>Feature sequence01 757 11 gene locus_tag LOCUS_00010 757 11 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668774.1 protein_id gnl|my_center|LOCUS_00010 1711 854 gene locus_tag LOCUS_00020 1711 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1844 2845 gene locus_tag LOCUS_00030 gene xerD 1844 2845 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565337.1 protein_id gnl|my_center|LOCUS_00030 6273 2941 gene locus_tag LOCUS_00040 6273 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6481 7359 gene locus_tag LOCUS_00050 6481 7359 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027427.1 protein_id gnl|my_center|LOCUS_00050 9069 7363 gene locus_tag LOCUS_00060 9069 7363 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090623.1 protein_id gnl|my_center|LOCUS_00060 9120 9677 gene locus_tag LOCUS_00070 9120 9677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10406 9696 gene locus_tag LOCUS_00080 10406 9696 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285024.1 protein_id gnl|my_center|LOCUS_00080 11885 10494 gene locus_tag LOCUS_00090 11885 10494 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027778.1 protein_id gnl|my_center|LOCUS_00090 12675 11908 gene locus_tag LOCUS_00100 12675 11908 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_00100 12980 13393 gene locus_tag LOCUS_00110 12980 13393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 14237 13461 gene locus_tag LOCUS_00120 14237 13461 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081655759.1 protein_id gnl|my_center|LOCUS_00120 14426 15841 gene locus_tag LOCUS_00130 14426 15841 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_00130 15855 16853 gene locus_tag LOCUS_00140 gene cydB 15855 16853 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029331.1 protein_id gnl|my_center|LOCUS_00140 16964 18148 gene locus_tag LOCUS_00150 16964 18148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18916 18218 gene locus_tag LOCUS_00160 18916 18218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19434 18982 gene locus_tag LOCUS_00170 19434 18982 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971790.1 protein_id gnl|my_center|LOCUS_00170 19533 20120 gene locus_tag LOCUS_00180 19533 20120 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224590.1 protein_id gnl|my_center|LOCUS_00180 20120 20485 gene locus_tag LOCUS_00190 20120 20485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20565 21293 gene locus_tag LOCUS_00200 20565 21293 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977492.1 protein_id gnl|my_center|LOCUS_00200 21670 24051 gene locus_tag LOCUS_00210 21670 24051 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030980.1 protein_id gnl|my_center|LOCUS_00210 24734 25744 gene locus_tag LOCUS_00220 24734 25744 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226556.1 protein_id gnl|my_center|LOCUS_00220 26067 25660 gene locus_tag LOCUS_00230 26067 25660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25952 26773 gene locus_tag LOCUS_00240 25952 26773 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_00240 26906 28621 gene locus_tag LOCUS_00250 26906 28621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00250 28587 29621 gene locus_tag LOCUS_00260 28587 29621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00260 29842 30000 gene locus_tag LOCUS_00270 29842 30000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 31761 30196 gene locus_tag LOCUS_00280 31761 30196 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027644.1 protein_id gnl|my_center|LOCUS_00280 31842 32390 gene locus_tag LOCUS_00290 31842 32390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 32380 32964 gene locus_tag LOCUS_00300 32380 32964 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080770.1 protein_id gnl|my_center|LOCUS_00300 32990 33901 gene locus_tag LOCUS_00310 32990 33901 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973903.1 protein_id gnl|my_center|LOCUS_00310 34143 35153 gene locus_tag LOCUS_00320 34143 35153 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049808538.1 protein_id gnl|my_center|LOCUS_00320 36434 35262 gene locus_tag LOCUS_00330 36434 35262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38410 36932 gene locus_tag LOCUS_00340 38410 36932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 38316 38681 gene locus_tag LOCUS_00350 38316 38681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 39339 38725 gene locus_tag LOCUS_00360 39339 38725 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227150.1 protein_id gnl|my_center|LOCUS_00360 39441 39797 gene locus_tag LOCUS_00370 39441 39797 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031457.1 protein_id gnl|my_center|LOCUS_00370 39835 40617 gene locus_tag LOCUS_00380 39835 40617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 40599 41696 gene locus_tag LOCUS_00390 40599 41696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 42278 41769 gene locus_tag LOCUS_00400 gene def 42278 41769 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_00400 43474 42275 gene locus_tag LOCUS_00410 43474 42275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 43589 43822 gene locus_tag LOCUS_00420 43589 43822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 46772 43950 gene locus_tag LOCUS_00430 gene gcvP 46772 43950 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_00430 47912 47031 gene locus_tag LOCUS_00440 47912 47031 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027127.1 protein_id gnl|my_center|LOCUS_00440 48018 48677 gene locus_tag LOCUS_00450 48018 48677 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222032.1 protein_id gnl|my_center|LOCUS_00450 49391 48762 gene locus_tag LOCUS_00460 49391 48762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 50605 49388 gene locus_tag LOCUS_00470 50605 49388 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742063.1 protein_id gnl|my_center|LOCUS_00470 51844 50609 gene locus_tag LOCUS_00480 51844 50609 CDS product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848418.1 protein_id gnl|my_center|LOCUS_00480 52819 52235 gene locus_tag LOCUS_00490 52819 52235 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079363.1 protein_id gnl|my_center|LOCUS_00490 53491 53027 gene locus_tag LOCUS_00500 53491 53027 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_00500 54474 53716 gene locus_tag LOCUS_00510 54474 53716 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467185.1 protein_id gnl|my_center|LOCUS_00510 54923 54471 gene locus_tag LOCUS_00520 gene garA 54923 54471 CDS product glycogen accumulation regulator GarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899041.1 protein_id gnl|my_center|LOCUS_00520 55518 55138 gene locus_tag LOCUS_00530 gene gcvH 55518 55138 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_00530 56501 55581 gene locus_tag LOCUS_00540 56501 55581 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027758.1 protein_id gnl|my_center|LOCUS_00540 56844 56512 gene locus_tag LOCUS_00550 56844 56512 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977440.1 protein_id gnl|my_center|LOCUS_00550 57809 56841 gene locus_tag LOCUS_00560 57809 56841 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977439.1 protein_id gnl|my_center|LOCUS_00560 58444 57806 gene locus_tag LOCUS_00570 58444 57806 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 protein_id gnl|my_center|LOCUS_00570 59205 58735 gene locus_tag LOCUS_00580 59205 58735 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226165.1 protein_id gnl|my_center|LOCUS_00580 60438 59251 gene locus_tag LOCUS_00590 60438 59251 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031879.1 protein_id gnl|my_center|LOCUS_00590 60705 61586 gene locus_tag LOCUS_00600 60705 61586 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227300.1 protein_id gnl|my_center|LOCUS_00600 61693 61902 gene locus_tag LOCUS_00610 61693 61902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 61899 62372 gene locus_tag LOCUS_00620 61899 62372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 62659 62369 gene locus_tag LOCUS_00630 62659 62369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 62754 63431 gene locus_tag LOCUS_00640 62754 63431 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031342.1 protein_id gnl|my_center|LOCUS_00640 63640 63470 gene locus_tag LOCUS_00650 63640 63470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 63930 63733 gene locus_tag LOCUS_00660 63930 63733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 65802 64021 gene locus_tag LOCUS_00670 gene selB 65802 64021 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226942.1 protein_id gnl|my_center|LOCUS_00670 67222 65804 gene locus_tag LOCUS_00680 gene selA 67222 65804 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226943.1 protein_id gnl|my_center|LOCUS_00680 67220 67125 gene locus_tag LOCUS_t00010 67220 67125 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 68452 67289 gene locus_tag LOCUS_00690 gene nrfD 68452 67289 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225065.1 protein_id gnl|my_center|LOCUS_00690 69495 68449 gene locus_tag LOCUS_00700 69495 68449 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225066.1 protein_id gnl|my_center|LOCUS_00700 72817 69488 gene locus_tag LOCUS_00710 gene fdh 72817 69488 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225067.1 transl_except (pos:complement(72248..72250),aa:Sec) note codon on position 190 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_00710 73586 73272 gene locus_tag LOCUS_00720 73586 73272 CDS product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028253.1 protein_id gnl|my_center|LOCUS_00720 74283 73684 gene locus_tag LOCUS_00730 74283 73684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 75661 74663 gene locus_tag LOCUS_00740 75661 74663 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230546.1 protein_id gnl|my_center|LOCUS_00740 75794 76903 gene locus_tag LOCUS_00750 75794 76903 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230545.1 protein_id gnl|my_center|LOCUS_00750 77887 77033 gene locus_tag LOCUS_00760 77887 77033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 78747 78118 gene locus_tag LOCUS_00770 78747 78118 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978121.1 protein_id gnl|my_center|LOCUS_00770 79832 78744 gene locus_tag LOCUS_00780 79832 78744 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230142.1 protein_id gnl|my_center|LOCUS_00780 81329 80010 gene locus_tag LOCUS_00790 81329 80010 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104427.1 protein_id gnl|my_center|LOCUS_00790 81629 83074 gene locus_tag LOCUS_00800 81629 83074 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484182.1 protein_id gnl|my_center|LOCUS_00800 83932 83081 gene locus_tag LOCUS_00810 83932 83081 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224394.1 protein_id gnl|my_center|LOCUS_00810 84896 83964 gene locus_tag LOCUS_00820 84896 83964 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090078.1 protein_id gnl|my_center|LOCUS_00820 86435 84930 gene locus_tag LOCUS_00830 86435 84930 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226334.1 protein_id gnl|my_center|LOCUS_00830 86747 87166 gene locus_tag LOCUS_00840 86747 87166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 87303 88232 gene locus_tag LOCUS_00850 87303 88232 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027366.1 protein_id gnl|my_center|LOCUS_00850 88423 88653 gene locus_tag LOCUS_00860 88423 88653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 88873 88682 gene locus_tag LOCUS_00870 88873 88682 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971465.1 protein_id gnl|my_center|LOCUS_00870 90105 88888 gene locus_tag LOCUS_00880 90105 88888 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225331.1 protein_id gnl|my_center|LOCUS_00880 90665 90192 gene locus_tag LOCUS_00890 gene rnhA 90665 90192 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227882.1 protein_id gnl|my_center|LOCUS_00890 90760 91860 gene locus_tag LOCUS_00900 90760 91860 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027022.1 protein_id gnl|my_center|LOCUS_00900 93071 91878 gene locus_tag LOCUS_00910 93071 91878 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026915.1 protein_id gnl|my_center|LOCUS_00910 94010 93117 gene locus_tag LOCUS_00920 94010 93117 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223526.1 protein_id gnl|my_center|LOCUS_00920 94026 94925 gene locus_tag LOCUS_00930 94026 94925 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891968.1 protein_id gnl|my_center|LOCUS_00930 95549 94938 gene locus_tag LOCUS_00940 95549 94938 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031671.1 protein_id gnl|my_center|LOCUS_00940 95567 96076 gene locus_tag LOCUS_00950 95567 96076 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225219.1 protein_id gnl|my_center|LOCUS_00950 97084 96152 gene locus_tag LOCUS_00960 97084 96152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 97684 97247 gene locus_tag LOCUS_00970 97684 97247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 97849 98979 gene locus_tag LOCUS_00980 97849 98979 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225409.1 protein_id gnl|my_center|LOCUS_00980 98976 99641 gene locus_tag LOCUS_00990 98976 99641 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_00990 99835 100317 gene locus_tag LOCUS_01000 99835 100317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 100405 101040 gene locus_tag LOCUS_01010 100405 101040 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027455.1 protein_id gnl|my_center|LOCUS_01010 101116 102225 gene locus_tag LOCUS_01020 gene corA 101116 102225 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223003.1 protein_id gnl|my_center|LOCUS_01020 102594 103256 gene locus_tag LOCUS_01030 102594 103256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 103415 103834 gene locus_tag LOCUS_01040 103415 103834 CDS product YchJ family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227883.1 protein_id gnl|my_center|LOCUS_01040 104938 103886 gene locus_tag LOCUS_01050 104938 103886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 105843 105058 gene locus_tag LOCUS_01060 105843 105058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 107591 105936 gene locus_tag LOCUS_01070 107591 105936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 107962 109092 gene locus_tag LOCUS_01080 107962 109092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 111244 109199 gene locus_tag LOCUS_01090 111244 109199 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029494.1 protein_id gnl|my_center|LOCUS_01090 111335 112012 gene locus_tag LOCUS_01100 111335 112012 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974777.1 protein_id gnl|my_center|LOCUS_01100 112478 113371 gene locus_tag LOCUS_01110 112478 113371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01110 113452 114258 gene locus_tag LOCUS_01120 113452 114258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01120 114255 115004 gene locus_tag LOCUS_01130 114255 115004 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731624.1 protein_id gnl|my_center|LOCUS_01130 116044 115124 gene locus_tag LOCUS_01140 116044 115124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 116524 117834 gene locus_tag LOCUS_01150 116524 117834 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466941.1 protein_id gnl|my_center|LOCUS_01150 118256 117960 gene locus_tag LOCUS_01160 118256 117960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 119493 118387 gene locus_tag LOCUS_01170 119493 118387 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_01170 120260 119490 gene locus_tag LOCUS_01180 120260 119490 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_01180 121117 120317 gene locus_tag LOCUS_01190 gene modA 121117 120317 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029176.1 protein_id gnl|my_center|LOCUS_01190 121557 121141 gene locus_tag LOCUS_01200 121557 121141 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467790.1 protein_id gnl|my_center|LOCUS_01200 123087 121906 gene locus_tag LOCUS_01210 123087 121906 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228609.1 protein_id gnl|my_center|LOCUS_01210 124066 123221 gene locus_tag LOCUS_01220 124066 123221 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230371.1 protein_id gnl|my_center|LOCUS_01220 124195 125133 gene locus_tag LOCUS_01230 124195 125133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224152.1 protein_id gnl|my_center|LOCUS_01230 125737 125186 gene locus_tag LOCUS_01240 125737 125186 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226688.1 protein_id gnl|my_center|LOCUS_01240 126090 125773 gene locus_tag LOCUS_01250 126090 125773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 125974 127140 gene locus_tag LOCUS_01260 125974 127140 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225315.1 protein_id gnl|my_center|LOCUS_01260 127286 128404 gene locus_tag LOCUS_01270 127286 128404 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730643.1 protein_id gnl|my_center|LOCUS_01270 128529 129182 gene locus_tag LOCUS_01280 128529 129182 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_01280 130739 129186 gene locus_tag LOCUS_01290 130739 129186 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312152.1 protein_id gnl|my_center|LOCUS_01290 131235 130921 gene locus_tag LOCUS_01300 131235 130921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 131814 133784 gene locus_tag LOCUS_01310 131814 133784 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228637.1 protein_id gnl|my_center|LOCUS_01310 133781 134764 gene locus_tag LOCUS_01320 133781 134764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228636.1 protein_id gnl|my_center|LOCUS_01320 134862 140681 gene locus_tag LOCUS_01330 134862 140681 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831510.1 protein_id gnl|my_center|LOCUS_01330 140683 141156 gene locus_tag LOCUS_01340 140683 141156 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228629.1 protein_id gnl|my_center|LOCUS_01340 141202 141705 gene locus_tag LOCUS_01350 141202 141705 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228628.1 protein_id gnl|my_center|LOCUS_01350 141846 142109 gene locus_tag LOCUS_01360 141846 142109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 142557 142042 gene locus_tag LOCUS_01370 142557 142042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 143071 142835 gene locus_tag LOCUS_01380 143071 142835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 144194 143289 gene locus_tag LOCUS_01390 144194 143289 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849258.1 protein_id gnl|my_center|LOCUS_01390 145127 144285 gene locus_tag LOCUS_01400 145127 144285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 146718 145351 gene locus_tag LOCUS_01410 146718 145351 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228635.1 protein_id gnl|my_center|LOCUS_01410 147701 146715 gene locus_tag LOCUS_01420 147701 146715 CDS product DUF1702 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086861803.1 protein_id gnl|my_center|LOCUS_01420 147935 149026 gene locus_tag LOCUS_01430 147935 149026 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228627.1 protein_id gnl|my_center|LOCUS_01430 149023 149724 gene locus_tag LOCUS_01440 149023 149724 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228658.1 protein_id gnl|my_center|LOCUS_01440 150737 149925 gene locus_tag LOCUS_01450 150737 149925 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228650.1 protein_id gnl|my_center|LOCUS_01450 152226 151159 gene locus_tag LOCUS_01460 152226 151159 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742109.1 protein_id gnl|my_center|LOCUS_01460 152549 153148 gene locus_tag LOCUS_01470 152549 153148 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405473.1 protein_id gnl|my_center|LOCUS_01470 153174 154049 gene locus_tag LOCUS_01480 153174 154049 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100978.1 protein_id gnl|my_center|LOCUS_01480 154728 154129 gene locus_tag LOCUS_01490 154728 154129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 155308 154718 gene locus_tag LOCUS_01500 155308 154718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228656.1 protein_id gnl|my_center|LOCUS_01500 156820 155474 gene locus_tag LOCUS_01510 156820 155474 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027026.1 protein_id gnl|my_center|LOCUS_01510 156917 157567 gene locus_tag LOCUS_01520 156917 157567 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222801.1 protein_id gnl|my_center|LOCUS_01520 157787 159325 gene locus_tag LOCUS_01530 157787 159325 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172724.1 protein_id gnl|my_center|LOCUS_01530 160267 159707 gene locus_tag LOCUS_01540 160267 159707 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226547.1 protein_id gnl|my_center|LOCUS_01540 162061 160598 gene locus_tag LOCUS_01550 162061 160598 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030556.1 protein_id gnl|my_center|LOCUS_01550 163071 162271 gene locus_tag LOCUS_01560 163071 162271 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223236.1 protein_id gnl|my_center|LOCUS_01560 164426 163167 gene locus_tag LOCUS_01570 164426 163167 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226537.1 protein_id gnl|my_center|LOCUS_01570 164761 164423 gene locus_tag LOCUS_01580 164761 164423 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226535.1 protein_id gnl|my_center|LOCUS_01580 164966 165850 gene locus_tag LOCUS_01590 164966 165850 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405888.1 protein_id gnl|my_center|LOCUS_01590 165981 166847 gene locus_tag LOCUS_01600 165981 166847 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727063.1 protein_id gnl|my_center|LOCUS_01600 167704 166952 gene locus_tag LOCUS_01610 167704 166952 CDS product DUF899 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730220.1 protein_id gnl|my_center|LOCUS_01610 167957 169141 gene locus_tag LOCUS_01620 167957 169141 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228609.1 protein_id gnl|my_center|LOCUS_01620 169991 169209 gene locus_tag LOCUS_01630 169991 169209 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224474.1 protein_id gnl|my_center|LOCUS_01630 170337 170077 gene locus_tag LOCUS_01640 170337 170077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 170615 170328 gene locus_tag LOCUS_01650 170615 170328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 171011 171892 gene locus_tag LOCUS_01660 171011 171892 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_01660 171885 172079 gene locus_tag LOCUS_01670 171885 172079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 172412 173788 gene locus_tag LOCUS_01680 172412 173788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 173793 174392 gene locus_tag LOCUS_01690 173793 174392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 174698 175453 gene locus_tag LOCUS_01700 174698 175453 CDS product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727524.1 protein_id gnl|my_center|LOCUS_01700 175513 175851 gene locus_tag LOCUS_01710 175513 175851 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222125.1 protein_id gnl|my_center|LOCUS_01710 176818 175913 gene locus_tag LOCUS_01720 176818 175913 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_01720 179542 177362 gene locus_tag LOCUS_01730 179542 177362 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 protein_id gnl|my_center|LOCUS_01730 185982 179539 gene locus_tag LOCUS_01740 185982 179539 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937974.1 protein_id gnl|my_center|LOCUS_01740 185866 186144 gene locus_tag LOCUS_01750 185866 186144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 186250 187542 gene locus_tag LOCUS_01760 186250 187542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 187532 188170 gene locus_tag LOCUS_01770 187532 188170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 188173 188847 gene locus_tag LOCUS_01780 188173 188847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 188990 190219 gene locus_tag LOCUS_01790 188990 190219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 190514 191350 gene locus_tag LOCUS_01800 190514 191350 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972784.1 protein_id gnl|my_center|LOCUS_01800 191350 192504 gene locus_tag LOCUS_01810 191350 192504 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222997.1 protein_id gnl|my_center|LOCUS_01810 192501 193160 gene locus_tag LOCUS_01820 192501 193160 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972782.1 protein_id gnl|my_center|LOCUS_01820 194468 193209 gene locus_tag LOCUS_01830 194468 193209 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528639.1 protein_id gnl|my_center|LOCUS_01830 194827 194456 gene locus_tag LOCUS_01840 194827 194456 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528640.1 protein_id gnl|my_center|LOCUS_01840 196007 194976 gene locus_tag LOCUS_01850 196007 194976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 196287 196580 gene locus_tag LOCUS_01860 196287 196580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 197051 197587 gene locus_tag LOCUS_01870 197051 197587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 198140 197685 gene locus_tag LOCUS_01880 198140 197685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 198373 201243 gene locus_tag LOCUS_01890 198373 201243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 202317 201526 gene locus_tag LOCUS_01900 202317 201526 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899614.1 protein_id gnl|my_center|LOCUS_01900 203534 202317 gene locus_tag LOCUS_01910 gene istA 203534 202317 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014001845.1 protein_id gnl|my_center|LOCUS_01910 203956 204144 gene locus_tag LOCUS_01920 203956 204144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 204174 205526 gene locus_tag LOCUS_01930 204174 205526 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228451.1 protein_id gnl|my_center|LOCUS_01930 205966 206454 gene locus_tag LOCUS_01940 205966 206454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 207115 207801 gene locus_tag LOCUS_01950 207115 207801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 209111 208488 gene locus_tag LOCUS_01960 209111 208488 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027318.1 protein_id gnl|my_center|LOCUS_01960 209279 210043 gene locus_tag LOCUS_01970 209279 210043 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_01970 213641 210126 gene locus_tag LOCUS_01980 213641 210126 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007510795.1 protein_id gnl|my_center|LOCUS_01980 213731 214093 gene locus_tag LOCUS_01990 213731 214093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 214090 214920 gene locus_tag LOCUS_02000 214090 214920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 214938 215537 gene locus_tag LOCUS_02010 214938 215537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02010 215965 215639 gene locus_tag LOCUS_02020 215965 215639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 216634 215978 gene locus_tag LOCUS_02030 216634 215978 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228294.1 protein_id gnl|my_center|LOCUS_02030 216732 217700 gene locus_tag LOCUS_02040 216732 217700 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731576.1 protein_id gnl|my_center|LOCUS_02040 217898 217728 gene locus_tag LOCUS_02050 217898 217728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 218773 217937 gene locus_tag LOCUS_02060 218773 217937 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227428.1 protein_id gnl|my_center|LOCUS_02060 218868 219593 gene locus_tag LOCUS_02070 218868 219593 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227429.1 protein_id gnl|my_center|LOCUS_02070 219988 220896 gene locus_tag LOCUS_02080 219988 220896 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031781.1 protein_id gnl|my_center|LOCUS_02080 220889 221083 gene locus_tag LOCUS_02090 220889 221083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 221432 221148 gene locus_tag LOCUS_02100 221432 221148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 226539 221623 gene locus_tag LOCUS_02110 226539 221623 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013859.1 protein_id gnl|my_center|LOCUS_02110 229337 226536 gene locus_tag LOCUS_02120 229337 226536 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013860.1 protein_id gnl|my_center|LOCUS_02120 230418 229351 gene locus_tag LOCUS_02130 230418 229351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 232473 230515 gene locus_tag LOCUS_02140 232473 230515 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028768.1 protein_id gnl|my_center|LOCUS_02140 232703 235210 gene locus_tag LOCUS_02150 232703 235210 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073950391.1 protein_id gnl|my_center|LOCUS_02150 235237 235656 gene locus_tag LOCUS_02160 235237 235656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 235810 236202 gene locus_tag LOCUS_02170 235810 236202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 236296 237654 gene locus_tag LOCUS_02180 236296 237654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 237735 238733 gene locus_tag LOCUS_02190 237735 238733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 238730 239839 gene locus_tag LOCUS_02200 238730 239839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 239893 240438 gene locus_tag LOCUS_02210 239893 240438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 240438 241526 gene locus_tag LOCUS_02220 240438 241526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 242278 241544 gene locus_tag LOCUS_02230 242278 241544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 242501 243433 gene locus_tag LOCUS_02240 242501 243433 CDS product STM4015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042080.1 protein_id gnl|my_center|LOCUS_02240 243441 244391 gene locus_tag LOCUS_02250 243441 244391 CDS product STM4015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042080.1 protein_id gnl|my_center|LOCUS_02250 244393 245523 gene locus_tag LOCUS_02260 244393 245523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 245511 246314 gene locus_tag LOCUS_02270 245511 246314 CDS product STM4013/SEN3800 family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202626.1 protein_id gnl|my_center|LOCUS_02270 246311 247636 gene locus_tag LOCUS_02280 246311 247636 CDS product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202627.1 protein_id gnl|my_center|LOCUS_02280 247633 248550 gene locus_tag LOCUS_02290 247633 248550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 248873 250516 gene locus_tag LOCUS_02300 248873 250516 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026997.1 protein_id gnl|my_center|LOCUS_02300 250564 251535 gene locus_tag LOCUS_02310 250564 251535 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031004.1 protein_id gnl|my_center|LOCUS_02310 251713 252975 gene locus_tag LOCUS_02320 gene kynU 251713 252975 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257142.1 protein_id gnl|my_center|LOCUS_02320 253622 253050 gene locus_tag LOCUS_02330 253622 253050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 254998 253619 gene locus_tag LOCUS_02340 254998 253619 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_02340 255681 254995 gene locus_tag LOCUS_02350 255681 254995 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_02350 255834 256271 gene locus_tag LOCUS_02360 255834 256271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 256303 256572 gene locus_tag LOCUS_02370 256303 256572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 256617 256916 gene locus_tag LOCUS_02380 256617 256916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 258072 258773 gene locus_tag LOCUS_02390 258072 258773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 262281 258931 gene locus_tag LOCUS_02400 262281 258931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224789.1 protein_id gnl|my_center|LOCUS_02400 263289 262525 gene locus_tag LOCUS_02410 263289 262525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 265721 263808 gene locus_tag LOCUS_02420 gene htpG 265721 263808 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467081.1 protein_id gnl|my_center|LOCUS_02420 268479 265879 gene locus_tag LOCUS_02430 gene ppsA 268479 265879 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201372230.1 protein_id gnl|my_center|LOCUS_02430 268784 268476 gene locus_tag LOCUS_02440 268784 268476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 269462 270175 gene locus_tag LOCUS_02450 269462 270175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 270314 270760 gene locus_tag LOCUS_02460 270314 270760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 271892 270912 gene locus_tag LOCUS_02470 gene pip 271892 270912 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226797.1 protein_id gnl|my_center|LOCUS_02470 273185 272013 gene locus_tag LOCUS_02480 273185 272013 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_02480 274065 273220 gene locus_tag LOCUS_02490 274065 273220 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113284.1 protein_id gnl|my_center|LOCUS_02490 274400 274062 gene locus_tag LOCUS_02500 274400 274062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 275338 274397 gene locus_tag LOCUS_02510 275338 274397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 280481 275331 gene locus_tag LOCUS_02520 280481 275331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 282336 280498 gene locus_tag LOCUS_02530 282336 280498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 285137 282333 gene locus_tag LOCUS_02540 285137 282333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 286000 285134 gene locus_tag LOCUS_02550 286000 285134 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228939.1 protein_id gnl|my_center|LOCUS_02550 286698 285997 gene locus_tag LOCUS_02560 286698 285997 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229866.1 protein_id gnl|my_center|LOCUS_02560 287450 286695 gene locus_tag LOCUS_02570 287450 286695 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141932.1 protein_id gnl|my_center|LOCUS_02570 292785 287443 gene locus_tag LOCUS_02580 292785 287443 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895606.1 protein_id gnl|my_center|LOCUS_02580 293801 292782 gene locus_tag LOCUS_02590 293801 292782 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113096.1 protein_id gnl|my_center|LOCUS_02590 294895 293798 gene locus_tag LOCUS_02600 294895 293798 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115897.1 protein_id gnl|my_center|LOCUS_02600 298314 294892 gene locus_tag LOCUS_02610 298314 294892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 299414 298839 gene locus_tag LOCUS_02620 299414 298839 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971492.1 protein_id gnl|my_center|LOCUS_02620 299966 299553 gene locus_tag LOCUS_02630 299966 299553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 300274 300035 gene locus_tag LOCUS_02640 300274 300035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 311544 300271 gene locus_tag LOCUS_02650 311544 300271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 312800 311541 gene locus_tag LOCUS_02660 312800 311541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 313443 312898 gene locus_tag LOCUS_02670 313443 312898 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029338.1 protein_id gnl|my_center|LOCUS_02670 313558 314046 gene locus_tag LOCUS_02680 gene smpB 313558 314046 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_02680 314267 314950 gene locus_tag LOCUS_02690 314267 314950 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975649.1 protein_id gnl|my_center|LOCUS_02690 314998 316485 gene locus_tag LOCUS_02700 314998 316485 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029543.1 protein_id gnl|my_center|LOCUS_02700 316627 318006 gene locus_tag LOCUS_02710 316627 318006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 319214 318015 gene locus_tag LOCUS_02720 319214 318015 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230594.1 protein_id gnl|my_center|LOCUS_02720 320739 319744 gene locus_tag LOCUS_02730 320739 319744 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107451924.1 protein_id gnl|my_center|LOCUS_02730 320919 323900 gene locus_tag LOCUS_02740 320919 323900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 324410 324009 gene locus_tag LOCUS_02750 324410 324009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 324595 325380 gene locus_tag LOCUS_02760 324595 325380 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803873.1 protein_id gnl|my_center|LOCUS_02760 325957 325451 gene locus_tag LOCUS_02770 325957 325451 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225996.1 protein_id gnl|my_center|LOCUS_02770 326778 326101 gene locus_tag LOCUS_02780 326778 326101 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222589.1 protein_id gnl|my_center|LOCUS_02780 328132 327281 gene locus_tag LOCUS_02790 328132 327281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 328770 328321 gene locus_tag LOCUS_02800 328770 328321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 330235 328868 gene locus_tag LOCUS_02810 330235 328868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 330392 332665 gene locus_tag LOCUS_02820 330392 332665 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223220.1 protein_id gnl|my_center|LOCUS_02820 333186 332764 gene locus_tag LOCUS_02830 333186 332764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 333931 333329 gene locus_tag LOCUS_02840 333931 333329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 334384 334746 gene locus_tag LOCUS_02850 334384 334746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 334743 335405 gene locus_tag LOCUS_02860 334743 335405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 335494 337287 gene locus_tag LOCUS_02870 335494 337287 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028097.1 protein_id gnl|my_center|LOCUS_02870 338468 337401 gene locus_tag LOCUS_02880 338468 337401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 339365 338475 gene locus_tag LOCUS_02890 339365 338475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 340821 339658 gene locus_tag LOCUS_02900 340821 339658 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977757.1 protein_id gnl|my_center|LOCUS_02900 340982 341218 gene locus_tag LOCUS_02910 340982 341218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 341303 342775 gene locus_tag LOCUS_02920 341303 342775 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224038.1 protein_id gnl|my_center|LOCUS_02920 343553 342891 gene locus_tag LOCUS_02930 343553 342891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 345339 343567 gene locus_tag LOCUS_02940 345339 343567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 346699 345440 gene locus_tag LOCUS_02950 gene wcaI 346699 345440 CDS product colanic acid biosynthesis fucosyltransferase WcaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699685.1 protein_id gnl|my_center|LOCUS_02950 346847 347401 gene locus_tag LOCUS_02960 346847 347401 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068381.1 protein_id gnl|my_center|LOCUS_02960 348854 347382 gene locus_tag LOCUS_02970 348854 347382 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_02970 349430 349224 gene locus_tag LOCUS_02980 349430 349224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 349910 349557 gene locus_tag LOCUS_02990 349910 349557 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041222525.1 protein_id gnl|my_center|LOCUS_02990 350599 349949 gene locus_tag LOCUS_03000 350599 349949 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896727.1 protein_id gnl|my_center|LOCUS_03000 351753 350788 gene locus_tag LOCUS_03010 gene egtD 351753 350788 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226791.1 protein_id gnl|my_center|LOCUS_03010 352546 351770 gene locus_tag LOCUS_03020 gene egtC 352546 351770 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226792.1 protein_id gnl|my_center|LOCUS_03020 353951 352620 gene locus_tag LOCUS_03030 gene egtB 353951 352620 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226793.1 protein_id gnl|my_center|LOCUS_03030 355183 353948 gene locus_tag LOCUS_03040 gene egtA 355183 353948 CDS product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226794.1 protein_id gnl|my_center|LOCUS_03040 355704 357077 gene locus_tag LOCUS_03050 355704 357077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 357230 358492 gene locus_tag LOCUS_03060 357230 358492 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257976.1 protein_id gnl|my_center|LOCUS_03060 361024 358541 gene locus_tag LOCUS_03070 361024 358541 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_03070 361878 361021 gene locus_tag LOCUS_03080 361878 361021 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_03080 362619 361954 gene locus_tag LOCUS_03090 362619 361954 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975444.1 protein_id gnl|my_center|LOCUS_03090 363917 362616 gene locus_tag LOCUS_03100 363917 362616 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230965.1 protein_id gnl|my_center|LOCUS_03100 364217 365221 gene locus_tag LOCUS_03110 364217 365221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 366362 365355 gene locus_tag LOCUS_03120 366362 365355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 366603 367772 gene locus_tag LOCUS_03130 366603 367772 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104175.1 protein_id gnl|my_center|LOCUS_03130 368261 367791 gene locus_tag LOCUS_03140 368261 367791 CDS product DUF1203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028474.1 protein_id gnl|my_center|LOCUS_03140 368589 371558 gene locus_tag LOCUS_03150 368589 371558 CDS product carbohydrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031383.1 protein_id gnl|my_center|LOCUS_03150 373199 371598 gene locus_tag LOCUS_03160 373199 371598 CDS product asparagine synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526144.1 protein_id gnl|my_center|LOCUS_03160 374171 373203 gene locus_tag LOCUS_03170 374171 373203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 375023 374778 gene locus_tag LOCUS_03180 375023 374778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 375278 375105 gene locus_tag LOCUS_03190 375278 375105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 375622 375275 gene locus_tag LOCUS_03200 375622 375275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 376122 375619 gene locus_tag LOCUS_03210 376122 375619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 376517 376167 gene locus_tag LOCUS_03220 376517 376167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 376588 377061 gene locus_tag LOCUS_03230 376588 377061 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015324.1 protein_id gnl|my_center|LOCUS_03230 378963 377368 gene locus_tag LOCUS_03240 378963 377368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 379439 381151 gene locus_tag LOCUS_03250 379439 381151 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258936.1 protein_id gnl|my_center|LOCUS_03250 381632 381261 gene locus_tag LOCUS_03260 381632 381261 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228912.1 protein_id gnl|my_center|LOCUS_03260 384086 381756 gene locus_tag LOCUS_03270 gene lon 384086 381756 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729178.1 protein_id gnl|my_center|LOCUS_03270 384580 384927 gene locus_tag LOCUS_03280 384580 384927 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_03280 387263 386370 gene locus_tag LOCUS_03290 387263 386370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 387462 387247 gene locus_tag LOCUS_03300 387462 387247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 387484 388596 gene locus_tag LOCUS_03310 387484 388596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 389056 389613 gene locus_tag LOCUS_03320 389056 389613 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668689.1 protein_id gnl|my_center|LOCUS_03320 389774 390142 gene locus_tag LOCUS_03330 389774 390142 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222011.1 protein_id gnl|my_center|LOCUS_03330 390730 390194 gene locus_tag LOCUS_03340 390730 390194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 390639 392009 gene locus_tag LOCUS_03350 390639 392009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 393417 392158 gene locus_tag LOCUS_03360 393417 392158 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630264.1 protein_id gnl|my_center|LOCUS_03360 395327 393645 gene locus_tag LOCUS_03370 395327 393645 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213089166.1 protein_id gnl|my_center|LOCUS_03370 397826 396345 gene locus_tag LOCUS_03380 397826 396345 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029255.1 protein_id gnl|my_center|LOCUS_03380 398839 397823 gene locus_tag LOCUS_03390 398839 397823 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113321.1 protein_id gnl|my_center|LOCUS_03390 400038 398839 gene locus_tag LOCUS_03400 gene pdhA 400038 398839 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467649.1 protein_id gnl|my_center|LOCUS_03400 400144 400650 gene locus_tag LOCUS_03410 400144 400650 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083236.1 protein_id gnl|my_center|LOCUS_03410 401533 400712 gene locus_tag LOCUS_03420 401533 400712 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 protein_id gnl|my_center|LOCUS_03420 401966 401640 gene locus_tag LOCUS_03430 401966 401640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 402316 403806 gene locus_tag LOCUS_03440 402316 403806 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027994.1 protein_id gnl|my_center|LOCUS_03440 404031 405806 gene locus_tag LOCUS_03450 404031 405806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 405925 406425 gene locus_tag LOCUS_03460 405925 406425 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226147.1 protein_id gnl|my_center|LOCUS_03460 407433 406585 gene locus_tag LOCUS_03470 407433 406585 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_03470 407684 409123 gene locus_tag LOCUS_03480 407684 409123 CDS product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974134.1 protein_id gnl|my_center|LOCUS_03480 409484 409233 gene locus_tag LOCUS_03490 409484 409233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 410874 409555 gene locus_tag LOCUS_03500 410874 409555 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_03500 412019 410907 gene locus_tag LOCUS_03510 412019 410907 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872371.1 protein_id gnl|my_center|LOCUS_03510 412983 412012 gene locus_tag LOCUS_03520 412983 412012 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230588.1 protein_id gnl|my_center|LOCUS_03520 414210 412993 gene locus_tag LOCUS_03530 414210 412993 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226253.1 protein_id gnl|my_center|LOCUS_03530 415554 414280 gene locus_tag LOCUS_03540 415554 414280 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227054.1 protein_id gnl|my_center|LOCUS_03540 415929 417503 gene locus_tag LOCUS_03550 415929 417503 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084147.1 protein_id gnl|my_center|LOCUS_03550 417500 418840 gene locus_tag LOCUS_03560 417500 418840 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110111.1 protein_id gnl|my_center|LOCUS_03560 418903 418821 gene locus_tag LOCUS_t00020 418903 418821 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 419380 418886 gene locus_tag LOCUS_03570 419380 418886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 420034 420732 gene locus_tag LOCUS_03580 420034 420732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 421517 420774 gene locus_tag LOCUS_03590 421517 420774 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973545.1 protein_id gnl|my_center|LOCUS_03590 422458 421517 gene locus_tag LOCUS_03600 422458 421517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221995.1 protein_id gnl|my_center|LOCUS_03600 422381 424306 gene locus_tag LOCUS_03610 422381 424306 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221996.1 protein_id gnl|my_center|LOCUS_03610 424270 424917 gene locus_tag LOCUS_03620 424270 424917 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028204.1 protein_id gnl|my_center|LOCUS_03620 425939 424962 gene locus_tag LOCUS_03630 425939 424962 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228234.1 protein_id gnl|my_center|LOCUS_03630 427478 426120 gene locus_tag LOCUS_03640 427478 426120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863065.1 protein_id gnl|my_center|LOCUS_03640 428449 427478 gene locus_tag LOCUS_03650 428449 427478 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_03650 429420 428449 gene locus_tag LOCUS_03660 429420 428449 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259508.1 protein_id gnl|my_center|LOCUS_03660 430214 429417 gene locus_tag LOCUS_03670 430214 429417 CDS product DUF3050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219159941.1 protein_id gnl|my_center|LOCUS_03670 431147 430218 gene locus_tag LOCUS_03680 431147 430218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 432247 431144 gene locus_tag LOCUS_03690 gene hppD 432247 431144 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810922.1 protein_id gnl|my_center|LOCUS_03690 433560 432301 gene locus_tag LOCUS_03700 gene fabF 433560 432301 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460499.1 protein_id gnl|my_center|LOCUS_03700 435173 433557 gene locus_tag LOCUS_03710 435173 433557 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185142.1 protein_id gnl|my_center|LOCUS_03710 435736 435170 gene locus_tag LOCUS_03720 435736 435170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 436827 435733 gene locus_tag LOCUS_03730 436827 435733 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007460623.1 protein_id gnl|my_center|LOCUS_03730 437065 436820 gene locus_tag LOCUS_03740 437065 436820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 437331 437065 gene locus_tag LOCUS_03750 437331 437065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 437362 438087 gene locus_tag LOCUS_03760 437362 438087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 439472 438138 gene locus_tag LOCUS_03770 439472 438138 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902970.1 protein_id gnl|my_center|LOCUS_03770 439939 443511 gene locus_tag LOCUS_03780 439939 443511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 443883 443563 gene locus_tag LOCUS_03790 443883 443563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03790 445169 443880 gene locus_tag LOCUS_03800 445169 443880 CDS product ketosynthase chain-length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030171.1 protein_id gnl|my_center|LOCUS_03800 446440 445166 gene locus_tag LOCUS_03810 446440 445166 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973654.1 protein_id gnl|my_center|LOCUS_03810 446871 446437 gene locus_tag LOCUS_03820 446871 446437 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973653.1 protein_id gnl|my_center|LOCUS_03820 447592 446864 gene locus_tag LOCUS_03830 447592 446864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 449028 447592 gene locus_tag LOCUS_03840 gene accC 449028 447592 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_03840 449485 449042 gene locus_tag LOCUS_03850 449485 449042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 451431 449482 gene locus_tag LOCUS_03860 451431 449482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 451661 451428 gene locus_tag LOCUS_03870 451661 451428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 452087 452899 gene locus_tag LOCUS_03880 452087 452899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 453121 453471 gene locus_tag LOCUS_03890 453121 453471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 453487 454836 gene locus_tag LOCUS_03900 453487 454836 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093954241.1 protein_id gnl|my_center|LOCUS_03900 455321 456706 gene locus_tag LOCUS_03910 455321 456706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 457237 457446 gene locus_tag LOCUS_03920 457237 457446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082597.1 protein_id gnl|my_center|LOCUS_03920 459886 457607 gene locus_tag LOCUS_03930 459886 457607 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_03930 461441 460671 gene locus_tag LOCUS_03940 461441 460671 CDS product DUF5995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977373.1 protein_id gnl|my_center|LOCUS_03940 464517 461566 gene locus_tag LOCUS_03950 464517 461566 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486951.1 protein_id gnl|my_center|LOCUS_03950 464706 467372 gene locus_tag LOCUS_03960 464706 467372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 468043 467477 gene locus_tag LOCUS_03970 468043 467477 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969736.1 protein_id gnl|my_center|LOCUS_03970 468317 469444 gene locus_tag LOCUS_03980 468317 469444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 470530 469559 gene locus_tag LOCUS_03990 470530 469559 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229677.1 protein_id gnl|my_center|LOCUS_03990 470798 471640 gene locus_tag LOCUS_04000 470798 471640 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030136.1 protein_id gnl|my_center|LOCUS_04000 471786 472355 gene locus_tag LOCUS_04010 471786 472355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 472352 472714 gene locus_tag LOCUS_04020 gene crcB 472352 472714 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031399.1 protein_id gnl|my_center|LOCUS_04020 473114 472779 gene locus_tag LOCUS_04030 473114 472779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466777.1 protein_id gnl|my_center|LOCUS_04030 474589 473339 gene locus_tag LOCUS_04040 474589 473339 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704846.1 protein_id gnl|my_center|LOCUS_04040 474754 475470 gene locus_tag LOCUS_04050 474754 475470 CDS product serine esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013614293.1 protein_id gnl|my_center|LOCUS_04050 476637 475513 gene locus_tag LOCUS_04060 476637 475513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 477357 476740 gene locus_tag LOCUS_04070 477357 476740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 477570 478427 gene locus_tag LOCUS_04080 477570 478427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 479741 479376 gene locus_tag LOCUS_04090 479741 479376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 480127 479804 gene locus_tag LOCUS_04100 480127 479804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 482313 480124 gene locus_tag LOCUS_04110 482313 480124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 483226 482495 gene locus_tag LOCUS_04120 483226 482495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 483575 483336 gene locus_tag LOCUS_04130 483575 483336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 483886 484179 gene locus_tag LOCUS_04140 483886 484179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 484182 484451 gene locus_tag LOCUS_04150 484182 484451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 486268 484469 gene locus_tag LOCUS_04160 486268 484469 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977687.1 protein_id gnl|my_center|LOCUS_04160 486352 486804 gene locus_tag LOCUS_04170 486352 486804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 487558 487067 gene locus_tag LOCUS_04180 487558 487067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 487907 489268 gene locus_tag LOCUS_04190 487907 489268 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225339.1 protein_id gnl|my_center|LOCUS_04190 489296 489877 gene locus_tag LOCUS_04200 489296 489877 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680960.1 protein_id gnl|my_center|LOCUS_04200 490193 490534 gene locus_tag LOCUS_04210 490193 490534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 490531 491631 gene locus_tag LOCUS_04220 490531 491631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 491628 492023 gene locus_tag LOCUS_04230 491628 492023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 492033 492389 gene locus_tag LOCUS_04240 492033 492389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 492650 493165 gene locus_tag LOCUS_04250 492650 493165 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977430.1 protein_id gnl|my_center|LOCUS_04250 493310 494716 gene locus_tag LOCUS_04260 493310 494716 CDS product selenium-binding family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392113.1 protein_id gnl|my_center|LOCUS_04260 494713 495369 gene locus_tag LOCUS_04270 494713 495369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256632.1 protein_id gnl|my_center|LOCUS_04270 495482 496813 gene locus_tag LOCUS_04280 495482 496813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 499010 496911 gene locus_tag LOCUS_04290 499010 496911 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230344.1 protein_id gnl|my_center|LOCUS_04290 500854 499799 gene locus_tag LOCUS_04300 500854 499799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 501339 505286 gene locus_tag LOCUS_04310 501339 505286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 505283 506275 gene locus_tag LOCUS_04320 505283 506275 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090585.1 protein_id gnl|my_center|LOCUS_04320 506296 506916 gene locus_tag LOCUS_04330 506296 506916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 506938 508656 gene locus_tag LOCUS_04340 506938 508656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 508659 510113 gene locus_tag LOCUS_04350 508659 510113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 510110 511054 gene locus_tag LOCUS_04360 510110 511054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 511051 511302 gene locus_tag LOCUS_04370 511051 511302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 511299 512255 gene locus_tag LOCUS_04380 511299 512255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 513223 512339 gene locus_tag LOCUS_04390 513223 512339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 513485 514807 gene locus_tag LOCUS_04400 513485 514807 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228024.1 protein_id gnl|my_center|LOCUS_04400 515840 514773 gene locus_tag LOCUS_04410 515840 514773 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169618726.1 protein_id gnl|my_center|LOCUS_04410 515991 519158 gene locus_tag LOCUS_04420 515991 519158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 519155 520003 gene locus_tag LOCUS_04430 519155 520003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 520056 521330 gene locus_tag LOCUS_04440 520056 521330 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037802.1 protein_id gnl|my_center|LOCUS_04440 523269 521536 gene locus_tag LOCUS_04450 523269 521536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 525272 523614 gene locus_tag LOCUS_04460 525272 523614 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528300.1 protein_id gnl|my_center|LOCUS_04460 525367 526602 gene locus_tag LOCUS_04470 525367 526602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 529715 526761 gene locus_tag LOCUS_04480 529715 526761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 530824 529712 gene locus_tag LOCUS_04490 530824 529712 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977648.1 protein_id gnl|my_center|LOCUS_04490 532246 530837 gene locus_tag LOCUS_04500 532246 530837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 533697 532282 gene locus_tag LOCUS_04510 533697 532282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 534317 533697 gene locus_tag LOCUS_04520 534317 533697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 534586 536223 gene locus_tag LOCUS_04530 gene pgi 534586 536223 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028056.1 protein_id gnl|my_center|LOCUS_04530 536429 539128 gene locus_tag LOCUS_04540 gene lanKC 536429 539128 CDS product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495285.1 protein_id gnl|my_center|LOCUS_04540 539135 539254 gene locus_tag LOCUS_04550 539135 539254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 539329 541050 gene locus_tag LOCUS_04560 539329 541050 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031101.