_tag LOCUS_31200 29834 30226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962824.1 protein_id gnl|my_center|LOCUS_31200 30958 30227 gene locus_tag LOCUS_31210 30958 30227 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 protein_id gnl|my_center|LOCUS_31210 31052 31435 gene locus_tag LOCUS_31220 gene rsfS 31052 31435 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962763.1 protein_id gnl|my_center|LOCUS_31220 31445 33448 gene locus_tag LOCUS_31230 gene ftsH 31445 33448 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962764.1 protein_id gnl|my_center|LOCUS_31230 33507 34121 gene locus_tag LOCUS_31240 33507 34121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962765.1 protein_id gnl|my_center|LOCUS_31240 34126 34929 gene locus_tag LOCUS_31250 34126 34929 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962766.1 protein_id gnl|my_center|LOCUS_31250 34919 35602 gene locus_tag LOCUS_31260 34919 35602 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_31260 35577 35843 gene locus_tag LOCUS_31270 35577 35843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 36634 35873 gene locus_tag LOCUS_31280 36634 35873 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_31280 37975 36707 gene locus_tag LOCUS_31290 37975 36707 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_31290 38646 38053 gene locus_tag LOCUS_31300 38646 38053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 39510 38941 gene locus_tag LOCUS_31310 39510 38941 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963139.1 protein_id gnl|my_center|LOCUS_31310 39910 40530 gene locus_tag LOCUS_31320 39910 40530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 43187 40557 gene locus_tag LOCUS_31330 43187 40557 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963808.1 protein_id gnl|my_center|LOCUS_31330 43424 43774 gene locus_tag LOCUS_31340 43424 43774 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963807.1 protein_id gnl|my_center|LOCUS_31340 45116 43824 gene locus_tag LOCUS_31350 45116 43824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 >Feature sequence038 2991 1144 gene locus_tag LOCUS_31360 gene glmS 2991 1144 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962290.1 protein_id gnl|my_center|LOCUS_31360 5011 3179 gene locus_tag LOCUS_31370 5011 3179 CDS product DUF4270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962289.1 protein_id gnl|my_center|LOCUS_31370 5826 5017 gene locus_tag LOCUS_31380 5826 5017 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_31380 5934 6776 gene locus_tag LOCUS_31390 gene panC 5934 6776 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962287.1 protein_id gnl|my_center|LOCUS_31390 6794 7144 gene locus_tag LOCUS_31400 6794 7144 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962286.1 protein_id gnl|my_center|LOCUS_31400 7147 8112 gene locus_tag LOCUS_31410 7147 8112 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_31410 8140 9282 gene locus_tag LOCUS_31420 8140 9282 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962284.1 protein_id gnl|my_center|LOCUS_31420 9351 10712 gene locus_tag LOCUS_31430 gene radA 9351 10712 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962283.1 protein_id gnl|my_center|LOCUS_31430 11948 10851 gene locus_tag LOCUS_31440 11948 10851 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104034.1 protein_id gnl|my_center|LOCUS_31440 12847 12041 gene locus_tag LOCUS_31450 12847 12041 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_31450 12897 14978 gene locus_tag LOCUS_31460 12897 14978 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 protein_id gnl|my_center|LOCUS_31460 16525 14975 gene locus_tag LOCUS_31470 16525 14975 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964517.1 protein_id gnl|my_center|LOCUS_31470 17459 16563 gene locus_tag LOCUS_31480 17459 16563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 17633 18211 gene locus_tag LOCUS_31490 17633 18211 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964515.1 protein_id gnl|my_center|LOCUS_31490 18298 19872 gene locus_tag LOCUS_31500 18298 19872 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_31500 20632 19859 gene locus_tag LOCUS_31510 20632 19859 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143916869.1 protein_id gnl|my_center|LOCUS_31510 21255 20641 gene locus_tag LOCUS_31520 21255 20641 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886490.1 protein_id gnl|my_center|LOCUS_31520 21742 21269 gene locus_tag LOCUS_31530 21742 21269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 23393 21903 gene locus_tag LOCUS_31540 23393 21903 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390242.1 protein_id gnl|my_center|LOCUS_31540 23745 25949 gene locus_tag LOCUS_31550 23745 25949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 25946 26362 gene locus_tag LOCUS_31560 25946 26362 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_31560 26439 26831 gene locus_tag LOCUS_31570 26439 26831 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_31570 28097 26841 gene locus_tag LOCUS_31580 28097 26841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 30969 28231 gene locus_tag LOCUS_31590 30969 28231 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964328.1 protein_id gnl|my_center|LOCUS_31590 31133 32149 gene locus_tag LOCUS_31600 31133 32149 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 protein_id gnl|my_center|LOCUS_31600 32815 32222 gene locus_tag LOCUS_31610 32815 32222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 33296 32856 gene locus_tag LOCUS_31620 33296 32856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_31620 36155 33393 gene locus_tag LOCUS_31630 36155 33393 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962323.1 protein_id gnl|my_center|LOCUS_31630 38000 36363 gene locus_tag LOCUS_31640 gene pgi 38000 36363 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962324.1 protein_id gnl|my_center|LOCUS_31640 39378 38080 gene locus_tag LOCUS_31650 39378 38080 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_31650 40351 39380 gene locus_tag LOCUS_31660 40351 39380 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_31660 41138 40359 gene locus_tag LOCUS_31670 41138 40359 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_31670 42851 41640 gene locus_tag LOCUS_31680 gene hppD 42851 41640 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_31680 <44859 42975 gene locus_tag LOCUS_31690 <44859 42975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962399.1:patatin-like phospholipase family protein >Feature sequence039 702 2225 gene locus_tag LOCUS_31700 702 2225 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_31700 3069 6119 gene locus_tag LOCUS_31710 3069 6119 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_31710 6131 7714 gene locus_tag LOCUS_31720 6131 7714 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_31720 8444 11485 gene locus_tag LOCUS_31730 8444 11485 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_31730 11498 13096 gene locus_tag LOCUS_31740 11498 13096 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 protein_id gnl|my_center|LOCUS_31740 13120 13833 gene locus_tag LOCUS_31750 13120 13833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 14068 15804 gene locus_tag LOCUS_31760 14068 15804 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_31760 15892 17325 gene locus_tag LOCUS_31770 15892 17325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 17438 19918 gene locus_tag LOCUS_31780 17438 19918 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107553.1 protein_id gnl|my_center|LOCUS_31780 19971 20213 gene locus_tag LOCUS_31790 19971 20213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 20309 23023 gene locus_tag LOCUS_31800 20309 23023 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_31800 23738 23154 gene locus_tag LOCUS_31810 23738 23154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 25502 23802 gene locus_tag LOCUS_31820 25502 23802 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_31820 27272 25875 gene locus_tag LOCUS_31830 27272 25875 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073366.1 protein_id gnl|my_center|LOCUS_31830 28768 27335 gene locus_tag LOCUS_31840 28768 27335 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767199.1 protein_id gnl|my_center|LOCUS_31840 30189 28786 gene locus_tag LOCUS_31850 30189 28786 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767366.1 protein_id gnl|my_center|LOCUS_31850 33109 30596 gene locus_tag LOCUS_31860 33109 30596 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107129.1 protein_id gnl|my_center|LOCUS_31860 33963 33145 gene locus_tag LOCUS_31870 33963 33145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 34363 38421 gene locus_tag LOCUS_31880 34363 38421 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_31880 40005 38620 gene locus_tag LOCUS_31890 40005 38620 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921292.1 protein_id gnl|my_center|LOCUS_31890 43259 40194 gene locus_tag LOCUS_31900 43259 40194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 <43943 43389 gene locus_tag LOCUS_31910 <43943 43389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202204.1:beta-galactosidase >Feature sequence040 4594 2171 gene locus_tag LOCUS_31920 4594 2171 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_31920 4765 5871 gene locus_tag LOCUS_31930 4765 5871 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108695.1 protein_id gnl|my_center|LOCUS_31930 5912 6706 gene locus_tag LOCUS_31940 5912 6706 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_31940 7103 6717 gene locus_tag LOCUS_31950 7103 6717 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227644.1 protein_id gnl|my_center|LOCUS_31950 8753 7122 gene locus_tag LOCUS_31960 8753 7122 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964434.1 protein_id gnl|my_center|LOCUS_31960 9197 8808 gene locus_tag LOCUS_31970 gene rnpA 9197 8808 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964465.1 protein_id gnl|my_center|LOCUS_31970 11145 9286 gene locus_tag LOCUS_31980 11145 9286 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_31980 12783 11152 gene locus_tag LOCUS_31990 12783 11152 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 protein_id gnl|my_center|LOCUS_31990 14039 13179 gene locus_tag LOCUS_32000 14039 13179 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_32000 14279 16147 gene locus_tag LOCUS_32010 14279 16147 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544192.1 protein_id gnl|my_center|LOCUS_32010 16436 16203 gene locus_tag LOCUS_32020 16436 16203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 16694 16915 gene locus_tag LOCUS_32030 16694 16915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 16890 17063 gene locus_tag LOCUS_32040 16890 17063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 18916 17120 gene locus_tag LOCUS_32050 gene lepA 18916 17120 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964332.1 protein_id gnl|my_center|LOCUS_32050 19913 19029 gene locus_tag LOCUS_32060 19913 19029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 20314 20685 gene locus_tag LOCUS_32070 20314 20685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 20928 23198 gene locus_tag LOCUS_32080 20928 23198 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_32080 23376 24380 gene locus_tag LOCUS_32090 gene dusB 23376 24380 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_32090 25517 24384 gene locus_tag LOCUS_32100 25517 24384 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962414.1 protein_id gnl|my_center|LOCUS_32100 25972 25580 gene locus_tag LOCUS_32110 gene rbfA 25972 25580 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962413.1 protein_id gnl|my_center|LOCUS_32110 26044 26448 gene locus_tag LOCUS_32120 gene mce 26044 26448 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_32120 26506 26580 gene locus_tag LOCUS_t00230 26506 26580 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 28260 26659 gene locus_tag LOCUS_32130 28260 26659 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_32130 29908 28436 gene locus_tag LOCUS_32140 29908 28436 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_32140 33203 29919 gene locus_tag LOCUS_32150 33203 29919 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_32150 34504 33356 gene locus_tag LOCUS_32160 34504 33356 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_32160 34594 35178 gene locus_tag LOCUS_32170 34594 35178 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992764.1 protein_id gnl|my_center|LOCUS_32170 35317 35949 gene locus_tag LOCUS_32180 35317 35949 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 protein_id gnl|my_center|LOCUS_32180 36164 36529 gene locus_tag LOCUS_32190 36164 36529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 36652 40404 gene locus_tag LOCUS_32200 36652 40404 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_32200 40401 41642 gene locus_tag LOCUS_32210 40401 41642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 41696 42253 gene locus_tag LOCUS_32220 41696 42253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 42253 42810 gene locus_tag LOCUS_32230 42253 42810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 >Feature sequence041 894 43 gene locus_tag LOCUS_32240 894 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 972 1373 gene locus_tag LOCUS_32250 972 1373 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963561.1 protein_id gnl|my_center|LOCUS_32250 1426 1923 gene locus_tag LOCUS_32260 1426 1923 CDS product phosphoribosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_32260 2406 1915 gene locus_tag LOCUS_32270 2406 1915 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963564.1 protein_id gnl|my_center|LOCUS_32270 2570 2645 gene locus_tag LOCUS_t00240 2570 2645 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2739 2812 gene locus_tag LOCUS_t00250 2739 2812 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3280 2942 gene locus_tag LOCUS_32280 3280 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 4917 3493 gene locus_tag LOCUS_32290 4917 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 7055 4929 gene locus_tag LOCUS_32300 7055 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 7214 8092 gene locus_tag LOCUS_32310 7214 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963614.1 protein_id gnl|my_center|LOCUS_32310 8089 8580 gene locus_tag LOCUS_32320 8089 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 10714 8927 gene locus_tag LOCUS_32330 10714 8927 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229097.1 protein_id gnl|my_center|LOCUS_32330 11989 10715 gene locus_tag LOCUS_32340 11989 10715 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402917.1 protein_id gnl|my_center|LOCUS_32340 11995 12177 gene locus_tag LOCUS_32350 11995 12177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 12861 13253 gene locus_tag LOCUS_32360 12861 13253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 13390 14238 gene locus_tag LOCUS_32370 13390 14238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 14418 15671 gene locus_tag LOCUS_32380 14418 15671 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963097.1 protein_id gnl|my_center|LOCUS_32380 17555 15708 gene locus_tag LOCUS_32390 17555 15708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 18575 17928 gene locus_tag LOCUS_32400 18575 17928 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 protein_id gnl|my_center|LOCUS_32400 18965 