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04560 541047 543047 gene locus_tag LOCUS_04570 541047 543047 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031102.1 protein_id gnl|my_center|LOCUS_04570 543713 543135 gene locus_tag LOCUS_04580 543713 543135 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228375.1 protein_id gnl|my_center|LOCUS_04580 544445 543837 gene locus_tag LOCUS_04590 544445 543837 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226387.1 protein_id gnl|my_center|LOCUS_04590 545752 544640 gene locus_tag LOCUS_04600 545752 544640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 550600 546110 gene locus_tag LOCUS_04610 550600 546110 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226365.1 protein_id gnl|my_center|LOCUS_04610 551252 550770 gene locus_tag LOCUS_04620 551252 550770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 551605 551249 gene locus_tag LOCUS_04630 551605 551249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 551544 552383 gene locus_tag LOCUS_04640 551544 552383 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731440.1 protein_id gnl|my_center|LOCUS_04640 553011 552412 gene locus_tag LOCUS_04650 553011 552412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 553849 553097 gene locus_tag LOCUS_04660 553849 553097 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230869.1 protein_id gnl|my_center|LOCUS_04660 554584 556065 gene locus_tag LOCUS_04670 554584 556065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 556161 557267 gene locus_tag LOCUS_04680 556161 557267 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113497.1 protein_id gnl|my_center|LOCUS_04680 557264 558217 gene locus_tag LOCUS_04690 557264 558217 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122762.1 protein_id gnl|my_center|LOCUS_04690 558223 559050 gene locus_tag LOCUS_04700 558223 559050 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_04700 559112 559957 gene locus_tag LOCUS_04710 559112 559957 CDS product 27-O-demethylrifamycin SV methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222580.1 protein_id gnl|my_center|LOCUS_04710 560018 560893 gene locus_tag LOCUS_04720 560018 560893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 560904 562256 gene locus_tag LOCUS_04730 560904 562256 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921846.1 protein_id gnl|my_center|LOCUS_04730 562253 562954 gene locus_tag LOCUS_04740 562253 562954 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089550.1 protein_id gnl|my_center|LOCUS_04740 565785 563350 gene locus_tag LOCUS_04750 565785 563350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 567077 565782 gene locus_tag LOCUS_04760 567077 565782 CDS product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326291.1 protein_id gnl|my_center|LOCUS_04760 568660 567122 gene locus_tag LOCUS_04770 gene desA 568660 567122 CDS product lysine decarboxylase DesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028583.1 protein_id gnl|my_center|LOCUS_04770 569652 568795 gene locus_tag LOCUS_04780 569652 568795 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028582.1 protein_id gnl|my_center|LOCUS_04780 570687 569656 gene locus_tag LOCUS_04790 gene desE 570687 569656 CDS product siderophore-binding protein DesE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976020.1 protein_id gnl|my_center|LOCUS_04790 570752 571864 gene locus_tag LOCUS_04800 570752 571864 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027977.1 protein_id gnl|my_center|LOCUS_04800 571861 572886 gene locus_tag LOCUS_04810 571861 572886 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868181.1 protein_id gnl|my_center|LOCUS_04810 572883 573728 gene locus_tag LOCUS_04820 572883 573728 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027975.1 protein_id gnl|my_center|LOCUS_04820 574735 574004 gene locus_tag LOCUS_04830 574735 574004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 575084 575470 gene locus_tag LOCUS_04840 575084 575470 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284752.1 protein_id gnl|my_center|LOCUS_04840 575467 576357 gene locus_tag LOCUS_04850 575467 576357 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229213.1 protein_id gnl|my_center|LOCUS_04850 576354 577349 gene locus_tag LOCUS_04860 576354 577349 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229214.1 protein_id gnl|my_center|LOCUS_04860 578054 577464 gene locus_tag LOCUS_04870 578054 577464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04870 579207 578035 gene locus_tag LOCUS_04880 579207 578035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 579512 579267 gene locus_tag LOCUS_04890 579512 579267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 579629 579982 gene locus_tag LOCUS_04900 579629 579982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 580987 580070 gene locus_tag LOCUS_04910 580987 580070 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466931.1 protein_id gnl|my_center|LOCUS_04910 581629 581207 gene locus_tag LOCUS_04920 581629 581207 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031795.1 protein_id gnl|my_center|LOCUS_04920 581780 583087 gene locus_tag LOCUS_04930 gene eno 581780 583087 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031794.1 protein_id gnl|my_center|LOCUS_04930 583623 583156 gene locus_tag LOCUS_04940 583623 583156 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028365.1 protein_id gnl|my_center|LOCUS_04940 583739 584311 gene locus_tag LOCUS_04950 583739 584311 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228061.1 protein_id gnl|my_center|LOCUS_04950 584511 586013 gene locus_tag LOCUS_04960 584511 586013 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225274.1 protein_id gnl|my_center|LOCUS_04960 586053 586655 gene locus_tag LOCUS_04970 586053 586655 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225273.1 protein_id gnl|my_center|LOCUS_04970 586753 587235 gene locus_tag LOCUS_04980 586753 587235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 587312 587881 gene locus_tag LOCUS_04990 587312 587881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 588746 587844 gene locus_tag LOCUS_05000 588746 587844 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031796.1 protein_id gnl|my_center|LOCUS_05000 588773 590005 gene locus_tag LOCUS_05010 588773 590005 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031797.1 protein_id gnl|my_center|LOCUS_05010 590459 590596 gene locus_tag LOCUS_05020 590459 590596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 591011 590751 gene locus_tag LOCUS_05030 591011 590751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 591656 591375 gene locus_tag LOCUS_05040 591656 591375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 592511 591864 gene locus_tag LOCUS_05050 592511 591864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 593318 592521 gene locus_tag LOCUS_05060 593318 592521 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030352.1 protein_id gnl|my_center|LOCUS_05060 593580 593999 gene locus_tag LOCUS_05070 593580 593999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 593992 594333 gene locus_tag LOCUS_05080 593992 594333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 594317 594487 gene locus_tag LOCUS_05090 594317 594487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 594474 595397 gene locus_tag LOCUS_05100 594474 595397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 596154 595630 gene locus_tag LOCUS_05110 596154 595630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 596244 596987 gene locus_tag LOCUS_05120 596244 596987 CDS product TioE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230388.1 protein_id gnl|my_center|LOCUS_05120 597668 597042 gene locus_tag LOCUS_05130 597668 597042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 598188 597793 gene locus_tag LOCUS_05140 598188 597793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 599445 598204 gene locus_tag LOCUS_05150 599445 598204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 599584 601188 gene locus_tag LOCUS_05160 599584 601188 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_05160 601198 601944 gene locus_tag LOCUS_05170 601198 601944 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091242826.1 protein_id gnl|my_center|LOCUS_05170 601941 602768 gene locus_tag LOCUS_05180 601941 602768 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224651.1 protein_id gnl|my_center|LOCUS_05180 602765 603439 gene locus_tag LOCUS_05190 602765 603439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 603799 603530 gene locus_tag LOCUS_05200 603799 603530 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230904.1 protein_id gnl|my_center|LOCUS_05200 605433 604066 gene locus_tag LOCUS_05210 605433 604066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 605679 605479 gene locus_tag LOCUS_05220 605679 605479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 607543 605915 gene locus_tag LOCUS_05230 607543 605915 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014996.1 protein_id gnl|my_center|LOCUS_05230 607666 608595 gene locus_tag LOCUS_05240 607666 608595 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226710.1 protein_id gnl|my_center|LOCUS_05240 609391 608825 gene locus_tag LOCUS_05250 609391 608825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 609526 610881 gene locus_tag LOCUS_05260 609526 610881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 611117 612115 gene locus_tag LOCUS_05270 611117 612115 CDS product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031031.1 protein_id gnl|my_center|LOCUS_05270 612898 612143 gene locus_tag LOCUS_05280 612898 612143 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971784.1 protein_id gnl|my_center|LOCUS_05280 613865 612972 gene locus_tag LOCUS_05290 613865 612972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 615554 614340 gene locus_tag LOCUS_05300 615554 614340 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031811.1 protein_id gnl|my_center|LOCUS_05300 615923 616936 gene locus_tag LOCUS_05310 615923 616936 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977450.1 protein_id gnl|my_center|LOCUS_05310 617170 618609 gene locus_tag LOCUS_05320 617170 618609 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971507.1 protein_id gnl|my_center|LOCUS_05320 619807 618668 gene locus_tag LOCUS_05330 619807 618668 CDS product DUF3103 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707631.1 protein_id gnl|my_center|LOCUS_05330 620978 619914 gene locus_tag LOCUS_05340 620978 619914 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_05340 622030 620975 gene locus_tag LOCUS_05350 622030 620975 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966043.1 protein_id gnl|my_center|LOCUS_05350 622908 622027 gene locus_tag LOCUS_05360 622908 622027 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729761.1 protein_id gnl|my_center|LOCUS_05360 623849 622905 gene locus_tag LOCUS_05370 623849 622905 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729760.1 protein_id gnl|my_center|LOCUS_05370 625408 623867 gene locus_tag LOCUS_05380 625408 623867 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 protein_id gnl|my_center|LOCUS_05380 625429 625650 gene locus_tag LOCUS_05390 625429 625650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 625799 626335 gene locus_tag LOCUS_05400 625799 626335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 627785 626466 gene locus_tag LOCUS_05410 gene nhaA 627785 626466 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081951.1 protein_id gnl|my_center|LOCUS_05410 628045 629355 gene locus_tag LOCUS_05420 628045 629355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 629592 629948 gene locus_tag LOCUS_05430 629592 629948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 629945 630355 gene locus_tag LOCUS_05440 629945 630355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 631784 630480 gene locus_tag LOCUS_05450 631784 630480 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_05450 632356 631997 gene locus_tag LOCUS_05460 632356 631997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 632499 633050 gene locus_tag LOCUS_05470 632499 633050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 633267 636647 gene locus_tag LOCUS_05480 633267 636647 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007510795.1 protein_id gnl|my_center|LOCUS_05480 637791 636730 gene locus_tag LOCUS_05490 637791 636730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 638125 637778 gene locus_tag LOCUS_05500 638125 637778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 638282 639043 gene locus_tag LOCUS_05510 638282 639043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805165.1 protein_id gnl|my_center|LOCUS_05510 639190 639528 gene locus_tag LOCUS_05520 639190 639528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 641517 639643 gene locus_tag LOCUS_05530 641517 639643 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 protein_id gnl|my_center|LOCUS_05530 641981 641544 gene locus_tag LOCUS_05540 641981 641544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 642586 642062 gene locus_tag LOCUS_05550 642586 642062 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529229.1 protein_id gnl|my_center|LOCUS_05550 642694 643338 gene locus_tag LOCUS_05560 642694 643338 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029175.1 protein_id gnl|my_center|LOCUS_05560 644310 643429 gene locus_tag LOCUS_05570 644310 643429 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_05570 644576 644307 gene locus_tag LOCUS_05580 644576 644307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 644730 644912 gene locus_tag LOCUS_05590 644730 644912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 645181 645417 gene locus_tag LOCUS_05600 645181 645417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 645484 645642 gene locus_tag LOCUS_05610 645484 645642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 647973 646243 gene locus_tag LOCUS_05620 647973 646243 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030252.1 protein_id gnl|my_center|LOCUS_05620 650033 647970 gene locus_tag LOCUS_05630 650033 647970 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030253.1 protein_id gnl|my_center|LOCUS_05630 651196 650090 gene locus_tag LOCUS_05640 651196 650090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 651587 651282 gene locus_tag LOCUS_05650 651587 651282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 652246 659718 gene locus_tag LOCUS_05660 652246 659718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 659957 659697 gene locus_tag LOCUS_05670 659957 659697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 659929 660783 gene locus_tag LOCUS_05680 659929 660783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 660930 662294 gene locus_tag LOCUS_05690 660930 662294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 664357 662348 gene locus_tag LOCUS_05700 664357 662348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 665019 664570 gene locus_tag LOCUS_05710 665019 664570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 664904 666928 gene locus_tag LOCUS_05720 664904 666928 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060585.1 protein_id gnl|my_center|LOCUS_05720 668188 667205 gene locus_tag LOCUS_05730 668188 667205 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225862.1 protein_id gnl|my_center|LOCUS_05730 669381 668185 gene locus_tag LOCUS_05740 669381 668185 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225860.1 protein_id gnl|my_center|LOCUS_05740 670864 669374 gene locus_tag LOCUS_05750 670864 669374 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225861.1 protein_id gnl|my_center|LOCUS_05750 671634 670897 gene locus_tag LOCUS_05760 671634 670897 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225859.1 protein_id gnl|my_center|LOCUS_05760 672620 671631 gene locus_tag LOCUS_05770 672620 671631 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225858.1 protein_id gnl|my_center|LOCUS_05770 673988 672840 gene locus_tag LOCUS_05780 673988 672840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 676824 674380 gene locus_tag LOCUS_05790 676824 674380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 677072 678037 gene locus_tag LOCUS_05800 677072 678037 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229922.1 protein_id gnl|my_center|LOCUS_05800 678187 679419 gene locus_tag LOCUS_05810 678187 679419 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127180013.1 protein_id gnl|my_center|LOCUS_05810 680474 679602 gene locus_tag LOCUS_05820 680474 679602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 681643 680792 gene locus_tag LOCUS_05830 681643 680792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 683428 681785 gene locus_tag LOCUS_05840 683428 681785 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227193.1 protein_id gnl|my_center|LOCUS_05840 683892 683425 gene locus_tag LOCUS_05850 683892 683425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 684002 684616 gene locus_tag LOCUS_05860 684002 684616 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027253.1 protein_id gnl|my_center|LOCUS_05860 685939 684620 gene locus_tag LOCUS_05870 685939 684620 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224456.1 protein_id gnl|my_center|LOCUS_05870 687149 686049 gene locus_tag LOCUS_05880 gene chvE 687149 686049 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535531.1 protein_id gnl|my_center|LOCUS_05880 688501 687203 gene locus_tag LOCUS_05890 gene gguB 688501 687203 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976400.1 protein_id gnl|my_center|LOCUS_05890 690045 688498 gene locus_tag LOCUS_05900 gene gguA 690045 688498 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976401.1 protein_id gnl|my_center|LOCUS_05900 690730 690536 gene locus_tag LOCUS_05910 690730 690536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 690892 690767 gene locus_tag LOCUS_05920 690892 690767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 692175 690886 gene locus_tag LOCUS_05930 692175 690886 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467629.1 protein_id gnl|my_center|LOCUS_05930 694623 692365 gene locus_tag LOCUS_05940 gene catB 694623 692365 CDS product catalase CatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978196.1 protein_id gnl|my_center|LOCUS_05940 695221 694742 gene locus_tag LOCUS_05950 695221 694742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 696687 695356 gene locus_tag LOCUS_05960 696687 695356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 696865 697608 gene locus_tag LOCUS_05970 696865 697608 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977652.1 protein_id gnl|my_center|LOCUS_05970 698495 697656 gene locus_tag LOCUS_05980 698495 697656 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227669.1 protein_id gnl|my_center|LOCUS_05980 699286 698612 gene locus_tag LOCUS_05990 699286 698612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 700358 699336 gene locus_tag LOCUS_06000 700358 699336 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977450.1 protein_id gnl|my_center|LOCUS_06000 701259 700420 gene locus_tag LOCUS_06010 701259 700420 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226353.1 protein_id gnl|my_center|LOCUS_06010 702254 701256 gene locus_tag LOCUS_06020 702254 701256 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226352.1 protein_id gnl|my_center|LOCUS_06020 703602 702310 gene locus_tag LOCUS_06030 703602 702310 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310853.1 protein_id gnl|my_center|LOCUS_06030 703782 705479 gene locus_tag LOCUS_06040 703782 705479 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918873.1 protein_id gnl|my_center|LOCUS_06040 705506 706204 gene locus_tag LOCUS_06050 705506 706204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 707705 706305 gene locus_tag LOCUS_06060 707705 706305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 708093 708323 gene locus_tag LOCUS_06070 708093 708323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 708902 708624 gene locus_tag LOCUS_06080 708902 708624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 709744 708998 gene locus_tag LOCUS_06090 709744 708998 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014894892.1 protein_id gnl|my_center|LOCUS_06090 711055 709853 gene locus_tag LOCUS_06100 711055 709853 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861718.1 protein_id gnl|my_center|LOCUS_06100 712078 711089 gene locus_tag LOCUS_06110 712078 711089 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229920.1 protein_id gnl|my_center|LOCUS_06110 713045 712062 gene locus_tag LOCUS_06120 713045 712062 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_06120 713878 713042 gene locus_tag LOCUS_06130 713878 713042 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384270.1 protein_id gnl|my_center|LOCUS_06130 715056 713875 gene locus_tag LOCUS_06140 715056 713875 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384268.1 protein_id gnl|my_center|LOCUS_06140 715940 715059 gene locus_tag LOCUS_06150 715940 715059 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537722.1 protein_id gnl|my_center|LOCUS_06150 717012 716059 gene locus_tag LOCUS_06160 717012 716059 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537721.1 protein_id gnl|my_center|LOCUS_06160 718669 717044 gene locus_tag LOCUS_06170 718669 717044 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384265.1 protein_id gnl|my_center|LOCUS_06170 719868 718666 gene locus_tag LOCUS_06180 719868 718666 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861718.1 protein_id gnl|my_center|LOCUS_06180 720990 720253 gene locus_tag LOCUS_06190 720990 720253 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227890.1 protein_id gnl|my_center|LOCUS_06190 721845 721090 gene locus_tag LOCUS_06200 721845 721090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 722454 722867 gene locus_tag LOCUS_06210 722454 722867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 722864 723274 gene locus_tag LOCUS_06220 722864 723274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 724672 723371 gene locus_tag LOCUS_06230 724672 723371 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229610.1 protein_id gnl|my_center|LOCUS_06230 726948 724780 gene locus_tag LOCUS_06240 726948 724780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 727120 727776 gene locus_tag LOCUS_06250 727120 727776 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229194.1 protein_id gnl|my_center|LOCUS_06250 729316 727871 gene locus_tag LOCUS_06260 729316 727871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 729927 729511 gene locus_tag LOCUS_06270 gene tnpA 729927 729511 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703865.1 protein_id gnl|my_center|LOCUS_06270 730257 729976 gene locus_tag LOCUS_06280 730257 729976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 730395 730928 gene locus_tag LOCUS_06290 730395 730928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 732450 730915 gene locus_tag LOCUS_06300 732450 730915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 732762 732595 gene locus_tag LOCUS_06310 732762 732595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 734524 732941 gene locus_tag LOCUS_06320 734524 732941 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729718.1 protein_id gnl|my_center|LOCUS_06320 735684 734689 gene locus_tag LOCUS_06330 735684 734689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 737597 735720 gene locus_tag LOCUS_06340 737597 735720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 739581 737650 gene locus_tag LOCUS_06350 739581 737650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 744302 739578 gene locus_tag LOCUS_06360 744302 739578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 749263 744299 gene locus_tag LOCUS_06370 749263 744299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 752984 749265 gene locus_tag LOCUS_06380 752984 749265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 757395 753031 gene locus_tag LOCUS_06390 757395 753031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 757673 758026 gene locus_tag LOCUS_06400 757673 758026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06400 758515 759705 gene locus_tag LOCUS_06410 758515 759705 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229724.1 protein_id gnl|my_center|LOCUS_06410 759733 761208 gene locus_tag LOCUS_06420 759733 761208 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742107.1 protein_id gnl|my_center|LOCUS_06420 761398 762402 gene locus_tag LOCUS_06430 761398 762402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 762815 763207 gene locus_tag LOCUS_06440 762815 763207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 763393 763953 gene locus_tag LOCUS_06450 763393 763953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 764514 764275 gene locus_tag LOCUS_06460 764514 764275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 764437 765003 gene locus_tag LOCUS_06470 764437 765003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 765000 765581 gene locus_tag LOCUS_06480 765000 765581 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230366.1 protein_id gnl|my_center|LOCUS_06480 765954 766562 gene locus_tag LOCUS_06490 765954 766562 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973718.1 protein_id gnl|my_center|LOCUS_06490 767238 766675 gene locus_tag LOCUS_06500 767238 766675 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229487.1 protein_id gnl|my_center|LOCUS_06500 769353 767296 gene locus_tag LOCUS_06510 769353 767296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 772238 769350 gene locus_tag LOCUS_06520 772238 769350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 775699 772235 gene locus_tag LOCUS_06530 775699 772235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 775965 775699 gene locus_tag LOCUS_06540 775965 775699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 778235 775965 gene locus_tag LOCUS_06550 778235 775965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 781371 778228 gene locus_tag LOCUS_06560 781371 778228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06560 782479 781640 gene locus_tag LOCUS_06570 782479 781640 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226502.1 protein_id gnl|my_center|LOCUS_06570 783252 782485 gene locus_tag LOCUS_06580 783252 782485 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_06580 783898 783647 gene locus_tag LOCUS_06590 783898 783647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 783834 785045 gene locus_tag LOCUS_06600 783834 785045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 786517 785168 gene locus_tag LOCUS_06610 786517 785168 CDS product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227361.1 protein_id gnl|my_center|LOCUS_06610 787205 786720 gene locus_tag LOCUS_06620 787205 786720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 787553 788368 gene locus_tag LOCUS_06630 787553 788368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 788589 789023 gene locus_tag LOCUS_06640 788589 789023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 789222 790244 gene locus_tag LOCUS_06650 789222 790244 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230685.1 protein_id gnl|my_center|LOCUS_06650 791801 790269 gene locus_tag LOCUS_06660 791801 790269 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104502.1 protein_id gnl|my_center|LOCUS_06660 792862 791798 gene locus_tag LOCUS_06670 792862 791798 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727499.1 protein_id gnl|my_center|LOCUS_06670 793995 792859 gene locus_tag LOCUS_06680 793995 792859 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727498.1 protein_id gnl|my_center|LOCUS_06680 795168 794161 gene locus_tag LOCUS_06690 795168 794161 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261595.1 protein_id gnl|my_center|LOCUS_06690 795344 795171 gene locus_tag LOCUS_06700 795344 795171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 795781 795527 gene locus_tag LOCUS_06710 795781 795527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 795967 797199 gene locus_tag LOCUS_06720 795967 797199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 798438 797464 gene locus_tag LOCUS_06730 798438 797464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 799036 798491 gene locus_tag LOCUS_06740 799036 798491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 799467 799769 gene locus_tag LOCUS_06750 799467 799769 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215288.1 protein_id gnl|my_center|LOCUS_06750 799812 800273 gene locus_tag LOCUS_06760 gene ureB 799812 800273 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212228.1 protein_id gnl|my_center|LOCUS_06760 800323 802041 gene locus_tag LOCUS_06770 800323 802041 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212229.1 protein_id gnl|my_center|LOCUS_06770 802105 802668 gene locus_tag LOCUS_06780 gene ureE 802105 802668 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172973.1 protein_id gnl|my_center|LOCUS_06780 802681 803367 gene locus_tag LOCUS_06790 802681 803367 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212231.1 protein_id gnl|my_center|LOCUS_06790 803473 804102 gene locus_tag LOCUS_06800 gene ureG 803473 804102 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004390399.1 protein_id gnl|my_center|LOCUS_06800 804099 805016 gene locus_tag LOCUS_06810 804099 805016 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815718.1 protein_id gnl|my_center|LOCUS_06810 805036 806082 gene locus_tag LOCUS_06820 gene yut 805036 806082 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212233.1 protein_id gnl|my_center|LOCUS_06820 806089 807753 gene locus_tag LOCUS_06830 806089 807753 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831524.1 protein_id gnl|my_center|LOCUS_06830 808609 807875 gene locus_tag LOCUS_06840 808609 807875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 809232 808837 gene locus_tag LOCUS_06850 809232 808837 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 protein_id gnl|my_center|LOCUS_06850 809999 809229 gene locus_tag LOCUS_06860 809999 809229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977478.1 protein_id gnl|my_center|LOCUS_06860 811296 810076 gene locus_tag LOCUS_06870 811296 810076 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 protein_id gnl|my_center|LOCUS_06870 811359 812117 gene locus_tag LOCUS_06880 811359 812117 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089278.1 protein_id gnl|my_center|LOCUS_06880 812175 813845 gene locus_tag LOCUS_06890 812175 813845 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_06890 813875 814207 gene locus_tag LOCUS_06900 813875 814207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 815686 814274 gene locus_tag LOCUS_06910 815686 814274 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_06910 816244 815690 gene locus_tag LOCUS_06920 816244 815690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 818329 816380 gene locus_tag LOCUS_06930 818329 816380 CDS product RiPP maturation radical SAM C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_06930 819524 818337 gene locus_tag LOCUS_06940 819524 818337 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228930.1 protein_id gnl|my_center|LOCUS_06940 820911 819514 gene locus_tag LOCUS_06950 820911 819514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 821711 820908 gene locus_tag LOCUS_06960 821711 820908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 823599 821698 gene locus_tag LOCUS_06970 823599 821698 CDS product RiPP maturation radical SAM C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_06970 824924 823596 gene locus_tag LOCUS_06980 824924 823596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 825987 824857 gene locus_tag LOCUS_06990 825987 824857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 826218 826078 gene locus_tag LOCUS_07000 826218 826078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 828087 826273 gene locus_tag LOCUS_07010 828087 826273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 828406 829293 gene locus_tag LOCUS_07020 828406 829293 CDS product IS630-like element ISMsm2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003887303.1 protein_id gnl|my_center|LOCUS_07020 829454 830287 gene locus_tag LOCUS_07030 829454 830287 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731303.1 protein_id gnl|my_center|LOCUS_07030 831594 830335 gene locus_tag LOCUS_07040 831594 830335 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110111.1 protein_id gnl|my_center|LOCUS_07040 831823 832152 gene locus_tag LOCUS_07050 831823 832152 CDS product DUF6204 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972487.1 protein_id gnl|my_center|LOCUS_07050 832220 832777 gene locus_tag LOCUS_07060 832220 832777 CDS product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028522.1 protein_id gnl|my_center|LOCUS_07060 834191 832848 gene locus_tag LOCUS_07070 834191 832848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 835101 834244 gene locus_tag LOCUS_07080 835101 834244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 835670 835200 gene locus_tag LOCUS_07090 835670 835200 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230457.1 protein_id gnl|my_center|LOCUS_07090 836866 835667 gene locus_tag LOCUS_07100 836866 835667 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_07100 837078 836863 gene locus_tag LOCUS_07110 837078 836863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 840378 837118 gene locus_tag LOCUS_07120 840378 837118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 841382 840381 gene locus_tag LOCUS_07130 841382 840381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 844483 841406 gene locus_tag LOCUS_07140 844483 841406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07140 845328 844480 gene locus_tag LOCUS_07150 845328 844480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 854888 845601 gene locus_tag LOCUS_07160 854888 845601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 861799 854885 gene locus_tag LOCUS_07170 861799 854885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 878751 861820 gene locus_tag LOCUS_07180 878751 861820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07180 886352 881646 gene locus_tag LOCUS_07190 886352 881646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07190 899842 886349 gene locus_tag LOCUS_07200 899842 886349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 905994 899869 gene locus_tag LOCUS_07210 905994 899869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 906932 906456 gene locus_tag LOCUS_07220 906932 906456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 907237 908007 gene locus_tag LOCUS_07230 907237 908007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210249.1 protein_id gnl|my_center|LOCUS_07230 909225 908086 gene locus_tag LOCUS_07240 909225 908086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 909746 910000 gene locus_tag LOCUS_07250 909746 910000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 910193 911572 gene locus_tag LOCUS_07260 910193 911572 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772424.1 protein_id gnl|my_center|LOCUS_07260 911641 912621 gene locus_tag LOCUS_07270 911641 912621 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047667.1 protein_id gnl|my_center|LOCUS_07270 914470 912665 gene locus_tag LOCUS_07280 914470 912665 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_07280 915834 914467 gene locus_tag LOCUS_07290 915834 914467 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941437.1 protein_id gnl|my_center|LOCUS_07290 916805 915984 gene locus_tag LOCUS_07300 916805 915984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 917098 917745 gene locus_tag LOCUS_07310 917098 917745 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296686.1 protein_id gnl|my_center|LOCUS_07310 919861 917789 gene locus_tag LOCUS_07320 919861 917789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 939920 919905 gene locus_tag LOCUS_07330 939920 919905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 948938 940023 gene locus_tag LOCUS_07340 948938 940023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 949171 949497 gene locus_tag LOCUS_07350 949171 949497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 950916 949552 gene locus_tag LOCUS_07360 gene eccD 950916 949552 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224120.1 protein_id gnl|my_center|LOCUS_07360 951309 950983 gene locus_tag LOCUS_07370 951309 950983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 951711 951337 gene locus_tag LOCUS_07380 951711 951337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 955876 951833 gene locus_tag LOCUS_07390 955876 951833 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030426.1 protein_id gnl|my_center|LOCUS_07390 956660 955905 gene locus_tag LOCUS_07400 956660 955905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 957245 956721 gene locus_tag LOCUS_07410 957245 956721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 959565 957268 gene locus_tag LOCUS_07420 959565 957268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 959704 962049 gene locus_tag LOCUS_07430 959704 962049 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666873.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07430 961959 962447 gene locus_tag LOCUS_07440 961959 962447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07440 962506 963048 gene locus_tag LOCUS_07450 962506 963048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 963640 963125 gene locus_tag LOCUS_07460 963640 963125 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224600.1 protein_id gnl|my_center|LOCUS_07460 964020 965762 gene locus_tag LOCUS_07470 964020 965762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 965810 967612 gene locus_tag LOCUS_07480 965810 967612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 967709 968797 gene locus_tag LOCUS_07490 967709 968797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 968937 969203 gene locus_tag LOCUS_07500 968937 969203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 970032 969235 gene locus_tag LOCUS_07510 970032 969235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07510 970651 973581 gene locus_tag LOCUS_07520 970651 973581 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222212.1 protein_id gnl|my_center|LOCUS_07520 973874 977929 gene locus_tag LOCUS_07530 973874 977929 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027111.1 protein_id gnl|my_center|LOCUS_07530 988000 978023 gene locus_tag LOCUS_07540 988000 978023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 989426 990820 gene locus_tag LOCUS_07550 989426 990820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 990923 991513 gene locus_tag LOCUS_07560 990923 991513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 992666 994081 gene locus_tag LOCUS_07570 992666 994081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 995486 996136 gene locus_tag LOCUS_07580 995486 996136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 997746 998204 gene locus_tag LOCUS_07590 997746 998204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 998876 999274 gene locus_tag LOCUS_07600 998876 999274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 1001321 1001602 gene locus_tag LOCUS_07610 1001321 1001602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 1001909 1003405 gene locus_tag LOCUS_07620 1001909 1003405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 1003572 1004216 gene locus_tag LOCUS_07630 1003572 1004216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 1004944 1004603 gene locus_tag LOCUS_07640 1004944 1004603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 1005366 1004941 gene locus_tag LOCUS_07650 1005366 1004941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 1007895 1005433 gene locus_tag LOCUS_07660 1007895 1005433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 1008275 1007898 gene locus_tag LOCUS_07670 1008275 1007898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 1008647 1008360 gene locus_tag LOCUS_07680 1008647 1008360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 1009016 1008705 gene locus_tag LOCUS_07690 1009016 1008705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 1010555 1009128 gene locus_tag LOCUS_07700 1010555 1009128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 1011960 1010557 gene locus_tag LOCUS_07710 1011960 1010557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 1014093 1012021 gene locus_tag LOCUS_07720 1014093 1012021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 1018067 1014090 gene locus_tag LOCUS_07730 1018067 1014090 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224114.1 protein_id gnl|my_center|LOCUS_07730 1021682 1018224 gene locus_tag LOCUS_07740 1021682 1018224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 1023700 1021679 gene locus_tag LOCUS_07750 1023700 1021679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 1025088 1023847 gene locus_tag LOCUS_07760 1025088 1023847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 1026592 1025177 gene locus_tag LOCUS_07770 1026592 1025177 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096315.1 protein_id gnl|my_center|LOCUS_07770 1026885 1027421 gene locus_tag LOCUS_07780 1026885 1027421 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958345.1 protein_id gnl|my_center|LOCUS_07780 1027513 1028586 gene locus_tag LOCUS_07790 1027513 1028586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 1030988 1028601 gene locus_tag LOCUS_07800 1030988 1028601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 1031646 1030993 gene locus_tag LOCUS_07810 1031646 1030993 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727332.1 protein_id gnl|my_center|LOCUS_07810 1031792 1034296 gene locus_tag LOCUS_07820 1031792 1034296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 1035084 1034380 gene locus_tag LOCUS_07830 1035084 1034380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 1035446 1035123 gene locus_tag LOCUS_07840 1035446 1035123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 1035513 1036421 gene locus_tag LOCUS_07850 1035513 1036421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 1037668 1038195 gene locus_tag LOCUS_07860 1037668 1038195 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230782.1 protein_id gnl|my_center|LOCUS_07860 1038192 1039373 gene locus_tag LOCUS_07870 1038192 1039373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 1041711 1039450 gene locus_tag LOCUS_07880 1041711 1039450 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074382.1 protein_id gnl|my_center|LOCUS_07880 1042700 1041708 gene locus_tag LOCUS_07890 1042700 1041708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 1043722 1042697 gene locus_tag LOCUS_07900 1043722 1042697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 protein_id gnl|my_center|LOCUS_07900 1043960 1043790 gene locus_tag LOCUS_07910 1043960 1043790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1044098 1045528 gene locus_tag LOCUS_07920 1044098 1045528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 1046122 1045691 gene locus_tag LOCUS_07930 1046122 1045691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 1046513 1046034 gene locus_tag LOCUS_07940 1046513 1046034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 1046710 1048056 gene locus_tag LOCUS_07950 1046710 1048056 CDS product M64 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031040.1 protein_id gnl|my_center|LOCUS_07950 1048270 1049226 gene locus_tag LOCUS_07960 1048270 1049226 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230653.1 protein_id gnl|my_center|LOCUS_07960 1049944 1049237 gene locus_tag LOCUS_07970 1049944 1049237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 1050158 1049988 gene locus_tag LOCUS_07980 1050158 1049988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 1050254 1052350 gene locus_tag LOCUS_07990 1050254 1052350 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028768.1 protein_id gnl|my_center|LOCUS_07990 1052636 1053946 gene locus_tag LOCUS_08000 1052636 1053946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 1054210 1057443 gene locus_tag LOCUS_08010 1054210 1057443 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229882.1 protein_id gnl|my_center|LOCUS_08010 1058272 1057445 gene locus_tag LOCUS_08020 1058272 1057445 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230442.1 protein_id gnl|my_center|LOCUS_08020 1059234 1058269 gene locus_tag LOCUS_08030 1059234 1058269 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230441.1 protein_id gnl|my_center|LOCUS_08030 1059925 1059332 gene locus_tag LOCUS_08040 1059925 1059332 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978564.1 protein_id gnl|my_center|LOCUS_08040 1059987 1061648 gene locus_tag LOCUS_08050 1059987 1061648 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256282.1 protein_id gnl|my_center|LOCUS_08050 1063231 1061735 gene locus_tag LOCUS_08060 1063231 1061735 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899877.1 protein_id gnl|my_center|LOCUS_08060 1063597 1064748 gene locus_tag LOCUS_08070 1063597 1064748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 1064857 1065081 gene locus_tag LOCUS_08080 1064857 1065081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 1065575 1065303 gene locus_tag LOCUS_08090 1065575 1065303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 1065849 1065637 gene locus_tag LOCUS_08100 1065849 1065637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 1066342 1065890 gene locus_tag LOCUS_08110 1066342 1065890 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 protein_id gnl|my_center|LOCUS_08110 1066625 1066335 gene locus_tag LOCUS_08120 1066625 1066335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 1067584 1066700 gene locus_tag LOCUS_08130 1067584 1066700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030873.1 protein_id gnl|my_center|LOCUS_08130 1068326 1067601 gene locus_tag LOCUS_08140 1068326 1067601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 1069435 1068602 gene locus_tag LOCUS_08150 1069435 1068602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467192.1 protein_id gnl|my_center|LOCUS_08150 1069543 1072134 gene locus_tag LOCUS_08160 1069543 1072134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1072125 1072874 gene locus_tag LOCUS_08170 1072125 1072874 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325650.1 protein_id gnl|my_center|LOCUS_08170 1073907 1072903 gene locus_tag LOCUS_08180 gene hpnH 1073907 1072903 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972231.1 protein_id gnl|my_center|LOCUS_08180 1075466 1073904 gene locus_tag LOCUS_08190 1075466 1073904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 1077409 1075463 gene locus_tag LOCUS_08200 gene shc 1077409 1075463 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_08200 1078416 1077409 gene locus_tag LOCUS_08210 1078416 1077409 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223417.1 protein_id gnl|my_center|LOCUS_08210 1079852 1078413 gene locus_tag LOCUS_08220 gene hpnE 1079852 1078413 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_08220 1080721 1079849 gene locus_tag LOCUS_08230 gene hpnD 1080721 1079849 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483877.1 protein_id gnl|my_center|LOCUS_08230 1081575 1080718 gene locus_tag LOCUS_08240 gene hpnC 1081575 1080718 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031161.1 protein_id gnl|my_center|LOCUS_08240 1082169 1082552 gene locus_tag LOCUS_08250 1082169 1082552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 1082721 1083146 gene locus_tag LOCUS_08260 1082721 1083146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1083343 1085334 gene locus_tag LOCUS_08270 1083343 1085334 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229814.1 protein_id gnl|my_center|LOCUS_08270 1085784 1085629 gene locus_tag LOCUS_08280 1085784 1085629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 1087382 1086297 gene locus_tag LOCUS_08290 1087382 1086297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1087906 1087379 gene locus_tag LOCUS_08300 1087906 1087379 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089004579.1 protein_id gnl|my_center|LOCUS_08300 1088150 1088971 gene locus_tag LOCUS_08310 1088150 1088971 CDS product IS5-like element IS470 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029009.1 protein_id gnl|my_center|LOCUS_08310 1089154 1089771 gene locus_tag LOCUS_08320 1089154 1089771 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224335.1 protein_id gnl|my_center|LOCUS_08320 1089768 1090793 gene locus_tag LOCUS_08330 1089768 1090793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 1091421 1092248 gene locus_tag LOCUS_08340 1091421 1092248 CDS product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223025.1 protein_id gnl|my_center|LOCUS_08340 1092951 1092277 gene locus_tag LOCUS_08350 1092951 1092277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 1093657 1093079 gene locus_tag LOCUS_08360 1093657 1093079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 1096245 1093729 gene locus_tag LOCUS_08370 1096245 1093729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1096282 1097934 gene locus_tag LOCUS_08380 1096282 1097934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1098799 1097966 gene locus_tag LOCUS_08390 1098799 1097966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 1099255 1098902 gene locus_tag LOCUS_08400 1099255 1098902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1099419 1100246 gene locus_tag LOCUS_08410 1099419 1100246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 1101386 1100364 gene locus_tag LOCUS_08420 1101386 1100364 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_08420 1103837 1101750 gene locus_tag LOCUS_08430 1103837 1101750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1105413 1103911 gene locus_tag LOCUS_08440 gene araA 1105413 1103911 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226247.1 protein_id gnl|my_center|LOCUS_08440 1106429 1105440 gene locus_tag LOCUS_08450 gene yjfF 1106429 1105440 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_08450 1107496 1106426 gene locus_tag LOCUS_08460 1107496 1106426 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_08460 1109034 1107493 gene locus_tag LOCUS_08470 1109034 1107493 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_08470 1110106 1109105 gene locus_tag LOCUS_08480 1110106 1109105 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_08480 1110876 1110184 gene locus_tag LOCUS_08490 1110876 1110184 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226246.1 protein_id gnl|my_center|LOCUS_08490 1112555 1110873 gene locus_tag LOCUS_08500 gene araB 1112555 1110873 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226245.1 protein_id gnl|my_center|LOCUS_08500 1112922 1112728 gene locus_tag LOCUS_08510 1112922 1112728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 1113786 1115546 gene locus_tag LOCUS_08520 1113786 1115546 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225147.1 protein_id gnl|my_center|LOCUS_08520 1115664 1117991 gene locus_tag LOCUS_08530 1115664 1117991 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225837.1 protein_id gnl|my_center|LOCUS_08530 1119548 1118298 gene locus_tag LOCUS_08540 gene gguB 1119548 1118298 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776910.1 protein_id gnl|my_center|LOCUS_08540 1121083 1119545 gene locus_tag LOCUS_08550 gene gguA 1121083 1119545 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776911.1 protein_id gnl|my_center|LOCUS_08550 1121082 1121348 gene locus_tag LOCUS_08560 1121082 1121348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 1121206 1121215 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1122448 1121306 gene locus_tag LOCUS_08570 gene chvE 1122448 1121306 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776912.1 protein_id gnl|my_center|LOCUS_08570 1124427 1122787 gene locus_tag LOCUS_08580 1124427 1122787 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229143.1 protein_id gnl|my_center|LOCUS_08580 1125203 1124967 gene locus_tag LOCUS_08590 1125203 1124967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 1125142 1126569 gene locus_tag LOCUS_08600 1125142 1126569 CDS product non-reducing end alpha-L-arabinofuranosidase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224773.1 protein_id gnl|my_center|LOCUS_08600 1126896 1127588 gene locus_tag LOCUS_08610 1126896 1127588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08610 1127585 1128151 gene locus_tag LOCUS_08620 1127585 1128151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08620 1129556 1128174 gene locus_tag LOCUS_08630 1129556 1128174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 1131651 1130185 gene locus_tag LOCUS_08640 1131651 1130185 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466941.1 protein_id gnl|my_center|LOCUS_08640 1132693 1132307 gene locus_tag LOCUS_08650 1132693 1132307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08650 1133705 1134391 gene locus_tag LOCUS_08660 1133705 1134391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08660 1134583 1135596 gene locus_tag LOCUS_08670 1134583 1135596 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075004273.1 protein_id gnl|my_center|LOCUS_08670 1135616 1135948 gene locus_tag LOCUS_08680 1135616 1135948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 1137065 1136412 gene locus_tag LOCUS_08690 1137065 1136412 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866867.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence02 13 121 gene locus_tag LOCUS_r00010 13 121 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 951 268 gene locus_tag LOCUS_08700 951 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 1021 3639 gene locus_tag LOCUS_08710 1021 3639 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028455.1 protein_id gnl|my_center|LOCUS_08710 3636 5006 gene locus_tag LOCUS_08720 3636 5006 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_08720 5003 5401 gene locus_tag LOCUS_08730 5003 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 6906 5512 gene locus_tag LOCUS_08740 6906 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 7051 7476 gene locus_tag LOCUS_08750 gene ndk 7051 7476 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123449.1 protein_id gnl|my_center|LOCUS_08750 8373 7522 gene locus_tag LOCUS_08760 8373 7522 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 protein_id gnl|my_center|LOCUS_08760 8843 8403 gene locus_tag LOCUS_08770 8843 8403 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974366.1 protein_id gnl|my_center|LOCUS_08770 9179 9874 gene locus_tag LOCUS_08780 9179 9874 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224330.1 protein_id gnl|my_center|LOCUS_08780 11791 9929 gene locus_tag LOCUS_08790 11791 9929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08790 12016 12636 gene locus_tag LOCUS_08800 12016 12636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 12701 14701 gene locus_tag LOCUS_08810 12701 14701 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_08810 14947 15588 gene locus_tag LOCUS_08820 14947 15588 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_08820 15728 18868 gene locus_tag LOCUS_08830 15728 18868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08830 18986 19489 gene locus_tag LOCUS_08840 18986 19489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 19736 20050 gene locus_tag LOCUS_08850 gene rplU 19736 20050 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060209.1 protein_id gnl|my_center|LOCUS_08850 20062 20319 gene locus_tag LOCUS_08860 gene rpmA 20062 20319 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908352.1 protein_id gnl|my_center|LOCUS_08860 20414 21889 gene locus_tag LOCUS_08870 gene obgE 20414 21889 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228478.1 protein_id gnl|my_center|LOCUS_08870 21992 22441 gene locus_tag LOCUS_08880 21992 22441 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229404.1 protein_id gnl|my_center|LOCUS_08880 23055 22576 gene locus_tag LOCUS_08890 23055 22576 CDS product DUF4383 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466936.1 protein_id gnl|my_center|LOCUS_08890 24266 23139 gene locus_tag LOCUS_08900 24266 23139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 24532 24936 gene locus_tag LOCUS_08910 24532 24936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 25335 25117 gene locus_tag LOCUS_08920 25335 25117 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223584.1 protein_id gnl|my_center|LOCUS_08920 25403 27919 gene locus_tag LOCUS_08930 gene pepN 25403 27919 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283751.1 protein_id gnl|my_center|LOCUS_08930 28050 28646 gene locus_tag LOCUS_08940 gene nadD 28050 28646 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081655767.1 protein_id gnl|my_center|LOCUS_08940 28757 29167 gene locus_tag LOCUS_08950 gene rsfS 28757 29167 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_08950 29164 29793 gene locus_tag LOCUS_08960 29164 29793 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976227.1 protein_id gnl|my_center|LOCUS_08960 29841 30698 gene locus_tag LOCUS_08970 29841 30698 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228466.1 protein_id gnl|my_center|LOCUS_08970 30880 31899 gene locus_tag LOCUS_08980 30880 31899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225202.1 protein_id gnl|my_center|LOCUS_08980 32227 33378 gene locus_tag LOCUS_08990 32227 33378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 33375 34202 gene locus_tag LOCUS_09000 33375 34202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 34195 35559 gene locus_tag LOCUS_09010 34195 35559 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903979.1 protein_id gnl|my_center|LOCUS_09010 35635 35829 gene locus_tag LOCUS_09020 35635 35829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 36402 36061 gene locus_tag LOCUS_09030 36402 36061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 36561 36776 gene locus_tag LOCUS_09040 36561 36776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 38001 36841 gene locus_tag LOCUS_09050 38001 36841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 38516 38217 gene locus_tag LOCUS_09060 38516 38217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 38929 38513 gene locus_tag LOCUS_09070 38929 38513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 39575 39826 gene locus_tag LOCUS_09080 39575 39826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 40604 40329 gene locus_tag LOCUS_09090 40604 40329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 40953 40666 gene locus_tag LOCUS_09100 40953 40666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 41351 41103 gene locus_tag LOCUS_09110 41351 41103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 43707 41596 gene locus_tag LOCUS_09120 43707 41596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 43895 43704 gene locus_tag LOCUS_09130 43895 43704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 44268 45863 gene locus_tag LOCUS_09140 44268 45863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 45988 46968 gene locus_tag LOCUS_09150 gene holA 45988 46968 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165922484.1 protein_id gnl|my_center|LOCUS_09150 46965 47600 gene locus_tag LOCUS_09160 46965 47600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 48101 47835 gene locus_tag LOCUS_09170 gene rpsT 48101 47835 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_09170 49402 48215 gene locus_tag LOCUS_09180 49402 48215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 49395 49982 gene locus_tag LOCUS_09190 49395 49982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 49995 50633 gene locus_tag LOCUS_09200 49995 50633 CDS product DUF4240 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870944.1 protein_id gnl|my_center|LOCUS_09200 50756 52633 gene locus_tag LOCUS_09210 gene lepA 50756 52633 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976242.1 protein_id gnl|my_center|LOCUS_09210 52863 53150 gene locus_tag LOCUS_09220 52863 53150 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230904.1 protein_id gnl|my_center|LOCUS_09220 53464 53745 gene locus_tag LOCUS_09230 53464 53745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 54091 55380 gene locus_tag LOCUS_09240 54091 55380 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975864.1 protein_id gnl|my_center|LOCUS_09240 55446 56363 gene locus_tag LOCUS_09250 55446 56363 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776529.1 protein_id gnl|my_center|LOCUS_09250 56360 57208 gene locus_tag LOCUS_09260 56360 57208 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028676.1 protein_id gnl|my_center|LOCUS_09260 57358 58002 gene locus_tag LOCUS_09270 57358 58002 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110680.1 protein_id gnl|my_center|LOCUS_09270 58977 58075 gene locus_tag LOCUS_09280 58977 58075 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419601.1 protein_id gnl|my_center|LOCUS_09280 60054 59197 gene locus_tag LOCUS_09290 60054 59197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091319978.1 protein_id gnl|my_center|LOCUS_09290 61081 60299 gene locus_tag LOCUS_09300 61081 60299 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_09300 61094 62323 gene locus_tag LOCUS_09310 gene hemW 61094 62323 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_09310 63070 62393 gene locus_tag LOCUS_09320 63070 62393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 63338 64360 gene locus_tag LOCUS_09330 gene hrcA 63338 64360 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_09330 64434 65576 gene locus_tag LOCUS_09340 gene dnaJ 64434 65576 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_09340 65634 66368 gene locus_tag LOCUS_09350 65634 66368 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 protein_id gnl|my_center|LOCUS_09350 67300 66560 gene locus_tag LOCUS_09360 67300 66560 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507974.1 protein_id gnl|my_center|LOCUS_09360 67331 67717 gene locus_tag LOCUS_09370 67331 67717 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_09370 67725 69098 gene locus_tag LOCUS_09380 67725 69098 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230185.1 protein_id gnl|my_center|LOCUS_09380 69273 70337 gene locus_tag LOCUS_09390 69273 70337 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228400.1 protein_id gnl|my_center|LOCUS_09390 70347 70820 gene locus_tag LOCUS_09400 gene ybeY 70347 70820 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228399.1 protein_id gnl|my_center|LOCUS_09400 70820 72214 gene locus_tag LOCUS_09410 70820 72214 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_09410 72207 72593 gene locus_tag LOCUS_09420 72207 72593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228397.1 protein_id gnl|my_center|LOCUS_09420 72590 73597 gene locus_tag LOCUS_09430 gene era 72590 73597 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 protein_id gnl|my_center|LOCUS_09430 73823 74986 gene locus_tag LOCUS_09440 73823 74986 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975851.1 protein_id gnl|my_center|LOCUS_09440 75818 74973 gene locus_tag LOCUS_09450 75818 74973 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230875.1 protein_id gnl|my_center|LOCUS_09450 75918 76733 gene locus_tag LOCUS_09460 gene recO 75918 76733 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228390.1 protein_id gnl|my_center|LOCUS_09460 76766 77542 gene locus_tag LOCUS_09470 76766 77542 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976293.1 protein_id gnl|my_center|LOCUS_09470 77612 77797 gene locus_tag LOCUS_09480 77612 77797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 79333 77891 gene locus_tag LOCUS_09490 gene gndA 79333 77891 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027484.1 protein_id gnl|my_center|LOCUS_09490 79792 80136 gene locus_tag LOCUS_09500 79792 80136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 81155 80355 gene locus_tag LOCUS_09510 81155 80355 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731491.1 protein_id gnl|my_center|LOCUS_09510 82621 81152 gene locus_tag LOCUS_09520 82621 81152 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731492.1 protein_id gnl|my_center|LOCUS_09520 83313 82720 gene locus_tag LOCUS_09530 83313 82720 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898105.1 protein_id gnl|my_center|LOCUS_09530 83538 83750 gene locus_tag LOCUS_09540 83538 83750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 83761 84591 gene locus_tag LOCUS_09550 83761 84591 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030789.1 protein_id gnl|my_center|LOCUS_09550 84641 85441 gene locus_tag LOCUS_09560 84641 85441 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618766.1 protein_id gnl|my_center|LOCUS_09560 85438 86187 gene locus_tag LOCUS_09570 85438 86187 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732177.1 protein_id gnl|my_center|LOCUS_09570 86302 86805 gene locus_tag LOCUS_09580 86302 86805 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235623980.1 protein_id gnl|my_center|LOCUS_09580 86937 88928 gene locus_tag LOCUS_09590 86937 88928 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030396.1 protein_id gnl|my_center|LOCUS_09590 89172 89005 gene locus_tag LOCUS_09600 89172 89005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 89823 89182 gene locus_tag LOCUS_09610 89823 89182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085601.1 protein_id gnl|my_center|LOCUS_09610 90277 89882 gene locus_tag LOCUS_09620 90277 89882 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_09620 90573 90274 gene locus_tag LOCUS_09630 90573 90274 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060366.1 protein_id gnl|my_center|LOCUS_09630 91483 90617 gene locus_tag LOCUS_09640 91483 90617 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_09640 92247 91486 gene locus_tag LOCUS_09650 92247 91486 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028392.1 protein_id gnl|my_center|LOCUS_09650 93206 92244 gene locus_tag LOCUS_09660 93206 92244 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_09660 93574 93317 gene locus_tag LOCUS_09670 93574 93317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 93601 93942 gene locus_tag LOCUS_09680 93601 93942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 94006 94542 gene locus_tag LOCUS_09690 94006 94542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 94702 96081 gene locus_tag LOCUS_09700 94702 96081 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976298.1 protein_id gnl|my_center|LOCUS_09700 96146 97318 gene locus_tag LOCUS_09710 gene dusB 96146 97318 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230697.1 protein_id gnl|my_center|LOCUS_09710 98039 97374 gene locus_tag LOCUS_09720 98039 97374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 98789 101509 gene locus_tag LOCUS_09730 gene ppdK 98789 101509 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_09730 102135 101620 gene locus_tag LOCUS_09740 102135 101620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 102361 102711 gene locus_tag LOCUS_09750 102361 102711 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081659.1 protein_id gnl|my_center|LOCUS_09750 102721 103980 gene locus_tag LOCUS_09760 102721 103980 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228373.1 protein_id gnl|my_center|LOCUS_09760 104104 104934 gene locus_tag LOCUS_09770 104104 104934 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977203.1 protein_id gnl|my_center|LOCUS_09770 105011 106285 gene locus_tag LOCUS_09780 105011 106285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 106358 108238 gene locus_tag LOCUS_09790 gene dnaG 106358 108238 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228362.1 protein_id gnl|my_center|LOCUS_09790 108238 108774 gene locus_tag LOCUS_09800 108238 108774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467493.1 protein_id gnl|my_center|LOCUS_09800 108978 109514 gene locus_tag LOCUS_09810 108978 109514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 109634 110818 gene locus_tag LOCUS_09820 109634 110818 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282703.1 protein_id gnl|my_center|LOCUS_09820 111066 112244 gene locus_tag LOCUS_09830 111066 112244 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225823.1 protein_id gnl|my_center|LOCUS_09830 112241 113875 gene locus_tag LOCUS_09840 112241 113875 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972412.1 protein_id gnl|my_center|LOCUS_09840 113872 114891 gene locus_tag LOCUS_09850 113872 114891 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972411.1 protein_id gnl|my_center|LOCUS_09850 115017 116075 gene locus_tag LOCUS_09860 115017 116075 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225827.1 protein_id gnl|my_center|LOCUS_09860 116096 117325 gene locus_tag LOCUS_09870 116096 117325 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_09870 117959 120817 gene locus_tag LOCUS_09880 117959 120817 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855351.1 protein_id gnl|my_center|LOCUS_09880 120907 123012 gene locus_tag LOCUS_09890 120907 123012 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031512.1 protein_id gnl|my_center|LOCUS_09890 123369 124379 gene locus_tag LOCUS_09900 123369 124379 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225829.1 protein_id gnl|my_center|LOCUS_09900 124977 124582 gene locus_tag LOCUS_09910 124977 124582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 125256 125331 gene locus_tag LOCUS_t00030 125256 125331 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 125490 125335 gene locus_tag LOCUS_09920 125490 125335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 125586 125661 gene locus_tag LOCUS_t00040 125586 125661 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 126193 125720 gene locus_tag LOCUS_09930 126193 125720 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730741.1 protein_id gnl|my_center|LOCUS_09930 126403 127338 gene locus_tag LOCUS_09940 126403 127338 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225335.1 protein_id gnl|my_center|LOCUS_09940 128501 127515 gene locus_tag LOCUS_09950 gene ftrA 128501 127515 CDS product transcriptional regulator FtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205440.1 protein_id gnl|my_center|LOCUS_09950 128698 128498 gene locus_tag LOCUS_09960 128698 128498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 128592 129029 gene locus_tag LOCUS_09970 128592 129029 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027704.1 protein_id gnl|my_center|LOCUS_09970 130034 129096 gene locus_tag LOCUS_09980 130034 129096 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_09980 131300 130218 gene locus_tag LOCUS_09990 131300 130218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 131233 131448 gene locus_tag LOCUS_10000 131233 131448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 132499 133758 gene locus_tag LOCUS_10010 132499 133758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 133957 133745 gene locus_tag LOCUS_10020 133957 133745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 134964 134299 gene locus_tag LOCUS_10030 134964 134299 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389739.1 protein_id gnl|my_center|LOCUS_10030 136582 135338 gene locus_tag LOCUS_10040 136582 135338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 136734 136579 gene locus_tag LOCUS_10050 136734 136579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 136953 137744 gene locus_tag LOCUS_10060 136953 137744 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973878.1 protein_id gnl|my_center|LOCUS_10060 137926 137690 gene locus_tag LOCUS_10070 137926 137690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 138148 138348 gene locus_tag LOCUS_10080 138148 138348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 138345 138899 gene locus_tag LOCUS_10090 138345 138899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 140042 141715 gene locus_tag LOCUS_10100 140042 141715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 142753 141815 gene locus_tag LOCUS_10110 142753 141815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 144156 142750 gene locus_tag LOCUS_10120 144156 142750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 144458 144153 gene locus_tag LOCUS_10130 144458 144153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 144853 145203 gene locus_tag LOCUS_10140 144853 145203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 145381 146517 gene locus_tag LOCUS_10150 145381 146517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 146524 147255 gene locus_tag LOCUS_10160 146524 147255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729189.1 protein_id gnl|my_center|LOCUS_10160 147252 150503 gene locus_tag LOCUS_10170 147252 150503 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230032.1 protein_id gnl|my_center|LOCUS_10170 151930 150683 gene locus_tag LOCUS_10180 151930 150683 CDS product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088361.1 protein_id gnl|my_center|LOCUS_10180 152267 154552 gene locus_tag LOCUS_10190 152267 154552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 154549 155262 gene locus_tag LOCUS_10200 154549 155262 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_10200 155331 156260 gene locus_tag LOCUS_10210 155331 156260 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224046.1 protein_id gnl|my_center|LOCUS_10210 156741 156355 gene locus_tag LOCUS_10220 156741 156355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 156836 158149 gene locus_tag LOCUS_10230 gene aldO 156836 158149 CDS product alditol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030685.1 protein_id gnl|my_center|LOCUS_10230 159300 158158 gene locus_tag LOCUS_10240 159300 158158 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899401.1 protein_id gnl|my_center|LOCUS_10240 159343 161499 gene locus_tag LOCUS_10250 159343 161499 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466817.1 protein_id gnl|my_center|LOCUS_10250 163192 164058 gene locus_tag LOCUS_10260 163192 164058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10260 164414 164575 gene locus_tag LOCUS_10270 164414 164575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 165603 164842 gene locus_tag LOCUS_10280 165603 164842 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976314.1 protein_id gnl|my_center|LOCUS_10280 167217 165715 gene locus_tag LOCUS_10290 167217 165715 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224359.1 protein_id gnl|my_center|LOCUS_10290 167958 167377 gene locus_tag LOCUS_10300 167958 167377 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_10300 168648 169823 gene locus_tag LOCUS_10310 168648 169823 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_10310 170345 171343 gene locus_tag LOCUS_10320 170345 171343 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466931.1 protein_id gnl|my_center|LOCUS_10320 171550 171353 gene locus_tag LOCUS_10330 171550 171353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 171965 171543 gene locus_tag LOCUS_10340 171965 171543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 172195 172461 gene locus_tag LOCUS_10350 172195 172461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 172458 172712 gene locus_tag LOCUS_10360 172458 172712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 172806 173750 gene locus_tag LOCUS_10370 172806 173750 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878179.1 protein_id gnl|my_center|LOCUS_10370 173752 174555 gene locus_tag LOCUS_10380 173752 174555 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223407.1 protein_id gnl|my_center|LOCUS_10380 174580 175722 gene locus_tag LOCUS_10390 174580 175722 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030073.1 protein_id gnl|my_center|LOCUS_10390 175719 176342 gene locus_tag LOCUS_10400 175719 176342 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228375.1 protein_id gnl|my_center|LOCUS_10400 177251 176349 gene locus_tag LOCUS_10410 177251 176349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 177479 177330 gene locus_tag LOCUS_10420 177479 177330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 179020 177734 gene locus_tag LOCUS_10430 gene serS 179020 177734 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963346.1 protein_id gnl|my_center|LOCUS_10430 180291 179197 gene locus_tag LOCUS_10440 180291 179197 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027633.1 protein_id gnl|my_center|LOCUS_10440 180943 180326 gene locus_tag LOCUS_10450 180943 180326 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224772.1 protein_id gnl|my_center|LOCUS_10450 181031 181711 gene locus_tag LOCUS_10460 181031 181711 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222957.1 protein_id gnl|my_center|LOCUS_10460 182898 181714 gene locus_tag LOCUS_10470 182898 181714 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228752.1 protein_id gnl|my_center|LOCUS_10470 184205 183030 gene locus_tag LOCUS_10480 184205 183030 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037159.1 protein_id gnl|my_center|LOCUS_10480 184717 184202 gene locus_tag LOCUS_10490 184717 184202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 184895 187876 gene locus_tag LOCUS_10500 184895 187876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 188698 187934 gene locus_tag LOCUS_10510 188698 187934 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972431.1 protein_id gnl|my_center|LOCUS_10510 188789 189340 gene locus_tag LOCUS_10520 188789 189340 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027066.1 protein_id gnl|my_center|LOCUS_10520 189985 189437 gene locus_tag LOCUS_10530 189985 189437 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833874.1 protein_id gnl|my_center|LOCUS_10530 190662 189982 gene locus_tag LOCUS_10540 190662 189982 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183858629.1 protein_id gnl|my_center|LOCUS_10540 190886 192691 gene locus_tag LOCUS_10550 190886 192691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222074.1 protein_id gnl|my_center|LOCUS_10550 192907 195654 gene locus_tag LOCUS_10560 192907 195654 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227003.1 protein_id gnl|my_center|LOCUS_10560 196289 195882 gene locus_tag LOCUS_10570 196289 195882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 196640 196497 gene locus_tag LOCUS_10580 196640 196497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 196994 197368 gene locus_tag LOCUS_10590 196994 197368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 197451 197939 gene locus_tag LOCUS_10600 197451 197939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 199067 198036 gene locus_tag LOCUS_10610 199067 198036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 200278 199394 gene locus_tag LOCUS_10620 200278 199394 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229548.1 protein_id gnl|my_center|LOCUS_10620 202537 200420 gene locus_tag LOCUS_10630 202537 200420 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223681.1 protein_id gnl|my_center|LOCUS_10630 203697 202750 gene locus_tag LOCUS_10640 203697 202750 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223020.1 protein_id gnl|my_center|LOCUS_10640 204177 203923 gene locus_tag LOCUS_10650 204177 203923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 204645 205136 gene locus_tag LOCUS_10660 204645 205136 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223984.1 protein_id gnl|my_center|LOCUS_10660 205243 206979 gene locus_tag LOCUS_10670 205243 206979 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028566.1 protein_id gnl|my_center|LOCUS_10670 207086 208132 gene locus_tag LOCUS_10680 207086 208132 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029794.1 protein_id gnl|my_center|LOCUS_10680 208129 210474 gene locus_tag LOCUS_10690 208129 210474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 210555 210743 gene locus_tag LOCUS_10700 210555 210743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 213485 210792 gene locus_tag LOCUS_10710 213485 210792 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804126.1 protein_id gnl|my_center|LOCUS_10710 213897 215060 gene locus_tag LOCUS_10720 213897 215060 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929850.1 protein_id gnl|my_center|LOCUS_10720 215115 216176 gene locus_tag LOCUS_10730 215115 216176 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218916593.1 protein_id gnl|my_center|LOCUS_10730 216346 217419 gene locus_tag LOCUS_10740 216346 217419 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804129.1 protein_id gnl|my_center|LOCUS_10740 217416 219209 gene locus_tag LOCUS_10750 217416 219209 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804130.1 protein_id gnl|my_center|LOCUS_10750 219197 220207 gene locus_tag LOCUS_10760 219197 220207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 220204 221157 gene locus_tag LOCUS_10770 220204 221157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 221223 222680 gene locus_tag LOCUS_10780 221223 222680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 222718 223647 gene locus_tag LOCUS_10790 222718 223647 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225279.1 protein_id gnl|my_center|LOCUS_10790 224367 223720 gene locus_tag LOCUS_10800 224367 223720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 225206 224490 gene locus_tag LOCUS_10810 225206 224490 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523383.1 protein_id gnl|my_center|LOCUS_10810 225428 225868 gene locus_tag LOCUS_10820 225428 225868 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484516.1 protein_id gnl|my_center|LOCUS_10820 226766 227689 gene locus_tag LOCUS_10830 226766 227689 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222982.1 protein_id gnl|my_center|LOCUS_10830 227767 227985 gene locus_tag LOCUS_10840 227767 227985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976917.1 protein_id gnl|my_center|LOCUS_10840 229383 228157 gene locus_tag LOCUS_10850 229383 228157 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223986.1 protein_id gnl|my_center|LOCUS_10850 229625 229386 gene locus_tag LOCUS_10860 229625 229386 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559006.1 protein_id gnl|my_center|LOCUS_10860 230653 229709 gene locus_tag LOCUS_10870 230653 229709 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031009.1 protein_id gnl|my_center|LOCUS_10870 231822 230653 gene locus_tag LOCUS_10880 231822 230653 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878004.1 protein_id gnl|my_center|LOCUS_10880 233159 231930 gene locus_tag LOCUS_10890 gene fasR 233159 231930 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_10890 233943 233218 gene locus_tag LOCUS_10900 233943 233218 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973620.1 protein_id gnl|my_center|LOCUS_10900 235172 233940 gene locus_tag LOCUS_10910 235172 233940 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030212.1 protein_id gnl|my_center|LOCUS_10910 235390 235929 gene locus_tag LOCUS_10920 235390 235929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 236033 236359 gene locus_tag LOCUS_10930 236033 236359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 236445 237371 gene locus_tag LOCUS_10940 236445 237371 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973903.1 protein_id gnl|my_center|LOCUS_10940 238134 237448 gene locus_tag LOCUS_10950 238134 237448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 238362 238976 gene locus_tag LOCUS_10960 238362 238976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 240443 239046 gene locus_tag LOCUS_10970 gene gltX 240443 239046 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 protein_id gnl|my_center|LOCUS_10970 241831 240554 gene locus_tag LOCUS_10980 241831 240554 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222038.1 protein_id gnl|my_center|LOCUS_10980 243194 241836 gene locus_tag LOCUS_10990 243194 241836 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028409.1 protein_id gnl|my_center|LOCUS_10990 243449 243895 gene locus_tag LOCUS_11000 243449 243895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 246770 244032 gene locus_tag LOCUS_11010 gene aceE 246770 244032 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729733.1 protein_id gnl|my_center|LOCUS_11010 247019 247426 gene locus_tag LOCUS_11020 247019 247426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 247487 247891 gene locus_tag LOCUS_11030 247487 247891 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_11030 248100 250778 gene locus_tag LOCUS_11040 248100 250778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 250891 251328 gene locus_tag LOCUS_11050 250891 251328 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908452.1 protein_id gnl|my_center|LOCUS_11050 251448 251915 gene locus_tag LOCUS_11060 251448 251915 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224001.1 protein_id gnl|my_center|LOCUS_11060 251997 252069 gene locus_tag LOCUS_t00050 251997 252069 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 253099 252239 gene locus_tag LOCUS_11070 253099 252239 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976100.1 protein_id gnl|my_center|LOCUS_11070 253909 253730 gene locus_tag LOCUS_11080 253909 253730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 254129 253842 gene locus_tag LOCUS_11090 254129 253842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence03 2024 822 gene locus_tag LOCUS_11100 2024 822 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_11100 2803 2021 gene locus_tag LOCUS_11110 2803 2021 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230191.1 protein_id gnl|my_center|LOCUS_11110 3939 2800 gene locus_tag LOCUS_11120 3939 2800 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306837.1 protein_id gnl|my_center|LOCUS_11120 4586 3957 gene locus_tag LOCUS_11130 4586 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 4676 5329 gene locus_tag LOCUS_11140 4676 5329 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230194.1 protein_id gnl|my_center|LOCUS_11140 5371 6501 gene locus_tag LOCUS_11150 5371 6501 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230195.1 protein_id gnl|my_center|LOCUS_11150 6741 8378 gene locus_tag LOCUS_11160 6741 8378 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485448.1 protein_id gnl|my_center|LOCUS_11160 9516 9124 gene locus_tag LOCUS_11170 9516 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 10149 10277 gene locus_tag LOCUS_11180 10149 10277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 10413 10958 gene locus_tag LOCUS_11190 10413 10958 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085437.1 protein_id gnl|my_center|LOCUS_11190 11615 10968 gene locus_tag LOCUS_11200 11615 10968 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029801.1 protein_id gnl|my_center|LOCUS_11200 12826 11600 gene locus_tag LOCUS_11210 12826 11600 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029800.1 protein_id gnl|my_center|LOCUS_11210 12979 13719 gene locus_tag LOCUS_11220 12979 13719 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029799.1 protein_id gnl|my_center|LOCUS_11220 13719 16103 gene locus_tag LOCUS_11230 13719 16103 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207316850.1 protein_id gnl|my_center|LOCUS_11230 16394 16942 gene locus_tag LOCUS_11240 16394 16942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 17061 18539 gene locus_tag LOCUS_11250 17061 18539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 18645 18561 gene locus_tag LOCUS_t00060 18645 18561 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19396 18962 gene locus_tag LOCUS_11260 19396 18962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 20172 19915 gene locus_tag LOCUS_11270 20172 19915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 20889 20173 gene locus_tag LOCUS_11280 20889 20173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 21065 21676 gene locus_tag LOCUS_11290 21065 21676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 21812 24469 gene locus_tag LOCUS_11300 21812 24469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 24497 25498 gene locus_tag LOCUS_11310 24497 25498 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929980.1 protein_id gnl|my_center|LOCUS_11310 25515 26765 gene locus_tag LOCUS_11320 25515 26765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11320 26768 29221 gene locus_tag LOCUS_11330 26768 29221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 30183 29815 gene locus_tag LOCUS_11340 30183 29815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 30917 30378 gene locus_tag LOCUS_11350 30917 30378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 31832 31041 gene locus_tag LOCUS_11360 31832 31041 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_11360 32821 31829 gene locus_tag LOCUS_11370 32821 31829 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_11370 33591 32911 gene locus_tag LOCUS_11380 33591 32911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 33671 34123 gene locus_tag LOCUS_11390 33671 34123 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189303094.1 protein_id gnl|my_center|LOCUS_11390 34979 34134 gene locus_tag LOCUS_11400 34979 34134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 38393 35487 gene locus_tag LOCUS_11410 38393 35487 CDS product glycoside hydrolase family 48 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227017.1 protein_id gnl|my_center|LOCUS_11410 39025 38717 gene locus_tag LOCUS_11420 39025 38717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 39303 40790 gene locus_tag LOCUS_11430 39303 40790 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_11430 41316 40897 gene locus_tag LOCUS_11440 41316 40897 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078643930.1 protein_id gnl|my_center|LOCUS_11440 43958 41316 gene locus_tag LOCUS_11450 43958 41316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 45467 44055 gene locus_tag LOCUS_11460 45467 44055 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777065.1 protein_id gnl|my_center|LOCUS_11460 45750 47681 gene locus_tag LOCUS_11470 gene phzE 45750 47681 CDS product phenazine biosynthesis protein PhzE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118954.1 protein_id gnl|my_center|LOCUS_11470 48151 47759 gene locus_tag LOCUS_11480 48151 47759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 49027 48407 gene locus_tag LOCUS_11490 49027 48407 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337407.1 protein_id gnl|my_center|LOCUS_11490 49137 49631 gene locus_tag LOCUS_11500 49137 49631 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027466.1 protein_id gnl|my_center|LOCUS_11500 50749 50381 gene locus_tag LOCUS_11510 50749 50381 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 protein_id gnl|my_center|LOCUS_11510 51504 50746 gene locus_tag LOCUS_11520 51504 50746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977478.1 protein_id gnl|my_center|LOCUS_11520 51694 52851 gene locus_tag LOCUS_11530 51694 52851 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763966.1 protein_id gnl|my_center|LOCUS_11530 53518 52865 gene locus_tag LOCUS_11540 53518 52865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 55326 54250 gene locus_tag LOCUS_11550 55326 54250 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226641.1 protein_id gnl|my_center|LOCUS_11550 56015 55320 gene locus_tag LOCUS_11560 56015 55320 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742149.1 protein_id gnl|my_center|LOCUS_11560 57746 56259 gene locus_tag LOCUS_11570 57746 56259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 58105 58806 gene locus_tag LOCUS_11580 58105 58806 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110169.1 protein_id gnl|my_center|LOCUS_11580 59858 58902 gene locus_tag LOCUS_11590 59858 58902 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976313.1 protein_id gnl|my_center|LOCUS_11590 59959 60588 gene locus_tag LOCUS_11600 59959 60588 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080919.1 protein_id gnl|my_center|LOCUS_11600 60868 61299 gene locus_tag LOCUS_11610 60868 61299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 61346 61621 gene locus_tag LOCUS_11620 61346 61621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 62528 61818 gene locus_tag LOCUS_11630 62528 61818 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 protein_id gnl|my_center|LOCUS_11630 62652 62810 gene locus_tag LOCUS_11640 62652 62810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 63957 62872 gene locus_tag LOCUS_11650 63957 62872 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230195.1 protein_id gnl|my_center|LOCUS_11650 64631 63957 gene locus_tag LOCUS_11660 64631 63957 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284338.1 protein_id gnl|my_center|LOCUS_11660 64741 65628 gene locus_tag LOCUS_11670 64741 65628 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227650.1 protein_id gnl|my_center|LOCUS_11670 65625 66614 gene locus_tag LOCUS_11680 65625 66614 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227649.1 protein_id gnl|my_center|LOCUS_11680 69402 66673 gene locus_tag LOCUS_11690 69402 66673 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_11690 69490 71433 gene locus_tag LOCUS_11700 69490 71433 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 protein_id gnl|my_center|LOCUS_11700 71624 73372 gene locus_tag LOCUS_11710 71624 73372 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027941.1 protein_id gnl|my_center|LOCUS_11710 73519 74325 gene locus_tag LOCUS_11720 73519 74325 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977680.1 protein_id gnl|my_center|LOCUS_11720 75685 74426 gene locus_tag LOCUS_11730 75685 74426 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227356.1 protein_id gnl|my_center|LOCUS_11730 76091 76999 gene locus_tag LOCUS_11740 76091 76999 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836451.1 protein_id gnl|my_center|LOCUS_11740 78119 77091 gene locus_tag LOCUS_11750 78119 77091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 78845 78252 gene locus_tag LOCUS_11760 78845 78252 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_11760 79948 78938 gene locus_tag LOCUS_11770 79948 78938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225204.1 protein_id gnl|my_center|LOCUS_11770 80041 80661 gene locus_tag LOCUS_11780 80041 80661 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225203.1 protein_id gnl|my_center|LOCUS_11780 80744 81046 gene locus_tag LOCUS_11790 80744 81046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 81740 81150 gene locus_tag LOCUS_11800 81740 81150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 83590 81914 gene locus_tag LOCUS_11810 83590 81914 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228747.1 protein_id gnl|my_center|LOCUS_11810 84763 83804 gene locus_tag LOCUS_11820 84763 83804 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776379.1 protein_id gnl|my_center|LOCUS_11820 85717 84776 gene locus_tag LOCUS_11830 85717 84776 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776380.1 protein_id gnl|my_center|LOCUS_11830 87172 85760 gene locus_tag LOCUS_11840 gene ngcE 87172 85760 CDS product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776381.1 protein_id gnl|my_center|LOCUS_11840 87947 87198 gene locus_tag LOCUS_11850 87947 87198 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732177.1 protein_id gnl|my_center|LOCUS_11850 88900 87944 gene locus_tag LOCUS_11860 88900 87944 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 protein_id gnl|my_center|LOCUS_11860 89097 90086 gene locus_tag LOCUS_11870 89097 90086 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230309.1 protein_id gnl|my_center|LOCUS_11870 91103 90147 gene locus_tag LOCUS_11880 91103 90147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 91640 91188 gene locus_tag LOCUS_11890 91640 91188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 91887 94304 gene locus_tag LOCUS_11900 91887 94304 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_11900 95322 94408 gene locus_tag LOCUS_11910 95322 94408 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_11910 96227 95319 gene locus_tag LOCUS_11920 96227 95319 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030592.1 protein_id gnl|my_center|LOCUS_11920 97639 96224 gene locus_tag LOCUS_11930 gene ngcE 97639 96224 CDS product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776381.1 protein_id gnl|my_center|LOCUS_11930 97795 99168 gene locus_tag LOCUS_11940 97795 99168 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803753.1 protein_id gnl|my_center|LOCUS_11940 100648 99140 gene locus_tag LOCUS_11950 100648 99140 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893815.1 protein_id gnl|my_center|LOCUS_11950 101990 100683 gene locus_tag LOCUS_11960 101990 100683 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_11960 102252 103280 gene locus_tag LOCUS_11970 102252 103280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420615.1 protein_id gnl|my_center|LOCUS_11970 104014 103340 gene locus_tag LOCUS_11980 104014 103340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 104490 105272 gene locus_tag LOCUS_11990 104490 105272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 105503 106132 gene locus_tag LOCUS_12000 105503 106132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 106134 106748 gene locus_tag LOCUS_12010 106134 106748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 107006 107983 gene locus_tag LOCUS_12020 107006 107983 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226333.1 protein_id gnl|my_center|LOCUS_12020 109591 108242 gene locus_tag LOCUS_12030 gene murD 109591 108242 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037868.1 protein_id gnl|my_center|LOCUS_12030 109679 111028 gene locus_tag LOCUS_12040 gene murL 109679 111028 CDS product UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-L-glutamate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 protein_id gnl|my_center|LOCUS_12040 112941 111133 gene locus_tag LOCUS_12050 112941 111133 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728347.1 protein_id gnl|my_center|LOCUS_12050 113053 114336 gene locus_tag LOCUS_12060 113053 114336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 115237 114428 gene locus_tag LOCUS_12070 115237 114428 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977273.1 protein_id gnl|my_center|LOCUS_12070 115357 117213 gene locus_tag LOCUS_12080 115357 117213 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530887.1 protein_id gnl|my_center|LOCUS_12080 119548 117290 gene locus_tag LOCUS_12090 119548 117290 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013529.1 protein_id gnl|my_center|LOCUS_12090 120449 119625 gene locus_tag LOCUS_12100 120449 119625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 121745 120630 gene locus_tag LOCUS_12110 121745 120630 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027982.1 protein_id gnl|my_center|LOCUS_12110 122215 121742 gene locus_tag LOCUS_12120 122215 121742 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977025.1 protein_id gnl|my_center|LOCUS_12120 122326 123642 gene locus_tag LOCUS_12130 122326 123642 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230185.1 protein_id gnl|my_center|LOCUS_12130 124650 123835 gene locus_tag LOCUS_12140 124650 123835 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226503.1 protein_id gnl|my_center|LOCUS_12140 124834 125628 gene locus_tag LOCUS_12150 124834 125628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027983.1 protein_id gnl|my_center|LOCUS_12150 126574 125795 gene locus_tag LOCUS_12160 126574 125795 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_12160 127680 126649 gene locus_tag LOCUS_12170 127680 126649 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226767.1 protein_id gnl|my_center|LOCUS_12170 128546 127779 gene locus_tag LOCUS_12180 gene fabI 128546 127779 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_12180 129289 128585 gene locus_tag LOCUS_12190 129289 128585 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226771.1 protein_id gnl|my_center|LOCUS_12190 131118 130168 gene locus_tag LOCUS_12200 131118 130168 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 protein_id gnl|my_center|LOCUS_12200 132134 131115 gene locus_tag LOCUS_12210 132134 131115 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407529.1 protein_id gnl|my_center|LOCUS_12210 133228 132113 gene locus_tag LOCUS_12220 133228 132113 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_12220 133524 133697 gene locus_tag LOCUS_12230 133524 133697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 133720 134313 gene locus_tag LOCUS_12240 133720 134313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 134310 135788 gene locus_tag LOCUS_12250 134310 135788 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013786.1 protein_id gnl|my_center|LOCUS_12250 136868 135867 gene locus_tag LOCUS_12260 136868 135867 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218045413.1 protein_id gnl|my_center|LOCUS_12260 137022 137501 gene locus_tag LOCUS_12270 137022 137501 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083110.1 protein_id gnl|my_center|LOCUS_12270 137498 138328 gene locus_tag LOCUS_12280 137498 138328 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228583.1 protein_id gnl|my_center|LOCUS_12280 139198 138368 gene locus_tag LOCUS_12290 139198 138368 CDS product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704926.1 protein_id gnl|my_center|LOCUS_12290 139565 140677 gene locus_tag LOCUS_12300 139565 140677 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227012.1 protein_id gnl|my_center|LOCUS_12300 142697 140736 gene locus_tag LOCUS_12310 gene asnB 142697 140736 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014952.1 protein_id gnl|my_center|LOCUS_12310 142809 144290 gene locus_tag LOCUS_12320 142809 144290 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974973.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence04 1561 2220 gene locus_tag LOCUS_12330 1561 2220 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977232.1 protein_id gnl|my_center|LOCUS_12330 3567 2818 gene locus_tag LOCUS_12340 3567 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 3788 4984 gene locus_tag LOCUS_12350 3788 4984 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227700.1 protein_id gnl|my_center|LOCUS_12350 4987 5226 gene locus_tag LOCUS_12360 4987 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 5307 5840 gene locus_tag LOCUS_12370 5307 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 6392 5949 gene locus_tag LOCUS_12380 6392 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 7004 6528 gene locus_tag LOCUS_12390 7004 6528 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487415.1 protein_id gnl|my_center|LOCUS_12390 8503 7004 gene locus_tag LOCUS_12400 8503 7004 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727675.1 protein_id gnl|my_center|LOCUS_12400 8647 10341 gene locus_tag LOCUS_12410 8647 10341 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224279.1 protein_id gnl|my_center|LOCUS_12410 12697 10433 gene locus_tag LOCUS_12420 12697 10433 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031131.1 protein_id gnl|my_center|LOCUS_12420 12760 13743 gene locus_tag LOCUS_12430 12760 13743 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028824.1 protein_id gnl|my_center|LOCUS_12430 14501 13803 gene locus_tag LOCUS_12440 14501 13803 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043781894.1 protein_id gnl|my_center|LOCUS_12440 14887 15156 gene locus_tag LOCUS_12450 14887 15156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 16179 15076 gene locus_tag LOCUS_12460 16179 15076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228171.1 protein_id gnl|my_center|LOCUS_12460 16863 16486 gene locus_tag LOCUS_12470 16863 16486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 16774 17577 gene locus_tag LOCUS_12480 16774 17577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086839449.1 protein_id gnl|my_center|LOCUS_12480 17747 18502 gene locus_tag LOCUS_12490 17747 18502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 18499 19278 gene locus_tag LOCUS_12500 18499 19278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 19275 20321 gene locus_tag LOCUS_12510 19275 20321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 20318 21067 gene locus_tag LOCUS_12520 20318 21067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 21064 22290 gene locus_tag LOCUS_12530 21064 22290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 22287 24161 gene locus_tag LOCUS_12540 22287 24161 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875923.1 protein_id gnl|my_center|LOCUS_12540 24349 24164 gene locus_tag LOCUS_12550 24349 24164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 25892 24342 gene locus_tag LOCUS_12560 25892 24342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 28301 25896 gene locus_tag LOCUS_12570 28301 25896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 29491 28298 gene locus_tag LOCUS_12580 29491 28298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 32114 29493 gene locus_tag LOCUS_12590 32114 29493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 33828 32158 gene locus_tag LOCUS_12600 33828 32158 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963794.1 protein_id gnl|my_center|LOCUS_12600 34518 33859 gene locus_tag LOCUS_12610 34518 33859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 34652 36193 gene locus_tag LOCUS_12620 34652 36193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 36190 37542 gene locus_tag LOCUS_12630 36190 37542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 37539 39527 gene locus_tag LOCUS_12640 37539 39527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 41711 39600 gene locus_tag LOCUS_12650 41711 39600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 44469 41749 gene locus_tag LOCUS_12660 44469 41749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 45110 44625 gene locus_tag LOCUS_12670 45110 44625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 45303 46520 gene locus_tag LOCUS_12680 45303 46520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 45625 45717 gene locus_tag LOCUS_t00070 45625 45717 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 46752 47072 gene locus_tag LOCUS_12690 46752 47072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 47069 48295 gene locus_tag LOCUS_12700 47069 48295 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 protein_id gnl|my_center|LOCUS_12700 48379 49062 gene locus_tag LOCUS_12710 48379 49062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 49188 52163 gene locus_tag LOCUS_12720 49188 52163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 52309 52794 gene locus_tag LOCUS_12730 52309 52794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 52791 53687 gene locus_tag LOCUS_12740 52791 53687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 53794 56787 gene locus_tag LOCUS_12750 53794 56787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 57916 56702 gene locus_tag LOCUS_12760 57916 56702 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974733.1 protein_id gnl|my_center|LOCUS_12760 58437 57913 gene locus_tag LOCUS_12770 58437 57913 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226663.1 protein_id gnl|my_center|LOCUS_12770 60424 58469 gene locus_tag LOCUS_12780 60424 58469 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226664.1 protein_id gnl|my_center|LOCUS_12780 60834 60424 gene locus_tag LOCUS_12790 60834 60424 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226665.1 protein_id gnl|my_center|LOCUS_12790 61076 60840 gene locus_tag LOCUS_12800 61076 60840 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226666.1 protein_id gnl|my_center|LOCUS_12800 62989 61148 gene locus_tag LOCUS_12810 62989 61148 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_12810 63743 62973 gene locus_tag LOCUS_12820 63743 62973 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226668.1 protein_id gnl|my_center|LOCUS_12820 64184 63747 gene locus_tag LOCUS_12830 64184 63747 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226669.1 protein_id gnl|my_center|LOCUS_12830 66916 64244 gene locus_tag LOCUS_12840 66916 64244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091311560.1 protein_id gnl|my_center|LOCUS_12840 67079 66921 gene locus_tag LOCUS_12850 67079 66921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098516.1 protein_id gnl|my_center|LOCUS_12850 67525 67076 gene locus_tag LOCUS_12860 67525 67076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226671.1 protein_id gnl|my_center|LOCUS_12860 67973 67530 gene locus_tag LOCUS_12870 67973 67530 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226672.1 protein_id gnl|my_center|LOCUS_12870 69527 67998 gene locus_tag LOCUS_12880 69527 67998 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226673.1 protein_id gnl|my_center|LOCUS_12880 70152 70397 gene locus_tag LOCUS_12890 70152 70397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 71091 70519 gene locus_tag LOCUS_12900 71091 70519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 75256 71093 gene locus_tag LOCUS_12910 75256 71093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 76113 75349 gene locus_tag LOCUS_12920 76113 75349 CDS product DUF4157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226675.1 protein_id gnl|my_center|LOCUS_12920 76478 77215 gene locus_tag LOCUS_12930 76478 77215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 79368 77260 gene locus_tag LOCUS_12940 79368 77260 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226676.1 protein_id gnl|my_center|LOCUS_12940 79998 79372 gene locus_tag LOCUS_12950 79998 79372 CDS product DUF4255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226677.1 protein_id gnl|my_center|LOCUS_12950 83728 80003 gene locus_tag LOCUS_12960 83728 80003 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226661.1 protein_id gnl|my_center|LOCUS_12960 84465 83842 gene locus_tag LOCUS_12970 84465 83842 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226659.1 protein_id gnl|my_center|LOCUS_12970 84625 85956 gene locus_tag LOCUS_12980 84625 85956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226660.1 protein_id gnl|my_center|LOCUS_12980 86570 86151 gene locus_tag LOCUS_12990 86570 86151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 86818 86567 gene locus_tag LOCUS_13000 86818 86567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 86994 88115 gene locus_tag LOCUS_13010 86994 88115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 89223 88138 gene locus_tag LOCUS_13020 89223 88138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 89554 89216 gene locus_tag LOCUS_13030 89554 89216 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991882.1 protein_id gnl|my_center|LOCUS_13030 89653 90456 gene locus_tag LOCUS_13040 89653 90456 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226540.1 protein_id gnl|my_center|LOCUS_13040 90503 91939 gene locus_tag LOCUS_13050 90503 91939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 91956 93059 gene locus_tag LOCUS_13060 91956 93059 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222295.1 protein_id gnl|my_center|LOCUS_13060 93073 94212 gene locus_tag LOCUS_13070 93073 94212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 94209 96455 gene locus_tag LOCUS_13080 94209 96455 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014868643.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13080 96559 98031 gene locus_tag LOCUS_13090 96559 98031 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 protein_id gnl|my_center|LOCUS_13090 98028 99812 gene locus_tag LOCUS_13100 98028 99812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 99888 100886 gene locus_tag LOCUS_13110 gene rfbB 99888 100886 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892900.1 protein_id gnl|my_center|LOCUS_13110 100982 101845 gene locus_tag LOCUS_13120 100982 101845 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977080.1 protein_id gnl|my_center|LOCUS_13120 102149 101805 gene locus_tag LOCUS_13130 102149 101805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13130 103486 102464 gene locus_tag LOCUS_13140 103486 102464 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222560.1 protein_id gnl|my_center|LOCUS_13140 103846 103493 gene locus_tag LOCUS_13150 103846 103493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 104379 103948 gene locus_tag LOCUS_13160 104379 103948 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222584.1 protein_id gnl|my_center|LOCUS_13160 104738 105901 gene locus_tag LOCUS_13170 gene rifK 104738 105901 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_13170 105898 107034 gene locus_tag LOCUS_13180 105898 107034 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222558.1 protein_id gnl|my_center|LOCUS_13180 107072 107791 gene locus_tag LOCUS_13190 107072 107791 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222559.1 protein_id gnl|my_center|LOCUS_13190 108834 107914 gene locus_tag LOCUS_13200 108834 107914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 110169 109219 gene locus_tag LOCUS_13210 110169 109219 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229873.1 protein_id gnl|my_center|LOCUS_13210 112547 110481 gene locus_tag LOCUS_13220 112547 110481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 112716 127799 gene locus_tag LOCUS_13230 112716 127799 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067456433.1 protein_id gnl|my_center|LOCUS_13230 127879 129456 gene locus_tag LOCUS_13240 127879 129456 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222576.1 protein_id gnl|my_center|LOCUS_13240 129487 130374 gene locus_tag LOCUS_13250 129487 130374 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932075.1 protein_id gnl|my_center|LOCUS_13250 130975 131778 gene locus_tag LOCUS_13260 130975 131778 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777030.1 protein_id gnl|my_center|LOCUS_13260 132063 132836 gene locus_tag LOCUS_13270 132063 132836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 134117 133881 gene locus_tag LOCUS_13280 134117 133881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 134073 134651 gene locus_tag LOCUS_13290 134073 134651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 135529 134969 gene locus_tag LOCUS_13300 135529 134969 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921433.1 protein_id gnl|my_center|LOCUS_13300 135593 136324 gene locus_tag LOCUS_13310 135593 136324 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223927.1 protein_id gnl|my_center|LOCUS_13310 136466 137317 gene locus_tag LOCUS_13320 136466 137317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 137376 137711 gene locus_tag LOCUS_13330 137376 137711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 137776 139428 gene locus_tag LOCUS_13340 137776 139428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence05 1100 3 gene locus_tag LOCUS_13350 1100 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1685 1230 gene locus_tag LOCUS_13360 1685 1230 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223944.1 protein_id gnl|my_center|LOCUS_13360 2075 1815 gene locus_tag LOCUS_13370 2075 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976994.1 protein_id gnl|my_center|LOCUS_13370 2050 2268 gene locus_tag LOCUS_13380 2050 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 2710 2300 gene locus_tag LOCUS_13390 gene msrB 2710 2300 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972860.1 protein_id gnl|my_center|LOCUS_13390 2758 3786 gene locus_tag LOCUS_13400 gene ligD 2758 3786 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_13400 4160 3864 gene locus_tag LOCUS_13410 4160 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 4327 7515 gene locus_tag LOCUS_13420 4327 7515 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484982.1 protein_id gnl|my_center|LOCUS_13420 7667 10366 gene locus_tag LOCUS_13430 7667 10366 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484980.1 protein_id gnl|my_center|LOCUS_13430 10368 11360 gene locus_tag LOCUS_13440 10368 11360 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_13440 11357 12079 gene locus_tag LOCUS_13450 11357 12079 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 protein_id gnl|my_center|LOCUS_13450 12625 12221 gene locus_tag LOCUS_13460 12625 12221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 13164 12712 gene locus_tag LOCUS_13470 13164 12712 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029305.1 protein_id gnl|my_center|LOCUS_13470 14898 13315 gene locus_tag LOCUS_13480 14898 13315 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030099.1 protein_id gnl|my_center|LOCUS_13480 16058 14934 gene locus_tag LOCUS_13490 16058 14934 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031122.1 protein_id gnl|my_center|LOCUS_13490 16182 16400 gene locus_tag LOCUS_13500 16182 16400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 16681 17103 gene locus_tag LOCUS_13510 16681 17103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 17572 17078 gene locus_tag LOCUS_13520 17572 17078 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230160.1 protein_id gnl|my_center|LOCUS_13520 17656 18159 gene locus_tag LOCUS_13530 17656 18159 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943975.1 protein_id gnl|my_center|LOCUS_13530 19227 18289 gene locus_tag LOCUS_13540 19227 18289 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028728.1 protein_id gnl|my_center|LOCUS_13540 20191 19334 gene locus_tag LOCUS_13550 20191 19334 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 protein_id gnl|my_center|LOCUS_13550 21368 20256 gene locus_tag LOCUS_13560 21368 20256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223613.1 protein_id gnl|my_center|LOCUS_13560 23839 21365 gene locus_tag LOCUS_13570 23839 21365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 24987 23839 gene locus_tag LOCUS_13580 24987 23839 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223610.1 protein_id gnl|my_center|LOCUS_13580 26751 25000 gene locus_tag LOCUS_13590 26751 25000 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223609.1 protein_id gnl|my_center|LOCUS_13590 27184 26765 gene locus_tag LOCUS_13600 27184 26765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 28556 27777 gene locus_tag LOCUS_13610 28556 27777 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224546.1 protein_id gnl|my_center|LOCUS_13610 29019 30332 gene locus_tag LOCUS_13620 29019 30332 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224314.1 protein_id gnl|my_center|LOCUS_13620 30484 31470 gene locus_tag LOCUS_13630 30484 31470 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229856.1 protein_id gnl|my_center|LOCUS_13630 31474 32382 gene locus_tag LOCUS_13640 31474 32382 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224316.1 protein_id gnl|my_center|LOCUS_13640 32379 33812 gene locus_tag LOCUS_13650 32379 33812 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_13650 33898 34944 gene locus_tag LOCUS_13660 33898 34944 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027638.1 protein_id gnl|my_center|LOCUS_13660 36205 34994 gene locus_tag LOCUS_13670 36205 34994 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_13670 37326 36205 gene locus_tag LOCUS_13680 37326 36205 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_13680 37457 38164 gene locus_tag LOCUS_13690 37457 38164 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443162.1 protein_id gnl|my_center|LOCUS_13690 38299 39435 gene locus_tag LOCUS_13700 38299 39435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13700 41138 39573 gene locus_tag LOCUS_13710 41138 39573 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067284407.1 protein_id gnl|my_center|LOCUS_13710 41478 44393 gene locus_tag LOCUS_13720 41478 44393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 45419 44460 gene locus_tag LOCUS_13730 45419 44460 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419327.1 protein_id gnl|my_center|LOCUS_13730 46224 45715 gene locus_tag LOCUS_13740 46224 45715 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227056.1 protein_id gnl|my_center|LOCUS_13740 47427 46432 gene locus_tag LOCUS_13750 gene bioB 47427 46432 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728886.1 protein_id gnl|my_center|LOCUS_13750 47687 48823 gene locus_tag LOCUS_13760 47687 48823 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223945.1 protein_id gnl|my_center|LOCUS_13760 48841 49569 gene locus_tag LOCUS_13770 gene bioD 48841 49569 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027666.1 protein_id gnl|my_center|LOCUS_13770 49659 51206 gene locus_tag LOCUS_13780 49659 51206 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223179.1 protein_id gnl|my_center|LOCUS_13780 51203 51892 gene locus_tag LOCUS_13790 51203 51892 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223180.1 protein_id gnl|my_center|LOCUS_13790 52696 51896 gene locus_tag LOCUS_13800 52696 51896 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223184.1 protein_id gnl|my_center|LOCUS_13800 53652 52693 gene locus_tag LOCUS_13810 53652 52693 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223185.1 protein_id gnl|my_center|LOCUS_13810 55027 53864 gene locus_tag LOCUS_13820 55027 53864 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229724.1 protein_id gnl|my_center|LOCUS_13820 55705 55037 gene locus_tag LOCUS_13830 55705 55037 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508815.1 protein_id gnl|my_center|LOCUS_13830 55903 57213 gene locus_tag LOCUS_13840 55903 57213 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228182.1 protein_id gnl|my_center|LOCUS_13840 58339 57638 gene locus_tag LOCUS_13850 58339 57638 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972222.1 protein_id gnl|my_center|LOCUS_13850 58734 58807 gene locus_tag LOCUS_t00080 58734 58807 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 58841 58912 gene locus_tag LOCUS_t00090 58841 58912 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 58926 59000 gene locus_tag LOCUS_t00100 58926 59000 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 59635 69417 gene locus_tag LOCUS_13860 59635 69417 CDS product polymorphic toxin-type HINT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051754043.1 protein_id gnl|my_center|LOCUS_13860 69453 71831 gene locus_tag LOCUS_13870 69453 71831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 72193 74190 gene locus_tag LOCUS_13880 72193 74190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 77134 74240 gene locus_tag LOCUS_13890 77134 74240 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223426.1 protein_id gnl|my_center|LOCUS_13890 77390 80773 gene locus_tag LOCUS_13900 77390 80773 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225870.1 protein_id gnl|my_center|LOCUS_13900 80967 81986 gene locus_tag LOCUS_13910 80967 81986 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173142140.1 protein_id gnl|my_center|LOCUS_13910 82292 82053 gene locus_tag LOCUS_13920 82292 82053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 82500 82573 gene locus_tag LOCUS_t00110 82500 82573 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 82635 82709 gene locus_tag LOCUS_t00120 82635 82709 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 82830 84665 gene locus_tag LOCUS_13930 gene recQ 82830 84665 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224869.1 protein_id gnl|my_center|LOCUS_13930 85552 84785 gene locus_tag LOCUS_13940 85552 84785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 86421 85756 gene locus_tag LOCUS_13950 86421 85756 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029635.1 protein_id gnl|my_center|LOCUS_13950 86660 87415 gene locus_tag LOCUS_13960 86660 87415 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974575.1 protein_id gnl|my_center|LOCUS_13960 87533 88534 gene locus_tag LOCUS_13970 87533 88534 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849145.1 protein_id gnl|my_center|LOCUS_13970 88633 88875 gene locus_tag LOCUS_13980 88633 88875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 89939 88965 gene locus_tag LOCUS_13990 89939 88965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467269.1 protein_id gnl|my_center|LOCUS_13990 90129 90767 gene locus_tag LOCUS_14000 90129 90767 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_14000 91205 90768 gene locus_tag LOCUS_14010 91205 90768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 92100 91510 gene locus_tag LOCUS_14020 92100 91510 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978436.1 protein_id gnl|my_center|LOCUS_14020 92158 93708 gene locus_tag LOCUS_14030 92158 93708 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027641.1 protein_id gnl|my_center|LOCUS_14030 94490 93891 gene locus_tag LOCUS_14040 gene mfpA 94490 93891 CDS product pentapeptide repeat protein MfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417767.1 protein_id gnl|my_center|LOCUS_14040 96340 94640 gene locus_tag LOCUS_14050 96340 94640 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730409.1 protein_id gnl|my_center|LOCUS_14050 97433 96429 gene locus_tag LOCUS_14060 97433 96429 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227277.1 protein_id gnl|my_center|LOCUS_14060 97800 97931 gene locus_tag LOCUS_14070 97800 97931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 98785 97910 gene locus_tag LOCUS_14080 98785 97910 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227300.1 protein_id gnl|my_center|LOCUS_14080 101245 98825 gene locus_tag LOCUS_14090 101245 98825 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729203.1 protein_id gnl|my_center|LOCUS_14090 102227 101367 gene locus_tag LOCUS_14100 102227 101367 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227300.1 protein_id gnl|my_center|LOCUS_14100 102659 102441 gene locus_tag LOCUS_14110 102659 102441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 102671 102994 gene locus_tag LOCUS_14120 102671 102994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 103128 103370 gene locus_tag LOCUS_14130 103128 103370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 103488 103724 gene locus_tag LOCUS_14140 103488 103724 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559389.1 protein_id gnl|my_center|LOCUS_14140 103724 104302 gene locus_tag LOCUS_14150 103724 104302 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094669.1 protein_id gnl|my_center|LOCUS_14150 104455 105441 gene locus_tag LOCUS_14160 104455 105441 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804319.1 protein_id gnl|my_center|LOCUS_14160 105434 106435 gene locus_tag LOCUS_14170 105434 106435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 106517 108007 gene locus_tag LOCUS_14180 106517 108007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 108016 108819 gene locus_tag LOCUS_14190 108016 108819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 108948 109394 gene locus_tag LOCUS_14200 108948 109394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 109627 109508 gene locus_tag LOCUS_14210 109627 109508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 109826 109641 gene locus_tag LOCUS_14220 109826 109641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 110870 109908 