18657 gene locus_tag LOCUS_32410 18965 18657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 19732 18998 gene locus_tag LOCUS_32420 19732 18998 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119458.1 protein_id gnl|my_center|LOCUS_32420 20653 19763 gene locus_tag LOCUS_32430 20653 19763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 21416 20826 gene locus_tag LOCUS_32440 21416 20826 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 protein_id gnl|my_center|LOCUS_32440 22005 21442 gene locus_tag LOCUS_32450 22005 21442 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226768.1 protein_id gnl|my_center|LOCUS_32450 23304 22165 gene locus_tag LOCUS_32460 23304 22165 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963083.1 protein_id gnl|my_center|LOCUS_32460 24579 23341 gene locus_tag LOCUS_32470 24579 23341 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963087.1 protein_id gnl|my_center|LOCUS_32470 25895 24639 gene locus_tag LOCUS_32480 25895 24639 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963088.1 protein_id gnl|my_center|LOCUS_32480 27381 29534 gene locus_tag LOCUS_32490 27381 29534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 29561 30760 gene locus_tag LOCUS_32500 29561 30760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963085.1 protein_id gnl|my_center|LOCUS_32500 30757 32283 gene locus_tag LOCUS_32510 30757 32283 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963086.1 protein_id gnl|my_center|LOCUS_32510 32656 32360 gene locus_tag LOCUS_32520 32656 32360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 32928 34937 gene locus_tag LOCUS_32530 32928 34937 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963167.1 protein_id gnl|my_center|LOCUS_32530 36090 35374 gene locus_tag LOCUS_32540 36090 35374 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_32540 36412 36095 gene locus_tag LOCUS_32550 36412 36095 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963165.1 protein_id gnl|my_center|LOCUS_32550 37475 36417 gene locus_tag LOCUS_32560 37475 36417 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963164.1 protein_id gnl|my_center|LOCUS_32560 38608 37475 gene locus_tag LOCUS_32570 38608 37475 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963163.1 protein_id gnl|my_center|LOCUS_32570 40602 38611 gene locus_tag LOCUS_32580 40602 38611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 41137 40595 gene locus_tag LOCUS_32590 41137 40595 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490721.1 protein_id gnl|my_center|LOCUS_32590 41615 41214 gene locus_tag LOCUS_32600 41615 41214 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_32600 >Feature sequence042 2245 758 gene locus_tag LOCUS_32610 2245 758 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762102.1 protein_id gnl|my_center|LOCUS_32610 3745 2294 gene locus_tag LOCUS_32620 3745 2294 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_32620 5224 3923 gene locus_tag LOCUS_32630 5224 3923 CDS product glycosyhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029020.1 protein_id gnl|my_center|LOCUS_32630 6426 5272 gene locus_tag LOCUS_32640 6426 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 9565 6515 gene locus_tag LOCUS_32650 9565 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 10957 9572 gene locus_tag LOCUS_32660 10957 9572 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921851.1 protein_id gnl|my_center|LOCUS_32660 13333 11042 gene locus_tag LOCUS_32670 13333 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 15343 13343 gene locus_tag LOCUS_32680 15343 13343 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038270.1 protein_id gnl|my_center|LOCUS_32680 16197 15313 gene locus_tag LOCUS_32690 16197 15313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 18499 16208 gene locus_tag LOCUS_32700 18499 16208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 20223 18571 gene locus_tag LOCUS_32710 20223 18571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 22136 20328 gene locus_tag LOCUS_32720 22136 20328 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681494.1 protein_id gnl|my_center|LOCUS_32720 25421 22155 gene locus_tag LOCUS_32730 25421 22155 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765142.1 protein_id gnl|my_center|LOCUS_32730 25650 26666 gene locus_tag LOCUS_32740 25650 26666 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107685.1 protein_id gnl|my_center|LOCUS_32740 28117 26675 gene locus_tag LOCUS_32750 28117 26675 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048253.1 protein_id gnl|my_center|LOCUS_32750 29261 28143 gene locus_tag LOCUS_32760 29261 28143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 31051 29258 gene locus_tag LOCUS_32770 31051 29258 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120263.1 protein_id gnl|my_center|LOCUS_32770 34180 31265 gene locus_tag LOCUS_32780 34180 31265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 36469 34208 gene locus_tag LOCUS_32790 36469 34208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 39293 36900 gene locus_tag LOCUS_32800 39293 36900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 40958 39426 gene locus_tag LOCUS_32810 40958 39426 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922831.1 protein_id gnl|my_center|LOCUS_32810 42617 40959 gene locus_tag LOCUS_32820 42617 40959 CDS product DUF5060 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922627.1 protein_id gnl|my_center|LOCUS_32820 >Feature sequence043 <1 1011 gene locus_tag LOCUS_32830 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368548.1:metabolite traffic protein EboE 1015 2388 gene locus_tag LOCUS_32840 1015 2388 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 protein_id gnl|my_center|LOCUS_32840 2391 2768 gene locus_tag LOCUS_32850 2391 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 4581 2740 gene locus_tag LOCUS_32860 4581 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 5588 5040 gene locus_tag LOCUS_32870 gene rsmD 5588 5040 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_32870 6382 5588 gene locus_tag LOCUS_32880 6382 5588 CDS product DUF3822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963132.1 protein_id gnl|my_center|LOCUS_32880 7049 6396 gene locus_tag LOCUS_32890 7049 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 7151 8590 gene locus_tag LOCUS_32900 7151 8590 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_32900 8696 9265 gene locus_tag LOCUS_32910 8696 9265 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_32910 9414 10082 gene locus_tag LOCUS_32920 gene kdsB 9414 10082 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963128.1 protein_id gnl|my_center|LOCUS_32920 10073 10774 gene locus_tag LOCUS_32930 10073 10774 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_32930 10778 11905 gene locus_tag LOCUS_32940 10778 11905 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072443.1 protein_id gnl|my_center|LOCUS_32940 11987 12523 gene locus_tag LOCUS_32950 11987 12523 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962996.1 protein_id gnl|my_center|LOCUS_32950 12648 13673 gene locus_tag LOCUS_32960 12648 13673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 14462 13752 gene locus_tag LOCUS_32970 14462 13752 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962991.1 protein_id gnl|my_center|LOCUS_32970 14940 14602 gene locus_tag LOCUS_32980 14940 14602 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201313.1 protein_id gnl|my_center|LOCUS_32980 15818 14970 gene locus_tag LOCUS_32990 15818 14970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 16913 15828 gene locus_tag LOCUS_33000 gene gcvT 16913 15828 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_33000 17041 18654 gene locus_tag LOCUS_33010 17041 18654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 19993 18698 gene locus_tag LOCUS_33020 gene thrC 19993 18698 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_33020 20916 19993 gene locus_tag LOCUS_33030 20916 19993 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_33030 23363 20919 gene locus_tag LOCUS_33040 gene thrA 23363 20919 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_33040 23742 25295 gene locus_tag LOCUS_33050 23742 25295 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_33050 25784 25383 gene locus_tag LOCUS_33060 25784 25383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 28533 25987 gene locus_tag LOCUS_33070 28533 25987 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_33070 28790 31330 gene locus_tag LOCUS_33080 gene gyrA 28790 31330 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962907.1 protein_id gnl|my_center|LOCUS_33080 31415 32635 gene locus_tag LOCUS_33090 31415 32635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 33465 32713 gene locus_tag LOCUS_33100 33465 32713 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_33100 34663 33491 gene locus_tag LOCUS_33110 34663 33491 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_33110 34785 36833 gene locus_tag LOCUS_33120 34785 36833 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762019.1 protein_id gnl|my_center|LOCUS_33120 37018 37107 gene locus_tag LOCUS_t00260 37018 37107 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 37179 37254 gene locus_tag LOCUS_t00270 37179 37254 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 38051 38815 gene locus_tag LOCUS_33130 38051 38815 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462069.1 protein_id gnl|my_center|LOCUS_33130 39137 40840 gene locus_tag LOCUS_33140 39137 40840 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028668529.1 protein_id gnl|my_center|LOCUS_33140 >Feature sequence044 1472 45 gene locus_tag LOCUS_33150 1472 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 1924 2379 gene locus_tag LOCUS_33160 1924 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 2455 3138 gene locus_tag LOCUS_33170 2455 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 3747 3154 gene locus_tag LOCUS_33180 3747 3154 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964094.1 protein_id gnl|my_center|LOCUS_33180 3908 4537 gene locus_tag LOCUS_33190 3908 4537 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902568.1 protein_id gnl|my_center|LOCUS_33190 4641 5534 gene locus_tag LOCUS_33200 4641 5534 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_33200 5547 6749 gene locus_tag LOCUS_33210 5547 6749 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_33210 6825 7649 gene locus_tag LOCUS_33220 6825 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 7805 8317 gene locus_tag LOCUS_33230 7805 8317 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963696.1 protein_id gnl|my_center|LOCUS_33230 8367 9167 gene locus_tag LOCUS_33240 8367 9167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 9181 9741 gene locus_tag LOCUS_33250 gene sigZ 9181 9741 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398507.1 protein_id gnl|my_center|LOCUS_33250 9798 10160 gene locus_tag LOCUS_33260 9798 10160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33260 10161 10682 gene locus_tag LOCUS_33270 10161 10682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33270 11776 10778 gene locus_tag LOCUS_33280 11776 10778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682355.1 protein_id gnl|my_center|LOCUS_33280 12088 12651 gene locus_tag LOCUS_33290 12088 12651 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_33290 12852 13241 gene locus_tag LOCUS_33300 12852 13241 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169721.1 protein_id gnl|my_center|LOCUS_33300 14007 13330 gene locus_tag LOCUS_33310 14007 13330 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100427.1 protein_id gnl|my_center|LOCUS_33310 15194 14034 gene locus_tag LOCUS_33320 15194 14034 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962321.1 protein_id gnl|my_center|LOCUS_33320 16217 15222 gene locus_tag LOCUS_33330 16217 15222 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242607.1 protein_id gnl|my_center|LOCUS_33330 16869 16237 gene locus_tag LOCUS_33340 16869 16237 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919325.1 protein_id gnl|my_center|LOCUS_33340 17476 16898 gene locus_tag LOCUS_33350 17476 16898 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963139.1 protein_id gnl|my_center|LOCUS_33350 17667 18143 gene locus_tag LOCUS_33360 17667 18143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 18915 18154 gene locus_tag LOCUS_33370 18915 18154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 19155 20369 gene locus_tag LOCUS_33380 19155 20369 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268636.1 protein_id gnl|my_center|LOCUS_33380 21842 20382 gene locus_tag LOCUS_33390 gene desA 21842 20382 CDS product lysine decarboxylase DesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028583.1 protein_id gnl|my_center|LOCUS_33390 21957 22841 gene locus_tag LOCUS_33400 21957 22841 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931374.1 protein_id gnl|my_center|LOCUS_33400 23055 22855 gene locus_tag LOCUS_33410 23055 22855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 23439 24128 gene locus_tag LOCUS_33420 23439 24128 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_33420 25032 24136 gene locus_tag LOCUS_33430 25032 24136 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548912.1 protein_id gnl|my_center|LOCUS_33430 25267 26211 gene locus_tag LOCUS_33440 25267 26211 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529392.1 protein_id gnl|my_center|LOCUS_33440 26231 27025 gene locus_tag LOCUS_33450 26231 27025 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 protein_id gnl|my_center|LOCUS_33450 27104 27733 gene locus_tag LOCUS_33460 27104 27733 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 protein_id gnl|my_center|LOCUS_33460 27948 28622 gene locus_tag LOCUS_33470 27948 28622 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185713.1 protein_id gnl|my_center|LOCUS_33470 28650 29657 gene locus_tag LOCUS_33480 28650 29657 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266546.1 protein_id gnl|my_center|LOCUS_33480 29688 30155 gene locus_tag LOCUS_33490 29688 30155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 30172 31020 gene locus_tag LOCUS_33500 30172 31020 CDS product DUF4437 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616129.1 protein_id gnl|my_center|LOCUS_33500 31023 32129 gene locus_tag LOCUS_33510 31023 32129 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072052.1 protein_id gnl|my_center|LOCUS_33510 32375 33928 gene locus_tag LOCUS_33520 32375 33928 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963094.1 protein_id gnl|my_center|LOCUS_33520 33993 34592 gene locus_tag LOCUS_33530 33993 34592 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141342.1 protein_id gnl|my_center|LOCUS_33530 34589 36475 gene locus_tag LOCUS_33540 34589 36475 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943387.1 protein_id gnl|my_center|LOCUS_33540 36598 37575 gene locus_tag LOCUS_33550 36598 37575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 >Feature sequence045 545 1957 gene locus_tag LOCUS_33560 545 1957 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_33560 1992 5156 gene locus_tag LOCUS_33570 1992 5156 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_33570 5192 6943 gene locus_tag LOCUS_33580 gene nrfD 5192 6943 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_33580 6946 7476 gene locus_tag LOCUS_33590 6946 7476 