gene locus_tag LOCUS_14230 110870 109908 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031568.1 protein_id gnl|my_center|LOCUS_14230 111425 112783 gene locus_tag LOCUS_14240 111425 112783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 114168 112975 gene locus_tag LOCUS_14250 114168 112975 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229204.1 protein_id gnl|my_center|LOCUS_14250 114636 114235 gene locus_tag LOCUS_14260 114636 114235 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224534.1 protein_id gnl|my_center|LOCUS_14260 114832 114647 gene locus_tag LOCUS_14270 114832 114647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 114952 115710 gene locus_tag LOCUS_14280 114952 115710 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227194.1 protein_id gnl|my_center|LOCUS_14280 117935 115797 gene locus_tag LOCUS_14290 117935 115797 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639906.1 protein_id gnl|my_center|LOCUS_14290 118698 118441 gene locus_tag LOCUS_14300 118698 118441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 118947 119993 gene locus_tag LOCUS_14310 118947 119993 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_14310 119990 120226 gene locus_tag LOCUS_14320 119990 120226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 120434 121465 gene locus_tag LOCUS_14330 120434 121465 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484222.1 protein_id gnl|my_center|LOCUS_14330 121821 121537 gene locus_tag LOCUS_14340 121821 121537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 121763 121933 gene locus_tag LOCUS_14350 121763 121933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 122136 122549 gene locus_tag LOCUS_14360 122136 122549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 124950 122656 gene locus_tag LOCUS_14370 124950 122656 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449606.1 protein_id gnl|my_center|LOCUS_14370 125100 125726 gene locus_tag LOCUS_14380 125100 125726 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_14380 127573 125792 gene locus_tag LOCUS_14390 127573 125792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 128095 127634 gene locus_tag LOCUS_14400 128095 127634 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227147.1 protein_id gnl|my_center|LOCUS_14400 128143 128664 gene locus_tag LOCUS_14410 128143 128664 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226958.1 protein_id gnl|my_center|LOCUS_14410 128714 129640 gene locus_tag LOCUS_14420 128714 129640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 129831 129840 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 130093 129914 gene locus_tag LOCUS_14430 130093 129914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 130453 131052 gene locus_tag LOCUS_14440 130453 131052 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977747.1 protein_id gnl|my_center|LOCUS_14440 131593 131138 gene locus_tag LOCUS_14450 131593 131138 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_14450 132851 131601 gene locus_tag LOCUS_14460 132851 131601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 133017 133799 gene locus_tag LOCUS_14470 133017 133799 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529669.1 protein_id gnl|my_center|LOCUS_14470 134301 133870 gene locus_tag LOCUS_14480 134301 133870 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004002642.1 protein_id gnl|my_center|LOCUS_14480 134666 135151 gene locus_tag LOCUS_14490 134666 135151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 135202 135275 gene locus_tag LOCUS_t00130 135202 135275 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 136258 137478 gene locus_tag LOCUS_14500 136258 137478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 137755 137432 gene locus_tag LOCUS_14510 137755 137432 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226991.1 protein_id gnl|my_center|LOCUS_14510 137916 138077 gene locus_tag LOCUS_14520 137916 138077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence06 13 121 gene locus_tag LOCUS_r00020 13 121 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1192 197 gene locus_tag LOCUS_14530 1192 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 1635 3149 gene locus_tag LOCUS_14540 1635 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 3239 4357 gene locus_tag LOCUS_14550 3239 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 6002 4440 gene locus_tag LOCUS_14560 6002 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 6736 6116 gene locus_tag LOCUS_14570 6736 6116 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228646.1 protein_id gnl|my_center|LOCUS_14570 6821 7222 gene locus_tag LOCUS_14580 6821 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 7487 7197 gene locus_tag LOCUS_14590 7487 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 10567 7487 gene locus_tag LOCUS_14600 10567 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 12109 10604 gene locus_tag LOCUS_14610 12109 10604 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_14610 17880 12106 gene locus_tag LOCUS_14620 17880 12106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 18019 20859 gene locus_tag LOCUS_14630 18019 20859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 21099 21743 gene locus_tag LOCUS_14640 21099 21743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 21877 22476 gene locus_tag LOCUS_14650 21877 22476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 23617 22523 gene locus_tag LOCUS_14660 23617 22523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 24353 23700 gene locus_tag LOCUS_14670 24353 23700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 26209 24350 gene locus_tag LOCUS_14680 26209 24350 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851158.1 protein_id gnl|my_center|LOCUS_14680 26745 26206 gene locus_tag LOCUS_14690 26745 26206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 27322 26645 gene locus_tag LOCUS_14700 27322 26645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 27703 27428 gene locus_tag LOCUS_14710 27703 27428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 28588 27761 gene locus_tag LOCUS_14720 28588 27761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 29543 29079 gene locus_tag LOCUS_14730 29543 29079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031366.1 protein_id gnl|my_center|LOCUS_14730 30150 29518 gene locus_tag LOCUS_14740 30150 29518 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223264.1 protein_id gnl|my_center|LOCUS_14740 31495 30182 gene locus_tag LOCUS_14750 31495 30182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 31654 34305 gene locus_tag LOCUS_14760 31654 34305 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223261.1 protein_id gnl|my_center|LOCUS_14760 34526 35323 gene locus_tag LOCUS_14770 34526 35323 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224432.1 protein_id gnl|my_center|LOCUS_14770 36671 35385 gene locus_tag LOCUS_14780 36671 35385 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226163.1 protein_id gnl|my_center|LOCUS_14780 36856 38016 gene locus_tag LOCUS_14790 36856 38016 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226162.1 protein_id gnl|my_center|LOCUS_14790 39033 38068 gene locus_tag LOCUS_14800 39033 38068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 39191 39033 gene locus_tag LOCUS_14810 39191 39033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 41393 39291 gene locus_tag LOCUS_14820 41393 39291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 41553 43052 gene locus_tag LOCUS_14830 41553 43052 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029391.1 protein_id gnl|my_center|LOCUS_14830 43416 45608 gene locus_tag LOCUS_14840 43416 45608 CDS product carbohydrate-binding module family 20 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259365.1 protein_id gnl|my_center|LOCUS_14840 46038 46532 gene locus_tag LOCUS_14850 46038 46532 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974913.1 protein_id gnl|my_center|LOCUS_14850 46683 47612 gene locus_tag LOCUS_14860 46683 47612 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100352.1 protein_id gnl|my_center|LOCUS_14860 47629 47973 gene locus_tag LOCUS_14870 47629 47973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 47970 48293 gene locus_tag LOCUS_14880 47970 48293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 48786 48322 gene locus_tag LOCUS_14890 48786 48322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 48889 49581 gene locus_tag LOCUS_14900 48889 49581 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_14900 49578 50861 gene locus_tag LOCUS_14910 49578 50861 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027197.1 protein_id gnl|my_center|LOCUS_14910 50933 51430 gene locus_tag LOCUS_14920 50933 51430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 51773 52351 gene locus_tag LOCUS_14930 51773 52351 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221471091.1 protein_id gnl|my_center|LOCUS_14930 53229 52459 gene locus_tag LOCUS_14940 53229 52459 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908659.1 protein_id gnl|my_center|LOCUS_14940 54388 53357 gene locus_tag LOCUS_14950 54388 53357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 55563 54385 gene locus_tag LOCUS_14960 55563 54385 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257619.1 protein_id gnl|my_center|LOCUS_14960 56861 55560 gene locus_tag LOCUS_14970 56861 55560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 57642 56929 gene locus_tag LOCUS_14980 gene kynA 57642 56929 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661971.1 protein_id gnl|my_center|LOCUS_14980 57935 58876 gene locus_tag LOCUS_14990 57935 58876 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729742.1 protein_id gnl|my_center|LOCUS_14990 59710 58931 gene locus_tag LOCUS_15000 59710 58931 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027577.1 protein_id gnl|my_center|LOCUS_15000 59788 62589 gene locus_tag LOCUS_15010 59788 62589 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226708.1 protein_id gnl|my_center|LOCUS_15010 63541 62642 gene locus_tag LOCUS_15020 63541 62642 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_15020 64401 63787 gene locus_tag LOCUS_15030 64401 63787 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974777.1 protein_id gnl|my_center|LOCUS_15030 64539 65402 gene locus_tag LOCUS_15040 64539 65402 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230013.1 protein_id gnl|my_center|LOCUS_15040 66290 65538 gene locus_tag LOCUS_15050 66290 65538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 66522 67637 gene locus_tag LOCUS_15060 66522 67637 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_15060 67634 68776 gene locus_tag LOCUS_15070 67634 68776 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230156.1 protein_id gnl|my_center|LOCUS_15070 68786 69010 gene locus_tag LOCUS_15080 68786 69010 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_15080 69037 69540 gene locus_tag LOCUS_15090 69037 69540 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_15090 70069 69473 gene locus_tag LOCUS_15100 70069 69473 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229706.1 protein_id gnl|my_center|LOCUS_15100 71724 70180 gene locus_tag LOCUS_15110 gene rox 71724 70180 CDS product rifampin monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223527.1 protein_id gnl|my_center|LOCUS_15110 72119 72313 gene locus_tag LOCUS_15120 72119 72313 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226939.1 protein_id gnl|my_center|LOCUS_15120 73189 72398 gene locus_tag LOCUS_15130 73189 72398 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030683.1 protein_id gnl|my_center|LOCUS_15130 73724 74596 gene locus_tag LOCUS_15140 73724 74596 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027927.1 protein_id gnl|my_center|LOCUS_15140 76181 74775 gene locus_tag LOCUS_15150 76181 74775 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742083.1 protein_id gnl|my_center|LOCUS_15150 76325 77386 gene locus_tag LOCUS_15160 gene kdd 76325 77386 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_15160 77392 78978 gene locus_tag LOCUS_15170 77392 78978 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866976.1 protein_id gnl|my_center|LOCUS_15170 78975 80612 gene locus_tag LOCUS_15180 78975 80612 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_15180 80609 81361 gene locus_tag LOCUS_15190 80609 81361 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_15190 81358 81750 gene locus_tag LOCUS_15200 81358 81750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 81747 83084 gene locus_tag LOCUS_15210 gene glmL 81747 83084 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945203.1 protein_id gnl|my_center|LOCUS_15210 83545 85152 gene locus_tag LOCUS_15220 gene lnt 83545 85152 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226566.1 protein_id gnl|my_center|LOCUS_15220 85193 85999 gene locus_tag LOCUS_15230 85193 85999 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_15230 86075 86596 gene locus_tag LOCUS_15240 86075 86596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 87024 86683 gene locus_tag LOCUS_15250 87024 86683 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081521.1 protein_id gnl|my_center|LOCUS_15250 87271 88752 gene locus_tag LOCUS_15260 87271 88752 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975747.1 protein_id gnl|my_center|LOCUS_15260 89910 88768 gene locus_tag LOCUS_15270 89910 88768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 91297 89948 gene locus_tag LOCUS_15280 91297 89948 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226840.1 protein_id gnl|my_center|LOCUS_15280 91358 92014 gene locus_tag LOCUS_15290 91358 92014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 92011 93393 gene locus_tag LOCUS_15300 92011 93393 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971674.1 protein_id gnl|my_center|LOCUS_15300 93390 94214 gene locus_tag LOCUS_15310 93390 94214 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_15310 94237 94914 gene locus_tag LOCUS_15320 94237 94914 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870827.1 protein_id gnl|my_center|LOCUS_15320 95104 95571 gene locus_tag LOCUS_15330 95104 95571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 96794 95619 gene locus_tag LOCUS_15340 96794 95619 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202991912.1 protein_id gnl|my_center|LOCUS_15340 97447 96965 gene locus_tag LOCUS_15350 97447 96965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 97994 97629 gene locus_tag LOCUS_15360 97994 97629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 98093 99016 gene locus_tag LOCUS_15370 98093 99016 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729360.1 protein_id gnl|my_center|LOCUS_15370 99006 100406 gene locus_tag LOCUS_15380 99006 100406 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029898.1 protein_id gnl|my_center|LOCUS_15380 100479 101045 gene locus_tag LOCUS_15390 100479 101045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 103458 101113 gene locus_tag LOCUS_15400 103458 101113 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226876.1 protein_id gnl|my_center|LOCUS_15400 104983 103559 gene locus_tag LOCUS_15410 gene rox 104983 103559 CDS product rifampin monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877344.1 protein_id gnl|my_center|LOCUS_15410 105308 106222 gene locus_tag LOCUS_15420 105308 106222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 106699 106391 gene locus_tag LOCUS_15430 106699 106391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 107247 106696 gene locus_tag LOCUS_15440 107247 106696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 107743 108327 gene locus_tag LOCUS_15450 gene lexA 107743 108327 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225332.1 protein_id gnl|my_center|LOCUS_15450 108882 108376 gene locus_tag LOCUS_15460 108882 108376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 109702 108974 gene locus_tag LOCUS_15470 109702 108974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 109812 110378 gene locus_tag LOCUS_15480 109812 110378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 110539 111297 gene locus_tag LOCUS_15490 110539 111297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 111294 113351 gene locus_tag LOCUS_15500 111294 113351 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079184950.1 protein_id gnl|my_center|LOCUS_15500 113348 114394 gene locus_tag LOCUS_15510 113348 114394 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104311.1 protein_id gnl|my_center|LOCUS_15510 114391 115323 gene locus_tag LOCUS_15520 114391 115323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 116988 116311 gene locus_tag LOCUS_15530 116988 116311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 117572 116985 gene locus_tag LOCUS_15540 117572 116985 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977103.1 protein_id gnl|my_center|LOCUS_15540 117988 118539 gene locus_tag LOCUS_15550 117988 118539 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088057164.1 protein_id gnl|my_center|LOCUS_15550 119955 118573 gene locus_tag LOCUS_15560 119955 118573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 120476 119952 gene locus_tag LOCUS_15570 120476 119952 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089004579.1 protein_id gnl|my_center|LOCUS_15570 121132 120650 gene locus_tag LOCUS_15580 121132 120650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 122660 121032 gene locus_tag LOCUS_15590 122660 121032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206056.1 protein_id gnl|my_center|LOCUS_15590 123564 122677 gene locus_tag LOCUS_15600 123564 122677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 123446 123733 gene locus_tag LOCUS_15610 123446 123733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 124358 123711 gene locus_tag LOCUS_15620 124358 123711 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028204.1 protein_id gnl|my_center|LOCUS_15620 125602 124346 gene locus_tag LOCUS_15630 125602 124346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 125754 126194 gene locus_tag LOCUS_15640 125754 126194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 128466 126448 gene locus_tag LOCUS_15650 128466 126448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15650 128646 128473 gene locus_tag LOCUS_15660 128646 128473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 129079 128690 gene locus_tag LOCUS_15670 129079 128690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 129374 129072 gene locus_tag LOCUS_15680 129374 129072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 130757 129672 gene locus_tag LOCUS_15690 130757 129672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 131098 130757 gene locus_tag LOCUS_15700 131098 130757 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141202.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence07 <1 522 gene locus_tag LOCUS_15710 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228562.1:helix-turn-helix transcriptional regulator 525 764 gene locus_tag LOCUS_15720 525 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2199 967 gene locus_tag LOCUS_15730 2199 967 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_15730 2888 2196 gene locus_tag LOCUS_15740 2888 2196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230191.1 protein_id gnl|my_center|LOCUS_15740 4027 2885 gene locus_tag LOCUS_15750 4027 2885 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225401.1 protein_id gnl|my_center|LOCUS_15750 4578 4024 gene locus_tag LOCUS_15760 4578 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 5993 4725 gene locus_tag LOCUS_15770 5993 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 6535 5990 gene locus_tag LOCUS_15780 6535 5990 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230782.1 protein_id gnl|my_center|LOCUS_15780 7561 6725 gene locus_tag LOCUS_15790 7561 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 7821 8135 gene locus_tag LOCUS_15800 7821 8135 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043782036.1 protein_id gnl|my_center|LOCUS_15800 8160 9176 gene locus_tag LOCUS_15810 8160 9176 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225780.1 protein_id gnl|my_center|LOCUS_15810 9689 9111 gene locus_tag LOCUS_15820 9689 9111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 9887 11797 gene locus_tag LOCUS_15830 9887 11797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 12455 11859 gene locus_tag LOCUS_15840 12455 11859 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223589.1 protein_id gnl|my_center|LOCUS_15840 12542 13417 gene locus_tag LOCUS_15850 12542 13417 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030042.1 protein_id gnl|my_center|LOCUS_15850 13971 13498 gene locus_tag LOCUS_15860 13971 13498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 13913 14605 gene locus_tag LOCUS_15870 13913 14605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 15769 15125 gene locus_tag LOCUS_15880 15769 15125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 16002 15763 gene locus_tag LOCUS_15890 16002 15763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 16229 15999 gene locus_tag LOCUS_15900 16229 15999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 16126 17415 gene locus_tag LOCUS_15910 16126 17415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 18592 17528 gene locus_tag LOCUS_15920 18592 17528 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 protein_id gnl|my_center|LOCUS_15920 19863 18598 gene locus_tag LOCUS_15930 19863 18598 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897679.1 protein_id gnl|my_center|LOCUS_15930 20110 20898 gene locus_tag LOCUS_15940 20110 20898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 20984 21535 gene locus_tag LOCUS_15950 20984 21535 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382970.1 protein_id gnl|my_center|LOCUS_15950 21876 23633 gene locus_tag LOCUS_15960 gene leuA 21876 23633 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 protein_id gnl|my_center|LOCUS_15960 25156 23669 gene locus_tag LOCUS_15970 25156 23669 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_15970 25289 25936 gene locus_tag LOCUS_15980 25289 25936 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222232.1 protein_id gnl|my_center|LOCUS_15980 25918 26349 gene locus_tag LOCUS_15990 25918 26349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 27517 26399 gene locus_tag LOCUS_16000 27517 26399 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230613.1 protein_id gnl|my_center|LOCUS_16000 28635 27514 gene locus_tag LOCUS_16010 28635 27514 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230614.1 protein_id gnl|my_center|LOCUS_16010 29720 28758 gene locus_tag LOCUS_16020 29720 28758 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230615.1 protein_id gnl|my_center|LOCUS_16020 30721 29717 gene locus_tag LOCUS_16030 30721 29717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230616.1 protein_id gnl|my_center|LOCUS_16030 32464 30800 gene locus_tag LOCUS_16040 32464 30800 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230617.1 protein_id gnl|my_center|LOCUS_16040 33386 32793 gene locus_tag LOCUS_16050 gene recR 33386 32793 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_16050 33731 33399 gene locus_tag LOCUS_16060 33731 33399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 36259 33818 gene locus_tag LOCUS_16070 36259 33818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 36539 36626 gene locus_tag LOCUS_t00140 36539 36626 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 37431 36898 gene locus_tag LOCUS_16080 37431 36898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 37312 38427 gene locus_tag LOCUS_16090 37312 38427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 38453 38965 gene locus_tag LOCUS_16100 38453 38965 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230489.1 protein_id gnl|my_center|LOCUS_16100 38976 39590 gene locus_tag LOCUS_16110 38976 39590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 39587 40147 gene locus_tag LOCUS_16120 39587 40147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 40228 42327 gene locus_tag LOCUS_16130 40228 42327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 42524 43042 gene locus_tag LOCUS_16140 42524 43042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223938.1 protein_id gnl|my_center|LOCUS_16140 43119 43967 gene locus_tag LOCUS_16150 43119 43967 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223937.1 protein_id gnl|my_center|LOCUS_16150 43993 44949 gene locus_tag LOCUS_16160 43993 44949 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221977.1 protein_id gnl|my_center|LOCUS_16160 44946 45737 gene locus_tag LOCUS_16170 44946 45737 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974578.1 protein_id gnl|my_center|LOCUS_16170 45951 45862 gene locus_tag LOCUS_t00150 45951 45862 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 46027 46734 gene locus_tag LOCUS_16180 gene deoD 46027 46734 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110703.1 protein_id gnl|my_center|LOCUS_16180 47525 46842 gene locus_tag LOCUS_16190 47525 46842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 48039 47515 gene locus_tag LOCUS_16200 48039 47515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 48372 48169 gene locus_tag LOCUS_16210 48372 48169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 48837 48448 gene locus_tag LOCUS_16220 48837 48448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 48969 49739 gene locus_tag LOCUS_16230 48969 49739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 49949 52849 gene locus_tag LOCUS_16240 49949 52849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 52920 53984 gene locus_tag LOCUS_16250 52920 53984 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869314.1 protein_id gnl|my_center|LOCUS_16250 55025 53985 gene locus_tag LOCUS_16260 55025 53985 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226734.1 protein_id gnl|my_center|LOCUS_16260 55076 55675 gene locus_tag LOCUS_16270 55076 55675 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230158.1 protein_id gnl|my_center|LOCUS_16270 55728 57398 gene locus_tag LOCUS_16280 55728 57398 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742099.1 protein_id gnl|my_center|LOCUS_16280 59042 57546 gene locus_tag LOCUS_16290 59042 57546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 59723 59121 gene locus_tag LOCUS_16300 59723 59121 CDS product DUF6230 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030235.1 protein_id gnl|my_center|LOCUS_16300 61054 60110 gene locus_tag LOCUS_16310 gene nudC 61054 60110 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338430.1 protein_id gnl|my_center|LOCUS_16310 61250 63052 gene locus_tag LOCUS_16320 61250 63052 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 protein_id gnl|my_center|LOCUS_16320 63778 63146 gene locus_tag LOCUS_16330 63778 63146 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973533.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence08 1723 521 gene locus_tag LOCUS_16340 1723 521 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026832.1 protein_id gnl|my_center|LOCUS_16340 1820 2425 gene locus_tag LOCUS_16350 1820 2425 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097992.1 protein_id gnl|my_center|LOCUS_16350 2479 3630 gene locus_tag LOCUS_16360 2479 3630 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124712897.1 protein_id gnl|my_center|LOCUS_16360 4213 4794 gene locus_tag LOCUS_16370 4213 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 6271 5492 gene locus_tag LOCUS_16380 6271 5492 CDS product IS5/IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028796838.1 protein_id gnl|my_center|LOCUS_16380 6580 6377 gene locus_tag LOCUS_16390 6580 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 6498 6701 gene locus_tag LOCUS_16400 6498 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 8656 7130 gene locus_tag LOCUS_16410 8656 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 8715 8999 gene locus_tag LOCUS_16420 8715 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16420 8996 9313 gene locus_tag LOCUS_16430 8996 9313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16430 9325 10296 gene locus_tag LOCUS_16440 9325 10296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 10732 10944 gene locus_tag LOCUS_16450 10732 10944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 11122 11048 gene locus_tag LOCUS_t00160 11122 11048 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12719 11316 gene locus_tag LOCUS_16460 gene der 12719 11316 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467391.1 protein_id gnl|my_center|LOCUS_16460 13396 12716 gene locus_tag LOCUS_16470 gene cmk 13396 12716 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729300.1 protein_id gnl|my_center|LOCUS_16470 14351 13581 gene locus_tag LOCUS_16480 14351 13581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16480 15333 14338 gene locus_tag LOCUS_16490 15333 14338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 16361 15330 gene locus_tag LOCUS_16500 16361 15330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 17355 16432 gene locus_tag LOCUS_16510 17355 16432 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_16510 18506 17577 gene locus_tag LOCUS_16520 gene xerD 18506 17577 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 protein_id gnl|my_center|LOCUS_16520 18175 18086 gene locus_tag LOCUS_t00170 18175 18086 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19696 18581 gene locus_tag LOCUS_16530 gene ald 19696 18581 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_16530 19985 20236 gene locus_tag LOCUS_16540 19985 20236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 20977 20372 gene locus_tag LOCUS_16550 20977 20372 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895191.1 protein_id gnl|my_center|LOCUS_16550 22737 20974 gene locus_tag LOCUS_16560 22737 20974 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063606961.1 protein_id gnl|my_center|LOCUS_16560 25228 22889 gene locus_tag LOCUS_16570 25228 22889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 26430 25228 gene locus_tag LOCUS_16580 26430 25228 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666770.1 protein_id gnl|my_center|LOCUS_16580 28138 26441 gene locus_tag LOCUS_16590 28138 26441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 28988 28140 gene locus_tag LOCUS_16600 28988 28140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 30009 29074 gene locus_tag LOCUS_16610 30009 29074 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227815.1 protein_id gnl|my_center|LOCUS_16610 31215 30037 gene locus_tag LOCUS_16620 gene steA 31215 30037 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_16620 33090 31336 gene locus_tag LOCUS_16630 gene recN 33090 31336 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_16630 33184 34167 gene locus_tag LOCUS_16640 33184 34167 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027112.1 protein_id gnl|my_center|LOCUS_16640 37942 34220 gene locus_tag LOCUS_16650 37942 34220 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027111.1 protein_id gnl|my_center|LOCUS_16650 39067 38183 gene locus_tag LOCUS_16660 39067 38183 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_16660 40001 39120 gene locus_tag LOCUS_16670 40001 39120 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079310.1 protein_id gnl|my_center|LOCUS_16670 40245 40021 gene locus_tag LOCUS_16680 40245 40021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 40882 40274 gene locus_tag LOCUS_16690 40882 40274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 40995 41333 gene locus_tag LOCUS_16700 40995 41333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977038.1 protein_id gnl|my_center|LOCUS_16700 42443 41421 gene locus_tag LOCUS_16710 42443 41421 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227824.1 protein_id gnl|my_center|LOCUS_16710 43402 42440 gene locus_tag LOCUS_16720 43402 42440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 43635 44404 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccctcacggcggtcaccgccacggaagccaccctc 44911 44803 gene locus_tag LOCUS_r00030 44911 44803 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence09 467 315 gene locus_tag LOCUS_16730 467 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 676 1203 gene locus_tag LOCUS_16740 676 1203 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226688.1 protein_id gnl|my_center|LOCUS_16740 1272 1826 gene locus_tag LOCUS_16750 1272 1826 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226688.1 protein_id gnl|my_center|LOCUS_16750 1881 2435 gene locus_tag LOCUS_16760 1881 2435 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226688.1 protein_id gnl|my_center|LOCUS_16760 4883 2607 gene locus_tag LOCUS_16770 gene katG 4883 2607 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225954.1 protein_id gnl|my_center|LOCUS_16770 5353 4907 gene locus_tag LOCUS_16780 5353 4907 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225955.1 protein_id gnl|my_center|LOCUS_16780 5525 6808 gene locus_tag LOCUS_16790 5525 6808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 6886 7416 gene locus_tag LOCUS_16800 6886 7416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 7927 7478 gene locus_tag LOCUS_16810 7927 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 8341 7943 gene locus_tag LOCUS_16820 8341 7943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 9063 8536 gene locus_tag LOCUS_16830 9063 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 9222 9365 gene locus_tag LOCUS_16840 9222 9365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 10486 9539 gene locus_tag LOCUS_16850 10486 9539 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971541.1 protein_id gnl|my_center|LOCUS_16850 10655 11884 gene locus_tag LOCUS_16860 10655 11884 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222105.1 protein_id gnl|my_center|LOCUS_16860 12269 12859 gene locus_tag LOCUS_16870 12269 12859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 12981 13247 gene locus_tag LOCUS_16880 12981 13247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 13716 18065 gene locus_tag LOCUS_16890 13716 18065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 18062 21295 gene locus_tag LOCUS_16900 18062 21295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 21327 23180 gene locus_tag LOCUS_16910 21327 23180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 23191 27501 gene locus_tag LOCUS_16920 23191 27501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 27513 29378 gene locus_tag LOCUS_16930 27513 29378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 30299 29478 gene locus_tag LOCUS_16940 30299 29478 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404373.1 protein_id gnl|my_center|LOCUS_16940 30453 31379 gene locus_tag LOCUS_16950 30453 31379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 31500 34616 gene locus_tag LOCUS_16960 31500 34616 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170213355.1 protein_id gnl|my_center|LOCUS_16960 35068 34664 gene locus_tag LOCUS_16970 35068 34664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 35625 35302 gene locus_tag LOCUS_16980 35625 35302 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973104.1 protein_id gnl|my_center|LOCUS_16980 36190 36011 gene locus_tag LOCUS_16990 36190 36011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 36544 37128 gene locus_tag LOCUS_17000 36544 37128 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976326.1 protein_id gnl|my_center|LOCUS_17000 37636 37148 gene locus_tag LOCUS_17010 gene soxR 37636 37148 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165476095.1 protein_id gnl|my_center|LOCUS_17010 38773 37679 gene locus_tag LOCUS_17020 38773 37679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 39271 38807 gene locus_tag LOCUS_17030 39271 38807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 39555 39812 gene locus_tag LOCUS_17040 39555 39812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence10 88 279 gene locus_tag LOCUS_17050 88 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 683 243 gene locus_tag LOCUS_17060 683 243 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896379.1 protein_id gnl|my_center|LOCUS_17060 1730 966 gene locus_tag LOCUS_17070 1730 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 3403 2147 gene locus_tag LOCUS_17080 3403 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 4673 3801 gene locus_tag LOCUS_17090 4673 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 4801 6510 gene locus_tag LOCUS_17100 4801 6510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 6726 7523 gene locus_tag LOCUS_17110 6726 7523 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532089.1 protein_id gnl|my_center|LOCUS_17110 7669 8250 gene locus_tag LOCUS_17120 7669 8250 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200072.1 protein_id gnl|my_center|LOCUS_17120 8247 9257 gene locus_tag LOCUS_17130 8247 9257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 9477 10682 gene locus_tag LOCUS_17140 9477 10682 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027422.1 protein_id gnl|my_center|LOCUS_17140 10861 10655 gene locus_tag LOCUS_17150 10861 10655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 10988 11509 gene locus_tag LOCUS_17160 10988 11509 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224813.1 protein_id gnl|my_center|LOCUS_17160 12451 11564 gene locus_tag LOCUS_17170 12451 11564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 14646 12460 gene locus_tag LOCUS_17180 14646 12460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 14805 18179 gene locus_tag LOCUS_17190 14805 18179 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950658.1 protein_id gnl|my_center|LOCUS_17190 18176 19348 gene locus_tag LOCUS_17200 18176 19348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 19645 19388 gene locus_tag LOCUS_17210 19645 19388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 20149 22236 gene locus_tag LOCUS_17220 20149 22236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 22245 23624 gene locus_tag LOCUS_17230 22245 23624 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929473.1 protein_id gnl|my_center|LOCUS_17230 23621 25036 gene locus_tag LOCUS_17240 23621 25036 CDS product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027856.1 protein_id gnl|my_center|LOCUS_17240 25127 25714 gene locus_tag LOCUS_17250 25127 25714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 25728 26516 gene locus_tag LOCUS_17260 25728 26516 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223631.1 protein_id gnl|my_center|LOCUS_17260 27795 27124 gene locus_tag LOCUS_17270 27795 27124 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230520.1 protein_id gnl|my_center|LOCUS_17270 28035 29270 gene locus_tag LOCUS_17280 28035 29270 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227700.1 protein_id gnl|my_center|LOCUS_17280 29267 29869 gene locus_tag LOCUS_17290 29267 29869 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027345.1 protein_id gnl|my_center|LOCUS_17290 29999 30952 gene locus_tag LOCUS_17300 29999 30952 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_17300 30949 31686 gene locus_tag LOCUS_17310 30949 31686 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223078.1 protein_id gnl|my_center|LOCUS_17310 31692 32930 gene locus_tag LOCUS_17320 31692 32930 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223079.1 protein_id gnl|my_center|LOCUS_17320 33220 33462 gene locus_tag LOCUS_17330 33220 33462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 33462 35132 gene locus_tag LOCUS_17340 33462 35132 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230949.1 protein_id gnl|my_center|LOCUS_17340 35781 35305 gene locus_tag LOCUS_17350 35781 35305 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666375.1 protein_id gnl|my_center|LOCUS_17350 35835 37067 gene locus_tag LOCUS_17360 35835 37067 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138806.1 protein_id gnl|my_center|LOCUS_17360 37941 37153 gene locus_tag LOCUS_17370 37941 37153 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057760.1 protein_id gnl|my_center|LOCUS_17370 38463 38654 gene locus_tag LOCUS_17380 38463 38654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence11 830 2794 gene locus_tag LOCUS_17390 830 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 5433 2866 gene locus_tag LOCUS_17400 5433 2866 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120729314.1 protein_id gnl|my_center|LOCUS_17400 5961 5656 gene locus_tag LOCUS_17410 5961 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 6939 9629 gene locus_tag LOCUS_17420 6939 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 9732 10571 gene locus_tag LOCUS_17430 9732 10571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 11220 10939 gene locus_tag LOCUS_17440 11220 10939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 12365 11217 gene locus_tag LOCUS_17450 12365 11217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 13248 12373 gene locus_tag LOCUS_17460 13248 12373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 13859 13245 gene locus_tag LOCUS_17470 13859 13245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 14029 13868 gene locus_tag LOCUS_17480 14029 13868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 14477 14881 gene locus_tag LOCUS_17490 14477 14881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 14878 16269 gene locus_tag LOCUS_17500 14878 16269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 16569 16730 gene locus_tag LOCUS_17510 16569 16730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 21021 16765 gene locus_tag LOCUS_17520 21021 16765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 19113 19192 gene locus_tag LOCUS_t00180 19113 19192 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21875 22117 gene locus_tag LOCUS_17530 21875 22117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 22196 22636 gene locus_tag LOCUS_17540 22196 22636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 23848 22724 gene locus_tag LOCUS_17550 23848 22724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 24174 23872 gene locus_tag LOCUS_17560 24174 23872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 24452 24108 gene locus_tag LOCUS_17570 24452 24108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 26181 24619 gene locus_tag LOCUS_17580 26181 24619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 25023 25032 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26302 26766 gene locus_tag LOCUS_17590 26302 26766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 28526 27345 gene locus_tag LOCUS_17600 28526 27345 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256649.1 protein_id gnl|my_center|LOCUS_17600 28798 28613 gene locus_tag LOCUS_17610 28798 28613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 29714 29526 gene locus_tag LOCUS_17620 29714 29526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 29969 30979 gene locus_tag LOCUS_17630 29969 30979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 31919 31122 gene locus_tag LOCUS_17640 31919 31122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 32623 31949 gene locus_tag LOCUS_17650 32623 31949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17650 32861 32550 gene locus_tag LOCUS_17660 32861 32550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17660 >Feature sequence12 611 838 gene locus_tag LOCUS_17670 611 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 1713 916 gene locus_tag LOCUS_17680 1713 916 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194407.1 protein_id gnl|my_center|LOCUS_17680 3115 1811 gene locus_tag LOCUS_17690 gene clpX 3115 1811 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_17690 3986 3324 gene locus_tag LOCUS_17700 3986 3324 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228511.1 protein_id gnl|my_center|LOCUS_17700 4642 4001 gene locus_tag LOCUS_17710 4642 4001 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115412275.1 protein_id gnl|my_center|LOCUS_17710 6165 4813 gene locus_tag LOCUS_17720 gene tig 6165 4813 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228513.1 protein_id gnl|my_center|LOCUS_17720 6382 6308 gene locus_tag LOCUS_t00190 6382 6308 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6834 6907 gene locus_tag LOCUS_t00200 6834 6907 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7599 8066 gene locus_tag LOCUS_17730 7599 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 8342 8743 gene locus_tag LOCUS_17740 8342 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 8769 9737 gene locus_tag LOCUS_17750 8769 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 11294 9831 gene locus_tag LOCUS_17760 11294 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 15829 11306 gene locus_tag LOCUS_17770 15829 11306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 16075 16557 gene locus_tag LOCUS_17780 16075 16557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 16652 19429 gene locus_tag LOCUS_17790 16652 19429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 21397 19517 gene locus_tag LOCUS_17800 21397 19517 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896800.1 protein_id gnl|my_center|LOCUS_17800 22244 21687 gene locus_tag LOCUS_17810 22244 21687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 22355 23587 gene locus_tag LOCUS_17820 22355 23587 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106275831.1 protein_id gnl|my_center|LOCUS_17820 23654 23974 gene locus_tag LOCUS_17830 23654 23974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 24472 23996 gene locus_tag LOCUS_17840 24472 23996 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467526.1 protein_id gnl|my_center|LOCUS_17840 25783 24584 gene locus_tag LOCUS_17850 25783 24584 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225994.1 protein_id gnl|my_center|LOCUS_17850 26091 25795 gene locus_tag LOCUS_17860 26091 25795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 26856 26233 gene locus_tag LOCUS_17870 26856 26233 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_17870 27070 29631 gene locus_tag LOCUS_17880 gene pepN 27070 29631 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228585.1 protein_id gnl|my_center|LOCUS_17880 29660 29875 gene locus_tag LOCUS_17890 29660 29875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 30365 29973 gene locus_tag LOCUS_17900 30365 29973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 30669 30367 gene locus_tag LOCUS_17910 30669 30367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 31319 30891 gene locus_tag LOCUS_17920 31319 30891 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911071.1 protein_id gnl|my_center|LOCUS_17920 31534 31316 gene locus_tag LOCUS_17930 31534 31316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 32589 31564 gene locus_tag LOCUS_17940 32589 31564 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_17940 33113 32589 gene locus_tag LOCUS_17950 33113 32589 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_17950 33538 33110 gene locus_tag LOCUS_17960 33538 33110 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174212.1 protein_id gnl|my_center|LOCUS_17960 34376 33603 gene locus_tag LOCUS_17970 34376 33603 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742177.1 protein_id gnl|my_center|LOCUS_17970 35446 34373 gene locus_tag LOCUS_17980 gene dmpG 35446 34373 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112330.1 protein_id gnl|my_center|LOCUS_17980 36414 35443 gene locus_tag LOCUS_17990 36414 35443 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729593.1 protein_id gnl|my_center|LOCUS_17990 37205 36411 gene locus_tag LOCUS_18000 gene mhpD 37205 36411 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160712.1 protein_id gnl|my_center|LOCUS_18000 38769 37261 gene locus_tag LOCUS_18010 38769 37261 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_18010 40103 38760 gene locus_tag LOCUS_18020 40103 38760 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036736.1 protein_id gnl|my_center|LOCUS_18020 41440 40100 gene locus_tag LOCUS_18030 gene kynU 41440 40100 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057429.1 protein_id gnl|my_center|LOCUS_18030 42318 41416 gene locus_tag LOCUS_18040 42318 41416 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029139.1 protein_id gnl|my_center|LOCUS_18040 42465 42917 gene locus_tag LOCUS_18050 42465 42917 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222590.1 protein_id gnl|my_center|LOCUS_18050 43055 43579 gene locus_tag LOCUS_18060 43055 43579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 43590 44429 gene locus_tag LOCUS_18070 43590 44429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 45058 44516 gene locus_tag LOCUS_18080 45058 44516 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028487.1 protein_id gnl|my_center|LOCUS_18080 45581 45913 gene locus_tag LOCUS_18090 45581 45913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 46210 46806 gene locus_tag LOCUS_18100 46210 46806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 47304 46792 gene locus_tag LOCUS_18110 47304 46792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203084.1 protein_id gnl|my_center|LOCUS_18110 47900 47649 gene locus_tag LOCUS_18120 47900 47649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 47782 48849 gene locus_tag LOCUS_18130 47782 48849 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228591.1 protein_id gnl|my_center|LOCUS_18130 49099 50478 gene locus_tag LOCUS_18140 49099 50478 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230812.1 protein_id gnl|my_center|LOCUS_18140 50559 50981 gene locus_tag LOCUS_18150 50559 50981 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_18150 51551 51111 gene locus_tag LOCUS_18160 51551 51111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 52684 51827 gene locus_tag LOCUS_18170 52684 51827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 53139 52681 gene locus_tag LOCUS_18180 53139 52681 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028505.1 protein_id gnl|my_center|LOCUS_18180 54808 53132 gene locus_tag LOCUS_18190 gene ettA 54808 53132 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412708.1 protein_id gnl|my_center|LOCUS_18190 55267 56667 gene locus_tag LOCUS_18200 55267 56667 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230392.1 protein_id gnl|my_center|LOCUS_18200 56664 59270 gene locus_tag LOCUS_18210 gene otsB 56664 59270 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230393.1 protein_id gnl|my_center|LOCUS_18210 59470 60024 gene locus_tag LOCUS_18220 59470 60024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 61382 60117 gene locus_tag LOCUS_18230 gene cobA 61382 60117 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226827.1 protein_id gnl|my_center|LOCUS_18230 62485 61379 gene locus_tag LOCUS_18240 62485 61379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 63567 62485 gene locus_tag LOCUS_18250 gene cobC 63567 62485 CDS product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897661.1 protein_id gnl|my_center|LOCUS_18250 63773 65833 gene locus_tag LOCUS_18260 63773 65833 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091319019.1 protein_id gnl|my_center|LOCUS_18260 65939 66760 gene locus_tag LOCUS_18270 65939 66760 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872966.1 protein_id gnl|my_center|LOCUS_18270 67203 66928 gene locus_tag LOCUS_18280 67203 66928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 67478 67822 gene locus_tag LOCUS_18290 67478 67822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 69467 67887 gene locus_tag LOCUS_18300 69467 67887 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877353.1 protein_id gnl|my_center|LOCUS_18300 69786 69598 gene locus_tag LOCUS_18310 69786 69598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 71234 69882 gene locus_tag LOCUS_18320 71234 69882 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412946.1 protein_id gnl|my_center|LOCUS_18320 71978 71298 gene locus_tag LOCUS_18330 71978 71298 CDS product 4-amino-4-deoxychorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296643.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18330 72053 72469 gene locus_tag LOCUS_18340 72053 72469 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973252.1 protein_id gnl|my_center|LOCUS_18340 73555 72494 gene locus_tag LOCUS_18350 73555 72494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 74845 73565 gene locus_tag LOCUS_18360 74845 73565 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951710.1 protein_id gnl|my_center|LOCUS_18360 75629 74964 gene locus_tag LOCUS_18370 75629 74964 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227485.1 protein_id gnl|my_center|LOCUS_18370 75700 76575 gene locus_tag LOCUS_18380 75700 76575 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229089.1 protein_id gnl|my_center|LOCUS_18380 77438 76683 gene locus_tag LOCUS_18390 77438 76683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 77969 77535 gene locus_tag LOCUS_18400 77969 77535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 78638 78198 gene locus_tag LOCUS_18410 78638 78198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 78745 78954 gene locus_tag LOCUS_18420 78745 78954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 78951 79265 gene locus_tag LOCUS_18430 78951 79265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 79555 79316 gene locus_tag LOCUS_18440 79555 79316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 81822 79666 gene locus_tag LOCUS_18450 81822 79666 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230500.1 protein_id gnl|my_center|LOCUS_18450 82107 81883 gene locus_tag LOCUS_18460 82107 81883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 82358 82194 gene locus_tag LOCUS_18470 82358 82194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 82614 82444 gene locus_tag LOCUS_18480 82614 82444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 82772 82614 gene locus_tag LOCUS_18490 82772 82614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 83926 82769 gene locus_tag LOCUS_18500 83926 82769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 84153 83923 gene locus_tag LOCUS_18510 84153 83923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 84281 84150 gene locus_tag LOCUS_18520 84281 84150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 84432 84283 gene locus_tag LOCUS_18530 84432 84283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 85196 84486 gene locus_tag LOCUS_18540 85196 84486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 85311 85538 gene locus_tag LOCUS_18550 85311 85538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 85823 85620 gene locus_tag LOCUS_18560 85823 85620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 85928 86131 gene locus_tag LOCUS_18570 85928 86131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 86184 86375 gene locus_tag LOCUS_18580 86184 86375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 86903 86442 gene locus_tag LOCUS_18590 86903 86442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 87693 86890 gene locus_tag LOCUS_18600 87693 86890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 88219 88010 gene locus_tag LOCUS_18610 88219 88010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 88193 88501 gene locus_tag LOCUS_18620 88193 88501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 88793 88551 gene locus_tag LOCUS_18630 88793 88551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 88823 89032 gene locus_tag LOCUS_18640 88823 89032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 89390 89034 gene locus_tag LOCUS_18650 89390 89034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 89758 89387 gene locus_tag LOCUS_18660 89758 89387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 90691 89810 gene locus_tag LOCUS_18670 90691 89810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 90766 91212 gene locus_tag LOCUS_18680 90766 91212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 91970 91209 gene locus_tag LOCUS_18690 91970 91209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 93115 91970 gene locus_tag LOCUS_18700 93115 91970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 94197 93112 gene locus_tag LOCUS_18710 94197 93112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 95047 94208 gene locus_tag LOCUS_18720 95047 94208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 97152 95047 gene locus_tag LOCUS_18730 97152 95047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 97635 97156 gene locus_tag LOCUS_18740 97635 97156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 98096 97518 gene locus_tag LOCUS_18750 98096 97518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 98602 98093 gene locus_tag LOCUS_18760 98602 98093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 98862 98599 gene locus_tag LOCUS_18770 98862 98599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 99295 98888 gene locus_tag LOCUS_18780 99295 98888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 99710 99372 gene locus_tag LOCUS_18790 99710 99372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 100162 99767 gene locus_tag LOCUS_18800 100162 99767 CDS product DUF6093 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813058.1 protein_id gnl|my_center|LOCUS_18800 101311 100172 gene locus_tag LOCUS_18810 101311 100172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 102257 101328 gene locus_tag LOCUS_18820 102257 101328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 102685 102260 gene locus_tag LOCUS_18830 102685 102260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 103083 102682 gene locus_tag LOCUS_18840 103083 102682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 103541 103149 gene locus_tag LOCUS_18850 103541 103149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 104575 103538 gene locus_tag LOCUS_18860 104575 103538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 104981 104592 gene locus_tag LOCUS_18870 104981 104592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 105731 104994 gene locus_tag LOCUS_18880 105731 104994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 106216 105770 gene locus_tag LOCUS_18890 106216 105770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 106848 106099 gene locus_tag LOCUS_18900 106848 106099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 108277 106832 gene locus_tag LOCUS_18910 108277 106832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 109963 108281 gene locus_tag LOCUS_18920 109963 108281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 110435 109947 gene locus_tag LOCUS_18930 110435 109947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 110871 110599 gene locus_tag LOCUS_18940 110871 110599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 111218 110868 gene locus_tag LOCUS_18950 111218 110868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 111603 111385 gene locus_tag LOCUS_18960 111603 111385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 112586 111600 gene locus_tag LOCUS_18970 112586 111600 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920842.1 protein_id gnl|my_center|LOCUS_18970 113130 112756 gene locus_tag LOCUS_18980 113130 112756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227944.1 protein_id gnl|my_center|LOCUS_18980 114054 113365 gene locus_tag LOCUS_18990 114054 113365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 114707 114051 gene locus_tag LOCUS_19000 114707 114051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 114942 114724 gene locus_tag LOCUS_19010 114942 114724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 115192 115016 gene locus_tag LOCUS_19020 115192 115016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 116725 115196 gene locus_tag LOCUS_19030 116725 115196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 117124 116741 gene locus_tag LOCUS_19040 117124 116741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 117456 117124 gene locus_tag LOCUS_19050 117456 117124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 117812 117456 gene locus_tag LOCUS_19060 117812 117456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 120631 117809 gene locus_tag LOCUS_19070 120631 117809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 121311 120736 gene locus_tag LOCUS_19080 121311 120736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 122387 121380 gene locus_tag LOCUS_19090 122387 121380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 122533 122384 gene locus_tag LOCUS_19100 122533 122384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 122757 122530 gene locus_tag LOCUS_19110 122757 122530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 123074 122700 gene locus_tag LOCUS_19120 123074 122700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 123412 123071 gene locus_tag LOCUS_19130 123412 123071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 124407 123409 gene locus_tag LOCUS_19140 124407 123409 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112685.1 protein_id gnl|my_center|LOCUS_19140 124681 124490 gene locus_tag LOCUS_19150 124681 124490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 124961 124683 gene locus_tag LOCUS_19160 124961 124683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 125767 124958 gene locus_tag LOCUS_19170 125767 124958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 126301 125840 gene locus_tag LOCUS_19180 126301 125840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 126647 126444 gene locus_tag LOCUS_19190 126647 126444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 126871 126644 gene locus_tag LOCUS_19200 126871 126644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 127047 127562 gene locus_tag LOCUS_19210 127047 127562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 127562 128989 gene locus_tag LOCUS_19220 127562 128989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 129700 129203 gene locus_tag LOCUS_19230 129700 129203 CDS product FBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978065.1 protein_id gnl|my_center|LOCUS_19230 129775 130392 gene locus_tag LOCUS_19240 129775 130392 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031763.1 protein_id gnl|my_center|LOCUS_19240 130540 130965 gene locus_tag LOCUS_19250 130540 130965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 131074 132120 gene locus_tag LOCUS_19260 131074 132120 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081672.1 protein_id gnl|my_center|LOCUS_19260 132246 132319 gene locus_tag LOCUS_t00210 132246 132319 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 132388 133929 gene locus_tag LOCUS_19270 132388 133929 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072775144.1 protein_id gnl|my_center|LOCUS_19270 134040 135242 gene locus_tag LOCUS_19280 134040 135242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 135354 136388 gene locus_tag LOCUS_19290 135354 136388 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167468068.1 protein_id gnl|my_center|LOCUS_19290 137669 136368 gene locus_tag LOCUS_19300 137669 136368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 137782 138024 gene locus_tag LOCUS_19310 137782 138024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 138264 138028 gene locus_tag LOCUS_19320 138264 138028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 138373 138615 gene locus_tag LOCUS_19330 138373 138615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 138628 138837 gene locus_tag LOCUS_19340 138628 138837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 138834 139625 gene locus_tag LOCUS_19350 138834 139625 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230499.1 protein_id gnl|my_center|LOCUS_19350 139720 140187 gene locus_tag LOCUS_19360 139720 140187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 140151 140405 gene locus_tag LOCUS_19370 140151 140405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 140503 142686 gene locus_tag LOCUS_19380 140503 142686 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230500.1 protein_id gnl|my_center|LOCUS_19380 142834 143073 gene locus_tag LOCUS_19390 142834 143073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 143070 143372 gene locus_tag LOCUS_19400 143070 143372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 143409 145364 gene locus_tag LOCUS_19410 143409 145364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 145764 145489 gene locus_tag LOCUS_19420 145764 145489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 145936 146070 gene locus_tag LOCUS_19430 145936 146070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 146116 146427 gene locus_tag LOCUS_19440 146116 146427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19440 147252 146422 gene locus_tag LOCUS_19450 147252 146422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 147516 147280 gene locus_tag LOCUS_19460 147516 147280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 147790 147527 gene locus_tag LOCUS_19470 147790 147527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 148415 148924 gene locus_tag LOCUS_19480 148415 148924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 149393 149082 gene locus_tag LOCUS_19490 149393 149082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 150349 151497 gene locus_tag LOCUS_19500 150349 151497 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229408.1 protein_id gnl|my_center|LOCUS_19500 152052 151624 gene locus_tag LOCUS_19510 152052 151624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 152649 152170 gene locus_tag LOCUS_19520 152649 152170 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029549.1 protein_id gnl|my_center|LOCUS_19520 152866 153198 gene locus_tag LOCUS_19530 152866 153198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 153266 154066 gene locus_tag LOCUS_19540 153266 154066 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066520.1 protein_id gnl|my_center|LOCUS_19540 154872 154123 gene locus_tag LOCUS_19550 154872 154123 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222170.1 protein_id gnl|my_center|LOCUS_19550 155367 154882 gene locus_tag LOCUS_19560 155367 154882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 155480 156160 gene locus_tag LOCUS_19570 155480 156160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 158316 156256 gene locus_tag LOCUS_19580 158316 156256 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031702.1 protein_id gnl|my_center|LOCUS_19580 158687 158316 gene locus_tag LOCUS_19590 158687 158316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 159289 158873 gene locus_tag LOCUS_19600 159289 158873 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027424.1 protein_id gnl|my_center|LOCUS_19600 159949 159509 gene locus_tag LOCUS_19610 159949 159509 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406060.1 protein_id gnl|my_center|LOCUS_19610 161057 160047 gene locus_tag LOCUS_19620 161057 160047 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028472.1 protein_id gnl|my_center|LOCUS_19620 161314 161069 gene locus_tag LOCUS_19630 161314 161069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 161480 161489 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 162990 161644 gene locus_tag LOCUS_19640 162990 161644 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030488.1 protein_id gnl|my_center|LOCUS_19640 164368 163076 gene locus_tag LOCUS_19650 164368 163076 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_19650 164711 164496 gene locus_tag LOCUS_19660 164711 164496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 165119 166213 gene locus_tag LOCUS_19670 165119 166213 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224332.1 protein_id gnl|my_center|LOCUS_19670 166375 166722 gene locus_tag LOCUS_19680 166375 166722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 166815 167015 gene locus_tag LOCUS_19690 166815 167015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 167736 167122 gene locus_tag LOCUS_19700 167736 167122 CDS product DUF1360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226138.1 protein_id gnl|my_center|LOCUS_19700 168068 167733 gene locus_tag LOCUS_19710 168068 167733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 168394 168068 gene locus_tag LOCUS_19720 168394 168068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 168433 168966 gene locus_tag LOCUS_19730 168433 168966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 169017 169343 gene locus_tag LOCUS_19740 169017 169343 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666291.1 protein_id gnl|my_center|LOCUS_19740 169857 169372 gene locus_tag LOCUS_19750 169857 169372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 170392 171381 gene locus_tag LOCUS_19760 170392 171381 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976680.1 protein_id gnl|my_center|LOCUS_19760 172457 171456 gene locus_tag LOCUS_19770 172457 171456 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975615.1 protein_id gnl|my_center|LOCUS_19770 173859 172906 gene locus_tag LOCUS_19780 173859 172906 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230532.1 protein_id gnl|my_center|LOCUS_19780 174770 173856 gene locus_tag LOCUS_19790 174770 173856 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 protein_id gnl|my_center|LOCUS_19790 175664 174945 gene locus_tag LOCUS_19800 gene tmk 175664 174945 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173647.1 protein_id gnl|my_center|LOCUS_19800 175818 176402 gene locus_tag LOCUS_19810 175818 176402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 176399 176719 gene locus_tag LOCUS_19820 176399 176719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 176733 177506 gene locus_tag LOCUS_19830 176733 177506 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031621.1 protein_id gnl|my_center|LOCUS_19830 177811 177488 gene locus_tag LOCUS_19840 177811 177488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 177777 178304 gene locus_tag LOCUS_19850 177777 178304 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092308.1 protein_id gnl|my_center|LOCUS_19850 178620 179966 gene locus_tag LOCUS_19860 178620 179966 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241336.1 protein_id gnl|my_center|LOCUS_19860 180037 181086 gene locus_tag LOCUS_19870 180037 181086 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127580519.1 protein_id gnl|my_center|LOCUS_19870 181088 182053 gene locus_tag LOCUS_19880 181088 182053 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258586.1 protein_id gnl|my_center|LOCUS_19880 182116 183183 gene locus_tag LOCUS_19890 gene cytR 182116 183183 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481416.1 protein_id gnl|my_center|LOCUS_19890 183213 184940 gene locus_tag LOCUS_19900 183213 184940 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_19900 186401 184977 gene locus_tag LOCUS_19910 186401 184977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 187603 186503 gene locus_tag LOCUS_19920 187603 186503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 189180 187645 gene locus_tag LOCUS_19930 gene xylB 189180 187645 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877620.1 protein_id gnl|my_center|LOCUS_19930 190378 189191 gene locus_tag LOCUS_19940 gene xylA 190378 189191 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730977.1 protein_id gnl|my_center|LOCUS_19940 190350 191684 gene locus_tag LOCUS_19950 190350 191684 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228545.1 protein_id gnl|my_center|LOCUS_19950 192405 191776 gene locus_tag LOCUS_19960 192405 191776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 192505 193635 gene locus_tag LOCUS_19970 192505 193635 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224920.1 protein_id gnl|my_center|LOCUS_19970 195141 193657 gene locus_tag LOCUS_19980 195141 193657 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978484.1 protein_id gnl|my_center|LOCUS_19980 197102 195360 gene locus_tag LOCUS_19990 197102 195360 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742065.1 protein_id gnl|my_center|LOCUS_19990 198326 197289 gene locus_tag LOCUS_20000 198326 197289 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668699.1 protein_id gnl|my_center|LOCUS_20000 199018 198452 gene locus_tag LOCUS_20010 199018 198452 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977427.1 protein_id gnl|my_center|LOCUS_20010 199421 199035 gene locus_tag LOCUS_20020 199421 199035 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977673.1 protein_id gnl|my_center|LOCUS_20020 199833 199411 gene locus_tag LOCUS_20030 199833 199411 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977425.1 protein_id gnl|my_center|LOCUS_20030 202187 199833 gene locus_tag LOCUS_20040 202187 199833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20040 202093 202293 gene locus_tag LOCUS_20050 202093 202293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 203917 202427 gene locus_tag LOCUS_20060 203917 202427 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731142.1 protein_id gnl|my_center|LOCUS_20060 204171 204830 gene locus_tag LOCUS_20070 204171 204830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 204842 205921 gene locus_tag LOCUS_20080 204842 205921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 206417 206043 gene locus_tag LOCUS_20090 206417 206043 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228135.1 protein_id gnl|my_center|LOCUS_20090 206541 207512 gene locus_tag LOCUS_20100 206541 207512 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229677.1 protein_id gnl|my_center|LOCUS_20100 208058 207924 gene locus_tag LOCUS_20110 208058 207924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 208042 208281 gene locus_tag LOCUS_20120 208042 208281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 208677 208285 gene locus_tag LOCUS_20130 208677 208285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 210547 208826 gene locus_tag LOCUS_20140 gene argS 210547 208826 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228472.1 protein_id gnl|my_center|LOCUS_20140 210916 211284 gene locus_tag LOCUS_20150 210916 211284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 213278 211515 gene locus_tag LOCUS_20160 213278 211515 CDS product cellulose 1,4-beta-cellobiosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031002.1 protein_id gnl|my_center|LOCUS_20160 213851 215119 gene locus_tag LOCUS_20170 213851 215119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 215103 215846 gene locus_tag LOCUS_20180 215103 215846 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976324.1 protein_id gnl|my_center|LOCUS_20180 220985 215925 gene locus_tag LOCUS_20190 220985 215925 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_20190 221275 223248 gene locus_tag LOCUS_20200 221275 223248 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804249.1 protein_id gnl|my_center|LOCUS_20200 225268 223880 gene locus_tag LOCUS_20210 225268 223880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 226258 225335 gene locus_tag LOCUS_20220 226258 225335 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223501.1 protein_id gnl|my_center|LOCUS_20220 228179 226491 gene locus_tag LOCUS_20230 228179 226491 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030230.1 protein_id gnl|my_center|LOCUS_20230 228689 228276 gene locus_tag LOCUS_20240 228689 228276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 229781 228777 gene locus_tag LOCUS_20250 gene meaB 229781 228777 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_20250 230965 229778 gene locus_tag LOCUS_20260 230965 229778 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 protein_id gnl|my_center|LOCUS_20260 231021 231524 gene locus_tag LOCUS_20270 gene mce 231021 231524 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223476.1 protein_id gnl|my_center|LOCUS_20270 231873 233228 gene locus_tag LOCUS_20280 gene ccrA 231873 233228 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223473.1 protein_id gnl|my_center|LOCUS_20280 233564 234823 gene locus_tag LOCUS_20290 233564 234823 CDS product cellulose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973600.1 protein_id gnl|my_center|LOCUS_20290 235509 235879 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggaggagtccacccggctcggca 237425 238747 gene locus_tag LOCUS_20300 237425 238747 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225393.1 protein_id gnl|my_center|LOCUS_20300 239611 238811 gene locus_tag LOCUS_20310 239611 238811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 240010 239678 gene locus_tag LOCUS_20320 240010 239678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229480.1 protein_id gnl|my_center|LOCUS_20320 241912 240122 gene locus_tag LOCUS_20330 241912 240122 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229492.1 protein_id gnl|my_center|LOCUS_20330 242551 242129 gene locus_tag LOCUS_20340 242551 242129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 242867 244369 gene locus_tag LOCUS_20350 242867 244369 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_20350 244924 244448 gene locus_tag LOCUS_20360 244924 244448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 244881 245054 gene locus_tag LOCUS_20370 244881 245054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 245179 245796 gene locus_tag LOCUS_20380 245179 245796 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896486.1 protein_id gnl|my_center|LOCUS_20380 246496 245900 gene locus_tag LOCUS_20390 246496 245900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 246977 247951 gene locus_tag LOCUS_20400 246977 247951 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030618.1 protein_id gnl|my_center|LOCUS_20400 248056 248352 gene locus_tag LOCUS_20410 248056 248352 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225091.1 protein_id gnl|my_center|LOCUS_20410 250377 248374 gene locus_tag LOCUS_20420 250377 248374 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840716.1 protein_id gnl|my_center|LOCUS_20420 250484 251329 gene locus_tag LOCUS_20430 250484 251329 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230181.1 protein_id gnl|my_center|LOCUS_20430 251329 252177 gene locus_tag LOCUS_20440 251329 252177 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225489.1 protein_id gnl|my_center|LOCUS_20440 252406 252215 gene locus_tag LOCUS_20450 252406 252215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 252535 253281 gene locus_tag LOCUS_20460 252535 253281 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228118.1 protein_id gnl|my_center|LOCUS_20460 254170 253322 gene locus_tag LOCUS_20470 254170 253322 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030215.1 protein_id gnl|my_center|LOCUS_20470 255702 254266 gene locus_tag LOCUS_20480 gene murA 255702 254266 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084647.1 protein_id gnl|my_center|LOCUS_20480 255701 256273 gene locus_tag LOCUS_20490 255701 256273 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730200.1 protein_id gnl|my_center|LOCUS_20490 256327 256692 gene locus_tag LOCUS_20500 256327 256692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 257291 256836 gene locus_tag LOCUS_20510 257291 256836 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973622.1 protein_id gnl|my_center|LOCUS_20510 257590 257306 gene locus_tag LOCUS_20520 257590 257306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 258844 257705 gene locus_tag LOCUS_20530 258844 257705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 260458 259064 gene locus_tag LOCUS_20540 gene atpD 260458 259064 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896328.1 protein_id gnl|my_center|LOCUS_20540 261444 260515 gene locus_tag LOCUS_20550 261444 260515 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229523.1 protein_id gnl|my_center|LOCUS_20550 263094 261454 gene locus_tag LOCUS_20560 gene atpA 263094 261454 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896330.1 protein_id gnl|my_center|LOCUS_20560 264020 263199 gene locus_tag LOCUS_20570 264020 263199 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_20570 264559 264020 gene locus_tag LOCUS_20580 264559 264020 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229526.1 protein_id gnl|my_center|LOCUS_20580 264826 264590 gene locus_tag LOCUS_20590 gene atpE 264826 264590 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973629.1 protein_id gnl|my_center|LOCUS_20590 265692 264895 gene locus_tag LOCUS_20600 gene atpB 265692 264895 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229528.1 protein_id gnl|my_center|LOCUS_20600 265940 265704 gene locus_tag LOCUS_20610 265940 265704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 266554 266123 gene locus_tag LOCUS_20620 266554 266123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 266696 266547 gene locus_tag LOCUS_20630 266696 266547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 268933 266816 gene locus_tag LOCUS_20640 268933 266816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 269719 269108 gene locus_tag LOCUS_20650 269719 269108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 270364 269720 gene locus_tag LOCUS_20660 270364 269720 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898815.1 protein_id gnl|my_center|LOCUS_20660 271341 270364 gene locus_tag LOCUS_20670 gene prmC 271341 270364 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229533.1 protein_id gnl|my_center|LOCUS_20670 271469 273019 gene locus_tag LOCUS_20680 271469 273019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 274133 273045 gene locus_tag LOCUS_20690 gene prfA 274133 273045 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229537.1 protein_id gnl|my_center|LOCUS_20690 274473 274249 gene locus_tag LOCUS_20700 gene rpmE 274473 274249 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229538.1 protein_id gnl|my_center|LOCUS_20700 274376 274819 gene locus_tag LOCUS_20710 274376 274819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 278406 274900 gene locus_tag LOCUS_20720 278406 274900 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228485.1 protein_id gnl|my_center|LOCUS_20720 280835 278559 gene locus_tag LOCUS_20730 280835 278559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 282076 281132 gene locus_tag LOCUS_20740 gene thrB 282076 281132 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_20740 283433 282195 gene locus_tag LOCUS_20750 283433 282195 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972472.1 protein_id gnl|my_center|LOCUS_20750 284266 283445 gene locus_tag LOCUS_20760 284266 283445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 287707 284426 gene locus_tag LOCUS_20770 287707 284426 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224450.1 protein_id gnl|my_center|LOCUS_20770 288893 287844 gene locus_tag LOCUS_20780 gene thrC 288893 287844 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_20780 290353 289028 gene locus_tag LOCUS_20790 290353 289028 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_20790 291735 290350 gene locus_tag LOCUS_20800 gene lysA 291735 290350 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_20800 293401 291737 gene locus_tag LOCUS_20810 gene argS 293401 291737 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406630.1 protein_id gnl|my_center|LOCUS_20810 293502 294314 gene locus_tag LOCUS_20820 293502 294314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 294340 295002 gene locus_tag LOCUS_20830 294340 295002 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_20830 295299 295913 gene locus_tag LOCUS_20840 295299 295913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 296023 296097 gene locus_tag LOCUS_t00220 296023 296097 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 299558 296184 gene locus_tag LOCUS_20850 299558 296184 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 protein_id gnl|my_center|LOCUS_20850 300850 299558 gene locus_tag LOCUS_20860 300850 299558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 301410 300847 gene locus_tag LOCUS_20870 301410 300847 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223533.1 protein_id gnl|my_center|LOCUS_20870 302255 301560 gene locus_tag LOCUS_20880 302255 301560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20880 302701 302949 gene locus_tag LOCUS_20890 302701 302949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 304604 303135 gene locus_tag LOCUS_20900 304604 303135 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227868.1 protein_id gnl|my_center|LOCUS_20900 304686 305123 gene locus_tag LOCUS_20910 304686 305123 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227867.1 protein_id gnl|my_center|LOCUS_20910 305371 307593 gene locus_tag LOCUS_20920 305371 307593 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804148.1 protein_id gnl|my_center|LOCUS_20920 308288 307494 gene locus_tag LOCUS_20930 308288 307494 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223482.1 protein_id gnl|my_center|LOCUS_20930 308472 308864 gene locus_tag LOCUS_20940 308472 308864 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227867.1 protein_id gnl|my_center|LOCUS_20940 309004 309549 gene locus_tag LOCUS_20950 309004 309549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 309594 311801 gene locus_tag LOCUS_20960 309594 311801 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019547503.1 protein_id gnl|my_center|LOCUS_20960 313114 311858 gene locus_tag LOCUS_20970 313114 311858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 313230 313421 gene locus_tag LOCUS_20980 313230 313421 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226108.1 protein_id gnl|my_center|LOCUS_20980 314338 313433 gene locus_tag LOCUS_20990 314338 313433 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027311.1 protein_id gnl|my_center|LOCUS_20990 314642 315067 gene locus_tag LOCUS_21000 314642 315067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222284.1 protein_id gnl|my_center|LOCUS_21000 315060 315482 gene locus_tag LOCUS_21010 315060 315482 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222283.1 protein_id gnl|my_center|LOCUS_21010 316344 315586 gene locus_tag LOCUS_21020 gene fabG 316344 315586 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_21020 318095 316443 gene locus_tag LOCUS_21030 318095 316443 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083724.1 protein_id gnl|my_center|LOCUS_21030 318226 318873 gene locus_tag LOCUS_21040 318226 318873 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804427.1 protein_id gnl|my_center|LOCUS_21040 319647 318922 gene locus_tag LOCUS_21050 319647 318922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 319894 320565 gene locus_tag LOCUS_21060 319894 320565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21060 322145 320586 gene locus_tag LOCUS_21070 322145 320586 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222228.1 protein_id gnl|my_center|LOCUS_21070 323726 322323 gene locus_tag LOCUS_21080 323726 322323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 324730 323987 gene locus_tag LOCUS_21090 324730 323987 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028619.1 protein_id gnl|my_center|LOCUS_21090 325236 324937 gene locus_tag LOCUS_21100 325236 324937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 325493 326620 gene locus_tag LOCUS_21110 325493 326620 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226144.1 protein_id gnl|my_center|LOCUS_21110 326693 328072 gene locus_tag LOCUS_21120 326693 328072 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030612.1 protein_id gnl|my_center|LOCUS_21120 328157 329578 gene locus_tag LOCUS_21130 328157 329578 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978299.1 protein_id gnl|my_center|LOCUS_21130 331309 329678 gene locus_tag LOCUS_21140 gene ptsP 331309 329678 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977434.1 protein_id gnl|my_center|LOCUS_21140 331577 331302 gene locus_tag LOCUS_21150 331577 331302 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804003.1 protein_id gnl|my_center|LOCUS_21150 332626 331586 gene locus_tag LOCUS_21160 332626 331586 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_21160 333057 332623 gene locus_tag LOCUS_21170 333057 332623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21170 333358 333050 gene locus_tag LOCUS_21180 333358 333050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21180 334497 333364 gene locus_tag LOCUS_21190 334497 333364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21190 335463 334555 gene locus_tag LOCUS_21200 gene pfkB 335463 334555 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028823.1 protein_id gnl|my_center|LOCUS_21200 336238 335477 gene locus_tag LOCUS_21210 336238 335477 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226344.1 protein_id gnl|my_center|LOCUS_21210 336344 336541 gene locus_tag LOCUS_21220 336344 336541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 337320 336514 gene locus_tag LOCUS_21230 337320 336514 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_21230 337577 338431 gene locus_tag LOCUS_21240 337577 338431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 338959 339774 gene locus_tag LOCUS_21250 338959 339774 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222475.1 protein_id gnl|my_center|LOCUS_21250 339771 340988 gene locus_tag LOCUS_21260 gene rocD 339771 340988 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727654.1 protein_id gnl|my_center|LOCUS_21260 342218 341067 gene locus_tag LOCUS_21270 342218 341067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 342508 342215 gene locus_tag LOCUS_21280 342508 342215 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229777.1 protein_id gnl|my_center|LOCUS_21280 342724 343506 gene locus_tag LOCUS_21290 342724 343506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 344617 343568 gene locus_tag LOCUS_21300 344617 343568 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224400.1 protein_id gnl|my_center|LOCUS_21300 348525 344845 gene locus_tag LOCUS_21310 348525 344845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 348893 348573 gene locus_tag LOCUS_21320 348893 348573 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880624.1 protein_id gnl|my_center|LOCUS_21320 349925 348903 gene locus_tag LOCUS_21330 349925 348903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 350758 349925 gene locus_tag LOCUS_21340 350758 349925 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104392.1 protein_id gnl|my_center|LOCUS_21340 350914 352443 gene locus_tag LOCUS_21350 350914 352443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 353618 352503 gene locus_tag LOCUS_21360 353618 352503 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091560406.1 protein_id gnl|my_center|LOCUS_21360 354469 353801 gene locus_tag LOCUS_21370 354469 353801 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140230840.1 protein_id gnl|my_center|LOCUS_21370 356227 354653 gene locus_tag LOCUS_21380 356227 354653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 357843 356290 gene locus_tag LOCUS_21390 357843 356290 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804419.1 protein_id gnl|my_center|LOCUS_21390 358553 357840 gene locus_tag LOCUS_21400 gene phoP 358553 357840 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403867.1 protein_id gnl|my_center|LOCUS_21400 359229 358618 gene locus_tag LOCUS_21410 359229 358618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 360059 359226 gene locus_tag LOCUS_21420 360059 359226 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486398.1 protein_id gnl|my_center|LOCUS_21420 360230 360892 gene locus_tag LOCUS_21430 360230 360892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088487.1 protein_id gnl|my_center|LOCUS_21430 361076 362014 gene locus_tag LOCUS_21440 361076 362014 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230969.1 protein_id gnl|my_center|LOCUS_21440 362011 362835 gene locus_tag LOCUS_21450 362011 362835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 363105 366863 gene locus_tag LOCUS_21460 363105 366863 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467712.1 protein_id gnl|my_center|LOCUS_21460 366982 367161 gene locus_tag LOCUS_21470 366982 367161 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_21470 367782 367216 gene locus_tag LOCUS_21480 367782 367216 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971313.1 protein_id gnl|my_center|LOCUS_21480 368204 367779 gene locus_tag LOCUS_21490 368204 367779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 368363 370432 gene locus_tag LOCUS_21500 gene pta 368363 370432 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030239.1 protein_id gnl|my_center|LOCUS_21500 370429 371547 gene locus_tag LOCUS_21510 370429 371547 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030238.1 protein_id gnl|my_center|LOCUS_21510 371840 371664 gene locus_tag LOCUS_21520 371840 371664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 371990 372904 gene locus_tag LOCUS_21530 371990 372904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 373085 373678 gene locus_tag LOCUS_21540 373085 373678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 373743 374720 gene locus_tag LOCUS_21550 373743 374720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 375746 374793 gene locus_tag LOCUS_21560 375746 374793 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_21560 377009 375831 gene locus_tag LOCUS_21570 377009 375831 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973709.1 protein_id gnl|my_center|LOCUS_21570 377512 377168 gene locus_tag LOCUS_21580 gene sodX 377512 377168 CDS product nickel-type superoxide dismutase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868025.1 protein_id gnl|my_center|LOCUS_21580 377597 378001 gene locus_tag LOCUS_21590 gene sodN 377597 378001 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_21590 377998 378543 gene locus_tag LOCUS_21600 377998 378543 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229707.1 protein_id gnl|my_center|LOCUS_21600 378568 378981 gene locus_tag LOCUS_21610 378568 378981 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973726.1 protein_id gnl|my_center|LOCUS_21610 379437 379006 gene locus_tag LOCUS_21620 379437 379006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 379436 380386 gene locus_tag LOCUS_21630 379436 380386 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_21630 380835 381092 gene locus_tag LOCUS_21640 380835 381092 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_21640 382091 381243 gene locus_tag LOCUS_21650 382091 381243 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228436.1 protein_id gnl|my_center|LOCUS_21650 382864 382073 gene locus_tag LOCUS_21660 382864 382073 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_21660 383019 382861 gene locus_tag LOCUS_21670 383019 382861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972819.1 protein_id gnl|my_center|LOCUS_21670 384728 383016 gene locus_tag LOCUS_21680 384728 383016 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228431.1 protein_id gnl|my_center|LOCUS_21680 385121 386665 gene locus_tag LOCUS_21690 385121 386665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 388434 386776 gene locus_tag LOCUS_21700 388434 386776 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229710.1 protein_id gnl|my_center|LOCUS_21700 389491 388460 gene locus_tag LOCUS_21710 389491 388460 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092074.1 protein_id gnl|my_center|LOCUS_21710 389598 391577 gene locus_tag LOCUS_21720 389598 391577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 393283 391688 gene locus_tag LOCUS_21730 393283 391688 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028938.1 protein_id gnl|my_center|LOCUS_21730 393392 393958 gene locus_tag LOCUS_21740 393392 393958 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975467.1 protein_id gnl|my_center|LOCUS_21740 394518 393997 gene locus_tag LOCUS_21750 394518 393997 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223567.1 protein_id gnl|my_center|LOCUS_21750 394730 394515 gene locus_tag LOCUS_21760 394730 394515 CDS product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056341.1 protein_id gnl|my_center|LOCUS_21760 395468 395220 gene locus_tag LOCUS_21770 395468 395220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 396126 395509 gene locus_tag LOCUS_21780 gene sigR 396126 395509 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_21780 397219 396599 gene locus_tag LOCUS_21790 397219 396599 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229714.1 protein_id gnl|my_center|LOCUS_21790 397599 397333 gene locus_tag LOCUS_21800 397599 397333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 398914 397925 gene locus_tag LOCUS_21810 398914 397925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 398799 400037 gene locus_tag LOCUS_21820 gene aroA 398799 400037 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_21820 400007 401158 gene locus_tag LOCUS_21830 gene rsgA 400007 401158 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229716.1 protein_id gnl|my_center|LOCUS_21830 401155 402039 gene locus_tag LOCUS_21840 gene hisN 401155 402039 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973764.1 protein_id gnl|my_center|LOCUS_21840 402066 402965 gene locus_tag LOCUS_21850 402066 402965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229149.1 protein_id gnl|my_center|LOCUS_21850 404225 403023 gene locus_tag LOCUS_21860 404225 403023 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030721.1 protein_id gnl|my_center|LOCUS_21860 404417 405415 gene locus_tag LOCUS_21870 404417 405415 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969394.1 protein_id gnl|my_center|LOCUS_21870 405415 406197 gene locus_tag LOCUS_21880 405415 406197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 406312 406881 gene locus_tag LOCUS_21890 406312 406881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 407567 406914 gene locus_tag LOCUS_21900 407567 406914 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976695.1 protein_id gnl|my_center|LOCUS_21900 408718 407564 gene locus_tag LOCUS_21910 408718 407564 CDS product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976694.1 protein_id gnl|my_center|LOCUS_21910 408739 409269 gene locus_tag LOCUS_21920 408739 409269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 410235 409288 gene locus_tag LOCUS_21930 410235 409288 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027351.1 protein_id gnl|my_center|LOCUS_21930 410290 411774 gene locus_tag LOCUS_21940 gene glpK 410290 411774 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226254.1 protein_id gnl|my_center|LOCUS_21940 413017 411884 gene locus_tag LOCUS_21950 413017 411884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 413511 413014 gene locus_tag LOCUS_21960 413511 413014 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467244.1 protein_id gnl|my_center|LOCUS_21960 414473 413640 gene locus_tag LOCUS_21970 414473 413640 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224066.1 protein_id gnl|my_center|LOCUS_21970 414638 415966 gene locus_tag LOCUS_21980 414638 415966 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776937.1 protein_id gnl|my_center|LOCUS_21980 416272 416024 gene locus_tag LOCUS_21990 416272 416024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 416561 416487 gene locus_tag LOCUS_t00230 416561 416487 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 417311 416658 gene locus_tag LOCUS_22000 417311 416658 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895252.1 protein_id gnl|my_center|LOCUS_22000 417412 418446 gene locus_tag LOCUS_22010 417412 418446 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225665.1 protein_id gnl|my_center|LOCUS_22010 418671 418597 gene locus_tag LOCUS_t00240 418671 418597 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 421703 418743 gene locus_tag LOCUS_22020 421703 418743 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630643.1 protein_id gnl|my_center|LOCUS_22020 422813 421815 gene locus_tag LOCUS_22030 422813 421815 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893338.1 protein_id gnl|my_center|LOCUS_22030 423011 424243 gene locus_tag LOCUS_22040 423011 424243 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_22040 425089 424490 gene locus_tag LOCUS_22050 425089 424490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 425686 425216 gene locus_tag LOCUS_22060 425686 425216 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867997.1 protein_id gnl|my_center|LOCUS_22060 426260 426427 gene locus_tag LOCUS_22070 426260 426427 CDS product DUF5679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551122.1 protein_id gnl|my_center|LOCUS_22070 426632 427684 gene locus_tag LOCUS_22080 426632 427684 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486346.1 protein_id gnl|my_center|LOCUS_22080 427919 429250 gene locus_tag LOCUS_22090 427919 429250 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_22090 429565 429386 gene locus_tag LOCUS_22100 429565 429386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 430000 429635 gene locus_tag LOCUS_22110 430000 429635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 430388 430134 gene locus_tag LOCUS_22120 430388 430134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 432661 430511 gene locus_tag LOCUS_22130 432661 430511 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_22130 432779 433021 gene locus_tag LOCUS_22140 432779 433021 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_22140 434439 433174 gene locus_tag LOCUS_22150 434439 433174 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028035.1 protein_id gnl|my_center|LOCUS_22150 434648 435625 gene locus_tag LOCUS_22160 434648 435625 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_22160 435702 435941 gene locus_tag LOCUS_22170 435702 435941 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230745.1 protein_id gnl|my_center|LOCUS_22170 436155 436424 gene locus_tag LOCUS_22180 436155 436424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 437728 436745 gene locus_tag LOCUS_22190 gene nudC 437728 436745 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056376.1 protein_id gnl|my_center|LOCUS_22190 439068 437725 gene locus_tag LOCUS_22200 439068 437725 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223056.1 protein_id gnl|my_center|LOCUS_22200 440435 439125 gene locus_tag LOCUS_22210 440435 439125 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 protein_id gnl|my_center|LOCUS_22210 441586 440492 gene locus_tag LOCUS_22220 441586 440492 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729904.1 protein_id gnl|my_center|LOCUS_22220 441771 442835 gene locus_tag LOCUS_22230 441771 442835 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_22230 442832 443611 gene locus_tag LOCUS_22240 442832 443611 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972825.1 protein_id gnl|my_center|LOCUS_22240 443601 444485 gene locus_tag LOCUS_22250 443601 444485 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223442.1 protein_id gnl|my_center|LOCUS_22250 444487 445002 gene locus_tag LOCUS_22260 444487 445002 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730224.1 protein_id gnl|my_center|LOCUS_22260 445310 445089 gene locus_tag LOCUS_22270 445310 445089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 446914 445511 gene locus_tag LOCUS_22280 446914 445511 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029195.1 protein_id gnl|my_center|LOCUS_22280 447347 447144 gene locus_tag LOCUS_22290 447347 447144 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_22290 450980 447597 gene locus_tag LOCUS_22300 450980 447597 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223039.1 protein_id gnl|my_center|LOCUS_22300 454742 451086 gene locus_tag LOCUS_22310 454742 451086 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_22310 455440 454895 gene locus_tag LOCUS_22320 455440 454895 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088046.1 protein_id gnl|my_center|LOCUS_22320 456296 455445 gene locus_tag LOCUS_22330 456296 455445 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074240.1 protein_id gnl|my_center|LOCUS_22330 456474 456641 gene locus_tag LOCUS_22340 456474 456641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 457825 456752 gene locus_tag LOCUS_22350 gene dapE 457825 456752 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_22350 457883 458809 gene locus_tag LOCUS_22360 gene dapD 457883 458809 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222940.1 protein_id gnl|my_center|LOCUS_22360 462300 458935 gene locus_tag LOCUS_22370 462300 458935 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 protein_id gnl|my_center|LOCUS_22370 462464 463000 gene locus_tag LOCUS_22380 462464 463000 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031718.1 protein_id gnl|my_center|LOCUS_22380 463713 463069 gene locus_tag LOCUS_22390 463713 463069 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230842.1 protein_id gnl|my_center|LOCUS_22390 464357 463713 gene locus_tag LOCUS_22400 464357 463713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 465542 464523 gene locus_tag LOCUS_22410 465542 464523 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920085.1 protein_id gnl|my_center|LOCUS_22410 466718 465675 gene locus_tag LOCUS_22420 gene dapC 466718 465675 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730331.1 protein_id gnl|my_center|LOCUS_22420 467113 466787 gene locus_tag LOCUS_22430 467113 466787 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083029.1 protein_id gnl|my_center|LOCUS_22430 467211 468164 gene locus_tag LOCUS_22440 467211 468164 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030076.1 protein_id gnl|my_center|LOCUS_22440 469162 468698 gene locus_tag LOCUS_22450 469162 468698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 469705 469244 gene locus_tag LOCUS_22460 469705 469244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 470631 469702 gene locus_tag LOCUS_22470 gene mshB 470631 469702 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089212260.1 protein_id gnl|my_center|LOCUS_22470 470719 472863 gene locus_tag LOCUS_22480 470719 472863 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 protein_id gnl|my_center|LOCUS_22480 474684 472942 gene locus_tag LOCUS_22490 474684 472942 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973864.1 protein_id gnl|my_center|LOCUS_22490 475802 474816 gene locus_tag LOCUS_22500 475802 474816 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973863.1 protein_id gnl|my_center|LOCUS_22500 476825 475812 gene locus_tag LOCUS_22510 476825 475812 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_22510 477844 476822 gene locus_tag LOCUS_22520 477844 476822 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973861.1 protein_id gnl|my_center|LOCUS_22520 478944 477841 gene locus_tag LOCUS_22530 478944 477841 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 protein_id gnl|my_center|LOCUS_22530 479171 479719 gene locus_tag LOCUS_22540 479171 479719 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393557.1 protein_id gnl|my_center|LOCUS_22540 479855 480403 gene locus_tag LOCUS_22550 479855 480403 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_22550 480436 481872 gene locus_tag LOCUS_22560 480436 481872 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 protein_id gnl|my_center|LOCUS_22560 481869 483407 gene locus_tag LOCUS_22570 481869 483407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 483756 484499 gene locus_tag LOCUS_22580 483756 484499 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891739.1 protein_id gnl|my_center|LOCUS_22580 484510 486441 gene locus_tag LOCUS_22590 484510 486441 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_22590 486441 487505 gene locus_tag LOCUS_22600 486441 487505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 488025 487585 gene locus_tag LOCUS_22610 488025 487585 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229768.1 protein_id gnl|my_center|LOCUS_22610 488209 488517 gene locus_tag LOCUS_22620 488209 488517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 488524 489054 gene locus_tag LOCUS_22630 488524 489054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 489066 489455 gene locus_tag LOCUS_22640 489066 489455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 490399 489509 gene locus_tag LOCUS_22650 490399 489509 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030042.1 protein_id gnl|my_center|LOCUS_22650 490515 491057 gene locus_tag LOCUS_22660 490515 491057 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223589.1 protein_id gnl|my_center|LOCUS_22660 491538 491095 gene locus_tag LOCUS_22670 491538 491095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 491572 491886 gene locus_tag LOCUS_22680 491572 491886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 492827 491883 gene locus_tag LOCUS_22690 492827 491883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 493186 492992 gene locus_tag LOCUS_22700 493186 492992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 493479 493249 gene locus_tag LOCUS_22710 493479 493249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 493745 494158 gene locus_tag LOCUS_22720 493745 494158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 494828 494193 gene locus_tag LOCUS_22730 494828 494193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 494892 495611 gene locus_tag LOCUS_22740 494892 495611 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976332.1 protein_id gnl|my_center|LOCUS_22740 496526 495597 gene locus_tag LOCUS_22750 496526 495597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 497398 496772 gene locus_tag LOCUS_22760 497398 496772 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259190.1 protein_id gnl|my_center|LOCUS_22760 498368 498868 gene locus_tag LOCUS_22770 498368 498868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 499069 499527 gene locus_tag LOCUS_22780 499069 499527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22780 500883 499798 gene locus_tag LOCUS_22790 gene ychF 500883 499798 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 protein_id gnl|my_center|LOCUS_22790 501681 500923 gene locus_tag LOCUS_22800 501681 500923 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031666.1 protein_id gnl|my_center|LOCUS_22800 502189 501704 gene locus_tag LOCUS_22810 502189 501704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 502412 503890 gene locus_tag LOCUS_22820 502412 503890 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972517.1 protein_id gnl|my_center|LOCUS_22820 503887 504399 gene locus_tag LOCUS_22830 503887 504399 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058688.1 protein_id gnl|my_center|LOCUS_22830 504487 506286 gene locus_tag LOCUS_22840 504487 506286 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730691.1 protein_id gnl|my_center|LOCUS_22840 506283 508244 gene locus_tag LOCUS_22850 506283 508244 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730690.1 protein_id gnl|my_center|LOCUS_22850 508349 509788 gene locus_tag LOCUS_22860 508349 509788 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030529.1 protein_id gnl|my_center|LOCUS_22860 509844 512501 gene locus_tag LOCUS_22870 gene valS 509844 512501 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224259.1 protein_id gnl|my_center|LOCUS_22870 513162 512515 gene locus_tag LOCUS_22880 513162 512515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 515024 513345 gene locus_tag LOCUS_22890 515024 513345 CDS product CotH kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855409.1 protein_id gnl|my_center|LOCUS_22890 515701 515024 gene locus_tag LOCUS_22900 515701 515024 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897325.1 protein_id gnl|my_center|LOCUS_22900 516631 515708 gene locus_tag LOCUS_22910 516631 515708 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496031.1 protein_id gnl|my_center|LOCUS_22910 516932 518461 gene locus_tag LOCUS_22920 516932 518461 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_22920 518498 519574 gene locus_tag LOCUS_22930 gene galT 518498 519574 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230058.1 protein_id gnl|my_center|LOCUS_22930 520981 519764 gene locus_tag LOCUS_22940 520981 519764 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222746.1 protein_id gnl|my_center|LOCUS_22940 521119 521937 gene locus_tag LOCUS_22950 521119 521937 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030032.1 protein_id gnl|my_center|LOCUS_22950 522918 521968 gene locus_tag LOCUS_22960 gene mdh 522918 521968 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_22960 523921 523061 gene locus_tag LOCUS_22970 523921 523061 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056107.1 protein_id gnl|my_center|LOCUS_22970 524388 525992 gene locus_tag LOCUS_22980 524388 525992 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014806.1 protein_id gnl|my_center|LOCUS_22980 526074 527012 gene locus_tag LOCUS_22990 526074 527012 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857497.1 protein_id gnl|my_center|LOCUS_22990 527049 528005 gene locus_tag LOCUS_23000 527049 528005 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973858.1 protein_id gnl|my_center|LOCUS_23000 528013 529050 gene locus_tag LOCUS_23010 528013 529050 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229921.1 protein_id gnl|my_center|LOCUS_23010 529034 530065 gene locus_tag LOCUS_23020 529034 530065 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229920.1 protein_id gnl|my_center|LOCUS_23020 531676 530105 gene locus_tag LOCUS_23030 gene purH 531676 530105 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 protein_id gnl|my_center|LOCUS_23030 532293 531673 gene locus_tag LOCUS_23040 gene purN 532293 531673 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 protein_id gnl|my_center|LOCUS_23040 532265 532474 gene locus_tag LOCUS_23050 532265 532474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 532519 532821 gene locus_tag LOCUS_23060 532519 532821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 532851 533501 gene locus_tag LOCUS_23070 532851 533501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 534855 533563 gene locus_tag LOCUS_23080 534855 533563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 535059 535325 gene locus_tag LOCUS_23090 535059 535325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 536273 535386 gene locus_tag LOCUS_23100 gene sucD 536273 535386 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974163.1 protein_id gnl|my_center|LOCUS_23100 537454 536276 gene locus_tag LOCUS_23110 gene sucC 537454 536276 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974164.1 protein_id gnl|my_center|LOCUS_23110 538311 537907 gene locus_tag LOCUS_23120 538311 537907 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_23120 538700 539413 gene locus_tag LOCUS_23130 538700 539413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 539687 540466 gene locus_tag LOCUS_23140 539687 540466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 542929 540539 gene locus_tag LOCUS_23150 gene pcrA 542929 540539 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_23150 543123 544973 gene locus_tag LOCUS_23160 543123 544973 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029468.1 protein_id gnl|my_center|LOCUS_23160 545262 545654 gene locus_tag LOCUS_23170 545262 545654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 546862 545849 gene locus_tag LOCUS_23180 546862 545849 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229920.1 protein_id gnl|my_center|LOCUS_23180 547898 546855 gene locus_tag LOCUS_23190 547898 546855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229921.1 protein_id gnl|my_center|LOCUS_23190 548881 547910 gene locus_tag LOCUS_23200 548881 547910 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229922.1 protein_id gnl|my_center|LOCUS_23200 549883 548957 gene locus_tag LOCUS_23210 549883 548957 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229923.1 protein_id gnl|my_center|LOCUS_23210 551673 550033 gene locus_tag LOCUS_23220 551673 550033 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949626.1 protein_id gnl|my_center|LOCUS_23220 553017 552331 gene locus_tag LOCUS_23230 553017 552331 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222701.1 protein_id gnl|my_center|LOCUS_23230 554252 553014 gene locus_tag LOCUS_23240 554252 553014 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222700.1 protein_id gnl|my_center|LOCUS_23240 554446 556290 gene locus_tag LOCUS_23250 554446 556290 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222697.1 protein_id gnl|my_center|LOCUS_23250 556287 556901 gene locus_tag LOCUS_23260 556287 556901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 557097 558350 gene locus_tag LOCUS_23270 557097 558350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 559322 558402 gene locus_tag LOCUS_23280 559322 558402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 560577 559669 gene locus_tag LOCUS_23290 560577 559669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 561584 560706 gene locus_tag LOCUS_23300 561584 560706 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886974.1 protein_id gnl|my_center|LOCUS_23300 561798 562160 gene locus_tag LOCUS_23310 561798 562160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 563700 562168 gene locus_tag LOCUS_23320 gene guaA 563700 562168 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222695.1 protein_id gnl|my_center|LOCUS_23320 565550 563853 gene locus_tag LOCUS_23330 565550 563853 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086844353.1 protein_id gnl|my_center|LOCUS_23330 565690 566808 gene locus_tag LOCUS_23340 565690 566808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 568336 566858 gene locus_tag LOCUS_23350 568336 566858 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854953.1 protein_id gnl|my_center|LOCUS_23350 569893 568538 gene locus_tag LOCUS_23360 569893 568538 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854953.1 protein_id gnl|my_center|LOCUS_23360 571343 570225 gene locus_tag LOCUS_23370 571343 570225 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222686.1 protein_id gnl|my_center|LOCUS_23370 572936 571374 gene locus_tag LOCUS_23380 gene guaB 572936 571374 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222684.1 protein_id gnl|my_center|LOCUS_23380 573169 573579 gene locus_tag LOCUS_23390 573169 573579 CDS product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003073549.1 protein_id gnl|my_center|LOCUS_23390 574435 573617 gene locus_tag LOCUS_23400 574435 573617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 574689 575072 gene locus_tag LOCUS_23410 574689 575072 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974205.1 protein_id gnl|my_center|LOCUS_23410 577308 575665 gene locus_tag LOCUS_23420 gene groL 577308 575665 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_23420 577694 577380 gene locus_tag LOCUS_23430 gene groES 577694 577380 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974211.1 protein_id gnl|my_center|LOCUS_23430 578089 577874 gene locus_tag LOCUS_23440 578089 577874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 578407 578778 gene locus_tag LOCUS_23450 578407 578778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 578717 578959 gene locus_tag LOCUS_23460 578717 578959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 579173 580384 gene locus_tag LOCUS_23470 579173 580384 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_23470 580523 581002 gene locus_tag LOCUS_23480 gene ybaK 580523 581002 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 protein_id gnl|my_center|LOCUS_23480 581514 581257 gene locus_tag LOCUS_23490 581514 581257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 581918 581604 gene locus_tag LOCUS_23500 581918 581604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 582457 581915 gene locus_tag LOCUS_23510 582457 581915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 582899 582471 gene locus_tag LOCUS_23520 582899 582471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 583468 582896 gene locus_tag LOCUS_23530 583468 582896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 584120 583593 gene locus_tag LOCUS_23540 584120 583593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 584671 584132 gene locus_tag LOCUS_23550 584671 584132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 585096 586184 gene locus_tag LOCUS_23560 585096 586184 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897421.1 protein_id gnl|my_center|LOCUS_23560 586310 587116 gene locus_tag LOCUS_23570 586310 587116 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224454.1 protein_id gnl|my_center|LOCUS_23570 587113 588375 gene locus_tag LOCUS_23580 587113 588375 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878529.1 protein_id gnl|my_center|LOCUS_23580 588383 589564 gene locus_tag LOCUS_23590 588383 589564 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224456.1 protein_id gnl|my_center|LOCUS_23590 589620 589910 gene locus_tag LOCUS_23600 589620 589910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 591701 589938 gene locus_tag LOCUS_23610 591701 589938 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027610.1 protein_id gnl|my_center|LOCUS_23610 593404 591701 gene locus_tag LOCUS_23620 593404 591701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230756.1 protein_id gnl|my_center|LOCUS_23620 593580 593948 gene locus_tag LOCUS_23630 593580 593948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 593958 594281 gene locus_tag LOCUS_23640 593958 594281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 594283 595371 gene locus_tag LOCUS_23650 594283 595371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 595371 595964 gene locus_tag LOCUS_23660 595371 595964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 596241 595987 gene locus_tag LOCUS_23670 596241 595987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 597320 596274 gene locus_tag LOCUS_23680 gene tsaD 597320 596274 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_23680 597782 597327 gene locus_tag LOCUS_23690 gene rimI 597782 597327 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_23690 598524 597838 gene locus_tag LOCUS_23700 gene tsaB 598524 597838 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222662.1 protein_id gnl|my_center|LOCUS_23700 599456 598596 gene locus_tag LOCUS_23710 599456 598596 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230371.1 protein_id gnl|my_center|LOCUS_23710 600418 599717 gene locus_tag LOCUS_23720 600418 599717 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887334.1 protein_id gnl|my_center|LOCUS_23720 601138 600644 gene locus_tag LOCUS_23730 gene tsaE 601138 600644 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466589.1 protein_id gnl|my_center|LOCUS_23730 602250 601162 gene locus_tag LOCUS_23740 602250 601162 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327056.1 protein_id gnl|my_center|LOCUS_23740 603382 602264 gene locus_tag LOCUS_23750 gene alr 603382 602264 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222656.1 protein_id gnl|my_center|LOCUS_23750 604915 603455 gene locus_tag LOCUS_23760 604915 603455 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222652.1 protein_id gnl|my_center|LOCUS_23760 605112 604921 gene locus_tag LOCUS_23770 605112 604921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 605351 605647 gene locus_tag LOCUS_23780 605351 605647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 605644 607281 gene locus_tag LOCUS_23790 605644 607281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 609303 607390 gene locus_tag LOCUS_23800 gene glmS 609303 607390 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_23800 609586 610566 gene locus_tag LOCUS_23810 609586 610566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 610606 611802 gene locus_tag LOCUS_23820 610606 611802 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_23820 611799 612908 gene locus_tag LOCUS_23830 611799 612908 CDS product beta-eliminating lyase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028948.1 protein_id gnl|my_center|LOCUS_23830 614363 613008 gene locus_tag LOCUS_23840 gene glmM 614363 613008 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_23840 614943 614479 gene locus_tag LOCUS_23850 614943 614479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 615407 614964 gene locus_tag LOCUS_23860 gene rplM 615407 614964 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974239.1 protein_id gnl|my_center|LOCUS_23860 615939 615646 gene locus_tag LOCUS_23870 615939 615646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 616186 615929 gene locus_tag LOCUS_23880 616186 615929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 616612 616962 gene locus_tag LOCUS_23890 616612 616962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 616962 618050 gene locus_tag LOCUS_23900 616962 618050 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223031.1 protein_id gnl|my_center|LOCUS_23900 618869 618246 gene locus_tag LOCUS_23910 618869 618246 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314218.1 protein_id gnl|my_center|LOCUS_23910 619215 618850 gene locus_tag LOCUS_23920 