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_33590 7479 8039 gene locus_tag LOCUS_33600 7479 8039 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_33600 8055 9392 gene locus_tag LOCUS_33610 8055 9392 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_33610 9423 10526 gene locus_tag LOCUS_33620 9423 10526 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_33620 10601 12427 gene locus_tag LOCUS_33630 10601 12427 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_33630 12585 13406 gene locus_tag LOCUS_33640 12585 13406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 15702 13438 gene locus_tag LOCUS_33650 15702 13438 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839113.1 protein_id gnl|my_center|LOCUS_33650 15822 16844 gene locus_tag LOCUS_33660 gene ruvB 15822 16844 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964224.1 protein_id gnl|my_center|LOCUS_33660 16846 17766 gene locus_tag LOCUS_33670 gene queG 16846 17766 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_33670 17887 19212 gene locus_tag LOCUS_33680 17887 19212 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 protein_id gnl|my_center|LOCUS_33680 19328 21625 gene locus_tag LOCUS_33690 19328 21625 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_33690 21645 22262 gene locus_tag LOCUS_33700 gene ruvA 21645 22262 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964221.1 protein_id gnl|my_center|LOCUS_33700 22331 29461 gene locus_tag LOCUS_33710 gene sprA 22331 29461 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100614127.1 protein_id gnl|my_center|LOCUS_33710 29620 30000 gene locus_tag LOCUS_33720 gene gcvH 29620 30000 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964219.1 protein_id gnl|my_center|LOCUS_33720 29990 30394 gene locus_tag LOCUS_33730 29990 30394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 30448 31152 gene locus_tag LOCUS_33740 30448 31152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 31328 32227 gene locus_tag LOCUS_33750 gene cyoE 31328 32227 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964205.1 protein_id gnl|my_center|LOCUS_33750 32230 32817 gene locus_tag LOCUS_33760 32230 32817 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_33760 32915 33904 gene locus_tag LOCUS_33770 32915 33904 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_33770 33956 34339 gene locus_tag LOCUS_33780 33956 34339 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964208.1 protein_id gnl|my_center|LOCUS_33780 34441 35079 gene locus_tag LOCUS_33790 34441 35079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964209.1 protein_id gnl|my_center|LOCUS_33790 35106 35828 gene locus_tag LOCUS_33800 35106 35828 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 protein_id gnl|my_center|LOCUS_33800 35829 36362 gene locus_tag LOCUS_33810 35829 36362 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_33810 36402 36635 gene locus_tag LOCUS_33820 36402 36635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964212.1 protein_id gnl|my_center|LOCUS_33820 >Feature sequence046 <1 1049 gene locus_tag LOCUS_33830 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_184173497.1:VCBS repeat-containing protein 1333 2658 gene locus_tag LOCUS_33840 1333 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 3428 2712 gene locus_tag LOCUS_33850 3428 2712 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970134.1 protein_id gnl|my_center|LOCUS_33850 12337 3557 gene locus_tag LOCUS_33860 12337 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 12473 13594 gene locus_tag LOCUS_33870 12473 13594 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403228.1 protein_id gnl|my_center|LOCUS_33870 13641 14042 gene locus_tag LOCUS_33880 13641 14042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 14854 14045 gene locus_tag LOCUS_33890 gene murQ 14854 14045 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760452.1 protein_id gnl|my_center|LOCUS_33890 15609 14860 gene locus_tag LOCUS_33900 15609 14860 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096592.1 protein_id gnl|my_center|LOCUS_33900 15807 17735 gene locus_tag LOCUS_33910 15807 17735 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766195.1 protein_id gnl|my_center|LOCUS_33910 18039 19217 gene locus_tag LOCUS_33920 18039 19217 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762567.1 protein_id gnl|my_center|LOCUS_33920 19210 20781 gene locus_tag LOCUS_33930 19210 20781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 20786 21862 gene locus_tag LOCUS_33940 20786 21862 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_33940 21923 22183 gene locus_tag LOCUS_33950 21923 22183 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262767.1 protein_id gnl|my_center|LOCUS_33950 22208 23920 gene locus_tag LOCUS_33960 22208 23920 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188216241.1 protein_id gnl|my_center|LOCUS_33960 24035 25942 gene locus_tag LOCUS_33970 gene acs 24035 25942 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_33970 27243 26035 gene locus_tag LOCUS_33980 27243 26035 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257181.1 protein_id gnl|my_center|LOCUS_33980 27353 27961 gene locus_tag LOCUS_33990 gene udk 27353 27961 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963257.1 protein_id gnl|my_center|LOCUS_33990 27966 28298 gene locus_tag LOCUS_34000 27966 28298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 28711 29484 gene locus_tag LOCUS_34010 28711 29484 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_34010 29484 30386 gene locus_tag LOCUS_34020 29484 30386 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_34020 30379 31017 gene locus_tag LOCUS_34030 30379 31017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 31104 31775 gene locus_tag LOCUS_34040 gene dapB 31104 31775 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_34040 31880 33580 gene locus_tag LOCUS_34050 gene lepB 31880 33580 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963265.1 protein_id gnl|my_center|LOCUS_34050 33621 34811 gene locus_tag LOCUS_34060 33621 34811 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_34060 35893 34826 gene locus_tag LOCUS_34070 35893 34826 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964034.1 protein_id gnl|my_center|LOCUS_34070 >Feature sequence047 <1 1316 gene locus_tag LOCUS_34080 <1 1316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118376.1:sulfatase-like hydrolase/transferase 1756 4818 gene locus_tag LOCUS_34090 1756 4818 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_34090 4874 6340 gene locus_tag LOCUS_34100 4874 6340 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_34100 6496 8259 gene locus_tag LOCUS_34110 6496 8259 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117792.1 protein_id gnl|my_center|LOCUS_34110 8492 9817 gene locus_tag LOCUS_34120 8492 9817 CDS product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703671.1 protein_id gnl|my_center|LOCUS_34120 9825 10601 gene locus_tag LOCUS_34130 9825 10601 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_34130 10657 11511 gene locus_tag LOCUS_34140 10657 11511 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975564.1 protein_id gnl|my_center|LOCUS_34140 11519 12307 gene locus_tag LOCUS_34150 11519 12307 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_34150 12313 13632 gene locus_tag LOCUS_34160 12313 13632 CDS product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694544.1 protein_id gnl|my_center|LOCUS_34160 13702 14865 gene locus_tag LOCUS_34170 13702 14865 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220815.1 protein_id gnl|my_center|LOCUS_34170 15523 14888 gene locus_tag LOCUS_34180 15523 14888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192462057.1 protein_id gnl|my_center|LOCUS_34180 15728 16027 gene locus_tag LOCUS_34190 gene trxA 15728 16027 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963919.1 protein_id gnl|my_center|LOCUS_34190 16198 16851 gene locus_tag LOCUS_34200 gene upp 16198 16851 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_34200 18362 16938 gene locus_tag LOCUS_34210 18362 16938 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_34210 22633 18536 gene locus_tag LOCUS_34220 22633 18536 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_34220 22807 23052 gene locus_tag LOCUS_34230 22807 23052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 23003 26008 gene locus_tag LOCUS_34240 23003 26008 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_34240 26019 27578 gene locus_tag LOCUS_34250 26019 27578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 27643 29124 gene locus_tag LOCUS_34260 27643 29124 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_34260 29344 30000 gene locus_tag LOCUS_34270 29344 30000 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121534.1 protein_id gnl|my_center|LOCUS_34270 30049 31662 gene locus_tag LOCUS_34280 30049 31662 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427770.1 protein_id gnl|my_center|LOCUS_34280 31714 31887 gene locus_tag LOCUS_34290 31714 31887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34290 31888 33231 gene locus_tag LOCUS_34300 31888 33231 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108604.1 protein_id gnl|my_center|LOCUS_34300 33259 35358 gene locus_tag LOCUS_34310 33259 35358 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119288.1 protein_id gnl|my_center|LOCUS_34310 35633 35415 gene locus_tag LOCUS_34320 35633 35415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 36219 35719 gene locus_tag LOCUS_34330 36219 35719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 37025 36528 gene locus_tag LOCUS_34340 37025 36528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 >Feature sequence048 426 1442 gene locus_tag LOCUS_34350 gene murB 426 1442 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964097.1 protein_id gnl|my_center|LOCUS_34350 1652 2218 gene locus_tag LOCUS_34360 1652 2218 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925679.1 protein_id gnl|my_center|LOCUS_34360 2327 2980 gene locus_tag LOCUS_34370 2327 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 3066 3281 gene locus_tag LOCUS_34380 3066 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 3308 3862 gene locus_tag LOCUS_34390 3308 3862 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_34390 4016 4891 gene locus_tag LOCUS_34400 gene lipA 4016 4891 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_34400 4997 6007 gene locus_tag LOCUS_34410 gene gap 4997 6007 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963588.1 protein_id gnl|my_center|LOCUS_34410 6058 8241 gene locus_tag LOCUS_34420 6058 8241 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_34420 9178 8231 gene locus_tag LOCUS_34430 gene lpxK 9178 8231 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963591.1 protein_id gnl|my_center|LOCUS_34430 9277 10371 gene locus_tag LOCUS_34440 9277 10371 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963351.1 protein_id gnl|my_center|LOCUS_34440 10377 11156 gene locus_tag LOCUS_34450 10377 11156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_34450 11286 11681 gene locus_tag LOCUS_34460 11286 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 13018 11678 gene locus_tag LOCUS_34470 13018 11678 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964302.1 protein_id gnl|my_center|LOCUS_34470 13896 13348 gene locus_tag LOCUS_34480 gene clpP 13896 13348 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812508.1 protein_id gnl|my_center|LOCUS_34480 14356 16737 gene locus_tag LOCUS_34490 14356 16737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 16748 17653 gene locus_tag LOCUS_34500 16748 17653 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_34500 17773 18429 gene locus_tag LOCUS_34510 17773 18429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 19587 18433 gene locus_tag LOCUS_34520 19587 18433 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480120.1 protein_id gnl|my_center|LOCUS_34520 20789 19716 gene locus_tag LOCUS_34530 20789 19716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 22233 20962 gene locus_tag LOCUS_34540 gene kynU 22233 20962 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_34540 22757 22290 gene locus_tag LOCUS_34550 22757 22290 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621142.1 protein_id gnl|my_center|LOCUS_34550 22825 23466 gene locus_tag LOCUS_34560 22825 23466 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_34560 24004 23432 gene locus_tag LOCUS_34570 24004 23432 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_34570 24345 24007 gene locus_tag LOCUS_34580 24345 24007 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964182.1 protein_id gnl|my_center|LOCUS_34580 26741 24429 gene locus_tag LOCUS_34590 26741 24429 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_34590 27350 26802 gene locus_tag LOCUS_34600 27350 26802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964227.1 protein_id gnl|my_center|LOCUS_34600 28188 27358 gene locus_tag LOCUS_34610 28188 27358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 28986 28246 gene locus_tag LOCUS_34620 28986 28246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 29764 29015 gene locus_tag LOCUS_34630 29764 29015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 30095 33982 gene locus_tag LOCUS_34640 30095 33982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 34019 35167 gene locus_tag LOCUS_34650 34019 35167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 >Feature sequence049 <1 1043 gene locus_tag LOCUS_34660 <1 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865143.1:threonine synthase 1054 2127 gene locus_tag LOCUS_34670 1054 2127 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_34670 2124 3185 gene locus_tag LOCUS_34680 gene ykfB 2124 3185 CDS product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244980.1 protein_id gnl|my_center|LOCUS_34680 5754 3190 gene locus_tag LOCUS_34690 5754 3190 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839988.1 protein_id gnl|my_center|LOCUS_34690 6719 6087 gene locus_tag LOCUS_34700 6719 6087 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461288.1 protein_id gnl|my_center|LOCUS_34700 6682 6897 gene locus_tag LOCUS_34710 6682 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 6925 8736 gene locus_tag LOCUS_34720 6925 8736 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_34720 9178 8762 gene locus_tag LOCUS_34730 9178 8762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 9581 13216 gene locus_tag LOCUS_34740 9581 13216 CDS product DUF3857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583095.1 protein_id gnl|my_center|LOCUS_34740 13814 13218 gene locus_tag LOCUS_34750 13814 13218 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_34750 13874 14920 gene locus_tag LOCUS_34760 gene pdxA 13874 14920 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964471.1 protein_id gnl|my_center|LOCUS_34760 15084 15605 gene locus_tag LOCUS_34770 15084 15605 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_34770 15613 15810 gene locus_tag LOCUS_34780 gene rpmF 15613 15810 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964469.1 protein_id gnl|my_center|LOCUS_34780 15989 16981 gene locus_tag LOCUS_34790 15989 16981 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964468.1 protein_id gnl|my_center|LOCUS_34790 17015 17503 gene locus_tag LOCUS_34800 gene accB 17015 17503 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_34800 17590 18942 gene locus_tag LOCUS_34810 gene accC 17590 18942 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_34810 18987 20102 gene locus_tag LOCUS_34820 18987 20102 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_34820 20229 21950 gene locus_tag LOCUS_34830 gene araD 20229 21950 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976013.1 protein_id gnl|my_center|LOCUS_34830 21955 22404 gene locus_tag LOCUS_34840 21955 22404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962689.1 protein_id gnl|my_center|LOCUS_34840 22732 22424 gene locus_tag LOCUS_34850 22732 22424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 23084 23245 gene locus_tag LOCUS_34860 23084 23245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 23719 23333 gene locus_tag LOCUS_34870 23719 23333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 24373 23825 gene locus_tag LOCUS_34880 24373 23825 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922248.1 protein_id gnl|my_center|LOCUS_34880 25544 24696 gene locus_tag LOCUS_34890 25544 24696 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107849.1 protein_id gnl|my_center|LOCUS_34890 25726 26235 gene locus_tag LOCUS_34900 25726 26235 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963609.1 protein_id gnl|my_center|LOCUS_34900 27705 26269 gene locus_tag LOCUS_34910 gene pyk 27705 26269 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962380.1 protein_id gnl|my_center|LOCUS_34910 28173 27709 gene locus_tag LOCUS_34920 28173 27709 CDS product IPExxxVDY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962379.1 protein_id gnl|my_center|LOCUS_34920 29020 28283 gene locus_tag LOCUS_34930 gene rnc 29020 28283 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962378.1 protein_id gnl|my_center|LOCUS_34930 30280 29027 gene locus_tag LOCUS_34940 gene fabF 30280 29027 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962377.1 protein_id gnl|my_center|LOCUS_34940 30626 30393 gene locus_tag LOCUS_34950 30626 30393 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007137004.1 protein_id gnl|my_center|LOCUS_34950 30786 31355 gene locus_tag LOCUS_34960 30786 31355 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962376.1 protein_id gnl|my_center|LOCUS_34960 31355 31990 gene locus_tag LOCUS_34970 31355 31990 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201899.1 protein_id gnl|my_center|LOCUS_34970 32194 33120 gene locus_tag LOCUS_34980 32194 33120 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_34980 33166 35064 gene locus_tag LOCUS_34990 33166 35064 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_34990 >Feature sequence050 <1 2373 gene locus_tag LOCUS_35000 <1 2373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798907.1:TonB-dependent receptor 2387 3946 gene locus_tag LOCUS_35010 2387 3946 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098075356.1 protein_id gnl|my_center|LOCUS_35010 3958 5271 gene locus_tag LOCUS_35020 3958 5271 CDS product SusF/SusE family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203231.1 protein_id gnl|my_center|LOCUS_35020 5283 7571 gene locus_tag LOCUS_35030 5283 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 7807 9714 gene locus_tag LOCUS_35040 7807 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 9835 11673 gene locus_tag LOCUS_35050 9835 11673 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839780.1 protein_id gnl|my_center|LOCUS_35050 12840 11911 gene locus_tag LOCUS_35060 12840 11911 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925938.1 protein_id gnl|my_center|LOCUS_35060 14411 13611 gene locus_tag LOCUS_35070 14411 13611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 14932 15387 gene locus_tag LOCUS_35080 14932 15387 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_35080 15674 16723 gene locus_tag LOCUS_35090 15674 16723 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970232.1 protein_id gnl|my_center|LOCUS_35090 16966 18798 gene locus_tag LOCUS_35100 16966 18798 CDS product FAD-NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716940.1 protein_id gnl|my_center|LOCUS_35100 19005 19373 gene locus_tag LOCUS_35110 19005 19373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 21581 19488 gene locus_tag LOCUS_35120 21581 19488 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208304.1 protein_id gnl|my_center|LOCUS_35120 21725 23086 gene locus_tag LOCUS_35130 21725 23086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 23901 23164 gene locus_tag LOCUS_35140 23901 23164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 25860 24085 gene locus_tag LOCUS_35150 25860 24085 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921313.1 protein_id gnl|my_center|LOCUS_35150 26658 28934 gene locus_tag LOCUS_35160 26658 28934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 29094 30554 gene locus_tag LOCUS_35170 29094 30554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 31003 30566 gene locus_tag LOCUS_35180 31003 30566 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_35180 31391 31570 gene locus_tag LOCUS_35190 31391 31570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 34269 31768 gene locus_tag LOCUS_35200 34269 31768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 34718 34275 gene locus_tag LOCUS_35210 34718 34275 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_35210 >Feature sequence051 2176 389 gene locus_tag LOCUS_35220 gene uvrC 2176 389 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_35220 2604 3167 gene locus_tag LOCUS_35230 2604 3167 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962396.1 protein_id gnl|my_center|LOCUS_35230 3819 3172 gene locus_tag LOCUS_35240 3819 3172 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962395.1 protein_id gnl|my_center|LOCUS_35240 4402 3857 gene locus_tag LOCUS_35250 4402 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 4926 4543 gene locus_tag LOCUS_35260 4926 4543 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_35260 8329 4931 gene locus_tag LOCUS_35270 gene ileS 8329 4931 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962393.1 protein_id gnl|my_center|LOCUS_35270 8519 8959 gene locus_tag LOCUS_35280 8519 8959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 11447 9036 gene locus_tag LOCUS_35290 11447 9036 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141609.1 protein_id gnl|my_center|LOCUS_35290 12168 11449 gene locus_tag LOCUS_35300 gene recO 12168 11449 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962443.1 protein_id gnl|my_center|LOCUS_35300 13640 12297 gene locus_tag LOCUS_35310 gene gdhA 13640 12297 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_35310 14885 13731 gene locus_tag LOCUS_35320 14885 13731 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_35320 14974 15714 gene locus_tag LOCUS_35330 14974 15714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 16179 15718 gene locus_tag LOCUS_35340 16179 15718 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_35340 16197 16619 gene locus_tag LOCUS_35350 16197 16619 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962523.1 protein_id gnl|my_center|LOCUS_35350 16616 17518 gene locus_tag LOCUS_35360 16616 17518 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_35360 17996 17493 gene locus_tag LOCUS_35370 17996 17493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 18093 19067 gene locus_tag LOCUS_35380 18093 19067 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 protein_id gnl|my_center|LOCUS_35380 20805 19147 gene locus_tag LOCUS_35390 20805 19147 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921422.1 protein_id gnl|my_center|LOCUS_35390 21195 22157 gene locus_tag LOCUS_35400 21195 22157 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_35400 22233 22718 gene locus_tag LOCUS_35410 22233 22718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 22925 23941 gene locus_tag LOCUS_35420 22925 23941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 25555 23990 gene locus_tag LOCUS_35430 25555 23990 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_35430 26702 25836 gene locus_tag LOCUS_35440 26702 25836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 26922 27917 gene locus_tag LOCUS_35450 26922 27917 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962320.1 protein_id gnl|my_center|LOCUS_35450 29681 28014 gene locus_tag LOCUS_35460 gene glpD 29681 28014 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233382.1 protein_id gnl|my_center|LOCUS_35460 31229 29721 gene locus_tag LOCUS_35470 gene glpK 31229 29721 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175870.1 protein_id gnl|my_center|LOCUS_35470 33650 31305 gene locus_tag LOCUS_35480 gene pbpC 33650 31305 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 protein_id gnl|my_center|LOCUS_35480 33955 33647 gene locus_tag LOCUS_35490 33955 33647 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168851.1 protein_id gnl|my_center|LOCUS_35490 34331 33978 gene locus_tag LOCUS_35500 34331 33978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_35500 >Feature sequence052 2375 1410 gene locus_tag LOCUS_35510 2375 1410 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_35510 3226 2564 gene locus_tag LOCUS_35520 3226 2564 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964116.1 protein_id gnl|my_center|LOCUS_35520 3396 3689 gene locus_tag LOCUS_35530 3396 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 5106 3748 gene locus_tag LOCUS_35540 gene mtaB 5106 3748 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_35540 6509 5334 gene locus_tag LOCUS_35550 6509 5334 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_35550 6944 6645 gene locus_tag LOCUS_35560 6944 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 7110 7631 gene locus_tag LOCUS_35570 7110 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 7829 8779 gene locus_tag LOCUS_35580 7829 8779 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_35580 8843 10552 gene locus_tag LOCUS_35590 8843 10552 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963276.1 protein_id gnl|my_center|LOCUS_35590 10675 12378 gene locus_tag LOCUS_35600 10675 12378 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_35600 12437 12991 gene locus_tag LOCUS_35610 12437 12991 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 protein_id gnl|my_center|LOCUS_35610 13003 13518 gene locus_tag LOCUS_35620 13003 13518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 13511 13975 gene locus_tag LOCUS_35630 13511 13975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 15005 13977 gene locus_tag LOCUS_35640 15005 13977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962781.1 protein_id gnl|my_center|LOCUS_35640 15078 16292 gene locus_tag LOCUS_35650 15078 16292 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_35650 16488 20171 gene locus_tag LOCUS_35660 gene purL 16488 20171 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962854.1 protein_id gnl|my_center|LOCUS_35660 20253 20705 gene locus_tag LOCUS_35670 20253 20705 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928801.1 protein_id gnl|my_center|LOCUS_35670 21096 22871 gene locus_tag LOCUS_35680 21096 22871 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_35680 23056 23538 gene locus_tag LOCUS_35690 23056 23538 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_35690 23561 25966 gene locus_tag LOCUS_35700 23561 25966 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_35700 25971 27161 gene locus_tag LOCUS_35710 25971 27161 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_35710 27191 28987 gene locus_tag LOCUS_35720 27191 28987 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_35720 30787 29069 gene locus_tag LOCUS_35730 30787 29069 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403165.1 protein_id gnl|my_center|LOCUS_35730 30974 33184 gene locus_tag LOCUS_35740 30974 33184 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_35740 33317 34387 gene locus_tag LOCUS_35750 33317 34387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 >Feature sequence053 2016 367 gene locus_tag LOCUS_35760 2016 367 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_35760 5078 2034 gene locus_tag LOCUS_35770 5078 2034 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_35770 6255 5470 gene locus_tag LOCUS_35780 6255 5470 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_35780 7567 6377 gene locus_tag LOCUS_35790 7567 6377 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072442.1 protein_id gnl|my_center|LOCUS_35790 8255 7617 gene locus_tag LOCUS_35800 8255 7617 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973894.1 protein_id gnl|my_center|LOCUS_35800 9602 8406 gene locus_tag LOCUS_35810 9602 8406 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_35810 9876 10829 gene locus_tag LOCUS_35820 gene rlmF 9876 10829 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109384.1 protein_id gnl|my_center|LOCUS_35820 11163 12158 gene locus_tag LOCUS_35830 gene lpxD 11163 12158 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963712.1 protein_id gnl|my_center|LOCUS_35830 12956 12315 gene locus_tag LOCUS_35840 12956 12315 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975300.1 protein_id gnl|my_center|LOCUS_35840 15489 13678 gene locus_tag LOCUS_35850 15489 13678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 16923 15721 gene locus_tag LOCUS_35860 16923 15721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 17356 17922 gene locus_tag LOCUS_35870 17356 17922 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208184.1 protein_id gnl|my_center|LOCUS_35870 17970 18419 gene locus_tag LOCUS_35880 17970 18419 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122365.1 protein_id gnl|my_center|LOCUS_35880 18654 19643 gene locus_tag LOCUS_35890 gene gap 18654 19643 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081074.1 protein_id gnl|my_center|LOCUS_35890 19829 20872 gene locus_tag LOCUS_35900 19829 20872 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108866.1 protein_id gnl|my_center|LOCUS_35900 21962 20904 gene locus_tag LOCUS_35910 21962 20904 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405131.1 protein_id gnl|my_center|LOCUS_35910 23848 22136 gene locus_tag LOCUS_35920 23848 22136 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962729.1 protein_id gnl|my_center|LOCUS_35920 25587 24067 gene locus_tag LOCUS_35930 25587 24067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962728.1 protein_id gnl|my_center|LOCUS_35930 27014 25875 gene locus_tag LOCUS_35940 27014 25875 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042596355.1 protein_id gnl|my_center|LOCUS_35940 27202 27672 gene locus_tag LOCUS_35950 27202 27672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 27686 28375 gene locus_tag LOCUS_35960 27686 28375 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_35960 28486 30207 gene locus_tag LOCUS_35970 28486 30207 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_35970 >Feature sequence054 2346 1219 gene locus_tag LOCUS_35980 2346 1219 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_35980 3116 2547 gene locus_tag LOCUS_35990 3116 2547 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681497.1 protein_id gnl|my_center|LOCUS_35990 5003 3432 gene locus_tag LOCUS_36000 5003 3432 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_36000 6547 5042 gene locus_tag LOCUS_36010 6547 5042 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_36010 8181 6664 gene locus_tag LOCUS_36020 8181 6664 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_36020 