619215 618850 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893046.1 protein_id gnl|my_center|LOCUS_23920 619692 619285 gene locus_tag LOCUS_23930 619692 619285 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973453.1 protein_id gnl|my_center|LOCUS_23930 622769 619689 gene locus_tag LOCUS_23940 622769 619689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23940 623218 624399 gene locus_tag LOCUS_23950 623218 624399 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031490.1 protein_id gnl|my_center|LOCUS_23950 625357 624500 gene locus_tag LOCUS_23960 625357 624500 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728490.1 protein_id gnl|my_center|LOCUS_23960 626483 625455 gene locus_tag LOCUS_23970 626483 625455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 626750 627586 gene locus_tag LOCUS_23980 626750 627586 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085622.1 protein_id gnl|my_center|LOCUS_23980 627589 628527 gene locus_tag LOCUS_23990 627589 628527 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224046.1 protein_id gnl|my_center|LOCUS_23990 628752 631184 gene locus_tag LOCUS_24000 628752 631184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 630647 630549 gene locus_tag LOCUS_t00250 630647 630549 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 632250 631306 gene locus_tag LOCUS_24010 632250 631306 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_24010 633220 632423 gene locus_tag LOCUS_24020 633220 632423 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729479.1 protein_id gnl|my_center|LOCUS_24020 634896 633217 gene locus_tag LOCUS_24030 634896 633217 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114333.1 protein_id gnl|my_center|LOCUS_24030 635551 634937 gene locus_tag LOCUS_24040 635551 634937 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 protein_id gnl|my_center|LOCUS_24040 635664 636701 gene locus_tag LOCUS_24050 635664 636701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 637557 636727 gene locus_tag LOCUS_24060 gene truA 637557 636727 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974242.1 protein_id gnl|my_center|LOCUS_24060 638183 637626 gene locus_tag LOCUS_24070 gene rplQ 638183 637626 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112004.1 protein_id gnl|my_center|LOCUS_24070 639240 638218 gene locus_tag LOCUS_24080 639240 638218 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_24080 639965 639339 gene locus_tag LOCUS_24090 gene rpsD 639965 639339 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583370.1 protein_id gnl|my_center|LOCUS_24090 640386 639979 gene locus_tag LOCUS_24100 gene rpsK 640386 639979 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558885.1 protein_id gnl|my_center|LOCUS_24100 640785 640405 gene locus_tag LOCUS_24110 gene rpsM 640785 640405 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808138.1 protein_id gnl|my_center|LOCUS_24110 641474 641253 gene locus_tag LOCUS_24120 gene infA 641474 641253 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003886926.1 protein_id gnl|my_center|LOCUS_24120 642396 641695 gene locus_tag LOCUS_24130 642396 641695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 643428 642577 gene locus_tag LOCUS_24140 gene map 643428 642577 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 protein_id gnl|my_center|LOCUS_24140 644171 643518 gene locus_tag LOCUS_24150 644171 643518 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 protein_id gnl|my_center|LOCUS_24150 645500 644172 gene locus_tag LOCUS_24160 gene secY 645500 644172 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222619.1 protein_id gnl|my_center|LOCUS_24160 646179 645736 gene locus_tag LOCUS_24170 gene rplO 646179 645736 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222616.1 protein_id gnl|my_center|LOCUS_24170 646361 646179 gene locus_tag LOCUS_24180 gene rpmD 646361 646179 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_24180 646975 646361 gene locus_tag LOCUS_24190 gene rpsE 646975 646361 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222614.1 protein_id gnl|my_center|LOCUS_24190 647398 647009 gene locus_tag LOCUS_24200 gene rplR 647398 647009 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974252.1 protein_id gnl|my_center|LOCUS_24200 647937 647395 gene locus_tag LOCUS_24210 gene rplF 647937 647395 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_24210 648361 647954 gene locus_tag LOCUS_24220 gene rpsH 648361 647954 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892856.1 protein_id gnl|my_center|LOCUS_24220 648664 648479 gene locus_tag LOCUS_24230 648664 648479 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_24230 649235 648666 gene locus_tag LOCUS_24240 gene rplE 649235 648666 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222611.1 protein_id gnl|my_center|LOCUS_24240 649555 649235 gene locus_tag LOCUS_24250 gene rplX 649555 649235 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222610.1 protein_id gnl|my_center|LOCUS_24250 649920 649552 gene locus_tag LOCUS_24260 gene rplN 649920 649552 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_24260 650300 650019 gene locus_tag LOCUS_24270 gene rpsQ 650300 650019 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_24270 650533 650297 gene locus_tag LOCUS_24280 gene rpmC 650533 650297 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080491.1 protein_id gnl|my_center|LOCUS_24280 650958 650533 gene locus_tag LOCUS_24290 gene rplP 650958 650533 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558864.1 protein_id gnl|my_center|LOCUS_24290 651828 650962 gene locus_tag LOCUS_24300 651828 650962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 652286 651828 gene locus_tag LOCUS_24310 652286 651828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 652608 652327 gene locus_tag LOCUS_24320 gene rpsS 652608 652327 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892827.1 protein_id gnl|my_center|LOCUS_24320 653460 652621 gene locus_tag LOCUS_24330 gene rplB 653460 652621 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727672.1 protein_id gnl|my_center|LOCUS_24330 653775 653473 gene locus_tag LOCUS_24340 gene rplW 653775 653473 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055645.1 protein_id gnl|my_center|LOCUS_24340 654449 653772 gene locus_tag LOCUS_24350 gene rplD 654449 653772 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_24350 655111 654446 gene locus_tag LOCUS_24360 gene rplC 655111 654446 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_24360 655431 655123 gene locus_tag LOCUS_24370 gene rpsJ 655431 655123 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_24370 656979 655786 gene locus_tag LOCUS_24380 gene tuf 656979 655786 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222603.1 protein_id gnl|my_center|LOCUS_24380 659298 657202 gene locus_tag LOCUS_24390 gene fusA 659298 657202 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222602.1 protein_id gnl|my_center|LOCUS_24390 659844 659374 gene locus_tag LOCUS_24400 gene rpsG 659844 659374 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102106.1 protein_id gnl|my_center|LOCUS_24400 660220 659846 gene locus_tag LOCUS_24410 gene rpsL 660220 659846 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007167812.1 protein_id gnl|my_center|LOCUS_24410 660628 660407 gene locus_tag LOCUS_24420 660628 660407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 661608 660769 gene locus_tag LOCUS_24430 661608 660769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 662096 661719 gene locus_tag LOCUS_24440 662096 661719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 666152 662265 gene locus_tag LOCUS_24450 666152 662265 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_24450 669665 666234 gene locus_tag LOCUS_24460 669665 666234 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222586.1 protein_id gnl|my_center|LOCUS_24460 670630 670247 gene locus_tag LOCUS_24470 gene rplL 670630 670247 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892753.1 protein_id gnl|my_center|LOCUS_24470 671229 670684 gene locus_tag LOCUS_24480 gene rplJ 671229 670684 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892752.1 protein_id gnl|my_center|LOCUS_24480 672318 671629 gene locus_tag LOCUS_24490 672318 671629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 673370 672315 gene locus_tag LOCUS_24500 673370 672315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 674167 673451 gene locus_tag LOCUS_24510 gene rplA 674167 673451 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061480.1 protein_id gnl|my_center|LOCUS_24510 674683 674249 gene locus_tag LOCUS_24520 gene rplK 674683 674249 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222525.1 protein_id gnl|my_center|LOCUS_24520 675590 674868 gene locus_tag LOCUS_24530 gene nusG 675590 674868 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222524.1 protein_id gnl|my_center|LOCUS_24530 676211 675630 gene locus_tag LOCUS_24540 676211 675630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 676306 676233 gene locus_tag LOCUS_t00260 676306 676233 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 676826 676434 gene locus_tag LOCUS_24550 676826 676434 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_24550 677274 676828 gene locus_tag LOCUS_24560 677274 676828 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_24560 677562 677395 gene locus_tag LOCUS_24570 gene rpmG 677562 677395 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898538.1 protein_id gnl|my_center|LOCUS_24570 677768 677695 gene locus_tag LOCUS_t00270 677768 677695 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 677866 677793 gene locus_tag LOCUS_t00280 677866 677793 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 680523 677992 gene locus_tag LOCUS_24580 680523 677992 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222516.1 protein_id gnl|my_center|LOCUS_24580 680772 680632 gene locus_tag LOCUS_24590 680772 680632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 681555 682307 gene locus_tag LOCUS_24600 681555 682307 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029211.1 protein_id gnl|my_center|LOCUS_24600 682304 684838 gene locus_tag LOCUS_24610 682304 684838 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207316850.1 protein_id gnl|my_center|LOCUS_24610 684949 686166 gene locus_tag LOCUS_24620 684949 686166 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029752.1 protein_id gnl|my_center|LOCUS_24620 686166 686810 gene locus_tag LOCUS_24630 686166 686810 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466646.1 protein_id gnl|my_center|LOCUS_24630 688835 687549 gene locus_tag LOCUS_24640 688835 687549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 690581 689145 gene locus_tag LOCUS_24650 690581 689145 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029764.1 protein_id gnl|my_center|LOCUS_24650 690763 690578 gene locus_tag LOCUS_24660 690763 690578 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031039432.1 protein_id gnl|my_center|LOCUS_24660 692439 690760 gene locus_tag LOCUS_24670 692439 690760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227708.1 protein_id gnl|my_center|LOCUS_24670 693095 692517 gene locus_tag LOCUS_24680 693095 692517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 693283 693092 gene locus_tag LOCUS_24690 693283 693092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 693543 693289 gene locus_tag LOCUS_24700 693543 693289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 695129 693540 gene locus_tag LOCUS_24710 695129 693540 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110627.1 protein_id gnl|my_center|LOCUS_24710 695826 695431 gene locus_tag LOCUS_24720 695826 695431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 696322 696750 gene locus_tag LOCUS_24730 696322 696750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250160.1 protein_id gnl|my_center|LOCUS_24730 697507 696740 gene locus_tag LOCUS_24740 697507 696740 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897093.1 protein_id gnl|my_center|LOCUS_24740 698325 697504 gene locus_tag LOCUS_24750 698325 697504 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029278.1 protein_id gnl|my_center|LOCUS_24750 698819 698475 gene locus_tag LOCUS_24760 698819 698475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 699144 698812 gene locus_tag LOCUS_24770 699144 698812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 699459 699220 gene locus_tag LOCUS_24780 699459 699220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 699650 700111 gene locus_tag LOCUS_24790 699650 700111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 700360 700178 gene locus_tag LOCUS_24800 700360 700178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 700663 703407 gene locus_tag LOCUS_24810 700663 703407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 703407 703871 gene locus_tag LOCUS_24820 703407 703871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 704867 704784 gene locus_tag LOCUS_t00290 704867 704784 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 705019 705513 gene locus_tag LOCUS_24830 705019 705513 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222510.1 protein_id gnl|my_center|LOCUS_24830 705683 707332 gene locus_tag LOCUS_24840 705683 707332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 708668 707409 gene locus_tag LOCUS_24850 708668 707409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 709715 708837 gene locus_tag LOCUS_24860 gene htpX 709715 708837 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974338.1 protein_id gnl|my_center|LOCUS_24860 711361 709889 gene locus_tag LOCUS_24870 711361 709889 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029760.1 protein_id gnl|my_center|LOCUS_24870 712904 711399 gene locus_tag LOCUS_24880 712904 711399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 714808 712901 gene locus_tag LOCUS_24890 714808 712901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 715230 714805 gene locus_tag LOCUS_24900 715230 714805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 715760 715227 gene locus_tag LOCUS_24910 715760 715227 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_24910 716353 715757 gene locus_tag LOCUS_24920 716353 715757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 716554 717129 gene locus_tag LOCUS_24930 716554 717129 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029739.1 protein_id gnl|my_center|LOCUS_24930 717532 717110 gene locus_tag LOCUS_24940 717532 717110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 717683 718720 gene locus_tag LOCUS_24950 717683 718720 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167582487.1 protein_id gnl|my_center|LOCUS_24950 719858 718896 gene locus_tag LOCUS_24960 719858 718896 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029756.1 protein_id gnl|my_center|LOCUS_24960 720628 719858 gene locus_tag LOCUS_24970 720628 719858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24970 720802 721848 gene locus_tag LOCUS_24980 720802 721848 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223306.1 protein_id gnl|my_center|LOCUS_24980 723182 721866 gene locus_tag LOCUS_24990 723182 721866 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 protein_id gnl|my_center|LOCUS_24990 723455 723219 gene locus_tag LOCUS_25000 723455 723219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 723814 723452 gene locus_tag LOCUS_25010 723814 723452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 723977 724258 gene locus_tag LOCUS_25020 723977 724258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 725592 724987 gene locus_tag LOCUS_25030 725592 724987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 727181 725655 gene locus_tag LOCUS_25040 727181 725655 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226839.1 protein_id gnl|my_center|LOCUS_25040 728642 727209 gene locus_tag LOCUS_25050 728642 727209 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226840.1 protein_id gnl|my_center|LOCUS_25050 728986 728675 gene locus_tag LOCUS_25060 728986 728675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 729071 730180 gene locus_tag LOCUS_25070 gene proB 729071 730180 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_25070 730217 731461 gene locus_tag LOCUS_25080 730217 731461 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_25080 731797 731480 gene locus_tag LOCUS_25090 731797 731480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 732614 731784 gene locus_tag LOCUS_25100 732614 731784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 733970 732711 gene locus_tag LOCUS_25110 gene moeZ 733970 732711 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_25110 734788 734000 gene locus_tag LOCUS_25120 734788 734000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 735786 734947 gene locus_tag LOCUS_25130 735786 734947 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742157.1 protein_id gnl|my_center|LOCUS_25130 736883 735909 gene locus_tag LOCUS_25140 736883 735909 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030094.1 protein_id gnl|my_center|LOCUS_25140 740379 737080 gene locus_tag LOCUS_25150 740379 737080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 740529 741167 gene locus_tag LOCUS_25160 740529 741167 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_25160 741233 741460 gene locus_tag LOCUS_25170 741233 741460 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893314.1 protein_id gnl|my_center|LOCUS_25170 742097 743812 gene locus_tag LOCUS_25180 742097 743812 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223014.1 protein_id gnl|my_center|LOCUS_25180 743958 745109 gene locus_tag LOCUS_25190 743958 745109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 745592 745134 gene locus_tag LOCUS_25200 745592 745134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 745880 746296 gene locus_tag LOCUS_25210 745880 746296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 747421 746393 gene locus_tag LOCUS_25220 747421 746393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091127472.1 protein_id gnl|my_center|LOCUS_25220 749868 747694 gene locus_tag LOCUS_25230 749868 747694 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030473.1 protein_id gnl|my_center|LOCUS_25230 750258 749983 gene locus_tag LOCUS_25240 750258 749983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 750602 750252 gene locus_tag LOCUS_25250 750602 750252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 750892 751128 gene locus_tag LOCUS_25260 750892 751128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 751335 752510 gene locus_tag LOCUS_25270 gene tcmP 751335 752510 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115511.1 protein_id gnl|my_center|LOCUS_25270 753308 752553 gene locus_tag LOCUS_25280 753308 752553 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_25280 754106 753501 gene locus_tag LOCUS_25290 754106 753501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 754086 755420 gene locus_tag LOCUS_25300 754086 755420 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_25300 755410 756078 gene locus_tag LOCUS_25310 755410 756078 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_25310 757744 756083 gene locus_tag LOCUS_25320 757744 756083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 759341 757815 gene locus_tag LOCUS_25330 759341 757815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 760454 759405 gene locus_tag LOCUS_25340 760454 759405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 761540 760731 gene locus_tag LOCUS_25350 761540 760731 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532140.1 protein_id gnl|my_center|LOCUS_25350 761985 761533 gene locus_tag LOCUS_25360 761985 761533 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229349.1 protein_id gnl|my_center|LOCUS_25360 763721 761982 gene locus_tag LOCUS_25370 763721 761982 CDS product CHASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731061.1 protein_id gnl|my_center|LOCUS_25370 764962 763718 gene locus_tag LOCUS_25380 764962 763718 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229351.1 protein_id gnl|my_center|LOCUS_25380 765192 767630 gene locus_tag LOCUS_25390 765192 767630 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228011.1 protein_id gnl|my_center|LOCUS_25390 767778 768014 gene locus_tag LOCUS_25400 767778 768014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 769640 768153 gene locus_tag LOCUS_25410 769640 768153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 769783 770238 gene locus_tag LOCUS_25420 769783 770238 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862546.1 protein_id gnl|my_center|LOCUS_25420 770548 770294 gene locus_tag LOCUS_25430 770548 770294 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224398.1 protein_id gnl|my_center|LOCUS_25430 771074 770706 gene locus_tag LOCUS_25440 771074 770706 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977977.1 protein_id gnl|my_center|LOCUS_25440 772035 771184 gene locus_tag LOCUS_25450 772035 771184 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 protein_id gnl|my_center|LOCUS_25450 772069 773694 gene locus_tag LOCUS_25460 772069 773694 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972254.1 protein_id gnl|my_center|LOCUS_25460 773734 774051 gene locus_tag LOCUS_25470 773734 774051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 774099 774824 gene locus_tag LOCUS_25480 774099 774824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 775437 777101 gene locus_tag LOCUS_25490 775437 777101 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193073.1 protein_id gnl|my_center|LOCUS_25490 780026 777156 gene locus_tag LOCUS_25500 780026 777156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 780456 780241 gene locus_tag LOCUS_25510 780456 780241 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028303.1 protein_id gnl|my_center|LOCUS_25510 780513 782174 gene locus_tag LOCUS_25520 780513 782174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 782247 783260 gene locus_tag LOCUS_25530 782247 783260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 783384 786659 gene locus_tag LOCUS_25540 783384 786659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 786886 787959 gene locus_tag LOCUS_25550 786886 787959 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084879622.1 protein_id gnl|my_center|LOCUS_25550 788561 788061 gene locus_tag LOCUS_25560 788561 788061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 790044 789061 gene locus_tag LOCUS_25570 gene hemB 790044 789061 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831526.1 protein_id gnl|my_center|LOCUS_25570 791643 790063 gene locus_tag LOCUS_25580 791643 790063 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222417.1 protein_id gnl|my_center|LOCUS_25580 792608 791640 gene locus_tag LOCUS_25590 gene hemC 792608 791640 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061881.1 protein_id gnl|my_center|LOCUS_25590 793948 792605 gene locus_tag LOCUS_25600 793948 792605 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402699.1 protein_id gnl|my_center|LOCUS_25600 794718 793945 gene locus_tag LOCUS_25610 794718 793945 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_25610 794865 795074 gene locus_tag LOCUS_25620 794865 795074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 795071 796366 gene locus_tag LOCUS_25630 795071 796366 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104242.1 protein_id gnl|my_center|LOCUS_25630 796363 797070 gene locus_tag LOCUS_25640 796363 797070 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726958.1 protein_id gnl|my_center|LOCUS_25640 797731 797081 gene locus_tag LOCUS_25650 797731 797081 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_25650 798055 797801 gene locus_tag LOCUS_25660 798055 797801 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030145241.1 protein_id gnl|my_center|LOCUS_25660 799457 798045 gene locus_tag LOCUS_25670 799457 798045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 799997 800986 gene locus_tag LOCUS_25680 799997 800986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 801361 802254 gene locus_tag LOCUS_25690 801361 802254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 802555 803430 gene locus_tag LOCUS_25700 802555 803430 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878084.1 protein_id gnl|my_center|LOCUS_25700 804640 803576 gene locus_tag LOCUS_25710 804640 803576 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975511.1 protein_id gnl|my_center|LOCUS_25710 805710 804637 gene locus_tag LOCUS_25720 805710 804637 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_25720 805982 805830 gene locus_tag LOCUS_25730 805982 805830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 806366 806157 gene locus_tag LOCUS_25740 806366 806157 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222402.1 protein_id gnl|my_center|LOCUS_25740 806976 806806 gene locus_tag LOCUS_25750 806976 806806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 808176 807109 gene locus_tag LOCUS_25760 808176 807109 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028949.1 protein_id gnl|my_center|LOCUS_25760 808525 808319 gene locus_tag LOCUS_25770 808525 808319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 808418 809413 gene locus_tag LOCUS_25780 808418 809413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 809922 809461 gene locus_tag LOCUS_25790 809922 809461 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028365.1 protein_id gnl|my_center|LOCUS_25790 810506 809919 gene locus_tag LOCUS_25800 810506 809919 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222694.1 protein_id gnl|my_center|LOCUS_25800 810569 811564 gene locus_tag LOCUS_25810 810569 811564 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727621.1 protein_id gnl|my_center|LOCUS_25810 812816 811587 gene locus_tag LOCUS_25820 812816 811587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 813921 812953 gene locus_tag LOCUS_25830 813921 812953 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_25830 813983 814252 gene locus_tag LOCUS_25840 813983 814252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 814254 815420 gene locus_tag LOCUS_25850 814254 815420 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112824.1 protein_id gnl|my_center|LOCUS_25850 815440 816012 gene locus_tag LOCUS_25860 815440 816012 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973714.1 protein_id gnl|my_center|LOCUS_25860 816941 816147 gene locus_tag LOCUS_25870 816941 816147 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 protein_id gnl|my_center|LOCUS_25870 817973 817029 gene locus_tag LOCUS_25880 817973 817029 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222397.1 protein_id gnl|my_center|LOCUS_25880 818048 818854 gene locus_tag LOCUS_25890 818048 818854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_25890 819637 818954 gene locus_tag LOCUS_25900 819637 818954 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_25900 820961 819660 gene locus_tag LOCUS_25910 820961 819660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 821174 821827 gene locus_tag LOCUS_25920 gene phoU 821174 821827 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_25920 822673 821897 gene locus_tag LOCUS_25930 822673 821897 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974762.1 protein_id gnl|my_center|LOCUS_25930 822579 822764 gene locus_tag LOCUS_25940 822579 822764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 822816 824195 gene locus_tag LOCUS_25950 822816 824195 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_25950 824277 825575 gene locus_tag LOCUS_25960 824277 825575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 827149 826121 gene locus_tag LOCUS_25970 827149 826121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 827750 827229 gene locus_tag LOCUS_25980 827750 827229 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222390.1 protein_id gnl|my_center|LOCUS_25980 829199 827841 gene locus_tag LOCUS_25990 gene mshA 829199 827841 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_25990 829392 830159 gene locus_tag LOCUS_26000 829392 830159 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975536.1 protein_id gnl|my_center|LOCUS_26000 830202 830981 gene locus_tag LOCUS_26010 830202 830981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222384.1 protein_id gnl|my_center|LOCUS_26010 831939 830989 gene locus_tag LOCUS_26020 831939 830989 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222386.1 protein_id gnl|my_center|LOCUS_26020 832150 832908 gene locus_tag LOCUS_26030 832150 832908 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094000.1 protein_id gnl|my_center|LOCUS_26030 833237 834616 gene locus_tag LOCUS_26040 833237 834616 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_26040 834636 835643 gene locus_tag LOCUS_26050 834636 835643 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031126.1 protein_id gnl|my_center|LOCUS_26050 835703 836119 gene locus_tag LOCUS_26060 835703 836119 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031693.1 protein_id gnl|my_center|LOCUS_26060 836116 837012 gene locus_tag LOCUS_26070 836116 837012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 837597 837073 gene locus_tag LOCUS_26080 837597 837073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 837944 837648 gene locus_tag LOCUS_26090 837944 837648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 838075 838305 gene locus_tag LOCUS_26100 838075 838305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 838368 838583 gene locus_tag LOCUS_26110 838368 838583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 839182 838673 gene locus_tag LOCUS_26120 839182 838673 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030929.1 protein_id gnl|my_center|LOCUS_26120 840053 839184 gene locus_tag LOCUS_26130 840053 839184 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028326.1 protein_id gnl|my_center|LOCUS_26130 840145 841122 gene locus_tag LOCUS_26140 840145 841122 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976631.1 protein_id gnl|my_center|LOCUS_26140 841174 841881 gene locus_tag LOCUS_26150 841174 841881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 842877 841996 gene locus_tag LOCUS_26160 842877 841996 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027226.1 protein_id gnl|my_center|LOCUS_26160 843011 844387 gene locus_tag LOCUS_26170 843011 844387 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230065.1 protein_id gnl|my_center|LOCUS_26170 845357 844470 gene locus_tag LOCUS_26180 845357 844470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 845671 845354 gene locus_tag LOCUS_26190 845671 845354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 846490 845753 gene locus_tag LOCUS_26200 846490 845753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 847215 846487 gene locus_tag LOCUS_26210 847215 846487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 847308 848105 gene locus_tag LOCUS_26220 847308 848105 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227110.1 protein_id gnl|my_center|LOCUS_26220 849091 848156 gene locus_tag LOCUS_26230 849091 848156 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_26230 849960 849130 gene locus_tag LOCUS_26240 849960 849130 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_26240 851129 850017 gene locus_tag LOCUS_26250 851129 850017 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230728.1 protein_id gnl|my_center|LOCUS_26250 851557 851126 gene locus_tag LOCUS_26260 851557 851126 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_26260 852206 851613 gene locus_tag LOCUS_26270 852206 851613 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230723.1 protein_id gnl|my_center|LOCUS_26270 852390 852752 gene locus_tag LOCUS_26280 852390 852752 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974797.1 protein_id gnl|my_center|LOCUS_26280 853466 852798 gene locus_tag LOCUS_26290 853466 852798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 854045 853512 gene locus_tag LOCUS_26300 854045 853512 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230782.1 protein_id gnl|my_center|LOCUS_26300 854247 855371 gene locus_tag LOCUS_26310 854247 855371 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027750.1 protein_id gnl|my_center|LOCUS_26310 855368 856051 gene locus_tag LOCUS_26320 855368 856051 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977459.1 protein_id gnl|my_center|LOCUS_26320 856074 856661 gene locus_tag LOCUS_26330 856074 856661 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973388.1 protein_id gnl|my_center|LOCUS_26330 857544 856693 gene locus_tag LOCUS_26340 857544 856693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 857704 858066 gene locus_tag LOCUS_26350 857704 858066 CDS product DUF2089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583104.1 protein_id gnl|my_center|LOCUS_26350 858066 858323 gene locus_tag LOCUS_26360 858066 858323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 858335 858757 gene locus_tag LOCUS_26370 858335 858757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 859657 859160 gene locus_tag LOCUS_26380 859657 859160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 860742 860335 gene locus_tag LOCUS_26390 860742 860335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 861167 860928 gene locus_tag LOCUS_26400 861167 860928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 861416 861853 gene locus_tag LOCUS_26410 861416 861853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 861850 862104 gene locus_tag LOCUS_26420 861850 862104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 862533 862213 gene locus_tag LOCUS_26430 862533 862213 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404278.1 protein_id gnl|my_center|LOCUS_26430 863385 862537 gene locus_tag LOCUS_26440 863385 862537 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730790.1 protein_id gnl|my_center|LOCUS_26440 864584 863796 gene locus_tag LOCUS_26450 864584 863796 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974808.1 protein_id gnl|my_center|LOCUS_26450 865805 864750 gene locus_tag LOCUS_26460 865805 864750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 866105 866773 gene locus_tag LOCUS_26470 866105 866773 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898599.1 protein_id gnl|my_center|LOCUS_26470 867399 868274 gene locus_tag LOCUS_26480 867399 868274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 868345 869271 gene locus_tag LOCUS_26490 gene mshD 868345 869271 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_26490 869463 870569 gene locus_tag LOCUS_26500 gene pstS 869463 870569 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974827.1 protein_id gnl|my_center|LOCUS_26500 870614 871705 gene locus_tag LOCUS_26510 gene pstC 870614 871705 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029460.1 protein_id gnl|my_center|LOCUS_26510 871702 872790 gene locus_tag LOCUS_26520 gene pstA 871702 872790 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 protein_id gnl|my_center|LOCUS_26520 872787 873584 gene locus_tag LOCUS_26530 gene pstB 872787 873584 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974830.1 protein_id gnl|my_center|LOCUS_26530 874525 873692 gene locus_tag LOCUS_26540 874525 873692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_26540 874607 875575 gene locus_tag LOCUS_26550 874607 875575 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_26550 876631 875624 gene locus_tag LOCUS_26560 gene pitH 876631 875624 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029459.1 protein_id gnl|my_center|LOCUS_26560 877262 876636 gene locus_tag LOCUS_26570 877262 876636 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_26570 877774 877418 gene locus_tag LOCUS_26580 877774 877418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 878363 877857 gene locus_tag LOCUS_26590 878363 877857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 878501 880663 gene locus_tag LOCUS_26600 878501 880663 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 protein_id gnl|my_center|LOCUS_26600 881899 880760 gene locus_tag LOCUS_26610 881899 880760 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231015.1 protein_id gnl|my_center|LOCUS_26610 881784 882176 gene locus_tag LOCUS_26620 881784 882176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 882260 882607 gene locus_tag LOCUS_26630 882260 882607 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 protein_id gnl|my_center|LOCUS_26630 882746 882913 gene locus_tag LOCUS_26640 882746 882913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 884447 882942 gene locus_tag LOCUS_26650 884447 882942 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029441.1 protein_id gnl|my_center|LOCUS_26650 884639 885910 gene locus_tag LOCUS_26660 884639 885910 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224833.1 protein_id gnl|my_center|LOCUS_26660 887183 885918 gene locus_tag LOCUS_26670 887183 885918 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 protein_id gnl|my_center|LOCUS_26670 887244 887906 gene locus_tag LOCUS_26680 887244 887906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974662.1 protein_id gnl|my_center|LOCUS_26680 888421 888149 gene locus_tag LOCUS_26690 888421 888149 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974664.1 protein_id gnl|my_center|LOCUS_26690 888457 889857 gene locus_tag LOCUS_26700 888457 889857 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975885.1 protein_id gnl|my_center|LOCUS_26700 891714 889882 gene locus_tag LOCUS_26710 891714 889882 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_26710 891778 894315 gene locus_tag LOCUS_26720 891778 894315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 894400 895338 gene locus_tag LOCUS_26730 894400 895338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 895357 895764 gene locus_tag LOCUS_26740 895357 895764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 897462 895840 gene locus_tag LOCUS_26750 gene groL 897462 895840 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_26750 897994 898950 gene locus_tag LOCUS_26760 897994 898950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 899211 899008 gene locus_tag LOCUS_26770 899211 899008 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004929928.1 protein_id gnl|my_center|LOCUS_26770 899436 900029 gene locus_tag LOCUS_26780 899436 900029 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929931.1 protein_id gnl|my_center|LOCUS_26780 901774 900101 gene locus_tag LOCUS_26790 gene paaN 901774 900101 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186941.1 protein_id gnl|my_center|LOCUS_26790 902957 901938 gene locus_tag LOCUS_26800 902957 901938 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804257.1 protein_id gnl|my_center|LOCUS_26800 904629 903316 gene locus_tag LOCUS_26810 gene thrC 904629 903316 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270150.1 protein_id gnl|my_center|LOCUS_26810 904843 905436 gene locus_tag LOCUS_26820 904843 905436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 905693 906400 gene locus_tag LOCUS_26830 905693 906400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 906852 906478 gene locus_tag LOCUS_26840 906852 906478 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532314.1 protein_id gnl|my_center|LOCUS_26840 907103 906849 gene locus_tag LOCUS_26850 907103 906849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 907056 907307 gene locus_tag LOCUS_26860 907056 907307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 908937 908011 gene locus_tag LOCUS_26870 908937 908011 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090584.1 protein_id gnl|my_center|LOCUS_26870 909054 909425 gene locus_tag LOCUS_26880 909054 909425 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974289.1 protein_id gnl|my_center|LOCUS_26880 911255 910383 gene locus_tag LOCUS_26890 911255 910383 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227901.1 protein_id gnl|my_center|LOCUS_26890 914113 911255 gene locus_tag LOCUS_26900 914113 911255 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227899.1 protein_id gnl|my_center|LOCUS_26900 914499 915746 gene locus_tag LOCUS_26910 914499 915746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 915733 918672 gene locus_tag LOCUS_26920 915733 918672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 918669 919142 gene locus_tag LOCUS_26930 918669 919142 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003061341.1 protein_id gnl|my_center|LOCUS_26930 919139 919621 gene locus_tag LOCUS_26940 919139 919621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 919599 920387 gene locus_tag LOCUS_26950 919599 920387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 920432 921196 gene locus_tag LOCUS_26960 920432 921196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 921374 923695 gene locus_tag LOCUS_26970 921374 923695 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230289.1 protein_id gnl|my_center|LOCUS_26970 924291 923791 gene locus_tag LOCUS_26980 924291 923791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 925283 924405 gene locus_tag LOCUS_26990 925283 924405 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803977.1 protein_id gnl|my_center|LOCUS_26990 925545 925760 gene locus_tag LOCUS_27000 925545 925760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 926348 925809 gene locus_tag LOCUS_27010 926348 925809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 927507 926488 gene locus_tag LOCUS_27020 927507 926488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 928454 927504 gene locus_tag LOCUS_27030 928454 927504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_27030 929396 928611 gene locus_tag LOCUS_27040 929396 928611 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027539.1 protein_id gnl|my_center|LOCUS_27040 929593 930522 gene locus_tag LOCUS_27050 929593 930522 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007446839.1 protein_id gnl|my_center|LOCUS_27050 930567 931439 gene locus_tag LOCUS_27060 930567 931439 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029555.1 protein_id gnl|my_center|LOCUS_27060 931439 932548 gene locus_tag LOCUS_27070 gene nagA 931439 932548 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029554.1 protein_id gnl|my_center|LOCUS_27070 933953 932730 gene locus_tag LOCUS_27080 933953 932730 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804886.1 protein_id gnl|my_center|LOCUS_27080 934031 934804 gene locus_tag LOCUS_27090 934031 934804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 936692 934806 gene locus_tag LOCUS_27100 936692 934806 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029118.1 protein_id gnl|my_center|LOCUS_27100 936691 937173 gene locus_tag LOCUS_27110 936691 937173 CDS product MSMEG_6728 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467217.1 protein_id gnl|my_center|LOCUS_27110 937246 938787 gene locus_tag LOCUS_27120 937246 938787 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877361.1 protein_id gnl|my_center|LOCUS_27120 938865 940076 gene locus_tag LOCUS_27130 938865 940076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 940298 940741 gene locus_tag LOCUS_27140 940298 940741 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226091.1 protein_id gnl|my_center|LOCUS_27140 941602 940835 gene locus_tag LOCUS_27150 941602 940835 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972249.1 protein_id gnl|my_center|LOCUS_27150 941556 941750 gene locus_tag LOCUS_27160 941556 941750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 944118 941737 gene locus_tag LOCUS_27170 944118 941737 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286347.1 protein_id gnl|my_center|LOCUS_27170 944247 944840 gene locus_tag LOCUS_27180 944247 944840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 945518 944895 gene locus_tag LOCUS_27190 945518 944895 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971926.1 protein_id gnl|my_center|LOCUS_27190 946001 945582 gene locus_tag LOCUS_27200 946001 945582 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891553.1 protein_id gnl|my_center|LOCUS_27200 946435 946037 gene locus_tag LOCUS_27210 946435 946037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 947515 946808 gene locus_tag LOCUS_27220 947515 946808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 948681 948605 gene locus_tag LOCUS_t00300 948681 948605 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 949047 950138 gene locus_tag LOCUS_27230 gene ugpC 949047 950138 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222655.1 protein_id gnl|my_center|LOCUS_27230 950278 950874 gene locus_tag LOCUS_27240 950278 950874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 952073 950940 gene locus_tag LOCUS_27250 952073 950940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 953509 952073 gene locus_tag LOCUS_27260 gene cysS 953509 952073 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_27260 953528 954241 gene locus_tag LOCUS_27270 953528 954241 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975875.1 protein_id gnl|my_center|LOCUS_27270 954392 955762 gene locus_tag LOCUS_27280 954392 955762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 957507 955828 gene locus_tag LOCUS_27290 957507 955828 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229919.1 protein_id gnl|my_center|LOCUS_27290 958355 957654 gene locus_tag LOCUS_27300 958355 957654 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114346.1 protein_id gnl|my_center|LOCUS_27300 959372 958395 gene locus_tag LOCUS_27310 959372 958395 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892918.1 protein_id gnl|my_center|LOCUS_27310 959448 959993 gene locus_tag LOCUS_27320 959448 959993 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080565.1 protein_id gnl|my_center|LOCUS_27320 960577 960176 gene locus_tag LOCUS_27330 960577 960176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 960741 960574 gene locus_tag LOCUS_27340 960741 960574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 962422 961022 gene locus_tag LOCUS_27350 962422 961022 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_27350 962936 962703 gene locus_tag LOCUS_27360 962936 962703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 964636 962969 gene locus_tag LOCUS_27370 964636 962969 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_27370 966172 964730 gene locus_tag LOCUS_27380 966172 964730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 966799 966296 gene locus_tag LOCUS_27390 966799 966296 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028667.1 protein_id gnl|my_center|LOCUS_27390 966939 968144 gene locus_tag LOCUS_27400 gene hppD 966939 968144 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229829.1 protein_id gnl|my_center|LOCUS_27400 968519 968292 gene locus_tag LOCUS_27410 968519 968292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 968425 968958 gene locus_tag LOCUS_27420 968425 968958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27420 968955 969956 gene locus_tag LOCUS_27430 968955 969956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 969953 971056 gene locus_tag LOCUS_27440 gene hisC 969953 971056 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222222.1 protein_id gnl|my_center|LOCUS_27440 972320 971067 gene locus_tag LOCUS_27450 972320 971067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 972852 972370 gene locus_tag LOCUS_27460 972852 972370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 973188 972979 gene locus_tag LOCUS_27470 973188 972979 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_27470 974585 973389 gene locus_tag LOCUS_27480 gene fahA 974585 973389 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224839.1 protein_id gnl|my_center|LOCUS_27480 975448 974582 gene locus_tag LOCUS_27490 975448 974582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113317.1 protein_id gnl|my_center|LOCUS_27490 975543 976709 gene locus_tag LOCUS_27500 975543 976709 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222108.1 protein_id gnl|my_center|LOCUS_27500 976814 977758 gene locus_tag LOCUS_27510 976814 977758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 979452 977893 gene locus_tag LOCUS_27520 979452 977893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 980757 979663 gene locus_tag LOCUS_27530 980757 979663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 981232 980765 gene locus_tag LOCUS_27540 gene ispF 981232 980765 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029522.1 protein_id gnl|my_center|LOCUS_27540 981959 981264 gene locus_tag LOCUS_27550 gene ispD 981959 981264 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029521.1 protein_id gnl|my_center|LOCUS_27550 982499 982014 gene locus_tag LOCUS_27560 982499 982014 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559016.1 protein_id gnl|my_center|LOCUS_27560 982827 983558 gene locus_tag LOCUS_27570 982827 983558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 984249 983572 gene locus_tag LOCUS_27580 984249 983572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 985376 984327 gene locus_tag LOCUS_27590 985376 984327 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421605.1 protein_id gnl|my_center|LOCUS_27590 986323 985574 gene locus_tag LOCUS_27600 986323 985574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 986391 987221 gene locus_tag LOCUS_27610 986391 987221 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031819.1 protein_id gnl|my_center|LOCUS_27610 987303 988178 gene locus_tag LOCUS_27620 987303 988178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 988502 988344 gene locus_tag LOCUS_27630 988502 988344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 988435 989715 gene locus_tag LOCUS_27640 gene radA 988435 989715 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230399.1 protein_id gnl|my_center|LOCUS_27640 989852 991042 gene locus_tag LOCUS_27650 gene disA 989852 991042 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_27650 991921 991106 gene locus_tag LOCUS_27660 991921 991106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851224.1 protein_id gnl|my_center|LOCUS_27660 992560 992000 gene locus_tag LOCUS_27670 gene def 992560 992000 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 protein_id gnl|my_center|LOCUS_27670 993069 992557 gene locus_tag LOCUS_27680 993069 992557 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_27680 993151 994077 gene locus_tag LOCUS_27690 993151 994077 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_27690 996789 994258 gene locus_tag LOCUS_27700 996789 994258 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284160.1 protein_id gnl|my_center|LOCUS_27700 997691 997347 gene locus_tag LOCUS_27710 997691 997347 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_27710 999316 997808 gene locus_tag LOCUS_27720 gene lysS 999316 997808 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230454.1 protein_id gnl|my_center|LOCUS_27720 1000268 999510 gene locus_tag LOCUS_27730 1000268 999510 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230456.1 protein_id gnl|my_center|LOCUS_27730 1001259 1000354 gene locus_tag LOCUS_27740 gene nadC 1001259 1000354 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975452.1 protein_id gnl|my_center|LOCUS_27740 1002997 1001291 gene locus_tag LOCUS_27750 1002997 1001291 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 protein_id gnl|my_center|LOCUS_27750 1003961 1003065 gene locus_tag LOCUS_27760 1003961 1003065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 1004500 1004075 gene locus_tag LOCUS_27770 1004500 1004075 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027487.1 protein_id gnl|my_center|LOCUS_27770 1005375 1004527 gene locus_tag LOCUS_27780 gene panC 1005375 1004527 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731036.1 protein_id gnl|my_center|LOCUS_27780 1006411 1005434 gene locus_tag LOCUS_27790 1006411 1005434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 1006605 1007786 gene locus_tag LOCUS_27800 1006605 1007786 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028950.1 protein_id gnl|my_center|LOCUS_27800 1007783 1008943 gene locus_tag LOCUS_27810 1007783 1008943 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_27810 1009932 1008982 gene locus_tag LOCUS_27820 1009932 1008982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 1011036 1010035 gene locus_tag LOCUS_27830 1011036 1010035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 1011941 1011216 gene locus_tag LOCUS_27840 1011941 1011216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 1012719 1012036 gene locus_tag LOCUS_27850 1012719 1012036 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222372.1 protein_id gnl|my_center|LOCUS_27850 1012722 1013711 gene locus_tag LOCUS_27860 1012722 1013711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 1014263 1013763 gene locus_tag LOCUS_27870 1014263 1013763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 1014634 1014326 gene locus_tag LOCUS_27880 1014634 1014326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 1015965 1014763 gene locus_tag LOCUS_27890 1015965 1014763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 1016637 1016083 gene locus_tag LOCUS_27900 1016637 1016083 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897501.1 protein_id gnl|my_center|LOCUS_27900 1017169 1016642 gene locus_tag LOCUS_27910 gene folK 1017169 1016642 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230464.1 protein_id gnl|my_center|LOCUS_27910 1017642 1017166 gene locus_tag LOCUS_27920 1017642 1017166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 1018592 1017639 gene locus_tag LOCUS_27930 gene folP 1018592 1017639 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467816.1 protein_id gnl|my_center|LOCUS_27930 1018947 1019261 gene locus_tag LOCUS_27940 1018947 1019261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 1019272 1019634 gene locus_tag LOCUS_27950 1019272 1019634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 1019684 1023094 gene locus_tag LOCUS_27960 1019684 1023094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 1023096 1025054 gene locus_tag LOCUS_27970 1023096 1025054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 1025060 1025608 gene locus_tag LOCUS_27980 1025060 1025608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 1025605 1026756 gene locus_tag LOCUS_27990 1025605 1026756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 1026770 1027369 gene locus_tag LOCUS_28000 1026770 1027369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 1027939 1027376 gene locus_tag LOCUS_28010 1027939 1027376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 1028267 1031266 gene locus_tag LOCUS_28020 1028267 1031266 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112141171.1 protein_id gnl|my_center|LOCUS_28020 1031263 1032066 gene locus_tag LOCUS_28030 1031263 1032066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 1032717 1032127 gene locus_tag LOCUS_28040 gene folE 1032717 1032127 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_28040 1034840 1032825 gene locus_tag LOCUS_28050 gene ftsH 1034840 1032825 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_28050 1035791 1035219 gene locus_tag LOCUS_28060 gene hpt 1035791 1035219 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230473.1 protein_id gnl|my_center|LOCUS_28060 1036027 1037142 gene locus_tag LOCUS_28070 1036027 1037142 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030121.1 protein_id gnl|my_center|LOCUS_28070 1038296 1037232 gene locus_tag LOCUS_28080 gene tilS 1038296 1037232 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 protein_id gnl|my_center|LOCUS_28080 1038078 1037982 gene locus_tag LOCUS_t00310 1038078 1037982 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 1039374 1038307 gene locus_tag LOCUS_28090 1039374 1038307 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_28090 1041260 1039455 gene locus_tag LOCUS_28100 1041260 1039455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 1041417 1041923 gene locus_tag LOCUS_28110 1041417 1041923 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_28110 1043359 1041959 gene locus_tag LOCUS_28120 gene eccD 1043359 1041959 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224120.1 protein_id gnl|my_center|LOCUS_28120 1043460 1047440 gene locus_tag LOCUS_28130 1043460 1047440 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222635.1 protein_id gnl|my_center|LOCUS_28130 1047562 1048914 gene locus_tag LOCUS_28140 1047562 1048914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 1048985 1049797 gene locus_tag LOCUS_28150 1048985 1049797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 1049828 1050535 gene locus_tag LOCUS_28160 1049828 1050535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 1051739 1050561 gene locus_tag LOCUS_28170 gene marP 1051739 1050561 CDS product acid resistance serine protease MarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731101.1 protein_id gnl|my_center|LOCUS_28170 1052495 1051797 gene locus_tag LOCUS_28180 1052495 1051797 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_28180 1053145 1052492 gene locus_tag LOCUS_28190 1053145 1052492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 1053930 1053142 gene locus_tag LOCUS_28200 gene nth 1053930 1053142 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078343767.1 protein_id gnl|my_center|LOCUS_28200 1055201 1054038 gene locus_tag LOCUS_28210 1055201 1054038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 1055958 1055257 gene locus_tag LOCUS_28220 1055958 1055257 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031658.1 protein_id gnl|my_center|LOCUS_28220 1056176 1056853 gene locus_tag LOCUS_28230 gene crp 1056176 1056853 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908817.1 protein_id gnl|my_center|LOCUS_28230 1057617 1057060 gene locus_tag LOCUS_28240 1057617 1057060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 1058847 1057654 gene locus_tag LOCUS_28250 1058847 1057654 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222426.1 protein_id gnl|my_center|LOCUS_28250 1059584 1058844 gene locus_tag LOCUS_28260 1059584 1058844 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222425.1 protein_id gnl|my_center|LOCUS_28260 1060813 1059584 gene locus_tag LOCUS_28270 1060813 1059584 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222424.1 protein_id gnl|my_center|LOCUS_28270 1062635 1060860 gene locus_tag LOCUS_28280 gene phoR 1062635 1060860 CDS product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403870.1 protein_id gnl|my_center|LOCUS_28280 1063396 1062632 gene locus_tag LOCUS_28290 1063396 1062632 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 protein_id gnl|my_center|LOCUS_28290 1064795 1063482 gene locus_tag LOCUS_28300 1064795 1063482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 1065084 1065689 gene locus_tag LOCUS_28310 1065084 1065689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 1065831 1066574 gene locus_tag LOCUS_28320 1065831 1066574 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224574.1 protein_id gnl|my_center|LOCUS_28320 1067114 1066863 gene locus_tag LOCUS_28330 1067114 1066863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 1067164 1067769 gene locus_tag LOCUS_28340 1067164 1067769 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224757.1 protein_id gnl|my_center|LOCUS_28340 1067876 1068706 gene locus_tag LOCUS_28350 1067876 1068706 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270155.1 protein_id gnl|my_center|LOCUS_28350 1068703 1070379 gene locus_tag LOCUS_28360 1068703 1070379 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224751.1 protein_id gnl|my_center|LOCUS_28360 1070408 1072009 gene locus_tag LOCUS_28370 1070408 1072009 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974603.1 protein_id gnl|my_center|LOCUS_28370 1072023 1074014 gene locus_tag LOCUS_28380 1072023 1074014 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224754.1 protein_id gnl|my_center|LOCUS_28380 1074011 1075174 gene locus_tag LOCUS_28390 1074011 1075174 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730571.1 protein_id gnl|my_center|LOCUS_28390 1078862 1075365 gene locus_tag LOCUS_28400 1078862 1075365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224182.1 protein_id gnl|my_center|LOCUS_28400 1079322 1078897 gene locus_tag LOCUS_28410 1079322 1078897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 1079825 1079616 gene locus_tag LOCUS_28420 1079825 1079616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 1080700 1079825 gene locus_tag LOCUS_28430 1080700 1079825 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_28430 1080872 1081057 gene locus_tag LOCUS_28440 1080872 1081057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 1081054 1081272 gene locus_tag LOCUS_28450 1081054 1081272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 1081269 1081538 gene locus_tag LOCUS_28460 1081269 1081538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 1082495 1081569 gene locus_tag LOCUS_28470 1082495 1081569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 1083085 1083402 gene locus_tag LOCUS_28480 1083085 1083402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 1083799 1083608 gene locus_tag LOCUS_28490 1083799 1083608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 1084082 1083849 gene locus_tag LOCUS_28500 1084082 1083849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170106.1 protein_id gnl|my_center|LOCUS_28500 1084957 1084514 gene locus_tag LOCUS_28510 1084957 1084514 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974546.1 protein_id gnl|my_center|LOCUS_28510 1085495 1085022 gene locus_tag LOCUS_28520 1085495 1085022 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_28520 1085599 1086564 gene locus_tag LOCUS_28530 1085599 1086564 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227839.1 protein_id gnl|my_center|LOCUS_28530 1087773 1086628 gene locus_tag LOCUS_28540 1087773 1086628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 1088422 1088012 gene locus_tag LOCUS_28550 1088422 1088012 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974546.1 protein_id gnl|my_center|LOCUS_28550 1088877 1088428 gene locus_tag LOCUS_28560 1088877 1088428 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224404.1 protein_id gnl|my_center|LOCUS_28560 1089026 1089769 gene locus_tag LOCUS_28570 1089026 1089769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 1090825 1089782 gene locus_tag LOCUS_28580 1090825 1089782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 1091763 1090825 gene locus_tag LOCUS_28590 1091763 1090825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 1093705 1091894 gene locus_tag LOCUS_28600 1093705 1091894 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157683565.1 protein_id gnl|my_center|LOCUS_28600 1093880 1094233 gene locus_tag LOCUS_28610 1093880 1094233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 1095785 1094220 gene locus_tag LOCUS_28620 1095785 1094220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 1096327 1095815 gene locus_tag LOCUS_28630 1096327 1095815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 1100050 1096463 gene locus_tag LOCUS_28640 1100050 1096463 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394238.1 protein_id gnl|my_center|LOCUS_28640 1100859 1100047 gene locus_tag LOCUS_28650 1100859 1100047 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_28650 1101441 1100980 gene locus_tag LOCUS_28660 1101441 1100980 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092109.1 protein_id gnl|my_center|LOCUS_28660 1101602 1101447 gene locus_tag LOCUS_28670 1101602 1101447 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975360.1 protein_id gnl|my_center|LOCUS_28670 1102130 1101645 gene locus_tag LOCUS_28680 1102130 1101645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 1102837 1102388 gene locus_tag LOCUS_28690 1102837 1102388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 1103042 1103470 gene locus_tag LOCUS_28700 1103042 1103470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 1103548 1104525 gene locus_tag LOCUS_28710 1103548 1104525 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230565.1 protein_id gnl|my_center|LOCUS_28710 1104582 1105730 gene locus_tag LOCUS_28720 1104582 1105730 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_28720 1106054 1105737 gene locus_tag LOCUS_28730 gene wblA 1106054 1105737 CDS product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 protein_id gnl|my_center|LOCUS_28730 1106452 1108887 gene locus_tag LOCUS_28740 gene ponA2 1106452 1108887 CDS product transglycosylase/D,D-transpeptidase PonA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878583.1 protein_id gnl|my_center|LOCUS_28740 1109733 1109047 gene locus_tag LOCUS_28750 1109733 1109047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 1110296 1109841 gene locus_tag LOCUS_28760 1110296 1109841 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_28760 1110322 1111215 gene locus_tag LOCUS_28770 1110322 1111215 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908824.