11433 8188 gene locus_tag LOCUS_36030 11433 8188 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_36030 12850 11696 gene locus_tag LOCUS_36040 12850 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 12970 13545 gene locus_tag LOCUS_36050 12970 13545 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796768.1 protein_id gnl|my_center|LOCUS_36050 16681 13571 gene locus_tag LOCUS_36060 gene ccsA 16681 13571 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_36060 17054 17818 gene locus_tag LOCUS_36070 17054 17818 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 protein_id gnl|my_center|LOCUS_36070 17802 18329 gene locus_tag LOCUS_36080 17802 18329 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_36080 18332 18913 gene locus_tag LOCUS_36090 18332 18913 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963543.1 protein_id gnl|my_center|LOCUS_36090 18949 19896 gene locus_tag LOCUS_36100 18949 19896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 19901 20446 gene locus_tag LOCUS_36110 19901 20446 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071240.1 protein_id gnl|my_center|LOCUS_36110 20597 23122 gene locus_tag LOCUS_36120 20597 23122 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974050.1 protein_id gnl|my_center|LOCUS_36120 23230 24963 gene locus_tag LOCUS_36130 23230 24963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 25106 26158 gene locus_tag LOCUS_36140 25106 26158 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107293.1 protein_id gnl|my_center|LOCUS_36140 26355 29399 gene locus_tag LOCUS_36150 26355 29399 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090706773.1 protein_id gnl|my_center|LOCUS_36150 29411 31027 gene locus_tag LOCUS_36160 29411 31027 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109269.1 protein_id gnl|my_center|LOCUS_36160 >Feature sequence055 598 777 gene locus_tag LOCUS_36170 598 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 1500 1838 gene locus_tag LOCUS_36180 1500 1838 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932186.1 protein_id gnl|my_center|LOCUS_36180 1870 3102 gene locus_tag LOCUS_36190 gene amt 1870 3102 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_36190 3219 4283 gene locus_tag LOCUS_36200 3219 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 5011 4361 gene locus_tag LOCUS_36210 5011 4361 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_36210 5095 5832 gene locus_tag LOCUS_36220 5095 5832 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981419.1 protein_id gnl|my_center|LOCUS_36220 7215 5839 gene locus_tag LOCUS_36230 7215 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 8163 7339 gene locus_tag LOCUS_36240 gene mscS 8163 7339 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_36240 10363 8294 gene locus_tag LOCUS_36250 10363 8294 CDS product choice-of-anchor L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963773.1 protein_id gnl|my_center|LOCUS_36250 10911 10465 gene locus_tag LOCUS_36260 10911 10465 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869023.1 protein_id gnl|my_center|LOCUS_36260 11038 11451 gene locus_tag LOCUS_36270 11038 11451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 11520 12392 gene locus_tag LOCUS_36280 gene purU 11520 12392 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762395.1 protein_id gnl|my_center|LOCUS_36280 12500 13204 gene locus_tag LOCUS_36290 12500 13204 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_36290 14251 13463 gene locus_tag LOCUS_36300 14251 13463 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962703.1 protein_id gnl|my_center|LOCUS_36300 14636 14833 gene locus_tag LOCUS_36310 14636 14833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 15655 14846 gene locus_tag LOCUS_36320 gene pyrF 15655 14846 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_36320 16779 15703 gene locus_tag LOCUS_36330 gene prfA 16779 15703 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964025.1 protein_id gnl|my_center|LOCUS_36330 18044 17088 gene locus_tag LOCUS_36340 18044 17088 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059223299.1 protein_id gnl|my_center|LOCUS_36340 18484 18080 gene locus_tag LOCUS_36350 18484 18080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 18995 18543 gene locus_tag LOCUS_36360 18995 18543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 20227 19046 gene locus_tag LOCUS_36370 20227 19046 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_36370 21160 20312 gene locus_tag LOCUS_36380 21160 20312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 23476 21290 gene locus_tag LOCUS_36390 23476 21290 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_36390 23687 24703 gene locus_tag LOCUS_36400 23687 24703 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922049.1 protein_id gnl|my_center|LOCUS_36400 25923 24793 gene locus_tag LOCUS_36410 25923 24793 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207445.1 protein_id gnl|my_center|LOCUS_36410 27024 26086 gene locus_tag LOCUS_36420 27024 26086 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_36420 28256 27744 gene locus_tag LOCUS_36430 28256 27744 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_36430 28386 28460 gene locus_tag LOCUS_t00280 28386 28460 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 28691 29152 gene locus_tag LOCUS_36440 28691 29152 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_36440 29155 29568 gene locus_tag LOCUS_36450 29155 29568 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_36450 29862 29587 gene locus_tag LOCUS_36460 29862 29587 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_36460 30726 29890 gene locus_tag LOCUS_36470 gene prmA 30726 29890 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_36470 31635 30886 gene locus_tag LOCUS_36480 gene tpiA 31635 30886 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963550.1 protein_id gnl|my_center|LOCUS_36480 >Feature sequence056 194 472 gene locus_tag LOCUS_36490 194 472 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_36490 1261 491 gene locus_tag LOCUS_36500 1261 491 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062784820.1 protein_id gnl|my_center|LOCUS_36500 1368 3617 gene locus_tag LOCUS_36510 1368 3617 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_36510 3653 4456 gene locus_tag LOCUS_36520 gene sppA 3653 4456 CDS product fructose-phosphate phosphohydrolase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263015.1 protein_id gnl|my_center|LOCUS_36520 4488 5804 gene locus_tag LOCUS_36530 4488 5804 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_36530 6804 5830 gene locus_tag LOCUS_36540 6804 5830 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325827.1 protein_id gnl|my_center|LOCUS_36540 8374 6806 gene locus_tag LOCUS_36550 8374 6806 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122546.1 protein_id gnl|my_center|LOCUS_36550 9099 8425 gene locus_tag LOCUS_36560 gene rpiA 9099 8425 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364539.1 protein_id gnl|my_center|LOCUS_36560 9379 10008 gene locus_tag LOCUS_36570 9379 10008 CDS product DUF4369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963060.1 protein_id gnl|my_center|LOCUS_36570 10322 10053 gene locus_tag LOCUS_36580 10322 10053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963895.1 protein_id gnl|my_center|LOCUS_36580 11367 10405 gene locus_tag LOCUS_36590 11367 10405 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963896.1 protein_id gnl|my_center|LOCUS_36590 11806 11399 gene locus_tag LOCUS_36600 11806 11399 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963898.1 protein_id gnl|my_center|LOCUS_36600 12335 11790 gene locus_tag LOCUS_36610 gene idi 12335 11790 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_36610 22941 12526 gene locus_tag LOCUS_36620 22941 12526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 24213 23260 gene locus_tag LOCUS_36630 24213 23260 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_36630 26246 24219 gene locus_tag LOCUS_36640 26246 24219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 <27203 26268 gene locus_tag LOCUS_36650 <27203 26268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_074472092.1:collagen-like protein >Feature sequence057 1508 459 gene locus_tag LOCUS_36660 gene hisC 1508 459 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963106.1 protein_id gnl|my_center|LOCUS_36660 2790 1501 gene locus_tag LOCUS_36670 gene hisD 2790 1501 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963107.1 protein_id gnl|my_center|LOCUS_36670 3233 2796 gene locus_tag LOCUS_36680 3233 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 4100 3243 gene locus_tag LOCUS_36690 gene hisG 4100 3243 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963108.1 protein_id gnl|my_center|LOCUS_36690 5147 4335 gene locus_tag LOCUS_36700 5147 4335 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_36700 7035 5158 gene locus_tag LOCUS_36710 7035 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_36710 7994 7248 gene locus_tag LOCUS_36720 gene fabG 7994 7248 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_36720 8983 8111 gene locus_tag LOCUS_36730 gene sucD 8983 8111 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963119.1 protein_id gnl|my_center|LOCUS_36730 9986 9054 gene locus_tag LOCUS_36740 9986 9054 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_36740 10616 10050 gene locus_tag LOCUS_36750 gene efp 10616 10050 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_36750 11486 10701 gene locus_tag LOCUS_36760 gene lpxA 11486 10701 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_36760 12873 11488 gene locus_tag LOCUS_36770 12873 11488 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963124.1 protein_id gnl|my_center|LOCUS_36770 13903 12854 gene locus_tag LOCUS_36780 gene lpxD 13903 12854 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_36780 15030 13927 gene locus_tag LOCUS_36790 15030 13927 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_36790 15303 16844 gene locus_tag LOCUS_36800 15303 16844 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_36800 16858 17268 gene locus_tag LOCUS_36810 gene tsaE 16858 17268 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_36810 17464 17607 gene locus_tag LOCUS_36820 17464 17607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 17716 18381 gene locus_tag LOCUS_36830 17716 18381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 18491 19690 gene locus_tag LOCUS_36840 18491 19690 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_36840 19835 20215 gene locus_tag LOCUS_36850 19835 20215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 21421 20255 gene locus_tag LOCUS_36860 21421 20255 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_36860 21552 22616 gene locus_tag LOCUS_36870 gene aroB 21552 22616 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963817.1 protein_id gnl|my_center|LOCUS_36870 22749 23075 gene locus_tag LOCUS_36880 22749 23075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963820.1 protein_id gnl|my_center|LOCUS_36880 23625 23107 gene locus_tag LOCUS_36890 23625 23107 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_36890 24174 23695 gene locus_tag LOCUS_36900 24174 23695 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962999.1 protein_id gnl|my_center|LOCUS_36900 25399 24290 gene locus_tag LOCUS_36910 25399 24290 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_36910 25691 26071 gene locus_tag LOCUS_36920 25691 26071 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_36920 26101 26478 gene locus_tag LOCUS_36930 26101 26478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962882.1 protein_id gnl|my_center|LOCUS_36930 >Feature sequence058 617 24 gene locus_tag LOCUS_36940 617 24 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404812.1 protein_id gnl|my_center|LOCUS_36940 1618 665 gene locus_tag LOCUS_36950 1618 665 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_36950 2528 1683 gene locus_tag LOCUS_36960 2528 1683 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_36960 2874 3950 gene locus_tag LOCUS_36970 gene tgt 2874 3950 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962771.1 protein_id gnl|my_center|LOCUS_36970 4037 5032 gene locus_tag LOCUS_36980 4037 5032 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962772.1 protein_id gnl|my_center|LOCUS_36980 5055 5948 gene locus_tag LOCUS_36990 5055 5948 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_36990 5994 6947 gene locus_tag LOCUS_37000 5994 6947 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962774.1 protein_id gnl|my_center|LOCUS_37000 7103 8650 gene locus_tag LOCUS_37010 gene dnaB 7103 8650 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962775.1 protein_id gnl|my_center|LOCUS_37010 8834 10021 gene locus_tag LOCUS_37020 8834 10021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_37020 10120 11685 gene locus_tag LOCUS_37030 10120 11685 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108902.1 protein_id gnl|my_center|LOCUS_37030 13926 11731 gene locus_tag LOCUS_37040 13926 11731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 14429 13932 gene locus_tag LOCUS_37050 14429 13932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 15947 14436 gene locus_tag LOCUS_37060 15947 14436 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208888955.1 protein_id gnl|my_center|LOCUS_37060 17419 16037 gene locus_tag LOCUS_37070 17419 16037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 19852 17438 gene locus_tag LOCUS_37080 19852 17438 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203741.1 protein_id gnl|my_center|LOCUS_37080 19978 20964 gene locus_tag LOCUS_37090 19978 20964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 21761 20970 gene locus_tag LOCUS_37100 21761 20970 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464970.1 protein_id gnl|my_center|LOCUS_37100 21875 22297 gene locus_tag LOCUS_37110 21875 22297 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921681.1 protein_id gnl|my_center|LOCUS_37110 22696 22352 gene locus_tag LOCUS_37120 gene rplT 22696 22352 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963048.1 protein_id gnl|my_center|LOCUS_37120 22982 22785 gene locus_tag LOCUS_37130 gene rpmI 22982 22785 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963049.1 protein_id gnl|my_center|LOCUS_37130 23549 23088 gene locus_tag LOCUS_37140 gene infC 23549 23088 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_37140 25611 23674 gene locus_tag LOCUS_37150 gene thrS 25611 23674 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963051.1 protein_id gnl|my_center|LOCUS_37150 >Feature sequence059 253 1077 gene locus_tag LOCUS_37160 253 1077 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 protein_id gnl|my_center|LOCUS_37160 2270 1098 gene locus_tag LOCUS_37170 2270 1098 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_37170 2475 3146 gene locus_tag LOCUS_37180 2475 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_37180 3148 3576 gene locus_tag LOCUS_37190 3148 3576 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964040.1 protein_id gnl|my_center|LOCUS_37190 4778 3579 gene locus_tag LOCUS_37200 gene uxuA 4778 3579 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815487.1 protein_id gnl|my_center|LOCUS_37200 5598 4780 gene locus_tag LOCUS_37210 5598 4780 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766741.1 protein_id gnl|my_center|LOCUS_37210 6980 5601 gene locus_tag LOCUS_37220 6980 