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28770 1111488 1111562 gene locus_tag LOCUS_t00320 1111488 1111562 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1112174 1111638 gene locus_tag LOCUS_28780 1112174 1111638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 1112606 1112262 gene locus_tag LOCUS_28790 1112606 1112262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 1113417 1112836 gene locus_tag LOCUS_28800 1113417 1112836 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230366.1 protein_id gnl|my_center|LOCUS_28800 1114262 1113504 gene locus_tag LOCUS_28810 1114262 1113504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 1114561 1115763 gene locus_tag LOCUS_28820 1114561 1115763 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227700.1 protein_id gnl|my_center|LOCUS_28820 1115766 1116005 gene locus_tag LOCUS_28830 1115766 1116005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 1116882 1116208 gene locus_tag LOCUS_28840 1116882 1116208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28840 1118341 1118042 gene locus_tag LOCUS_28850 1118341 1118042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 1118550 1118341 gene locus_tag LOCUS_28860 1118550 1118341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 1118482 1118658 gene locus_tag LOCUS_28870 1118482 1118658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 1120260 1120015 gene locus_tag LOCUS_28880 1120260 1120015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 1120560 1121726 gene locus_tag LOCUS_28890 1120560 1121726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 1121915 1122079 gene locus_tag LOCUS_28900 1121915 1122079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 >Feature sequence13 841 368 gene locus_tag LOCUS_28910 841 368 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730741.1 protein_id gnl|my_center|LOCUS_28910 1160 2095 gene locus_tag LOCUS_28920 1160 2095 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225335.1 protein_id gnl|my_center|LOCUS_28920 2550 5246 gene locus_tag LOCUS_28930 2550 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 5613 5347 gene locus_tag LOCUS_28940 5613 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 6812 5712 gene locus_tag LOCUS_28950 6812 5712 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977752.1 protein_id gnl|my_center|LOCUS_28950 7328 7002 gene locus_tag LOCUS_28960 7328 7002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 8287 7328 gene locus_tag LOCUS_28970 8287 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 9755 8298 gene locus_tag LOCUS_28980 9755 8298 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013396.1 protein_id gnl|my_center|LOCUS_28980 11140 9758 gene locus_tag LOCUS_28990 11140 9758 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_28990 11470 11147 gene locus_tag LOCUS_29000 11470 11147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 12439 11510 gene locus_tag LOCUS_29010 12439 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 14091 12547 gene locus_tag LOCUS_29020 14091 12547 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_29020 14991 14131 gene locus_tag LOCUS_29030 14991 14131 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229920.1 protein_id gnl|my_center|LOCUS_29030 16024 14984 gene locus_tag LOCUS_29040 16024 14984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_29040 16920 16021 gene locus_tag LOCUS_29050 16920 16021 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328129.1 protein_id gnl|my_center|LOCUS_29050 17840 16917 gene locus_tag LOCUS_29060 17840 16917 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_29060 19234 18182 gene locus_tag LOCUS_29070 19234 18182 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729196.1 protein_id gnl|my_center|LOCUS_29070 19458 20366 gene locus_tag LOCUS_29080 19458 20366 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432420.1 protein_id gnl|my_center|LOCUS_29080 20363 20512 gene locus_tag LOCUS_29090 20363 20512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 20512 21456 gene locus_tag LOCUS_29100 20512 21456 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337354.1 protein_id gnl|my_center|LOCUS_29100 21879 21715 gene locus_tag LOCUS_29110 21879 21715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 21872 22819 gene locus_tag LOCUS_29120 21872 22819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 23045 24058 gene locus_tag LOCUS_29130 23045 24058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 24331 24023 gene locus_tag LOCUS_29140 24331 24023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29140 24567 24328 gene locus_tag LOCUS_29150 24567 24328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29150 24603 24881 gene locus_tag LOCUS_29160 24603 24881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 25690 25016 gene locus_tag LOCUS_29170 25690 25016 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229666.1 protein_id gnl|my_center|LOCUS_29170 26073 25687 gene locus_tag LOCUS_29180 26073 25687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 26815 26261 gene locus_tag LOCUS_29190 26815 26261 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 protein_id gnl|my_center|LOCUS_29190 27302 26955 gene locus_tag LOCUS_29200 27302 26955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 27447 28556 gene locus_tag LOCUS_29210 27447 28556 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742181.1 protein_id gnl|my_center|LOCUS_29210 28553 29206 gene locus_tag LOCUS_29220 28553 29206 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222065.1 protein_id gnl|my_center|LOCUS_29220 >Feature sequence14 629 135 gene locus_tag LOCUS_29230 629 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 510 890 gene locus_tag LOCUS_29240 510 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 1157 867 gene locus_tag LOCUS_29250 1157 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 1048 2103 gene locus_tag LOCUS_29260 1048 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 2260 3324 gene locus_tag LOCUS_29270 2260 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 3756 3346 gene locus_tag LOCUS_29280 3756 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 5563 4391 gene locus_tag LOCUS_29290 5563 4391 CDS product McrBC 5-methylcytosine restriction system component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804187.1 protein_id gnl|my_center|LOCUS_29290 8387 5583 gene locus_tag LOCUS_29300 8387 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 8735 9430 gene locus_tag LOCUS_29310 8735 9430 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210395.1 protein_id gnl|my_center|LOCUS_29310 9427 10809 gene locus_tag LOCUS_29320 9427 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 10799 14110 gene locus_tag LOCUS_29330 10799 14110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 14091 15698 gene locus_tag LOCUS_29340 14091 15698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 15634 18063 gene locus_tag LOCUS_29350 15634 18063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 18065 19972 gene locus_tag LOCUS_29360 18065 19972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 21716 20439 gene locus_tag LOCUS_29370 21716 20439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 24787 21713 gene locus_tag LOCUS_29380 24787 21713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 25452 24799 gene locus_tag LOCUS_29390 25452 24799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 25988 25449 gene locus_tag LOCUS_29400 25988 25449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 27202 25985 gene locus_tag LOCUS_29410 27202 25985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 28376 27483 gene locus_tag LOCUS_29420 28376 27483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 >Feature sequence15 705 3974 gene locus_tag LOCUS_29430 705 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 3971 6520 gene locus_tag LOCUS_29440 3971 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 6520 7431 gene locus_tag LOCUS_29450 6520 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 7424 10450 gene locus_tag LOCUS_29460 7424 10450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 10417 11127 gene locus_tag LOCUS_29470 10417 11127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 11124 15578 gene locus_tag LOCUS_29480 11124 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 15580 16095 gene locus_tag LOCUS_29490 15580 16095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 16077 18086 gene locus_tag LOCUS_29500 16077 18086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 19362 18205 gene locus_tag LOCUS_29510 19362 18205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 20603 19359 gene locus_tag LOCUS_29520 20603 19359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 21736 20600 gene locus_tag LOCUS_29530 21736 20600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 22659 21733 gene locus_tag LOCUS_29540 22659 21733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 23462 22656 gene locus_tag LOCUS_29550 gene folE2 23462 22656 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_29550 23815 23459 gene locus_tag LOCUS_29560 gene queD 23815 23459 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090505.1 protein_id gnl|my_center|LOCUS_29560 24453 23815 gene locus_tag LOCUS_29570 gene queE 24453 23815 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810901.1 protein_id gnl|my_center|LOCUS_29570 25148 24453 gene locus_tag LOCUS_29580 gene queC 25148 24453 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_29580 25844 25617 gene locus_tag LOCUS_29590 25844 25617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 >Feature sequence16 820 95 gene locus_tag LOCUS_29600 820 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 1214 1876 gene locus_tag LOCUS_29610 gene prfH 1214 1876 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602086.1 protein_id gnl|my_center|LOCUS_29610 4171 1934 gene locus_tag LOCUS_29620 4171 1934 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316462.1 protein_id gnl|my_center|LOCUS_29620 4584 4943 gene locus_tag LOCUS_29630 4584 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 5207 5052 gene locus_tag LOCUS_29640 5207 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 5753 5310 gene locus_tag LOCUS_29650 5753 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 6659 6096 gene locus_tag LOCUS_29660 6659 6096 CDS product aspartyl/asparaginyl beta-hydroxylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142811.1 protein_id gnl|my_center|LOCUS_29660 7524 6922 gene locus_tag LOCUS_29670 7524 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 7771 7460 gene locus_tag LOCUS_29680 7771 7460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29680 8831 7836 gene locus_tag LOCUS_29690 8831 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29690 9235 8831 gene locus_tag LOCUS_29700 9235 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085100849.1 protein_id gnl|my_center|LOCUS_29700 9497 9333 gene locus_tag LOCUS_29710 9497 9333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 10506 9745 gene locus_tag LOCUS_29720 10506 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 11360 10575 gene locus_tag LOCUS_29730 11360 10575 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529940.1 protein_id gnl|my_center|LOCUS_29730 12607 11357 gene locus_tag LOCUS_29740 12607 11357 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226021.1 protein_id gnl|my_center|LOCUS_29740 13214 12588 gene locus_tag LOCUS_29750 13214 12588 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228584.1 protein_id gnl|my_center|LOCUS_29750 13254 13745 gene locus_tag LOCUS_29760 13254 13745 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192716.1 protein_id gnl|my_center|LOCUS_29760 14095 13931 gene locus_tag LOCUS_29770 14095 13931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 14287 14523 gene locus_tag LOCUS_29780 14287 14523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 16134 15043 gene locus_tag LOCUS_29790 16134 15043 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075004273.1 protein_id gnl|my_center|LOCUS_29790 16842 17138 gene locus_tag LOCUS_29800 16842 17138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 17403 17750 gene locus_tag LOCUS_29810 17403 17750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 18379 18582 gene locus_tag LOCUS_29820 18379 18582 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_29820 19434 18820 gene locus_tag LOCUS_29830 19434 18820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 20891 19458 gene locus_tag LOCUS_29840 20891 19458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 21990 20938 gene locus_tag LOCUS_29850 21990 20938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 >Feature sequence17 3306 204 gene locus_tag LOCUS_r00040 3306 204 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5199 3686 gene locus_tag LOCUS_r00050 5199 3686 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence18 442 1320 gene locus_tag LOCUS_29860 442 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 4689 1888 gene locus_tag LOCUS_29870 4689 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 2438 2447 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4831 4971 gene locus_tag LOCUS_29880 4831 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 >Feature sequence19 132 371 gene locus_tag LOCUS_29890 132 371 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731611.1 protein_id gnl|my_center|LOCUS_29890 368 1231 gene locus_tag LOCUS_29900 368 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29900 2056 1544 gene locus_tag LOCUS_29910 2056 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29910 >Feature sequence20 221 691 gene locus_tag LOCUS_29920 221 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 701 1003 gene locus_tag LOCUS_29930 701 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 >Feature sequence21 112 474 gene locus_tag LOCUS_29940 112 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085100849.1 protein_id gnl|my_center|LOCUS_29940 528 1478 gene locus_tag LOCUS_29950 528 1478 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418263.1 protein_id gnl|my_center|LOCUS_29950 >Feature sequence22 1300 56 gene locus_tag LOCUS_29960 1300 56 CDS product IS256-like element IS1081 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901078.1 protein_id gnl|my_center|LOCUS_29960 >Feature sequence23 997 392 gene locus_tag LOCUS_29970 997 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 1789 1214 gene locus_tag LOCUS_29980 1789 1214 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030768.1 protein_id gnl|my_center|LOCUS_29980 1859 2521 gene locus_tag LOCUS_29990 1859 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 3134 2655 gene locus_tag LOCUS_30000 3134 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 3993 3358 gene locus_tag LOCUS_30010 3993 3358 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854343.1 protein_id gnl|my_center|LOCUS_30010 4129 5349 gene locus_tag LOCUS_30020 4129 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 5613 6989 gene locus_tag LOCUS_30030 5613 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 7920 7090 gene locus_tag LOCUS_30040 7920 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 8136 11105 gene locus_tag LOCUS_30050 8136 11105 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_30050 12357 11275 gene locus_tag LOCUS_30060 12357 11275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 13093 12437 gene locus_tag LOCUS_30070 13093 12437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 14184 13339 gene locus_tag LOCUS_30080 14184 13339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972703.1 protein_id gnl|my_center|LOCUS_30080 15428 14187 gene locus_tag LOCUS_30090 15428 14187 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030748.1 protein_id gnl|my_center|LOCUS_30090 15877 15503 gene locus_tag LOCUS_30100 15877 15503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 17572 15980 gene locus_tag LOCUS_30110 17572 15980 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_30110 17785 18633 gene locus_tag LOCUS_30120 gene rsmI 17785 18633 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_30120 19604 18678 gene locus_tag LOCUS_30130 19604 18678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 19816 21639 gene locus_tag LOCUS_30140 gene metG 19816 21639 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775786.1 protein_id gnl|my_center|LOCUS_30140 22669 21773 gene locus_tag LOCUS_30150 22669 21773 CDS product bromoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074324.1 protein_id gnl|my_center|LOCUS_30150 22730 23644 gene locus_tag LOCUS_30160 22730 23644 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_30160 23638 24510 gene locus_tag LOCUS_30170 gene rsmA 23638 24510 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229977.1 protein_id gnl|my_center|LOCUS_30170 24520 25476 gene locus_tag LOCUS_30180 24520 25476 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021269012.1 protein_id gnl|my_center|LOCUS_30180 25669 27474 gene locus_tag LOCUS_30190 25669 27474 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_30190 27589 28044 gene locus_tag LOCUS_30200 27589 28044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 28272 28646 gene locus_tag LOCUS_30210 28272 28646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 29271 28669 gene locus_tag LOCUS_30220 29271 28669 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 protein_id gnl|my_center|LOCUS_30220 29257 29709 gene locus_tag LOCUS_30230 29257 29709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 29753 29824 gene locus_tag LOCUS_t00330 29753 29824 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 29897 31357 gene locus_tag LOCUS_30240 gene glmU 29897 31357 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_30240 31495 32475 gene locus_tag LOCUS_30250 31495 32475 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229964.1 protein_id gnl|my_center|LOCUS_30250 32843 33535 gene locus_tag LOCUS_30260 32843 33535 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229968.1 protein_id gnl|my_center|LOCUS_30260 33654 34244 gene locus_tag LOCUS_30270 gene pth 33654 34244 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975689.1 protein_id gnl|my_center|LOCUS_30270 34365 34826 gene locus_tag LOCUS_30280 34365 34826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 34906 35817 gene locus_tag LOCUS_30290 gene cysD 34906 35817 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972822.1 protein_id gnl|my_center|LOCUS_30290 35817 37118 gene locus_tag LOCUS_30300 35817 37118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 38456 37284 gene locus_tag LOCUS_30310 gene galK 38456 37284 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224288.1 protein_id gnl|my_center|LOCUS_30310 39436 38453 gene locus_tag LOCUS_30320 gene galE 39436 38453 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975676.1 protein_id gnl|my_center|LOCUS_30320 39644 40570 gene locus_tag LOCUS_30330 39644 40570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 40642 41229 gene locus_tag LOCUS_30340 40642 41229 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029900.1 protein_id gnl|my_center|LOCUS_30340 41278 42201 gene locus_tag LOCUS_30350 41278 42201 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974125.1 protein_id gnl|my_center|LOCUS_30350 42302 42745 gene locus_tag LOCUS_30360 42302 42745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 44620 42983 gene locus_tag LOCUS_30370 44620 42983 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_30370 45872 44784 gene locus_tag LOCUS_30380 45872 44784 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_30380 46072 47331 gene locus_tag LOCUS_30390 46072 47331 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804843.1 protein_id gnl|my_center|LOCUS_30390 47331 48971 gene locus_tag LOCUS_30400 47331 48971 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804842.1 protein_id gnl|my_center|LOCUS_30400 48968 49894 gene locus_tag LOCUS_30410 48968 49894 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804841.1 protein_id gnl|my_center|LOCUS_30410 50107 51966 gene locus_tag LOCUS_30420 gene malZ 50107 51966 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257409.1 protein_id gnl|my_center|LOCUS_30420 52332 51958 gene locus_tag LOCUS_30430 52332 51958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 52393 52734 gene locus_tag LOCUS_30440 52393 52734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897762.1 protein_id gnl|my_center|LOCUS_30440 53001 54080 gene locus_tag LOCUS_30450 53001 54080 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776144.1 protein_id gnl|my_center|LOCUS_30450 54399 55853 gene locus_tag LOCUS_30460 54399 55853 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776143.1 protein_id gnl|my_center|LOCUS_30460 55850 57229 gene locus_tag LOCUS_30470 55850 57229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30470 57242 58513 gene locus_tag LOCUS_30480 57242 58513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 58690 59397 gene locus_tag LOCUS_30490 58690 59397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 59456 60736 gene locus_tag LOCUS_30500 59456 60736 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 protein_id gnl|my_center|LOCUS_30500 60848 61528 gene locus_tag LOCUS_30510 60848 61528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 62434 61556 gene locus_tag LOCUS_30520 62434 61556 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014130.1 protein_id gnl|my_center|LOCUS_30520 62633 62436 gene locus_tag LOCUS_30530 62633 62436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 63192 62719 gene locus_tag LOCUS_30540 63192 62719 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031862.1 protein_id gnl|my_center|LOCUS_30540 63416 63694 gene locus_tag LOCUS_30550 63416 63694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 63691 64104 gene locus_tag LOCUS_30560 63691 64104 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406060.1 protein_id gnl|my_center|LOCUS_30560 64256 65335 gene locus_tag LOCUS_30570 64256 65335 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_30570 65941 65336 gene locus_tag LOCUS_30580 65941 65336 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189397579.1 protein_id gnl|my_center|LOCUS_30580 66135 69692 gene locus_tag LOCUS_30590 66135 69692 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030302.1 protein_id gnl|my_center|LOCUS_30590 69689 70093 gene locus_tag LOCUS_30600 69689 70093 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561253.1 protein_id gnl|my_center|LOCUS_30600 70197 70574 gene locus_tag LOCUS_30610 70197 70574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 70555 71169 gene locus_tag LOCUS_30620 70555 71169 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230254.1 protein_id gnl|my_center|LOCUS_30620 72541 71318 gene locus_tag LOCUS_30630 72541 71318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 75470 72867 gene locus_tag LOCUS_30640 75470 72867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 73511 73603 gene locus_tag LOCUS_t00340 73511 73603 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 76551 75535 gene locus_tag LOCUS_30650 76551 75535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 78815 76827 gene locus_tag LOCUS_30660 78815 76827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 80488 78812 gene locus_tag LOCUS_30670 80488 78812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30670 81057 80485 gene locus_tag LOCUS_30680 81057 80485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 82007 81102 gene locus_tag LOCUS_30690 82007 81102 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409298.1 protein_id gnl|my_center|LOCUS_30690 82464 82018 gene locus_tag LOCUS_30700 gene blaI 82464 82018 CDS product transcriptional repressor BlaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950618.1 protein_id gnl|my_center|LOCUS_30700 83683 82859 gene locus_tag LOCUS_30710 83683 82859 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_30710 85103 83676 gene locus_tag LOCUS_30720 85103 83676 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 protein_id gnl|my_center|LOCUS_30720 86083 85106 gene locus_tag LOCUS_30730 gene deoC 86083 85106 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_30730 86245 86877 gene locus_tag LOCUS_30740 gene upp 86245 86877 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222797.1 protein_id gnl|my_center|LOCUS_30740 87008 87685 gene locus_tag LOCUS_30750 87008 87685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30750 89606 87882 gene locus_tag LOCUS_30760 89606 87882 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_30760 91946 89673 gene locus_tag LOCUS_30770 91946 89673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 92153 93736 gene locus_tag LOCUS_30780 92153 93736 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031217.1 protein_id gnl|my_center|LOCUS_30780 94205 95455 gene locus_tag LOCUS_30790 94205 95455 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222829.1 protein_id gnl|my_center|LOCUS_30790 96338 95412 gene locus_tag LOCUS_30800 96338 95412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 96453 97082 gene locus_tag LOCUS_30810 96453 97082 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031843.1 protein_id gnl|my_center|LOCUS_30810 97087 98088 gene locus_tag LOCUS_30820 97087 98088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 98085 98861 gene locus_tag LOCUS_30830 98085 98861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 98977 99258 gene locus_tag LOCUS_30840 98977 99258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 99788 99333 gene locus_tag LOCUS_30850 99788 99333 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222831.1 protein_id gnl|my_center|LOCUS_30850 99895 101298 gene locus_tag LOCUS_30860 99895 101298 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222832.1 protein_id gnl|my_center|LOCUS_30860 101929 101321 gene locus_tag LOCUS_30870 101929 101321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 104298 102355 gene locus_tag LOCUS_30880 104298 102355 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_30880 106232 104499 gene locus_tag LOCUS_30890 106232 104499 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_30890 106708 106226 gene locus_tag LOCUS_30900 106708 106226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 107180 106734 gene locus_tag LOCUS_30910 107180 106734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092142.1 protein_id gnl|my_center|LOCUS_30910 107267 107836 gene locus_tag LOCUS_30920 107267 107836 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974075.1 protein_id gnl|my_center|LOCUS_30920 109301 107862 gene locus_tag LOCUS_30930 109301 107862 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279790.1 protein_id gnl|my_center|LOCUS_30930 109979 109383 gene locus_tag LOCUS_30940 gene lysE 109979 109383 CDS product L-lysine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726966.1 protein_id gnl|my_center|LOCUS_30940 110052 110966 gene locus_tag LOCUS_30950 110052 110966 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089396.1 protein_id gnl|my_center|LOCUS_30950 112833 111082 gene locus_tag LOCUS_30960 112833 111082 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222846.1 protein_id gnl|my_center|LOCUS_30960 112714 112938 gene locus_tag LOCUS_30970 112714 112938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 112980 113627 gene locus_tag LOCUS_30980 112980 113627 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229981.1 protein_id gnl|my_center|LOCUS_30980 113750 114709 gene locus_tag LOCUS_30990 113750 114709 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229982.1 protein_id gnl|my_center|LOCUS_30990 114734 115489 gene locus_tag LOCUS_31000 114734 115489 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229983.1 protein_id gnl|my_center|LOCUS_31000 115520 116971 gene locus_tag LOCUS_31010 115520 116971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 117642 116992 gene locus_tag LOCUS_31020 117642 116992 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_31020 118353 117652 gene locus_tag LOCUS_31030 118353 117652 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 protein_id gnl|my_center|LOCUS_31030 119484 118498 gene locus_tag LOCUS_31040 gene mycP 119484 118498 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977220.1 protein_id gnl|my_center|LOCUS_31040 121091 119673 gene locus_tag LOCUS_31050 121091 119673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 121549 121088 gene locus_tag LOCUS_31060 121549 121088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 121851 121639 gene locus_tag LOCUS_31070 121851 121639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 121944 124049 gene locus_tag LOCUS_31080 121944 124049 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029854.1 protein_id gnl|my_center|LOCUS_31080 124163 124405 gene locus_tag LOCUS_31090 124163 124405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 125260 124508 gene locus_tag LOCUS_31100 125260 124508 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030153.1 protein_id gnl|my_center|LOCUS_31100 125434 126177 gene locus_tag LOCUS_31110 125434 126177 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 protein_id gnl|my_center|LOCUS_31110 126305 126805 gene locus_tag LOCUS_31120 126305 126805 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155369284.1 protein_id gnl|my_center|LOCUS_31120 126798 127721 gene locus_tag LOCUS_31130 126798 127721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 129368 127785 gene locus_tag LOCUS_31140 129368 127785 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_31140 129478 130353 gene locus_tag LOCUS_31150 129478 130353 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_31150 130469 131041 gene locus_tag LOCUS_31160 130469 131041 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056202.1 protein_id gnl|my_center|LOCUS_31160 131918 131127 gene locus_tag LOCUS_31170 131918 131127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 132643 131927 gene locus_tag LOCUS_31180 132643 131927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 133264 132707 gene locus_tag LOCUS_31190 133264 132707 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028743.1 protein_id gnl|my_center|LOCUS_31190 133742 135586 gene locus_tag LOCUS_31200 133742 135586 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726783.1 protein_id gnl|my_center|LOCUS_31200 135624 136484 gene locus_tag LOCUS_31210 135624 136484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 136554 137696 gene locus_tag LOCUS_31220 136554 137696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 137677 138498 gene locus_tag LOCUS_31230 137677 138498 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_31230 139419 138595 gene locus_tag LOCUS_31240 gene otsB 139419 138595 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029558.1 protein_id gnl|my_center|LOCUS_31240 139841 139488 gene locus_tag LOCUS_31250 139841 139488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 140445 140005 gene locus_tag LOCUS_31260 140445 140005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 140706 141053 gene locus_tag LOCUS_31270 140706 141053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 141130 141492 gene locus_tag LOCUS_31280 141130 141492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 141692 141378 gene locus_tag LOCUS_31290 141692 141378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 141931 143340 gene locus_tag LOCUS_31300 141931 143340 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229808.1 protein_id gnl|my_center|LOCUS_31300 143618 144325 gene locus_tag LOCUS_31310 143618 144325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 144444 145094 gene locus_tag LOCUS_31320 144444 145094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 145221 146189 gene locus_tag LOCUS_31330 145221 146189 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284007.1 protein_id gnl|my_center|LOCUS_31330 147026 146301 gene locus_tag LOCUS_31340 147026 146301 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086839199.1 protein_id gnl|my_center|LOCUS_31340 147140 148102 gene locus_tag LOCUS_31350 147140 148102 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225136.1 protein_id gnl|my_center|LOCUS_31350 149087 148116 gene locus_tag LOCUS_31360 149087 148116 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114440.1 protein_id gnl|my_center|LOCUS_31360 150115 149084 gene locus_tag LOCUS_31370 gene glpX 150115 149084 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742217.1 protein_id gnl|my_center|LOCUS_31370 150328 151068 gene locus_tag LOCUS_31380 150328 151068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 151202 152020 gene locus_tag LOCUS_31390 151202 152020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 152248 153105 gene locus_tag LOCUS_31400 152248 153105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 153385 153152 gene locus_tag LOCUS_31410 153385 153152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 154684 153512 gene locus_tag LOCUS_31420 gene xseA 154684 153512 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030027.1 protein_id gnl|my_center|LOCUS_31420 154913 155905 gene locus_tag LOCUS_31430 154913 155905 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296404.1 protein_id gnl|my_center|LOCUS_31430 156096 156500 gene locus_tag LOCUS_31440 156096 156500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 157403 156744 gene locus_tag LOCUS_31450 157403 156744 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140957.1 protein_id gnl|my_center|LOCUS_31450 157493 157855 gene locus_tag LOCUS_31460 157493 157855 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225660.1 protein_id gnl|my_center|LOCUS_31460 159047 157869 gene locus_tag LOCUS_31470 159047 157869 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_31470 159057 159896 gene locus_tag LOCUS_31480 159057 159896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 162756 159970 gene locus_tag LOCUS_31490 gene ppc 162756 159970 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975687.1 protein_id gnl|my_center|LOCUS_31490 163936 162887 gene locus_tag LOCUS_31500 163936 162887 CDS product DUF3533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977086.1 protein_id gnl|my_center|LOCUS_31500 164034 165074 gene locus_tag LOCUS_31510 164034 165074 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905888.1 protein_id gnl|my_center|LOCUS_31510 165295 165068 gene locus_tag LOCUS_31520 165295 165068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 165504 165812 gene locus_tag LOCUS_31530 165504 165812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 166839 165925 gene locus_tag LOCUS_31540 166839 165925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 167140 170886 gene locus_tag LOCUS_31550 gene mfd 167140 170886 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_31550 170945 171748 gene locus_tag LOCUS_31560 170945 171748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 171745 172728 gene locus_tag LOCUS_31570 171745 172728 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975711.1 protein_id gnl|my_center|LOCUS_31570 173005 173577 gene locus_tag LOCUS_31580 173005 173577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 173574 174554 gene locus_tag LOCUS_31590 173574 174554 CDS product CU044_5270 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225196.1 protein_id gnl|my_center|LOCUS_31590 174594 176213 gene locus_tag LOCUS_31600 174594 176213 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 protein_id gnl|my_center|LOCUS_31600 177117 176227 gene locus_tag LOCUS_31610 gene nudC 177117 176227 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887811.1 protein_id gnl|my_center|LOCUS_31610 177806 177114 gene locus_tag LOCUS_31620 177806 177114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 178022 179305 gene locus_tag LOCUS_31630 gene eno 178022 179305 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_31630 179340 179972 gene locus_tag LOCUS_31640 179340 179972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 180002 180568 gene locus_tag LOCUS_31650 180002 180568 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_31650 180565 181083 gene locus_tag LOCUS_31660 180565 181083 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975457.1 protein_id gnl|my_center|LOCUS_31660 181258 182559 gene locus_tag LOCUS_31670 181258 182559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 182570 183523 gene locus_tag LOCUS_31680 182570 183523 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_31680 184251 184060 gene locus_tag LOCUS_31690 184251 184060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 184444 184731 gene locus_tag LOCUS_31700 184444 184731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 186403 185735 gene locus_tag LOCUS_31710 186403 185735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 186687 188588 gene locus_tag LOCUS_31720 186687 188588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 188539 188760 gene locus_tag LOCUS_31730 188539 188760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 188816 189148 gene locus_tag LOCUS_31740 188816 189148 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223697.1 protein_id gnl|my_center|LOCUS_31740 189178 190185 gene locus_tag LOCUS_31750 189178 190185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 190418 190723 gene locus_tag LOCUS_31760 190418 190723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 190739 191395 gene locus_tag LOCUS_31770 190739 191395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 191453 191881 gene locus_tag LOCUS_31780 191453 191881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 191903 192028 gene locus_tag LOCUS_31790 191903 192028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 192150 192695 gene locus_tag LOCUS_31800 192150 192695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 192840 193526 gene locus_tag LOCUS_31810 192840 193526 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982129.1 protein_id gnl|my_center|LOCUS_31810 193519 194259 gene locus_tag LOCUS_31820 193519 194259 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_31820 194278 195027 gene locus_tag LOCUS_31830 194278 195027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 195024 195605 gene locus_tag LOCUS_31840 195024 195605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 195605 196612 gene locus_tag LOCUS_31850 195605 196612 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804471.1 protein_id gnl|my_center|LOCUS_31850 196618 197985 gene locus_tag LOCUS_31860 196618 197985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 197975 198583 gene locus_tag LOCUS_31870 197975 198583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 198687 200015 gene locus_tag LOCUS_31880 198687 200015 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974853.1 protein_id gnl|my_center|LOCUS_31880 201963 200071 gene locus_tag LOCUS_31890 201963 200071 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630171.1 protein_id gnl|my_center|LOCUS_31890 202065 202147 gene locus_tag LOCUS_t00350 202065 202147 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 202265 203083 gene locus_tag LOCUS_31900 202265 203083 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229844.1 protein_id gnl|my_center|LOCUS_31900 203252 204010 gene locus_tag LOCUS_31910 203252 204010 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229844.1 protein_id gnl|my_center|LOCUS_31910 204046 204366 gene locus_tag LOCUS_31920 204046 204366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 205670 204408 gene locus_tag LOCUS_31930 205670 204408 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975732.1 protein_id gnl|my_center|LOCUS_31930 206625 205795 gene locus_tag LOCUS_31940 206625 205795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 207617 206622 gene locus_tag LOCUS_31950 207617 206622 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975733.1 protein_id gnl|my_center|LOCUS_31950 207805 208161 gene locus_tag LOCUS_31960 207805 208161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 208237 209607 gene locus_tag LOCUS_31970 208237 209607 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028755.1 protein_id gnl|my_center|LOCUS_31970 209790 210809 gene locus_tag LOCUS_31980 209790 210809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 211298 210828 gene locus_tag LOCUS_31990 211298 210828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 211560 211291 gene locus_tag LOCUS_32000 211560 211291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 211826 211560 gene locus_tag LOCUS_32010 211826 211560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 212090 212890 gene locus_tag LOCUS_32020 212090 212890 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_32020 212878 213078 gene locus_tag LOCUS_32030 212878 213078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 215386 213161 gene locus_tag LOCUS_32040 215386 213161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 216078 215383 gene locus_tag LOCUS_32050 216078 215383 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_32050 216506 216165 gene locus_tag LOCUS_32060 216506 216165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 217431 216922 gene locus_tag LOCUS_32070 217431 216922 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030950.1 protein_id gnl|my_center|LOCUS_32070 218375 217428 gene locus_tag LOCUS_32080 218375 217428 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223370.1 protein_id gnl|my_center|LOCUS_32080 219894 218707 gene locus_tag LOCUS_32090 219894 218707 CDS product osmoprotectant NAGGN system M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402538.1 protein_id gnl|my_center|LOCUS_32090 221726 219891 gene locus_tag LOCUS_32100 gene ngg 221726 219891 CDS product N-acetylglutaminylglutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728458.1 protein_id gnl|my_center|LOCUS_32100 223447 221729 gene locus_tag LOCUS_32110 223447 221729 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728459.1 protein_id gnl|my_center|LOCUS_32110 223979 223656 gene locus_tag LOCUS_32120 223979 223656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 223864 225516 gene locus_tag LOCUS_32130 223864 225516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 226184 225522 gene locus_tag LOCUS_32140 gene msrA 226184 225522 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918878.1 protein_id gnl|my_center|LOCUS_32140 226751 226332 gene locus_tag LOCUS_32150 226751 226332 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_32150 226950 228092 gene locus_tag LOCUS_32160 226950 228092 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_32160 228109 229518 gene locus_tag LOCUS_32170 228109 229518 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406369.1 protein_id gnl|my_center|LOCUS_32170 229679 230677 gene locus_tag LOCUS_32180 229679 230677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 230674 231894 gene locus_tag LOCUS_32190 gene ilvA 230674 231894 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229835.1 protein_id gnl|my_center|LOCUS_32190 232447 231947 gene locus_tag LOCUS_32200 gene greA 232447 231947 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059312.1 protein_id gnl|my_center|LOCUS_32200 233022 232588 gene locus_tag LOCUS_32210 233022 232588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 233218 234099 gene locus_tag LOCUS_32220 gene mca 233218 234099 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444314.1 protein_id gnl|my_center|LOCUS_32220 234148 234429 gene locus_tag LOCUS_32230 234148 234429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 234617 237148 gene locus_tag LOCUS_32240 234617 237148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 237432 237193 gene locus_tag LOCUS_32250 237432 237193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 237582 238061 gene locus_tag LOCUS_32260 237582 238061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 238639 239037 gene locus_tag LOCUS_32270 238639 239037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 239030 239521 gene locus_tag LOCUS_32280 239030 239521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 240958 239927 gene locus_tag LOCUS_32290 240958 239927 CDS product phosphatidylinositol-specific phospholipase C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230297.1 protein_id gnl|my_center|LOCUS_32290 241756 241052 gene locus_tag LOCUS_32300 241756 241052 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742194.1 protein_id gnl|my_center|LOCUS_32300 242028 244067 gene locus_tag LOCUS_32310 242028 244067 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_32310 244138 245298 gene locus_tag LOCUS_32320 244138 245298 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222902.1 protein_id gnl|my_center|LOCUS_32320 245339 245830 gene locus_tag LOCUS_32330 gene purE 245339 245830 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222903.1 protein_id gnl|my_center|LOCUS_32330 250851 245935 gene locus_tag LOCUS_32340 250851 245935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 249369 249273 gene locus_tag LOCUS_t00360 249369 249273 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 252438 251014 gene locus_tag LOCUS_32350 252438 251014 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 protein_id gnl|my_center|LOCUS_32350 252684 253847 gene locus_tag LOCUS_32360 252684 253847 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_32360 255353 253911 gene locus_tag LOCUS_32370 255353 253911 CDS product HEXXH motif-containing putative peptide modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030144.1 protein_id gnl|my_center|LOCUS_32370 255452 255706 gene locus_tag LOCUS_32380 255452 255706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 255717 259544 gene locus_tag LOCUS_32390 gene fxsT 255717 259544 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184695823.1 protein_id gnl|my_center|LOCUS_32390 259541 260569 gene locus_tag LOCUS_32400 259541 260569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229892.1 protein_id gnl|my_center|LOCUS_32400 260566 261921 gene locus_tag LOCUS_32410 260566 261921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211351449.1 protein_id gnl|my_center|LOCUS_32410 264267 261994 gene locus_tag LOCUS_32420 264267 261994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121008027.1 protein_id gnl|my_center|LOCUS_32420 265379 264267 gene locus_tag LOCUS_32430 265379 264267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229889.1 protein_id gnl|my_center|LOCUS_32430 266203 265376 gene locus_tag LOCUS_32440 266203 265376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 267011 266343 gene locus_tag LOCUS_32450 267011 266343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 267243 267043 gene locus_tag LOCUS_32460 267243 267043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 267158 267553 gene locus_tag LOCUS_32470 267158 267553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 267648 269693 gene locus_tag LOCUS_32480 267648 269693 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_32480 270277 270195 gene locus_tag LOCUS_t00370 270277 270195 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 270591 271736 gene locus_tag LOCUS_32490 270591 271736 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222923.1 protein_id gnl|my_center|LOCUS_32490 271783 272880 gene locus_tag LOCUS_32500 271783 272880 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776146.1 protein_id gnl|my_center|LOCUS_32500 273596 272988 gene locus_tag LOCUS_32510 273596 272988 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222931.1 protein_id gnl|my_center|LOCUS_32510 274005 275000 gene locus_tag LOCUS_32520 274005 275000 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145736531.1 protein_id gnl|my_center|LOCUS_32520 276123 275038 gene locus_tag LOCUS_32530 276123 275038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 277070 276120 gene locus_tag LOCUS_32540 gene cofD 277070 276120 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222933.1 protein_id gnl|my_center|LOCUS_32540 277171 278199 gene locus_tag LOCUS_32550 277171 278199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 278365 280965 gene locus_tag LOCUS_32560 278365 280965 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455006.1 protein_id gnl|my_center|LOCUS_32560 281681 281938 gene locus_tag LOCUS_32570 281681 281938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 282494 282039 gene locus_tag LOCUS_32580 282494 282039 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559274.1 protein_id gnl|my_center|LOCUS_32580 282721 283038 gene locus_tag LOCUS_32590 282721 283038 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086677666.1 protein_id gnl|my_center|LOCUS_32590 284426 283050 gene locus_tag LOCUS_32600 284426 283050 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_32600 285785 284439 gene locus_tag LOCUS_32610 285785 284439 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973370.1 protein_id gnl|my_center|LOCUS_32610 286747 286935 gene locus_tag LOCUS_32620 286747 286935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 287074 287283 gene locus_tag LOCUS_32630 287074 287283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 288021 287509 gene locus_tag LOCUS_32640 288021 287509 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111753.1 protein_id gnl|my_center|LOCUS_32640 288233 289417 gene locus_tag LOCUS_32650 288233 289417 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973358.1 protein_id gnl|my_center|LOCUS_32650 289414 290592 gene locus_tag LOCUS_32660 289414 290592 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973357.1 protein_id gnl|my_center|LOCUS_32660 290589 291503 gene locus_tag LOCUS_32670 290589 291503 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030376.1 protein_id gnl|my_center|LOCUS_32670 291500 292366 gene locus_tag LOCUS_32680 291500 292366 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973355.1 protein_id gnl|my_center|LOCUS_32680 292363 293784 gene locus_tag LOCUS_32690 292363 293784 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_32690 293784 294986 gene locus_tag LOCUS_32700 293784 294986 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731196.1 protein_id gnl|my_center|LOCUS_32700 295042 295206 gene locus_tag LOCUS_32710 295042 295206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 295203 295514 gene locus_tag LOCUS_32720 295203 295514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 296058 295576 gene locus_tag LOCUS_32730 296058 295576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 297563 296058 gene locus_tag LOCUS_32740 297563 296058 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027628.1 protein_id gnl|my_center|LOCUS_32740 298884 297604 gene locus_tag LOCUS_32750 298884 297604 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027627.1 protein_id gnl|my_center|LOCUS_32750 300276 299005 gene locus_tag LOCUS_32760 gene gabT 300276 299005 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892002.1 protein_id gnl|my_center|LOCUS_32760 301717 300281 gene locus_tag LOCUS_32770 301717 300281 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223105.1 protein_id gnl|my_center|LOCUS_32770 301860 303299 gene locus_tag LOCUS_32780 301860 303299 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030384.1 protein_id gnl|my_center|LOCUS_32780 304531 303302 gene locus_tag LOCUS_32790 304531 303302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 304617 305030 gene locus_tag LOCUS_32800 304617 305030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 305027 305380 gene locus_tag LOCUS_32810 305027 305380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 305398 309720 gene locus_tag LOCUS_32820 305398 309720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 309729 310166 gene locus_tag LOCUS_32830 309729 310166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231044.1 protein_id gnl|my_center|LOCUS_32830 310373 310446 gene locus_tag LOCUS_t00380 310373 310446 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 311838 310504 gene locus_tag LOCUS_32840 311838 310504 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630264.1 protein_id gnl|my_center|LOCUS_32840 313286 312015 gene locus_tag LOCUS_32850 313286 312015 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630264.1 protein_id gnl|my_center|LOCUS_32850 313473 313548 gene locus_tag LOCUS_t00390 313473 313548 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 313714 314394 gene locus_tag LOCUS_32860 313714 314394 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394499.1 protein_id gnl|my_center|LOCUS_32860 314408 315454 gene locus_tag LOCUS_32870 314408 315454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 315826 316230 gene locus_tag LOCUS_32880 315826 316230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085100849.1 protein_id gnl|my_center|LOCUS_32880 316230 317225 gene locus_tag LOCUS_32890 316230 317225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32890 317293 317637 gene locus_tag LOCUS_32900 317293 317637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 318301 319332 gene locus_tag LOCUS_32910 318301 319332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 319861 319583 gene locus_tag LOCUS_32920 319861 319583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 324158 320343 gene locus_tag LOCUS_32930 324158 320343 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027111.1 protein_id gnl|my_center|LOCUS_32930 324100 324288 gene locus_tag LOCUS_32940 324100 324288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 324441 325433 gene locus_tag LOCUS_32950 324441 325433 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030691.1 protein_id gnl|my_center|LOCUS_32950 325430 326440 gene locus_tag LOCUS_32960 325430 326440 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282906.1 protein_id gnl|my_center|LOCUS_32960 326713 327846 gene locus_tag LOCUS_32970 326713 327846 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967895.1 protein_id gnl|my_center|LOCUS_32970 327905 329284 gene locus_tag LOCUS_32980 327905 329284 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524172.1 protein_id gnl|my_center|LOCUS_32980 329299 330282 gene locus_tag LOCUS_32990 329299 330282 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213188.1 protein_id gnl|my_center|LOCUS_32990 330276 331151 gene locus_tag LOCUS_33000 330276 331151 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253348.1 protein_id gnl|my_center|LOCUS_33000 331186 332349 gene locus_tag LOCUS_33010 331186 332349 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227995.1 protein_id gnl|my_center|LOCUS_33010 332360 333052 gene locus_tag LOCUS_33020 332360 333052 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_33020 333049 334500 gene locus_tag LOCUS_33030 gene gabD 333049 334500 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187560.1 protein_id gnl|my_center|LOCUS_33030 334493 335512 gene locus_tag LOCUS_33040 334493 335512 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986244.1 protein_id gnl|my_center|LOCUS_33040 335565 337220 gene locus_tag LOCUS_33050 335565 337220 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_33050 337217 338701 gene locus_tag LOCUS_33060 gene glpK 337217 338701 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141749.1 protein_id gnl|my_center|LOCUS_33060 338689 339936 gene locus_tag LOCUS_33070 338689 339936 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898087.1 protein_id gnl|my_center|LOCUS_33070 339933 341096 gene locus_tag LOCUS_33080 339933 341096 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728358.1 protein_id gnl|my_center|LOCUS_33080 342029 341175 gene locus_tag LOCUS_33090 342029 341175 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466665.1 protein_id gnl|my_center|LOCUS_33090 343391 342087 gene locus_tag LOCUS_33100 343391 342087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 343509 345350 gene locus_tag LOCUS_33110 343509 345350 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978119.1 protein_id gnl|my_center|LOCUS_33110 345384 350831 gene locus_tag LOCUS_33120 345384 350831 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189716469.1 protein_id gnl|my_center|LOCUS_33120 350828 357172 gene locus_tag LOCUS_33130 350828 357172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33130 357169 363873 gene locus_tag LOCUS_33140 357169 363873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 363870 368378 gene locus_tag LOCUS_33150 363870 368378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 368365 368580 gene locus_tag LOCUS_33160 368365 368580 CDS product MbtH family NRPS accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192056.1 protein_id gnl|my_center|LOCUS_33160 368577 370862 gene locus_tag LOCUS_33170 368577 370862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 370910 371614 gene locus_tag LOCUS_33180 370910 371614 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552045.1 protein_id gnl|my_center|LOCUS_33180 371644 372591 gene locus_tag LOCUS_33190 371644 372591 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229986.1 protein_id gnl|my_center|LOCUS_33190 372597 377465 gene locus_tag LOCUS_33200 372597 377465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 377458 378753 gene locus_tag LOCUS_33210 377458 378753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 378879 379604 gene locus_tag LOCUS_33220 378879 379604 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028974.1 protein_id gnl|my_center|LOCUS_33220 380230 379682 gene locus_tag LOCUS_33230 380230 379682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 380479 381147 gene locus_tag LOCUS_33240 380479 381147 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949618.1 protein_id gnl|my_center|LOCUS_33240 381311 382429 gene locus_tag LOCUS_33250 381311 382429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 382499 383884 gene locus_tag LOCUS_33260 382499 383884 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_33260 383946 384131 gene locus_tag LOCUS_33270 383946 384131 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229750.1 protein_id gnl|my_center|LOCUS_33270 384131 385324 gene locus_tag LOCUS_33280 384131 385324 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975785.1 protein_id gnl|my_center|LOCUS_33280 385353 386372 gene locus_tag LOCUS_33290 385353 386372 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_33290 386375 387538 gene locus_tag LOCUS_33300 gene manA 386375 387538 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111913.1 protein_id gnl|my_center|LOCUS_33300 387819 389318 gene locus_tag LOCUS_33310 gene ahcY 387819 389318 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_33310 389492 390409 gene locus_tag LOCUS_33320 389492 390409 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_33320 390430 391563 gene locus_tag LOCUS_33330 390430 391563 CDS product peptidase M75 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229934.1 protein_id gnl|my_center|LOCUS_33330 391613 392893 gene locus_tag LOCUS_33340 gene efeB 391613 392893 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028245.1 protein_id gnl|my_center|LOCUS_33340 393830 392919 gene locus_tag LOCUS_33350 393830 392919 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223050.