5601 CDS product putative oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108896.1 protein_id gnl|my_center|LOCUS_37220 8474 7098 gene locus_tag LOCUS_37230 8474 7098 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_37230 9711 8491 gene locus_tag LOCUS_37240 9711 8491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 11570 9798 gene locus_tag LOCUS_37250 11570 9798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 14896 11684 gene locus_tag LOCUS_37260 14896 11684 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108253.1 protein_id gnl|my_center|LOCUS_37260 15509 16159 gene locus_tag LOCUS_37270 15509 16159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37270 16175 17089 gene locus_tag LOCUS_37280 16175 17089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 17124 17933 gene locus_tag LOCUS_37290 17124 17933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 20177 17946 gene locus_tag LOCUS_37300 20177 17946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 22344 20395 gene locus_tag LOCUS_37310 22344 20395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 24242 22356 gene locus_tag LOCUS_37320 24242 22356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 >Feature sequence060 831 1466 gene locus_tag LOCUS_37330 gene rsmG 831 1466 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962583.1 protein_id gnl|my_center|LOCUS_37330 2577 2008 gene locus_tag LOCUS_37340 2577 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 4260 2632 gene locus_tag LOCUS_37350 gene pruA 4260 2632 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_37350 4855 4469 gene locus_tag LOCUS_37360 gene apaG 4855 4469 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_37360 5994 4867 gene locus_tag LOCUS_37370 5994 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 7204 6026 gene locus_tag LOCUS_37380 7204 6026 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_37380 7423 8775 gene locus_tag LOCUS_37390 7423 8775 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765874.1 protein_id gnl|my_center|LOCUS_37390 8778 10052 gene locus_tag LOCUS_37400 8778 10052 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 protein_id gnl|my_center|LOCUS_37400 10055 10804 gene locus_tag LOCUS_37410 10055 10804 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_37410 10806 11453 gene locus_tag LOCUS_37420 10806 11453 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_37420 11475 12221 gene locus_tag LOCUS_37430 gene nqrE 11475 12221 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763480.1 protein_id gnl|my_center|LOCUS_37430 12290 13531 gene locus_tag LOCUS_37440 gene nqrF 12290 13531 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337386.1 protein_id gnl|my_center|LOCUS_37440 13646 14014 gene locus_tag LOCUS_37450 13646 14014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 14073 15017 gene locus_tag LOCUS_37460 14073 15017 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_37460 15691 15014 gene locus_tag LOCUS_37470 15691 15014 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_37470 16645 15827 gene locus_tag LOCUS_37480 gene map 16645 15827 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962588.1 protein_id gnl|my_center|LOCUS_37480 18195 16678 gene locus_tag LOCUS_37490 gene gpmI 18195 16678 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964233.1 protein_id gnl|my_center|LOCUS_37490 18566 18931 gene locus_tag LOCUS_37500 18566 18931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 20209 19445 gene locus_tag LOCUS_37510 20209 19445 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928819.1 protein_id gnl|my_center|LOCUS_37510 21005 20247 gene locus_tag LOCUS_37520 21005 20247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 21269 21769 gene locus_tag LOCUS_37530 21269 21769 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338439.1 protein_id gnl|my_center|LOCUS_37530 21721 23007 gene locus_tag LOCUS_37540 21721 23007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037383.1 protein_id gnl|my_center|LOCUS_37540 >Feature sequence061 17 1042 gene locus_tag LOCUS_37550 17 1042 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119543.1 protein_id gnl|my_center|LOCUS_37550 1252 2259 gene locus_tag LOCUS_37560 1252 2259 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985878.1 protein_id gnl|my_center|LOCUS_37560 2381 2836 gene locus_tag LOCUS_37570 2381 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 3442 2849 gene locus_tag LOCUS_37580 3442 2849 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880784.1 protein_id gnl|my_center|LOCUS_37580 5279 3429 gene locus_tag LOCUS_37590 5279 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 5903 5310 gene locus_tag LOCUS_37600 5903 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 6378 6001 gene locus_tag LOCUS_37610 6378 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 8973 6457 gene locus_tag LOCUS_37620 gene nirB 8973 6457 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207014.1 protein_id gnl|my_center|LOCUS_37620 9098 9871 gene locus_tag LOCUS_37630 gene cobA 9098 9871 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_37630 10147 11568 gene locus_tag LOCUS_37640 10147 11568 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_37640 11580 12338 gene locus_tag LOCUS_37650 11580 12338 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_37650 12612 13994 gene locus_tag LOCUS_37660 12612 13994 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_37660 14010 15128 gene locus_tag LOCUS_37670 14010 15128 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 protein_id gnl|my_center|LOCUS_37670 15147 15986 gene locus_tag LOCUS_37680 15147 15986 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442682.1 protein_id gnl|my_center|LOCUS_37680 15997 16824 gene locus_tag LOCUS_37690 15997 16824 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324929.1 protein_id gnl|my_center|LOCUS_37690 16869 18170 gene locus_tag LOCUS_37700 16869 18170 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201988.1 protein_id gnl|my_center|LOCUS_37700 18323 18994 gene locus_tag LOCUS_37710 18323 18994 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033930894.1 protein_id gnl|my_center|LOCUS_37710 19040 20383 gene locus_tag LOCUS_37720 19040 20383 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_37720 >Feature sequence062 1443 37 gene locus_tag LOCUS_37730 gene lpdA 1443 37 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963845.1 protein_id gnl|my_center|LOCUS_37730 1575 3065 gene locus_tag LOCUS_37740 1575 3065 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_37740 3304 3948 gene locus_tag LOCUS_37750 3304 3948 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963839.1 protein_id gnl|my_center|LOCUS_37750 4045 4359 gene locus_tag LOCUS_37760 4045 4359 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 protein_id gnl|my_center|LOCUS_37760 4364 4597 gene locus_tag LOCUS_37770 4364 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963837.1 protein_id gnl|my_center|LOCUS_37770 4786 5292 gene locus_tag LOCUS_37780 gene tpx 4786 5292 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963706.1 protein_id gnl|my_center|LOCUS_37780 5285 5653 gene locus_tag LOCUS_37790 5285 5653 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963705.1 protein_id gnl|my_center|LOCUS_37790 5865 7667 gene locus_tag LOCUS_37800 5865 7667 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963039.1 protein_id gnl|my_center|LOCUS_37800 7773 10163 gene locus_tag LOCUS_37810 7773 10163 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_37810 10190 10834 gene locus_tag LOCUS_37820 10190 10834 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963703.1 protein_id gnl|my_center|LOCUS_37820 10944 12413 gene locus_tag LOCUS_37830 10944 12413 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963702.1 protein_id gnl|my_center|LOCUS_37830 12410 13552 gene locus_tag LOCUS_37840 gene ribB 12410 13552 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 protein_id gnl|my_center|LOCUS_37840 17603 13566 gene locus_tag LOCUS_37850 17603 13566 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767023.1 protein_id gnl|my_center|LOCUS_37850 19977 17665 gene locus_tag LOCUS_37860 19977 17665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 >Feature sequence063 815 477 gene locus_tag LOCUS_37870 815 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 1426 815 gene locus_tag LOCUS_37880 1426 815 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_37880 2223 1447 gene locus_tag LOCUS_37890 2223 1447 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_37890 3589 2312 gene locus_tag LOCUS_37900 3589 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 5117 3753 gene locus_tag LOCUS_37910 5117 3753 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_37910 5892 5200 gene locus_tag LOCUS_37920 gene recR 5892 5200 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963432.1 protein_id gnl|my_center|LOCUS_37920 5878 7356 gene locus_tag LOCUS_37930 5878 7356 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_37930 7778 7419 gene locus_tag LOCUS_37940 7778 7419 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_37940 8994 7987 gene locus_tag LOCUS_37950 8994 7987 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_37950 10415 9105 gene locus_tag LOCUS_37960 10415 9105 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_37960 11113 10454 gene locus_tag LOCUS_37970 11113 10454 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 protein_id gnl|my_center|LOCUS_37970 11541 13433 gene locus_tag LOCUS_37980 gene htpG 11541 13433 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963627.1 protein_id gnl|my_center|LOCUS_37980 13882 14256 gene locus_tag LOCUS_37990 13882 14256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 15120 14311 gene locus_tag LOCUS_38000 15120 14311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 16785 15187 gene locus_tag LOCUS_38010 16785 15187 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087134.1 protein_id gnl|my_center|LOCUS_38010 17119 17940 gene locus_tag LOCUS_38020 17119 17940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 18039 18680 gene locus_tag LOCUS_38030 18039 18680 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141283.1 protein_id gnl|my_center|LOCUS_38030 18677 19036 gene locus_tag LOCUS_38040 18677 19036 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281604.1 protein_id gnl|my_center|LOCUS_38040 19685 19101 gene locus_tag LOCUS_38050 19685 19101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 19901 20788 gene locus_tag LOCUS_38060 19901 20788 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_38060 20788 21375 gene locus_tag LOCUS_38070 20788 21375 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_38070 >Feature sequence064 3728 2664 gene locus_tag LOCUS_38080 3728 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 5057 4350 gene locus_tag LOCUS_38090 5057 4350 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038982.1 protein_id gnl|my_center|LOCUS_38090 6467 5163 gene locus_tag LOCUS_38100 6467 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 6804 8171 gene locus_tag LOCUS_38110 6804 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 8271 9401 gene locus_tag LOCUS_38120 8271 9401 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275490.1 protein_id gnl|my_center|LOCUS_38120 9440 9841 gene locus_tag LOCUS_38130 9440 9841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 10879 9983 gene locus_tag LOCUS_38140 10879 9983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 13938 11461 gene locus_tag LOCUS_38150 13938 11461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 14387 13935 gene locus_tag LOCUS_38160 14387 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 14653 15117 gene locus_tag LOCUS_38170 14653 15117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 16471 15197 gene locus_tag LOCUS_38180 16471 15197 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768413.1 protein_id gnl|my_center|LOCUS_38180 16830 16468 gene locus_tag LOCUS_38190 16830 16468 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394197.1 protein_id gnl|my_center|LOCUS_38190 17089 17430 gene locus_tag LOCUS_38200 17089 17430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 17449 18363 gene locus_tag LOCUS_38210 17449 18363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 18958 18509 gene locus_tag LOCUS_38220 18958 18509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 >Feature sequence065 1035 52 gene locus_tag LOCUS_38230 gene tsf 1035 52 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325915.1 protein_id gnl|my_center|LOCUS_38230 2180 1122 gene locus_tag LOCUS_38240 2180 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 2827 2441 gene locus_tag LOCUS_38250 gene rpsI 2827 2441 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962624.1 protein_id gnl|my_center|LOCUS_38250 3282 2827 gene locus_tag LOCUS_38260 gene rplM 3282 2827 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962625.1 protein_id gnl|my_center|LOCUS_38260 3900 3553 gene locus_tag LOCUS_38270 3900 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 6845 4005 gene locus_tag LOCUS_38280 gene polA 6845 4005 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_38280 7893 6904 gene locus_tag LOCUS_38290 7893 6904 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_38290 7958 8680 gene locus_tag LOCUS_38300 gene cutC 7958 8680 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185770.1 protein_id gnl|my_center|LOCUS_38300 8702 9952 gene locus_tag LOCUS_38310 8702 9952 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_38310 10049 10345 gene locus_tag LOCUS_38320 10049 10345 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962464.1 protein_id gnl|my_center|LOCUS_38320 13847 10461 gene locus_tag LOCUS_38330 13847 10461 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962469.1 protein_id gnl|my_center|LOCUS_38330 14146 14218 gene locus_tag LOCUS_t00290 14146 14218 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15629 14262 gene locus_tag LOCUS_38340 15629 14262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 15822 16283 gene locus_tag LOCUS_38350 gene rimP 15822 16283 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962637.1 protein_id gnl|my_center|LOCUS_38350 16300 17532 gene locus_tag LOCUS_38360 gene nusA 16300 17532 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962638.1 protein_id gnl|my_center|LOCUS_38360 17653 20535 gene locus_tag LOCUS_38370 gene infB 17653 20535 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962639.1 protein_id gnl|my_center|LOCUS_38370 >Feature sequence066 1037 537 gene locus_tag LOCUS_38380 1037 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 1310 2698 gene locus_tag LOCUS_38390 1310 2698 CDS product methylmalonyl-CoA mutase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963259.1 protein_id gnl|my_center|LOCUS_38390 2727 4838 gene locus_tag LOCUS_38400 gene scpA 2727 4838 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963261.1 protein_id gnl|my_center|LOCUS_38400 5088 6650 gene locus_tag LOCUS_38410 5088 6650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 6655 7050 gene locus_tag LOCUS_38420 6655 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 7216 7290 gene locus_tag LOCUS_t00300 7216 7290 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10064 7683 gene locus_tag LOCUS_38430 10064 7683 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_38430 11361 10243 gene locus_tag LOCUS_38440 11361 10243 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050765261.1 protein_id gnl|my_center|LOCUS_38440 12268 11372 gene locus_tag LOCUS_38450 12268 11372 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050431.1 protein_id gnl|my_center|LOCUS_38450 13103 12273 gene locus_tag LOCUS_38460 13103 12273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 14021 13110 gene locus_tag LOCUS_38470 14021 13110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 15207 14221 gene locus_tag LOCUS_38480 15207 14221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203008.1 protein_id gnl|my_center|LOCUS_38480 16355 15219 gene locus_tag LOCUS_38490 16355 15219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 17396 16443 gene locus_tag LOCUS_38500 17396 16443 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203005.1 protein_id gnl|my_center|LOCUS_38500 18884 17421 gene locus_tag LOCUS_38510 18884 17421 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203002.1 protein_id gnl|my_center|LOCUS_38510 19775 19047 gene locus_tag LOCUS_38520 19775 19047 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203060.1 protein_id gnl|my_center|LOCUS_38520 20504 20028 gene locus_tag LOCUS_38530 20504 20028 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107226.1 protein_id gnl|my_center|LOCUS_38530 >Feature sequence067 226 3039 gene locus_tag LOCUS_38540 226 3039 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_38540 3087 4310 gene locus_tag LOCUS_38550 gene odhB 3087 4310 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964497.1 protein_id gnl|my_center|LOCUS_38550 4568 4401 gene locus_tag LOCUS_38560 4568 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 4840 4550 gene locus_tag LOCUS_38570 4840 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 4878 5645 gene locus_tag LOCUS_38580 4878 5645 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_38580 5686 6720 gene locus_tag LOCUS_38590 5686 6720 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_38590 6830 6918 gene locus_tag LOCUS_t00310 6830 6918 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7162 7908 gene locus_tag LOCUS_38600 7162 7908 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_38600 7996 8373 gene locus_tag LOCUS_38610 7996 8373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 8389 9015 gene locus_tag LOCUS_38620 8389 9015 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_38620 9039 9521 gene locus_tag LOCUS_38630 9039 9521 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761058.1 protein_id gnl|my_center|LOCUS_38630 9600 10286 gene locus_tag LOCUS_38640 9600 10286 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_38640 12312 10915 gene locus_tag LOCUS_38650 gene rpoN 12312 10915 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_38650 13851 12418 gene locus_tag LOCUS_38660 gene asnS 13851 12418 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964340.1 protein_id gnl|my_center|LOCUS_38660 16217 13929 gene locus_tag LOCUS_38670 16217 13929 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_38670 17018 16461 gene locus_tag LOCUS_38680 gene frr 17018 16461 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962605.1 protein_id gnl|my_center|LOCUS_38680 17764 17057 gene locus_tag LOCUS_38690 gene pyrH 17764 17057 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962604.1 protein_id gnl|my_center|LOCUS_38690 17944 19812 gene locus_tag LOCUS_38700 17944 19812 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_38700 >Feature sequence068 1544 1095 gene locus_tag LOCUS_38710 1544 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 2718 1561 gene locus_tag LOCUS_38720 2718 1561 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_38720 4234 2837 gene locus_tag LOCUS_38730 4234 2837 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_38730 4537 5193 gene locus_tag LOCUS_38740 4537 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 6298 5453 gene locus_tag LOCUS_38750 6298 5453 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 protein_id gnl|my_center|LOCUS_38750 8712 6304 gene locus_tag LOCUS_38760 8712 6304 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_38760 8956 9498 gene locus_tag LOCUS_38770 8956 9498 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073603.1 protein_id gnl|my_center|LOCUS_38770 9498 10037 gene locus_tag LOCUS_38780 9498 10037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 10063 11109 gene locus_tag LOCUS_38790 10063 11109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 11524 11189 gene locus_tag LOCUS_38800 11524 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 12199 11564 gene locus_tag LOCUS_38810 12199 11564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 12910 12398 gene locus_tag LOCUS_38820 12910 12398 CDS product lactoylglutathione lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119583.1 protein_id gnl|my_center|LOCUS_38820 13030 13347 gene locus_tag LOCUS_38830 13030 13347 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182948.1 protein_id gnl|my_center|LOCUS_38830 13467 14132 gene locus_tag LOCUS_38840 13467 14132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 14395 15105 gene locus_tag LOCUS_38850 14395 15105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 15710 15111 gene locus_tag LOCUS_38860 gene hisIE 15710 15111 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963101.1 protein_id gnl|my_center|LOCUS_38860 16413 15721 gene locus_tag LOCUS_38870 16413 15721 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440228.1 protein_id gnl|my_center|LOCUS_38870 17197 16442 gene locus_tag LOCUS_38880 gene hisF 17197 16442 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963102.1 protein_id gnl|my_center|LOCUS_38880 18039 17272 gene locus_tag LOCUS_38890 gene hisA 18039 17272 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963103.1 protein_id gnl|my_center|LOCUS_38890 18461 18111 gene locus_tag LOCUS_38900 18461 18111 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_38900 19097 18507 gene locus_tag LOCUS_38910 gene hisH 19097 18507 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963104.1 protein_id gnl|my_center|LOCUS_38910 <19884 19181 gene locus_tag LOCUS_38920 <19884 19181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963105.1:bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB >Feature sequence069 4600 302 gene locus_tag LOCUS_38930 gene rpoC 4600 302 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963311.1 protein_id gnl|my_center|LOCUS_38930 8464 4655 gene locus_tag LOCUS_38940 gene rpoB 8464 4655 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963312.1 protein_id gnl|my_center|LOCUS_38940 8982 8608 gene locus_tag LOCUS_38950 gene rplL 8982 8608 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963313.1 protein_id gnl|my_center|LOCUS_38950 9551 9036 gene locus_tag LOCUS_38960 gene rplJ 9551 9036 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963314.1 protein_id gnl|my_center|LOCUS_38960 10269 9580 gene locus_tag LOCUS_38970 gene rplA 10269 9580 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963315.1 protein_id gnl|my_center|LOCUS_38970 10727 10290 gene locus_tag LOCUS_38980 gene rplK 10727 10290 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963316.1 protein_id gnl|my_center|LOCUS_38980 11347 10796 gene locus_tag LOCUS_38990 gene nusG 11347 10796 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963317.1 protein_id gnl|my_center|LOCUS_38990 11545 11357 gene locus_tag LOCUS_39000 gene secE 11545 11357 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963318.1 protein_id gnl|my_center|LOCUS_39000 11639 11566 gene locus_tag LOCUS_t00320 11639 11566 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 12896 11709 gene locus_tag LOCUS_39010 gene tuf 12896 11709 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963319.1 protein_id gnl|my_center|LOCUS_39010 13023 12951 gene locus_tag LOCUS_t00330 13023 12951 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13165 13092 gene locus_tag LOCUS_t00340 13165 13092 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13304 13222 gene locus_tag LOCUS_t00350 13304 13222 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 13404 13330 gene locus_tag LOCUS_t00360 13404 13330 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13809 13507 gene locus_tag LOCUS_39020 gene raiA 13809 13507 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_39020 14740 13850 gene locus_tag LOCUS_39030 14740 13850 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 protein_id gnl|my_center|LOCUS_39030 15083 14889 gene locus_tag LOCUS_39040 gene rpsU 15083 14889 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963322.1 protein_id gnl|my_center|LOCUS_39040 16388 15219 gene locus_tag LOCUS_39050 16388 15219 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963323.1 protein_id gnl|my_center|LOCUS_39050 17296 16400 gene locus_tag LOCUS_39060 17296 16400 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963324.1 protein_id gnl|my_center|LOCUS_39060 <17924 17316 gene locus_tag LOCUS_39070 <17924 17316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189099273.1:alanine/glycine:cation symporter family protein >Feature sequence070 1444 2193 gene locus_tag LOCUS_39080 1444 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 2279 2698 gene locus_tag LOCUS_39090 2279 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 8289 2773 gene locus_tag LOCUS_39100 8289 2773 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964323.1 protein_id gnl|my_center|LOCUS_39100 8640 9116 gene locus_tag LOCUS_39110 8640 9116 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946613.1 protein_id gnl|my_center|LOCUS_39110 9256 9795 gene locus_tag LOCUS_39120 9256 9795 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964325.1 protein_id gnl|my_center|LOCUS_39120 9888 11498 gene locus_tag LOCUS_39130 9888 11498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 12034 13587 gene locus_tag LOCUS_39140 12034 13587 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_39140 14374 15180 gene locus_tag LOCUS_39150 14374 15180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 15205 15777 gene locus_tag LOCUS_39160 15205 15777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 >Feature sequence071 2176 719 gene locus_tag LOCUS_39170 2176 719 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263393.1 protein_id gnl|my_center|LOCUS_39170 3658 2177 gene locus_tag LOCUS_39180 3658 2177 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263391.1 protein_id gnl|my_center|LOCUS_39180 6994 4667 gene locus_tag LOCUS_39190 6994 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 8868 7339 gene locus_tag LOCUS_39200 8868 7339 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_39200 9311 11092 gene locus_tag LOCUS_39210 9311 11092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 11701 11279 gene locus_tag LOCUS_39220 11701 11279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 12304 11822 gene locus_tag LOCUS_39230 12304 11822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 12997 12488 gene locus_tag LOCUS_39240 12997 12488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 13377 14675 gene locus_tag LOCUS_39250 13377 14675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533119.1 protein_id gnl|my_center|LOCUS_39250 15632 14877 gene locus_tag LOCUS_39260 15632 14877 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388934.1 protein_id gnl|my_center|LOCUS_39260 >Feature sequence072 2269 269 gene locus_tag LOCUS_39270 2269 269 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_39270 2517 3101 gene locus_tag LOCUS_39280 2517 3101 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796757.1 protein_id gnl|my_center|LOCUS_39280 3343 3588 gene locus_tag LOCUS_39290 3343 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 3533 4687 gene locus_tag LOCUS_39300 3533 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 4705 5400 gene locus_tag LOCUS_39310 4705 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 5471 6763 gene locus_tag LOCUS_39320 5471 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 6969 9641 gene locus_tag LOCUS_39330 6969 9641 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_39330 10387 9644 gene locus_tag LOCUS_39340 10387 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 10956 10387 gene locus_tag LOCUS_39350 10956 10387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 11146 10925 gene locus_tag LOCUS_39360 11146 10925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 12185 11469 gene locus_tag LOCUS_39370 gene lipB 12185 11469 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963333.1 protein_id gnl|my_center|LOCUS_39370 12950 12213 gene locus_tag LOCUS_39380 12950 12213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 13336 15027 gene locus_tag LOCUS_39390 gene lysS 13336 15027 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963334.1 protein_id gnl|my_center|LOCUS_39390 >Feature sequence073 <1 870 gene locus_tag LOCUS_39400 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789577.1:LacI family DNA-binding transcriptional regulator 2825 951 gene locus_tag LOCUS_39410 2825 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 4002 2896 gene locus_tag LOCUS_39420 4002 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 4739 4056 gene locus_tag LOCUS_39430 4739 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 6500 4746 gene locus_tag LOCUS_39440 6500 4746 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764128.1 protein_id gnl|my_center|LOCUS_39440 9604 6518 gene locus_tag LOCUS_39450 9604 6518 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_39450 10312 11391 gene locus_tag LOCUS_39460 10312 11391 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728063.1 protein_id gnl|my_center|LOCUS_39460 11398 12036 gene locus_tag LOCUS_39470 11398 12036 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119544.1 protein_id gnl|my_center|LOCUS_39470 12042 13427 gene locus_tag LOCUS_39480 12042 13427 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119546.1 protein_id gnl|my_center|LOCUS_39480 >Feature sequence074 541 32 gene locus_tag LOCUS_39490 541 32 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100219.1 protein_id gnl|my_center|LOCUS_39490 1502 684 gene locus_tag LOCUS_39500 1502 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 4206 1594 gene locus_tag LOCUS_39510 gene bamA 4206 1594 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100221.1 protein_id gnl|my_center|LOCUS_39510 4951 4211 gene locus_tag LOCUS_39520 4951 4211 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964194.1 protein_id gnl|my_center|LOCUS_39520 5827 5129 gene locus_tag LOCUS_39530 5827 5129 CDS product DUF6089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_39530 6810 5929 gene locus_tag LOCUS_39540 6810 5929 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_39540 7571 6915 gene locus_tag LOCUS_39550 7571 6915 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964191.1 protein_id gnl|my_center|LOCUS_39550 7665 8381 gene locus_tag LOCUS_39560 7665 8381 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964190.1 protein_id gnl|my_center|LOCUS_39560 8378 9151 gene locus_tag LOCUS_39570 8378 9151 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_39570 9213 9563 gene locus_tag LOCUS_39580 9213 9563 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964186.1 protein_id gnl|my_center|LOCUS_39580 9660 10982 gene locus_tag LOCUS_39590 9660 10982 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 protein_id gnl|my_center|LOCUS_39590 11086 11766 gene locus_tag LOCUS_39600 gene clpP 11086 11766 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964184.1 protein_id gnl|my_center|LOCUS_39600 11865 13100 gene locus_tag LOCUS_39610 gene clpX 11865 13100 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964183.1 protein_id gnl|my_center|LOCUS_39610 >Feature sequence075 4723 266 gene locus_tag LOCUS_39620 4723 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 6996 5059 gene locus_tag LOCUS_39630 6996 5059 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_39630 7966 7007 gene locus_tag LOCUS_39640 7966 7007 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_39640 11052 7981 gene locus_tag LOCUS_39650 11052 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 11452 13041 gene locus_tag LOCUS_39660 11452 13041 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963308.1 protein_id gnl|my_center|LOCUS_39660 >Feature sequence076 1730 156 gene locus_tag LOCUS_39670 1730 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 5124 1750 gene locus_tag LOCUS_39680 5124 1750 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_39680 6205 5267 gene locus_tag LOCUS_39690 6205 5267 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049100798.1 protein_id gnl|my_center|LOCUS_39690 6851 6276 gene locus_tag LOCUS_39700 6851 6276 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_39700 8619 7261 gene locus_tag LOCUS_39710 8619 7261 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_39710 12011 8802 gene locus_tag LOCUS_39720 12011 8802 CDS product chondroitinase family polysaccharide lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767535.1 protein_id gnl|my_center|LOCUS_39720 >Feature sequence077 958 308 gene locus_tag LOCUS_39730 958 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 1922 1041 gene locus_tag LOCUS_39740 1922 1041 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207473.1 protein_id gnl|my_center|LOCUS_39740 2982 2434 gene locus_tag LOCUS_39750 2982 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 3587 3153 gene locus_tag LOCUS_39760 3587 3153 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_39760 4332 7436 gene locus_tag LOCUS_39770 4332 7436 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_39770 7460 9175 gene locus_tag LOCUS_39780 7460 9175 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763976.1 protein_id gnl|my_center|LOCUS_39780 9262 11259 gene locus_tag LOCUS_39790 9262 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 >Feature sequence078 127 3216 gene locus_tag LOCUS_39800 127 3216 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_39800 3227 4531 gene locus_tag LOCUS_39810 3227 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 4663 6129 gene locus_tag LOCUS_39820 4663 6129 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_39820 6122 6955 gene locus_tag LOCUS_39830 gene murQ 6122 6955 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962884.1 protein_id gnl|my_center|LOCUS_39830 7146 7505 gene locus_tag LOCUS_39840 7146 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 8131 7508 gene locus_tag LOCUS_39850 8131 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 8791 8138 gene locus_tag LOCUS_39860 8791 8138 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122200.1 protein_id gnl|my_center|LOCUS_39860 9528 8794 gene locus_tag LOCUS_39870 9528 8794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 11155 9542 gene locus_tag LOCUS_39880 11155 9542 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730646.1 protein_id gnl|my_center|LOCUS_39880 <11983 11174 gene locus_tag LOCUS_39890 <11983 11174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_163515044.1:metallophosphoesterase >Feature sequence079 <1 1731 gene locus_tag LOCUS_39900 <1 1731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791675.1:TonB-dependent receptor 1742 3472 gene locus_tag LOCUS_39910 1742 3472 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801846.1 protein_id gnl|my_center|LOCUS_39910 3826 3632 gene locus_tag LOCUS_39920 3826 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 5035 3857 gene locus_tag LOCUS_39930 5035 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 7432 5216 gene locus_tag LOCUS_39940 7432 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 9069 7534 gene locus_tag LOCUS_39950 9069 7534 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767373.1 protein_id gnl|my_center|LOCUS_39950 9661 10461 gene locus_tag LOCUS_39960 9661 10461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 >Feature sequence080 4056 970 gene locus_tag LOCUS_39970 4056 970 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108199.1 protein_id gnl|my_center|LOCUS_39970 4668 4303 gene locus_tag LOCUS_39980 4668 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962738.1 protein_id gnl|my_center|LOCUS_39980 5092 5847 gene locus_tag LOCUS_39990 5092 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 >Feature sequence081 <1 2904 gene locus_tag LOCUS_40000 <1 2904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169313288.1:Calx-beta domain-containing protein 3515 3000 gene locus_tag LOCUS_40010 3515 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962295.1 protein_id gnl|my_center|LOCUS_40010 3856 3578 gene locus_tag LOCUS_40020 3856 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 5443 3935 gene locus_tag LOCUS_40030 gene atpD 5443 3935 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962293.1 protein_id gnl|my_center|LOCUS_40030 7251 5626 gene locus_tag LOCUS_40040 7251 5626 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_40040 <9111 7271 gene locus_tag LOCUS_40050 <9111 7271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962291.1:TonB-dependent receptor >Feature sequence082 849 253 gene locus_tag LOCUS_40060 849 253 CDS product mobile mystery protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942040.1 protein_id gnl|my_center|LOCUS_40060 1301 840 gene locus_tag LOCUS_40070 1301 840 CDS product mobile mystery protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974879.1 protein_id gnl|my_center|LOCUS_40070 2172 1762 gene locus_tag LOCUS_40080 2172 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 4793 2451 gene locus_tag LOCUS_40090 4793 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 5485 4787 gene locus_tag LOCUS_40100 5485 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 6326 5904 gene locus_tag LOCUS_40110 6326 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 7313 6663 gene locus_tag LOCUS_40120 7313 6663 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085558.1 protein_id gnl|my_center|LOCUS_40120 8413 7361 gene locus_tag LOCUS_40130 8413 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 >Feature sequence083 386 580 gene locus_tag LOCUS_40140 386 580 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_40140 2039 1107 gene locus_tag LOCUS_40150 2039 1107 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964012.1 protein_id gnl|my_center|LOCUS_40150 3528 2146 gene locus_tag LOCUS_40160 3528 2146 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_40160 4408 3587 gene locus_tag LOCUS_40170 4408 3587 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962727.1 protein_id gnl|my_center|LOCUS_40170 4642 5295 gene locus_tag LOCUS_40180 4642 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 6514 5351 gene locus_tag LOCUS_40190 6514 5351 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_40190 7401 6526 gene locus_tag LOCUS_40200 7401 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 8329 7394 gene locus_tag LOCUS_40210 8329 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 >Feature sequence084 2227 167 gene locus_tag LOCUS_40220 2227 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 3505 2567 gene locus_tag LOCUS_40230 3505 2567 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_40230 5183 3768 gene locus_tag LOCUS_40240 5183 3768 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_40240 5820 5260 gene locus_tag LOCUS_40250 5820 5260 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963755.1 protein_id gnl|my_center|LOCUS_40250 6929 5832 gene locus_tag LOCUS_40260 6929 5832 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926820.1 protein_id gnl|my_center|LOCUS_40260 <8183 6926 gene locus_tag LOCUS_40270 <8183 6926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_111408924.1:glycosyltransferase family 2 protein >Feature sequence085 2211 1270 gene locus_tag LOCUS_40280 2211 1270 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_40280 3527 2394 gene locus_tag LOCUS_40290 gene dnaJ 3527 2394 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962830.1 protein_id gnl|my_center|LOCUS_40290 4082 3537 gene locus_tag LOCUS_40300 4082 3537 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962831.1 protein_id gnl|my_center|LOCUS_40300 5254 4289 gene locus_tag LOCUS_40310 5254 4289 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_40310 6042 5383 gene locus_tag LOCUS_40320 gene mnmD 6042 5383 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_40320 6538 6047 gene locus_tag LOCUS_40330 6538 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 6645 7709 gene locus_tag LOCUS_40340 6645 7709 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963851.1 protein_id gnl|my_center|LOCUS_40340 >Feature sequence086 <1 1351 gene locus_tag LOCUS_40350 <1 1351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196851.1:c-type cytochrome 3008 1422 gene locus_tag LOCUS_40360 3008 1422 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093328686.1 protein_id gnl|my_center|LOCUS_40360 3751 3176 gene locus_tag LOCUS_40370 3751 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 5073 4135 gene locus_tag LOCUS_40380 5073 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 6482 5559 gene locus_tag LOCUS_40390 6482 5559 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_40390 7648 6650 gene locus_tag LOCUS_40400 7648 6650 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814856.1 protein_id gnl|my_center|LOCUS_40400 >Feature sequence087 245 2029 gene locus_tag LOCUS_40410 245 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 2180 3064 gene locus_tag LOCUS_40420 2180 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 3133 4233 gene locus_tag LOCUS_40430 3133 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 <7237 4632 gene locus_tag LOCUS_40440 <7237 4632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000052484.1:Ig-like domain-containing protein >Feature sequence088 1428 106 gene locus_tag LOCUS_40450 1428 106 CDS product ribonuclease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141613167.1 protein_id gnl|my_center|LOCUS_40450 2379 1507 gene locus_tag LOCUS_40460 2379 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 3942 2431 gene locus_tag LOCUS_40470 3942 2431 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123415.1 protein_id gnl|my_center|LOCUS_40470 6624 3946 gene locus_tag LOCUS_40480 6624 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 >Feature sequence089 <6900 1368 gene locus_tag LOCUS_40490 <6900 1368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:immunoglobulin domain-containing protein >Feature sequence090 364 1098 gene locus_tag LOCUS_40500 gene rsbQ 364 1098 CDS product sigma factor SigB/phosphatase RsbP regulator RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228292.1 protein_id gnl|my_center|LOCUS_40500 1095 2276 gene locus_tag LOCUS_40510 1095 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 2586 3209 gene locus_tag LOCUS_40520 2586 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 4565 3288 gene locus_tag LOCUS_40530 4565 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 5390 4944 gene locus_tag LOCUS_40540 5390 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 6288 5788 gene locus_tag LOCUS_40550 6288 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 >Feature sequence091 419 1941 gene locus_tag LOCUS_r00010 419 1941 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2084 2158 gene locus_tag LOCUS_t00370 2084 2158 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2281 2357 gene locus_tag LOCUS_t00380 2281 2357 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2573 5393 gene locus_tag LOCUS_r00020 2573 5393 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5570 5674 gene locus_tag LOCUS_r00030 5570 5674 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence092 245 33 gene locus_tag LOCUS_40560 245 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 1247 315 gene locus_tag LOCUS_40570 1247 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 1665 1207 gene locus_tag LOCUS_40580 1665 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 3509 1671 gene locus_tag LOCUS_40590 3509 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 4485 3496 gene locus_tag LOCUS_40600 4485 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 <5560 4485 gene locus_tag LOCUS_40610 <5560 4485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962329.1:DUF4407 domain-containing protein >Feature sequence093 >Feature sequence094 <1 1876 gene locus_tag LOCUS_40620 <1 1876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947353.1:copper-translocating P-type ATPase 2090 2566 gene locus_tag LOCUS_40630 2090 2566 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_40630 2618 4342 gene locus_tag LOCUS_40640 2618 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 >Feature sequence095 <1 1712 gene locus_tag LOCUS_40650 <1 1712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061458.1:nitrite reductase large subunit NirB 1725 3164 gene locus_tag LOCUS_40660 1725 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 3204 4244 gene locus_tag LOCUS_40670 3204 4244 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921655.1 protein_id gnl|my_center|LOCUS_40670 >Feature sequence096 2283 1270 gene locus_tag LOCUS_40680 2283 1270 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767206.1 protein_id gnl|my_center|LOCUS_40680 2769 2629 gene locus_tag LOCUS_40690 2769 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 <3829 3192 gene locus_tag LOCUS_40700 <3829 3192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121095.1:sulfatase-like hydrolase/transferase >Feature sequence097 <1 1819 gene locus_tag LOCUS_40710 <1 1819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706631.1:polyphosphate kinase 1 1925 2782 gene locus_tag LOCUS_40720 1925 2782 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_40720 2861 3292 gene locus_tag LOCUS_40730 2861 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 >Feature sequence098 669 2348 gene locus_tag LOCUS_40740 669 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 >Feature sequence099 481 356 gene locus_tag LOCUS_40750 481 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 >Feature sequence100 424 269 gene locus_tag LOCUS_40760 424 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 >Feature sequence101 >Feature sequence102 412 290 gene locus_tag LOCUS_40770 412 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 899 633 gene locus_tag LOCUS_40780 899 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40780 >Feature sequence103 >Feature sequence104 >Feature sequence105 >Feature sequence106 >Feature sequence107 >Feature sequence108 >Feature sequence109 >Feature sequence110 >Feature sequence111 >Feature sequence112 >Feature sequence113 >Feature sequence114 >Feature sequence115 >Feature sequence116 >Feature sequence117 >Feature sequence118 >Feature sequence119 >Feature sequence120