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33350 393866 394879 gene locus_tag LOCUS_33360 393866 394879 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731132.1 protein_id gnl|my_center|LOCUS_33360 396167 394857 gene locus_tag LOCUS_33370 396167 394857 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223048.1 protein_id gnl|my_center|LOCUS_33370 397156 396164 gene locus_tag LOCUS_33380 397156 396164 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897409.1 protein_id gnl|my_center|LOCUS_33380 398688 397153 gene locus_tag LOCUS_33390 398688 397153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 399281 398685 gene locus_tag LOCUS_33400 399281 398685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 400129 399278 gene locus_tag LOCUS_33410 400129 399278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 400333 401022 gene locus_tag LOCUS_33420 gene mtrA 400333 401022 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_33420 401111 402790 gene locus_tag LOCUS_33430 gene mtrB 401111 402790 CDS product MtrAB system histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080870.1 protein_id gnl|my_center|LOCUS_33430 402787 404598 gene locus_tag LOCUS_33440 402787 404598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 404608 405330 gene locus_tag LOCUS_33450 404608 405330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 405582 406211 gene locus_tag LOCUS_33460 gene raiA 405582 406211 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080884.1 protein_id gnl|my_center|LOCUS_33460 407355 406246 gene locus_tag LOCUS_33470 407355 406246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 408530 407361 gene locus_tag LOCUS_33480 408530 407361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 408733 411612 gene locus_tag LOCUS_33490 gene secA 408733 411612 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_33490 412412 411810 gene locus_tag LOCUS_33500 412412 411810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 412740 412513 gene locus_tag LOCUS_33510 412740 412513 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776072.1 protein_id gnl|my_center|LOCUS_33510 412928 413437 gene locus_tag LOCUS_33520 412928 413437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028709.1 protein_id gnl|my_center|LOCUS_33520 414594 413503 gene locus_tag LOCUS_33530 414594 413503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 415031 416659 gene locus_tag LOCUS_33540 gene pruA 415031 416659 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 protein_id gnl|my_center|LOCUS_33540 416889 417341 gene locus_tag LOCUS_33550 416889 417341 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223153.1 protein_id gnl|my_center|LOCUS_33550 417508 418629 gene locus_tag LOCUS_33560 gene prfB 417508 418629 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975840.1 protein_id gnl|my_center|LOCUS_33560 418767 419429 gene locus_tag LOCUS_33570 gene ftsE 418767 419429 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082104.1 protein_id gnl|my_center|LOCUS_33570 419497 420372 gene locus_tag LOCUS_33580 gene ftsX 419497 420372 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223155.1 protein_id gnl|my_center|LOCUS_33580 420509 420988 gene locus_tag LOCUS_33590 gene smpB 420509 420988 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_33590 421096 421472 gene locus_tag LOCUS_tm00010 421096 421472 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 421600 422661 gene locus_tag LOCUS_33600 421600 422661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 424796 423201 gene locus_tag LOCUS_33610 gene mdlC 424796 423201 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727769.1 protein_id gnl|my_center|LOCUS_33610 425756 424953 gene locus_tag LOCUS_33620 425756 424953 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_33620 425999 426589 gene locus_tag LOCUS_33630 425999 426589 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_33630 426675 426749 gene locus_tag LOCUS_t00400 426675 426749 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 427512 427087 gene locus_tag LOCUS_33640 427512 427087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 427673 428326 gene locus_tag LOCUS_33650 427673 428326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 428355 428726 gene locus_tag LOCUS_33660 428355 428726 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230611.1 protein_id gnl|my_center|LOCUS_33660 428770 430008 gene locus_tag LOCUS_33670 428770 430008 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228643.1 protein_id gnl|my_center|LOCUS_33670 430096 431274 gene locus_tag LOCUS_33680 430096 431274 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731461.1 protein_id gnl|my_center|LOCUS_33680 432059 431721 gene locus_tag LOCUS_33690 432059 431721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 432277 433095 gene locus_tag LOCUS_33700 432277 433095 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_33700 433095 433295 gene locus_tag LOCUS_33710 433095 433295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 433541 433921 gene locus_tag LOCUS_33720 433541 433921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 433921 437541 gene locus_tag LOCUS_33730 433921 437541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 437907 437599 gene locus_tag LOCUS_33740 437907 437599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 438236 437904 gene locus_tag LOCUS_33750 438236 437904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 438306 438773 gene locus_tag LOCUS_33760 438306 438773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 439917 438928 gene locus_tag LOCUS_33770 gene mgrA 439917 438928 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_33770 440190 441158 gene locus_tag LOCUS_33780 440190 441158 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902161.1 protein_id gnl|my_center|LOCUS_33780 441222 442667 gene locus_tag LOCUS_33790 441222 442667 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226764.1 protein_id gnl|my_center|LOCUS_33790 442671 444623 gene locus_tag LOCUS_33800 442671 444623 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404895.1 protein_id gnl|my_center|LOCUS_33800 445025 445522 gene locus_tag LOCUS_33810 445025 445522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 445880 445596 gene locus_tag LOCUS_33820 445880 445596 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_33820 446010 447362 gene locus_tag LOCUS_33830 446010 447362 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005121857.1 protein_id gnl|my_center|LOCUS_33830 447359 448702 gene locus_tag LOCUS_33840 447359 448702 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897704.1 protein_id gnl|my_center|LOCUS_33840 449350 449033 gene locus_tag LOCUS_33850 449350 449033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 449532 449347 gene locus_tag LOCUS_33860 449532 449347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 449642 449875 gene locus_tag LOCUS_33870 449642 449875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 450155 451558 gene locus_tag LOCUS_33880 450155 451558 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529928.1 protein_id gnl|my_center|LOCUS_33880 450940 451024 gene locus_tag LOCUS_t00410 450940 451024 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 451555 452682 gene locus_tag LOCUS_33890 451555 452682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485125.1 protein_id gnl|my_center|LOCUS_33890 452679 454301 gene locus_tag LOCUS_33900 452679 454301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484926.1 protein_id gnl|my_center|LOCUS_33900 454681 456975 gene locus_tag LOCUS_33910 454681 456975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 457025 457783 gene locus_tag LOCUS_33920 457025 457783 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975420.1 protein_id gnl|my_center|LOCUS_33920 459379 457850 gene locus_tag LOCUS_33930 459379 457850 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223067.1 protein_id gnl|my_center|LOCUS_33930 460981 459428 gene locus_tag LOCUS_33940 gene gntK 460981 459428 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255195.1 protein_id gnl|my_center|LOCUS_33940 461240 462397 gene locus_tag LOCUS_33950 461240 462397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 462457 462828 gene locus_tag LOCUS_33960 462457 462828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 463406 462972 gene locus_tag LOCUS_33970 463406 462972 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338894.1 protein_id gnl|my_center|LOCUS_33970 465511 463994 gene locus_tag LOCUS_33980 465511 463994 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388520.1 protein_id gnl|my_center|LOCUS_33980 468769 465701 gene locus_tag LOCUS_33990 468769 465701 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742338.1 protein_id gnl|my_center|LOCUS_33990 468677 468904 gene locus_tag LOCUS_34000 468677 468904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 469995 468910 gene locus_tag LOCUS_34010 469995 468910 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_34010 470681 469992 gene locus_tag LOCUS_34020 470681 469992 CDS product DUF4433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143359.1 protein_id gnl|my_center|LOCUS_34020 472331 470685 gene locus_tag LOCUS_34030 472331 470685 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107018483.1 protein_id gnl|my_center|LOCUS_34030 472421 472966 gene locus_tag LOCUS_34040 472421 472966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 475210 472994 gene locus_tag LOCUS_34050 475210 472994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 476374 475394 gene locus_tag LOCUS_34060 476374 475394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 476571 477890 gene locus_tag LOCUS_34070 476571 477890 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975990.1 protein_id gnl|my_center|LOCUS_34070 478921 477953 gene locus_tag LOCUS_34080 478921 477953 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029688.1 protein_id gnl|my_center|LOCUS_34080 478980 479723 gene locus_tag LOCUS_34090 478980 479723 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966429.1 protein_id gnl|my_center|LOCUS_34090 480123 479902 gene locus_tag LOCUS_34100 480123 479902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 480134 480394 gene locus_tag LOCUS_34110 480134 480394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 481779 480442 gene locus_tag LOCUS_34120 481779 480442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 481998 482606 gene locus_tag LOCUS_34130 481998 482606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 482603 483502 gene locus_tag LOCUS_34140 482603 483502 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203660628.1 protein_id gnl|my_center|LOCUS_34140 483649 484281 gene locus_tag LOCUS_34150 483649 484281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 485076 484249 gene locus_tag LOCUS_34160 485076 484249 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230072.1 protein_id gnl|my_center|LOCUS_34160 485827 485243 gene locus_tag LOCUS_34170 485827 485243 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749610.1 protein_id gnl|my_center|LOCUS_34170 486984 485824 gene locus_tag LOCUS_34180 486984 485824 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749508.1 protein_id gnl|my_center|LOCUS_34180 487256 487612 gene locus_tag LOCUS_34190 487256 487612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 487609 488718 gene locus_tag LOCUS_34200 487609 488718 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978774.1 protein_id gnl|my_center|LOCUS_34200 488909 489754 gene locus_tag LOCUS_34210 488909 489754 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 protein_id gnl|my_center|LOCUS_34210 490504 491220 gene locus_tag LOCUS_34220 490504 491220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 491235 491495 gene locus_tag LOCUS_34230 491235 491495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 491492 491896 gene locus_tag LOCUS_34240 491492 491896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 492676 491966 gene locus_tag LOCUS_34250 492676 491966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 492757 493269 gene locus_tag LOCUS_34260 492757 493269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 494121 493378 gene locus_tag LOCUS_34270 494121 493378 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227429.1 protein_id gnl|my_center|LOCUS_34270 494247 495065 gene locus_tag LOCUS_34280 494247 495065 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029811.1 protein_id gnl|my_center|LOCUS_34280 495164 495940 gene locus_tag LOCUS_34290 495164 495940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 496880 496029 gene locus_tag LOCUS_34300 496880 496029 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228550.1 protein_id gnl|my_center|LOCUS_34300 498266 497055 gene locus_tag LOCUS_34310 498266 497055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 499295 498321 gene locus_tag LOCUS_34320 499295 498321 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978781.1 protein_id gnl|my_center|LOCUS_34320 499473 500432 gene locus_tag LOCUS_34330 499473 500432 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026839.1 protein_id gnl|my_center|LOCUS_34330 500587 501570 gene locus_tag LOCUS_34340 500587 501570 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026838.1 protein_id gnl|my_center|LOCUS_34340 501644 503272 gene locus_tag LOCUS_34350 501644 503272 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230225.1 protein_id gnl|my_center|LOCUS_34350 503322 503777 gene locus_tag LOCUS_34360 503322 503777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 503774 503986 gene locus_tag LOCUS_34370 503774 503986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 503970 504998 gene locus_tag LOCUS_34380 503970 504998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 504976 505671 gene locus_tag LOCUS_34390 504976 505671 CDS product 4Fe-4S single cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224751521.1 protein_id gnl|my_center|LOCUS_34390 507056 505638 gene locus_tag LOCUS_34400 507056 505638 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027457.1 protein_id gnl|my_center|LOCUS_34400 507865 507167 gene locus_tag LOCUS_34410 507865 507167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886572.1 protein_id gnl|my_center|LOCUS_34410 508662 507868 gene locus_tag LOCUS_34420 508662 507868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 509576 508659 gene locus_tag LOCUS_34430 509576 508659 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776493.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34430 509704 511050 gene locus_tag LOCUS_34440 509704 511050 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 protein_id gnl|my_center|LOCUS_34440 511047 511754 gene locus_tag LOCUS_34450 511047 511754 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_34450 512862 512074 gene locus_tag LOCUS_34460 512862 512074 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091388998.1 protein_id gnl|my_center|LOCUS_34460 513180 513833 gene locus_tag LOCUS_34470 513180 513833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 514523 513882 gene locus_tag LOCUS_34480 514523 513882 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390275.1 protein_id gnl|my_center|LOCUS_34480 515917 514685 gene locus_tag LOCUS_34490 515917 514685 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_34490 515983 516576 gene locus_tag LOCUS_34500 515983 516576 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223382.1 protein_id gnl|my_center|LOCUS_34500 516687 517016 gene locus_tag LOCUS_34510 516687 517016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 518771 517188 gene locus_tag LOCUS_34520 gene dacB 518771 517188 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 protein_id gnl|my_center|LOCUS_34520 519166 519447 gene locus_tag LOCUS_34530 519166 519447 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223741.1 protein_id gnl|my_center|LOCUS_34530 520711 519548 gene locus_tag LOCUS_34540 520711 519548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 520799 521692 gene locus_tag LOCUS_34550 520799 521692 CDS product glycolipid sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898849.1 protein_id gnl|my_center|LOCUS_34550 521939 522340 gene locus_tag LOCUS_34560 521939 522340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 522606 523031 gene locus_tag LOCUS_34570 522606 523031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 523107 524891 gene locus_tag LOCUS_34580 523107 524891 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027999.1 protein_id gnl|my_center|LOCUS_34580 524970 525755 gene locus_tag LOCUS_34590 524970 525755 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930068.1 protein_id gnl|my_center|LOCUS_34590 526150 526488 gene locus_tag LOCUS_34600 526150 526488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 526533 526952 gene locus_tag LOCUS_34610 526533 526952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 528131 527010 gene locus_tag LOCUS_34620 528131 527010 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027639.1 protein_id gnl|my_center|LOCUS_34620 528449 529555 gene locus_tag LOCUS_34630 528449 529555 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226918.1 protein_id gnl|my_center|LOCUS_34630 529812 529528 gene locus_tag LOCUS_34640 529812 529528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 529694 531451 gene locus_tag LOCUS_34650 gene ctaD 529694 531451 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229476.1 protein_id gnl|my_center|LOCUS_34650 532349 531528 gene locus_tag LOCUS_34660 532349 531528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 533687 532467 gene locus_tag LOCUS_34670 533687 532467 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230592.1 protein_id gnl|my_center|LOCUS_34670 534335 533754 gene locus_tag LOCUS_34680 534335 533754 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 protein_id gnl|my_center|LOCUS_34680 535716 534430 gene locus_tag LOCUS_34690 535716 534430 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229465.1 protein_id gnl|my_center|LOCUS_34690 538408 535733 gene locus_tag LOCUS_34700 538408 535733 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729639.1 protein_id gnl|my_center|LOCUS_34700 538610 540343 gene locus_tag LOCUS_34710 538610 540343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 540312 540782 gene locus_tag LOCUS_34720 540312 540782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 540785 541279 gene locus_tag LOCUS_34730 540785 541279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 541282 541821 gene locus_tag LOCUS_34740 541282 541821 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896304.1 protein_id gnl|my_center|LOCUS_34740 541895 542239 gene locus_tag LOCUS_34750 541895 542239 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975899.1 protein_id gnl|my_center|LOCUS_34750 542252 543217 gene locus_tag LOCUS_34760 542252 543217 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084687.1 protein_id gnl|my_center|LOCUS_34760 543452 544198 gene locus_tag LOCUS_34770 543452 544198 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_34770 544361 545002 gene locus_tag LOCUS_34780 gene rph 544361 545002 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_34780 544999 545616 gene locus_tag LOCUS_34790 gene rdgB 544999 545616 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229451.1 protein_id gnl|my_center|LOCUS_34790 547220 545682 gene locus_tag LOCUS_34800 gene hutH 547220 545682 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974041.1 protein_id gnl|my_center|LOCUS_34800 548488 547208 gene locus_tag LOCUS_34810 gene hutI 548488 547208 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892542.1 protein_id gnl|my_center|LOCUS_34810 549897 548485 gene locus_tag LOCUS_34820 549897 548485 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 protein_id gnl|my_center|LOCUS_34820 550130 549894 gene locus_tag LOCUS_34830 550130 549894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 551341 550121 gene locus_tag LOCUS_34840 551341 550121 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892540.1 protein_id gnl|my_center|LOCUS_34840 552993 551338 gene locus_tag LOCUS_34850 gene hutU 552993 551338 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223168.1 protein_id gnl|my_center|LOCUS_34850 553861 553007 gene locus_tag LOCUS_34860 553861 553007 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028753.1 protein_id gnl|my_center|LOCUS_34860 553966 555246 gene locus_tag LOCUS_34870 553966 555246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 555431 556549 gene locus_tag LOCUS_34880 555431 556549 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141525.1 protein_id gnl|my_center|LOCUS_34880 556536 557651 gene locus_tag LOCUS_34890 556536 557651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 557657 558829 gene locus_tag LOCUS_34900 557657 558829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 558826 560382 gene locus_tag LOCUS_34910 558826 560382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 560416 561621 gene locus_tag LOCUS_34920 560416 561621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 563118 561733 gene locus_tag LOCUS_34930 563118 561733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 564773 563217 gene locus_tag LOCUS_34940 564773 563217 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229159.1 protein_id gnl|my_center|LOCUS_34940 565964 564885 gene locus_tag LOCUS_34950 565964 564885 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028731.1 protein_id gnl|my_center|LOCUS_34950 566146 567102 gene locus_tag LOCUS_34960 566146 567102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 568238 567162 gene locus_tag LOCUS_34970 568238 567162 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031727.1 protein_id gnl|my_center|LOCUS_34970 568729 568304 gene locus_tag LOCUS_34980 568729 568304 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868971.1 protein_id gnl|my_center|LOCUS_34980 568792 569772 gene locus_tag LOCUS_34990 568792 569772 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868968.1 protein_id gnl|my_center|LOCUS_34990 570022 570369 gene locus_tag LOCUS_35000 570022 570369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 570444 570370 gene locus_tag LOCUS_t00420 570444 570370 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 571031 570435 gene locus_tag LOCUS_35010 571031 570435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 571632 571063 gene locus_tag LOCUS_35020 gene bcp 571632 571063 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412944.1 protein_id gnl|my_center|LOCUS_35020 571700 572419 gene locus_tag LOCUS_35030 571700 572419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35030 572416 572868 gene locus_tag LOCUS_35040 572416 572868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 572880 573650 gene locus_tag LOCUS_35050 gene cbiQ 572880 573650 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893990.1 protein_id gnl|my_center|LOCUS_35050 573659 574411 gene locus_tag LOCUS_35060 573659 574411 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_35060 575612 574455 gene locus_tag LOCUS_35070 575612 574455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 576322 575609 gene locus_tag LOCUS_35080 576322 575609 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715374.1 protein_id gnl|my_center|LOCUS_35080 576836 576315 gene locus_tag LOCUS_35090 576836 576315 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 protein_id gnl|my_center|LOCUS_35090 577482 576868 gene locus_tag LOCUS_35100 577482 576868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 577542 578234 gene locus_tag LOCUS_35110 577542 578234 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284363.1 protein_id gnl|my_center|LOCUS_35110 578231 580003 gene locus_tag LOCUS_35120 578231 580003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 580019 580741 gene locus_tag LOCUS_35130 580019 580741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 580901 581500 gene locus_tag LOCUS_35140 580901 581500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 583057 581768 gene locus_tag LOCUS_35150 583057 581768 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840295.1 protein_id gnl|my_center|LOCUS_35150 583131 583721 gene locus_tag LOCUS_35160 gene orn 583131 583721 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831683.1 protein_id gnl|my_center|LOCUS_35160 583991 583764 gene locus_tag LOCUS_35170 583991 583764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 584311 584796 gene locus_tag LOCUS_35180 584311 584796 CDS product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487417.1 protein_id gnl|my_center|LOCUS_35180 584952 585614 gene locus_tag LOCUS_35190 584952 585614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 585710 587152 gene locus_tag LOCUS_35200 585710 587152 CDS product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973562.1 protein_id gnl|my_center|LOCUS_35200 588850 587399 gene locus_tag LOCUS_35210 588850 587399 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226210.1 protein_id gnl|my_center|LOCUS_35210 589027 590196 gene locus_tag LOCUS_35220 589027 590196 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208195.1 protein_id gnl|my_center|LOCUS_35220 591287 590277 gene locus_tag LOCUS_35230 591287 590277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 592300 591284 gene locus_tag LOCUS_35240 592300 591284 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223258.1 protein_id gnl|my_center|LOCUS_35240 592187 592435 gene locus_tag LOCUS_35250 592187 592435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 592432 593274 gene locus_tag LOCUS_35260 592432 593274 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_35260 593294 594193 gene locus_tag LOCUS_35270 593294 594193 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231023.1 protein_id gnl|my_center|LOCUS_35270 594969 594244 gene locus_tag LOCUS_35280 594969 594244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 595979 595047 gene locus_tag LOCUS_35290 595979 595047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 596904 596422 gene locus_tag LOCUS_35300 596904 596422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 598117 597596 gene locus_tag LOCUS_35310 598117 597596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 598215 598988 gene locus_tag LOCUS_35320 598215 598988 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223512.1 protein_id gnl|my_center|LOCUS_35320 599060 600682 gene locus_tag LOCUS_35330 599060 600682 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908709.1 protein_id gnl|my_center|LOCUS_35330 600779 600976 gene locus_tag LOCUS_35340 600779 600976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 601500 601087 gene locus_tag LOCUS_35350 601500 601087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 601828 601529 gene locus_tag LOCUS_35360 601828 601529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 602217 601825 gene locus_tag LOCUS_35370 602217 601825 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977138.1 protein_id gnl|my_center|LOCUS_35370 602277 603056 gene locus_tag LOCUS_35380 602277 603056 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122195341.1 protein_id gnl|my_center|LOCUS_35380 603059 603466 gene locus_tag LOCUS_35390 603059 603466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 603707 604486 gene locus_tag LOCUS_35400 603707 604486 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_35400 604483 605457 gene locus_tag LOCUS_35410 604483 605457 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223551.1 protein_id gnl|my_center|LOCUS_35410 605824 607002 gene locus_tag LOCUS_35420 605824 607002 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223557.1 protein_id gnl|my_center|LOCUS_35420 607078 608211 gene locus_tag LOCUS_35430 gene mnmA 607078 608211 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_35430 608230 609234 gene locus_tag LOCUS_35440 608230 609234 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_35440 609271 609639 gene locus_tag LOCUS_35450 609271 609639 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222358.1 protein_id gnl|my_center|LOCUS_35450 609688 610689 gene locus_tag LOCUS_35460 609688 610689 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977058.1 protein_id gnl|my_center|LOCUS_35460 611388 610810 gene locus_tag LOCUS_35470 611388 610810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 611550 613838 gene locus_tag LOCUS_35480 gene ligA 611550 613838 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223566.1 protein_id gnl|my_center|LOCUS_35480 614052 616541 gene locus_tag LOCUS_35490 614052 616541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 616739 617044 gene locus_tag LOCUS_35500 gene gatC 616739 617044 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_35500 617041 618516 gene locus_tag LOCUS_35510 gene gatA 617041 618516 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223570.1 protein_id gnl|my_center|LOCUS_35510 618530 620029 gene locus_tag LOCUS_35520 gene gatB 618530 620029 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 protein_id gnl|my_center|LOCUS_35520 620147 622504 gene locus_tag LOCUS_35530 620147 622504 CDS product 1-deoxy-D-xylulose-5-phosphate synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258659.1 protein_id gnl|my_center|LOCUS_35530 622942 622535 gene locus_tag LOCUS_35540 622942 622535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 624676 623093 gene locus_tag LOCUS_35550 624676 623093 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974879.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35550 625910 624771 gene locus_tag LOCUS_35560 625910 624771 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486947.1 protein_id gnl|my_center|LOCUS_35560 626186 627112 gene locus_tag LOCUS_35570 626186 627112 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466703.1 protein_id gnl|my_center|LOCUS_35570 627873 627199 gene locus_tag LOCUS_35580 627873 627199 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729362.1 protein_id gnl|my_center|LOCUS_35580 629161 627956 gene locus_tag LOCUS_35590 629161 627956 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218919764.1 protein_id gnl|my_center|LOCUS_35590 629344 629940 gene locus_tag LOCUS_35600 629344 629940 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229903.1 protein_id gnl|my_center|LOCUS_35600 630449 630021 gene locus_tag LOCUS_35610 630449 630021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 630639 633254 gene locus_tag LOCUS_35620 630639 633254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 634307 633288 gene locus_tag LOCUS_35630 634307 633288 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972694.1 protein_id gnl|my_center|LOCUS_35630 634685 635968 gene locus_tag LOCUS_35640 634685 635968 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224314.1 protein_id gnl|my_center|LOCUS_35640 636070 637086 gene locus_tag LOCUS_35650 636070 637086 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 protein_id gnl|my_center|LOCUS_35650 637083 637994 gene locus_tag LOCUS_35660 637083 637994 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227021.1 protein_id gnl|my_center|LOCUS_35660 637991 640444 gene locus_tag LOCUS_35670 637991 640444 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225596.1 protein_id gnl|my_center|LOCUS_35670 641494 640559 gene locus_tag LOCUS_35680 641494 640559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 642110 641616 gene locus_tag LOCUS_35690 642110 641616 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 protein_id gnl|my_center|LOCUS_35690 643524 642199 gene locus_tag LOCUS_35700 643524 642199 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_35700 645081 643825 gene locus_tag LOCUS_35710 645081 643825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 645415 645185 gene locus_tag LOCUS_35720 645415 645185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 645717 645412 gene locus_tag LOCUS_35730 645717 645412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 645930 647075 gene locus_tag LOCUS_35740 645930 647075 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027320.1 protein_id gnl|my_center|LOCUS_35740 647320 647132 gene locus_tag LOCUS_35750 647320 647132 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_35750 647598 647410 gene locus_tag LOCUS_35760 647598 647410 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_35760 648472 647591 gene locus_tag LOCUS_35770 648472 647591 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_35770 648761 648997 gene locus_tag LOCUS_35780 648761 648997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 648994 651021 gene locus_tag LOCUS_35790 648994 651021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 651718 651077 gene locus_tag LOCUS_35800 651718 651077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 651978 652514 gene locus_tag LOCUS_35810 651978 652514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 654418 652571 gene locus_tag LOCUS_35820 gene ilvD 654418 652571 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223580.1 protein_id gnl|my_center|LOCUS_35820 654529 656991 gene locus_tag LOCUS_35830 654529 656991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 657175 659055 gene locus_tag LOCUS_35840 657175 659055 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284399.1 protein_id gnl|my_center|LOCUS_35840 659055 659570 gene locus_tag LOCUS_35850 gene ilvN 659055 659570 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_35850 659642 660655 gene locus_tag LOCUS_35860 gene ilvC 659642 660655 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223583.1 protein_id gnl|my_center|LOCUS_35860 660918 662516 gene locus_tag LOCUS_35870 gene serA 660918 662516 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_35870 662995 662603 gene locus_tag LOCUS_35880 662995 662603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 664184 663309 gene locus_tag LOCUS_35890 664184 663309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 664407 665438 gene locus_tag LOCUS_35900 664407 665438 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223592.1 protein_id gnl|my_center|LOCUS_35900 665635 666717 gene locus_tag LOCUS_35910 665635 666717 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145785146.1 protein_id gnl|my_center|LOCUS_35910 667605 666829 gene locus_tag LOCUS_35920 667605 666829 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724030.1 protein_id gnl|my_center|LOCUS_35920 668112 667654 gene locus_tag LOCUS_35930 668112 667654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 668804 668274 gene locus_tag LOCUS_35940 668804 668274 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973946.1 protein_id gnl|my_center|LOCUS_35940 669367 668807 gene locus_tag LOCUS_35950 669367 668807 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973945.1 protein_id gnl|my_center|LOCUS_35950 669779 671362 gene locus_tag LOCUS_35960 gene cimA 669779 671362 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223593.1 protein_id gnl|my_center|LOCUS_35960 672397 671399 gene locus_tag LOCUS_35970 672397 671399 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230440.1 protein_id gnl|my_center|LOCUS_35970 672749 673276 gene locus_tag LOCUS_35980 672749 673276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 673451 674500 gene locus_tag LOCUS_35990 673451 674500 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_35990 674497 675681 gene locus_tag LOCUS_36000 674497 675681 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728848.1 protein_id gnl|my_center|LOCUS_36000 675678 676637 gene locus_tag LOCUS_36010 675678 676637 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 protein_id gnl|my_center|LOCUS_36010 676727 677590 gene locus_tag LOCUS_36020 676727 677590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36020 677664 678089 gene locus_tag LOCUS_36030 gene arfB 677664 678089 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230741.1 protein_id gnl|my_center|LOCUS_36030 678288 678809 gene locus_tag LOCUS_36040 678288 678809 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668728.1 protein_id gnl|my_center|LOCUS_36040 678868 680106 gene locus_tag LOCUS_36050 678868 680106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 681033 680167 gene locus_tag LOCUS_36060 681033 680167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_36060 682447 681107 gene locus_tag LOCUS_36070 682447 681107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 682714 683517 gene locus_tag LOCUS_36080 682714 683517 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223594.1 protein_id gnl|my_center|LOCUS_36080 683643 683715 gene locus_tag LOCUS_t00430 683643 683715 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 683847 683920 gene locus_tag LOCUS_t00440 683847 683920 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 684134 684207 gene locus_tag LOCUS_t00450 684134 684207 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 685042 684356 gene locus_tag LOCUS_36090 gene ndgR 685042 684356 CDS product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_36090 685092 686534 gene locus_tag LOCUS_36100 gene leuC 685092 686534 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223619.1 protein_id gnl|my_center|LOCUS_36100 686552 687139 gene locus_tag LOCUS_36110 gene leuD 686552 687139 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775883.1 protein_id gnl|my_center|LOCUS_36110 687312 688004 gene locus_tag LOCUS_36120 687312 688004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36120 688167 690296 gene locus_tag LOCUS_36130 688167 690296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 691276 690398 gene locus_tag LOCUS_36140 691276 690398 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223623.1 protein_id gnl|my_center|LOCUS_36140 693670 691292 gene locus_tag LOCUS_36150 693670 691292 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893757.1 protein_id gnl|my_center|LOCUS_36150 693921 693724 gene locus_tag LOCUS_36160 693921 693724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 694613 693957 gene locus_tag LOCUS_36170 gene cofC 694613 693957 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223625.1 protein_id gnl|my_center|LOCUS_36170 694740 695483 gene locus_tag LOCUS_36180 694740 695483 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_36180 695498 696487 gene locus_tag LOCUS_36190 695498 696487 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_36190 696495 697610 gene locus_tag LOCUS_36200 696495 697610 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029309.1 protein_id gnl|my_center|LOCUS_36200 697868 698659 gene locus_tag LOCUS_36210 697868 698659 CDS product putative protein N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226080.1 protein_id gnl|my_center|LOCUS_36210 699086 698886 gene locus_tag LOCUS_36220 699086 698886 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224345.1 protein_id gnl|my_center|LOCUS_36220 699975 699091 gene locus_tag LOCUS_36230 699975 699091 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_36230 700166 700369 gene locus_tag LOCUS_36240 700166 700369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 700366 700581 gene locus_tag LOCUS_36250 700366 700581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 700769 701866 gene locus_tag LOCUS_36260 700769 701866 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223638.1 protein_id gnl|my_center|LOCUS_36260 702596 701910 gene locus_tag LOCUS_36270 702596 701910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 702830 702597 gene locus_tag LOCUS_36280 702830 702597 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_36280 703013 703951 gene locus_tag LOCUS_36290 703013 703951 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_36290 703980 704447 gene locus_tag LOCUS_36300 703980 704447 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223641.1 protein_id gnl|my_center|LOCUS_36300 704743 704552 gene locus_tag LOCUS_36310 gene rpmB 704743 704552 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091970.1 protein_id gnl|my_center|LOCUS_36310 704923 706539 gene locus_tag LOCUS_36320 704923 706539 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030309.1 protein_id gnl|my_center|LOCUS_36320 706536 708740 gene locus_tag LOCUS_36330 gene recG 706536 708740 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223647.1 protein_id gnl|my_center|LOCUS_36330 708808 709746 gene locus_tag LOCUS_36340 708808 709746 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_36340 711283 710003 gene locus_tag LOCUS_36350 711283 710003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 711590 712153 gene locus_tag LOCUS_36360 gene rsmD 711590 712153 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 protein_id gnl|my_center|LOCUS_36360 712162 712632 gene locus_tag LOCUS_36370 gene coaD 712162 712632 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_36370 712855 713352 gene locus_tag LOCUS_36380 712855 713352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 713463 714026 gene locus_tag LOCUS_36390 713463 714026 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284376.1 protein_id gnl|my_center|LOCUS_36390 714032 714205 gene locus_tag LOCUS_36400 gene rpmF 714032 714205 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006139588.1 protein_id gnl|my_center|LOCUS_36400 714320 715318 gene locus_tag LOCUS_36410 gene plsX 714320 715318 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919245.1 protein_id gnl|my_center|LOCUS_36410 715422 716360 gene locus_tag LOCUS_36420 715422 716360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 716353 717210 gene locus_tag LOCUS_36430 gene mutM 716353 717210 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973422.1 protein_id gnl|my_center|LOCUS_36430 717369 717530 gene locus_tag LOCUS_36440 717369 717530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 717533 718333 gene locus_tag LOCUS_36450 717533 718333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 719203 718358 gene locus_tag LOCUS_36460 719203 718358 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028181.1 protein_id gnl|my_center|LOCUS_36460 720654 719347 gene locus_tag LOCUS_36470 720654 719347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 721021 721215 gene locus_tag LOCUS_36480 721021 721215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 721626 721336 gene locus_tag LOCUS_36490 721626 721336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 721517 725131 gene locus_tag LOCUS_36500 gene smc 721517 725131 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223795.1 protein_id gnl|my_center|LOCUS_36500 725131 725751 gene locus_tag LOCUS_36510 725131 725751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 726298 725777 gene locus_tag LOCUS_36520 726298 725777 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977487.1 protein_id gnl|my_center|LOCUS_36520 727433 726936 gene locus_tag LOCUS_36530 727433 726936 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977923.1 protein_id gnl|my_center|LOCUS_36530 729071 727443 gene locus_tag LOCUS_36540 729071 727443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 729668 729228 gene locus_tag LOCUS_36550 729668 729228 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973682.1 protein_id gnl|my_center|LOCUS_36550 731434 729929 gene locus_tag LOCUS_36560 731434 729929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 733385 731670 gene locus_tag LOCUS_36570 733385 731670 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028298.1 protein_id gnl|my_center|LOCUS_36570 733532 734722 gene locus_tag LOCUS_36580 gene ftsY 733532 734722 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_36580 734805 735593 gene locus_tag LOCUS_36590 734805 735593 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975366.1 protein_id gnl|my_center|LOCUS_36590 736132 737544 gene locus_tag LOCUS_36600 736132 737544 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831524.1 protein_id gnl|my_center|LOCUS_36600 737555 737908 gene locus_tag LOCUS_36610 737555 737908 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 protein_id gnl|my_center|LOCUS_36610 738065 740368 gene locus_tag LOCUS_36620 738065 740368 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081546.1 protein_id gnl|my_center|LOCUS_36620 740610 742169 gene locus_tag LOCUS_36630 gene ffh 740610 742169 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223845.1 protein_id gnl|my_center|LOCUS_36630 742238 742414 gene locus_tag LOCUS_36640 742238 742414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 742433 743518 gene locus_tag LOCUS_36650 742433 743518 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223846.1 protein_id gnl|my_center|LOCUS_36650 744083 743484 gene locus_tag LOCUS_36660 744083 743484 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296502.1 protein_id gnl|my_center|LOCUS_36660 744270 745676 gene locus_tag LOCUS_36670 gene proS 744270 745676 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908400.1 protein_id gnl|my_center|LOCUS_36670 745818 746438 gene locus_tag LOCUS_36680 745818 746438 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742102.1 protein_id gnl|my_center|LOCUS_36680 746711 747202 gene locus_tag LOCUS_36690 746711 747202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 747204 747437 gene locus_tag LOCUS_36700 747204 747437 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_36700 747437 747994 gene locus_tag LOCUS_36710 gene rimM 747437 747994 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223850.1 protein_id gnl|my_center|LOCUS_36710 748014 748817 gene locus_tag LOCUS_36720 gene trmD 748014 748817 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223852.1 protein_id gnl|my_center|LOCUS_36720 748959 749315 gene locus_tag LOCUS_36730 gene rplS 748959 749315 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223853.1 protein_id gnl|my_center|LOCUS_36730 749512 750393 gene locus_tag LOCUS_36740 gene lepB 749512 750393 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227333.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36740 750390 751025 gene locus_tag LOCUS_36750 750390 751025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 751045 751611 gene locus_tag LOCUS_36760 751045 751611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 751605 752417 gene locus_tag LOCUS_36770 751605 752417 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728344.1 protein_id gnl|my_center|LOCUS_36770 752414 752737 gene locus_tag LOCUS_36780 752414 752737 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_36780 753226 752903 gene locus_tag LOCUS_36790 753226 752903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 753606 754181 gene locus_tag LOCUS_36800 753606 754181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 755494 754292 gene locus_tag LOCUS_36810 755494 754292 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033518021.1 protein_id gnl|my_center|LOCUS_36810 756749 755691 gene locus_tag LOCUS_36820 756749 755691 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804632.1 protein_id gnl|my_center|LOCUS_36820 756981 757148 gene locus_tag LOCUS_36830 756981 757148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 758476 757232 gene locus_tag LOCUS_36840 gene dprA 758476 757232 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487183.1 protein_id gnl|my_center|LOCUS_36840 759993 758473 gene locus_tag LOCUS_36850 759993 758473 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877410.1 protein_id gnl|my_center|LOCUS_36850 760366 760007 gene locus_tag LOCUS_36860 760366 760007 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872622.1 protein_id gnl|my_center|LOCUS_36860 760632 761846 gene locus_tag LOCUS_36870 760632 761846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 762051 762962 gene locus_tag LOCUS_36880 gene rpsB 762051 762962 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 protein_id gnl|my_center|LOCUS_36880 763097 763924 gene locus_tag LOCUS_36890 gene tsf 763097 763924 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223863.1 protein_id gnl|my_center|LOCUS_36890 764085 764852 gene locus_tag LOCUS_36900 gene pyrH 764085 764852 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804636.1 protein_id gnl|my_center|LOCUS_36900 764934 765491 gene locus_tag LOCUS_36910 gene frr 764934 765491 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466739.1 protein_id gnl|my_center|LOCUS_36910 765862 767235 gene locus_tag LOCUS_36920 765862 767235 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852129.1 protein_id gnl|my_center|LOCUS_36920 767340 768491 gene locus_tag LOCUS_36930 gene rlmN 767340 768491 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092553592.1 protein_id gnl|my_center|LOCUS_36930 768523 770019 gene locus_tag LOCUS_36940 768523 770019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 770328 770125 gene locus_tag LOCUS_36950 770328 770125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 770752 770438 gene locus_tag LOCUS_36960 770752 770438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 770703 772235 gene locus_tag LOCUS_36970 770703 772235 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731268.1 protein_id gnl|my_center|LOCUS_36970 773900 772299 gene locus_tag LOCUS_36980 773900 772299 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_36980 774046 774591 gene locus_tag LOCUS_36990 774046 774591 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229278.1 protein_id gnl|my_center|LOCUS_36990 777846 774670 gene locus_tag LOCUS_37000 777846 774670 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109036420.1 protein_id gnl|my_center|LOCUS_37000 778378 778046 gene locus_tag LOCUS_37010 778378 778046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 778381 786087 gene locus_tag LOCUS_37020 778381 786087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 786093 786539 gene locus_tag LOCUS_37030 786093 786539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 786909 788300 gene locus_tag LOCUS_37040 786909 788300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 788334 788513 gene locus_tag LOCUS_37050 788334 788513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 789151 788693 gene locus_tag LOCUS_37060 789151 788693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 789426 789148 gene locus_tag LOCUS_37070 789426 789148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 789633 790514 gene locus_tag LOCUS_37080 789633 790514 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_37080 790504 790698 gene locus_tag LOCUS_37090 790504 790698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 792175 790775 gene locus_tag LOCUS_37100 792175 790775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 793532 792216 gene locus_tag LOCUS_37110 793532 792216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 793694 794359 gene locus_tag LOCUS_37120 793694 794359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 794403 795614 gene locus_tag LOCUS_37130 gene dxr 794403 795614 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_37130 795614 796864 gene locus_tag LOCUS_37140 795614 796864 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088304.1 protein_id gnl|my_center|LOCUS_37140 796874 798046 gene locus_tag LOCUS_37150 gene ispG 796874 798046 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031167.1 protein_id gnl|my_center|LOCUS_37150 798797 798201 gene locus_tag LOCUS_37160 798797 798201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 798983 799822 gene locus_tag LOCUS_37170 798983 799822 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_37170 800056 803598 gene locus_tag LOCUS_37180 800056 803598 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110240682.1 protein_id gnl|my_center|LOCUS_37180 804750 803683 gene locus_tag LOCUS_37190 804750 803683 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113836.1 protein_id gnl|my_center|LOCUS_37190 806088 804787 gene locus_tag LOCUS_37200 806088 804787 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974451.1 protein_id gnl|my_center|LOCUS_37200 807002 806283 gene locus_tag LOCUS_37210 807002 806283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 807960 806995 gene locus_tag LOCUS_37220 807960 806995 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978084.1 protein_id gnl|my_center|LOCUS_37220 808058 809263 gene locus_tag LOCUS_37230 gene pcaF 808058 809263 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528954.1 protein_id gnl|my_center|LOCUS_37230 809461 813297 gene locus_tag LOCUS_37240 809461 813297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 813510 814322 gene locus_tag LOCUS_37250 813510 814322 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_37250 814329 816506 gene locus_tag LOCUS_37260 gene rmdA 814329 816506 CDS product cyclic Di-GMP phosphodiesterase RmdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027451.1 protein_id gnl|my_center|LOCUS_37260 816503 817003 gene locus_tag LOCUS_37270 816503 817003 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726666.1 protein_id gnl|my_center|LOCUS_37270 817089 817454 gene locus_tag LOCUS_37280 817089 817454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 817982 818260 gene locus_tag LOCUS_37290 817982 818260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 818282 825226 gene locus_tag LOCUS_37300 818282 825226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 825885 825418 gene locus_tag LOCUS_37310 825885 825418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 826919 826062 gene locus_tag LOCUS_37320 826919 826062 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228180.1 protein_id gnl|my_center|LOCUS_37320 827009 827491 gene locus_tag LOCUS_37330 827009 827491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 827580 828944 gene locus_tag LOCUS_37340 gene glnA4 827580 828944 CDS product gamma-glutamylethanolamide synthetase GlnA4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027883.1 protein_id gnl|my_center|LOCUS_37340 829092 830411 gene locus_tag LOCUS_37350 829092 830411 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223703.1 protein_id gnl|my_center|LOCUS_37350 830416 831183 gene locus_tag LOCUS_37360 830416 831183 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223704.1 protein_id gnl|my_center|LOCUS_37360 831284 831832 gene locus_tag LOCUS_37370 831284 831832 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977253.1 protein_id gnl|my_center|LOCUS_37370 831979 835671 gene locus_tag LOCUS_37380 831979 835671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 836050 835700 gene locus_tag LOCUS_37390 836050 835700 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003078104.1 protein_id gnl|my_center|LOCUS_37390 836144 837001 gene locus_tag LOCUS_37400 gene map 836144 837001 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_37400 836998 837711 gene locus_tag LOCUS_37410 836998 837711 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_37410 838460 837750 gene locus_tag LOCUS_37420 838460 837750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 839033 838536 gene locus_tag LOCUS_37430 839033 838536 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467644.1 protein_id gnl|my_center|LOCUS_37430 841852 839135 gene locus_tag LOCUS_37440 841852 839135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 842730 841963 gene locus_tag LOCUS_37450 842730 841963 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265944.1 protein_id gnl|my_center|LOCUS_37450 843362 842727 gene locus_tag LOCUS_37460 843362 842727 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804263.1 protein_id gnl|my_center|LOCUS_37460 843903 843454 gene locus_tag LOCUS_37470 843903 843454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 844409 843900 gene locus_tag LOCUS_37480 844409 843900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 844581 845273 gene locus_tag LOCUS_37490 844581 845273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 845270 846313 gene locus_tag LOCUS_37500 gene nusA 845270 846313 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228123.1 protein_id gnl|my_center|LOCUS_37500 846587 846255 gene locus_tag LOCUS_37510 846587 846255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 846756 849791 gene locus_tag LOCUS_37520 846756 849791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 849881 850183 gene locus_tag LOCUS_37530 849881 850183 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973319.1 protein_id gnl|my_center|LOCUS_37530 850306 850812 gene locus_tag LOCUS_37540 gene rbfA 850306 850812 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228119.1 protein_id gnl|my_center|LOCUS_37540 850809 851912 gene locus_tag LOCUS_37550 850809 851912 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296638.1 protein_id gnl|my_center|LOCUS_37550 851977 852384 gene locus_tag LOCUS_37560 851977 852384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 852381 852593 gene locus_tag LOCUS_37570 852381 852593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 852814 852990 gene locus_tag LOCUS_37580 852814 852990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 853158 854516 gene locus_tag LOCUS_37590 gene mmp 853158 854516 CDS product MATE family efflux transporter Mmp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728487.1 protein_id gnl|my_center|LOCUS_37590 855605 854559 gene locus_tag LOCUS_37600 855605 854559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 855998 855699 gene locus_tag LOCUS_37610 855998 855699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 856088 856972 gene locus_tag LOCUS_37620 gene truB 856088 856972 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728501.1 protein_id gnl|my_center|LOCUS_37620 857032 857961 gene locus_tag LOCUS_37630 857032 857961 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790919.1 protein_id gnl|my_center|LOCUS_37630 858212 858481 gene locus_tag LOCUS_37640 gene rpsO 858212 858481 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052997.1 protein_id gnl|my_center|LOCUS_37640 858714 861107 gene locus_tag LOCUS_37650 858714 861107 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728507.1 protein_id gnl|my_center|LOCUS_37650 861392 861111 gene locus_tag LOCUS_37660 861392 861111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 861346 862572 gene locus_tag LOCUS_37670 861346 862572 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_37670 862660 863433 gene locus_tag LOCUS_37680 gene dapB 862660 863433 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081787.1 protein_id gnl|my_center|LOCUS_37680 863480 863965 gene locus_tag LOCUS_37690 863480 863965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 864619 864038 gene locus_tag LOCUS_37700 864619 864038 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228094.1 protein_id gnl|my_center|LOCUS_37700 864655 865965 gene locus_tag LOCUS_37710 864655 865965 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840295.1 protein_id gnl|my_center|LOCUS_37710 866415 865864 gene locus_tag LOCUS_37720 866415 865864 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030950.1 protein_id gnl|my_center|LOCUS_37720 866464 867723 gene locus_tag LOCUS_37730 866464 867723 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 protein_id gnl|my_center|LOCUS_37730 867936 868391 gene locus_tag LOCUS_37740 867936 868391 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111747.1 protein_id gnl|my_center|LOCUS_37740 868976 869713 gene locus_tag LOCUS_37750 gene thyX 868976 869713 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228090.1 protein_id gnl|my_center|LOCUS_37750 869767 870690 gene locus_tag LOCUS_37760 gene dapA 869767 870690 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_37760 870746 872434 gene locus_tag LOCUS_37770 870746 872434 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_37770 873596 872562 gene locus_tag LOCUS_37780 873596 872562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 875471 873696 gene locus_tag LOCUS_37790 875471 873696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 875947 875468 gene locus_tag LOCUS_37800 875947 875468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 876211 878535 gene locus_tag LOCUS_37810 876211 878535 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113701643.1 protein_id gnl|my_center|LOCUS_37810 878880 878566 gene locus_tag LOCUS_37820 gene sugE 878880 878566 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228124.1 protein_id gnl|my_center|LOCUS_37820 879086 880009 gene locus_tag LOCUS_37830 879086 880009 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223380.1 protein_id gnl|my_center|LOCUS_37830 880167 881717 gene locus_tag LOCUS_37840 gene rimO 880167 881717 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228069.1 protein_id gnl|my_center|LOCUS_37840 881828 882388 gene locus_tag LOCUS_37850 gene pgsA 881828 882388 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228068.1 protein_id gnl|my_center|LOCUS_37850 882543 883118 gene locus_tag LOCUS_37860 882543 883118 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228067.1 protein_id gnl|my_center|LOCUS_37860 883279 883740 gene locus_tag LOCUS_37870 883279 883740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 884062 884931 gene locus_tag LOCUS_37880 gene pspA 884062 884931 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414030.1 protein_id gnl|my_center|LOCUS_37880 885026 885811 gene locus_tag LOCUS_37890 885026 885811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 889457 885816 gene locus_tag LOCUS_37900 889457 885816 CDS product choice-of-anchor D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942043.1 protein_id gnl|my_center|LOCUS_37900 890522 889668 gene locus_tag LOCUS_37910 890522 889668 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_37910 890631 891944 gene locus_tag LOCUS_37920 890631 891944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223425.1 protein_id gnl|my_center|LOCUS_37920 892308 892066 gene locus_tag LOCUS_37930 892308 892066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 893201 892425 gene locus_tag LOCUS_37940 893201 892425 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_37940 893179 893517 gene locus_tag LOCUS_37950 893179 893517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 893820 894041 gene locus_tag LOCUS_37960 893820 894041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 894675 895292 gene locus_tag LOCUS_37970 894675 895292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 895851 895393 gene locus_tag LOCUS_37980 895851 895393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 896982 895921 gene locus_tag LOCUS_37990 896982 895921 CDS product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229285.1 protein_id gnl|my_center|LOCUS_37990 902040 897097 gene locus_tag LOCUS_38000 902040 897097 CDS product alpha-(1->3)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229292.1 protein_id gnl|my_center|LOCUS_38000 903743 902037 gene locus_tag LOCUS_38010 903743 902037 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742065.1 protein_id gnl|my_center|LOCUS_38010 903845 905026 gene locus_tag LOCUS_38020 903845 905026 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296766.1 protein_id gnl|my_center|LOCUS_38020 906887 905082 gene locus_tag LOCUS_38030 906887 905082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229290.1 protein_id gnl|my_center|LOCUS_38030 908843 906891 gene locus_tag LOCUS_38040 908843 906891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296325.1 protein_id gnl|my_center|LOCUS_38040 909601 908840 gene locus_tag LOCUS_38050 909601 908840 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081985.1 protein_id gnl|my_center|LOCUS_38050 909715 910920 gene locus_tag LOCUS_38060 909715 910920 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427766.1 protein_id gnl|my_center|LOCUS_38060 910917 911723 gene locus_tag LOCUS_38070 910917 911723 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_38070 911735 912760 gene locus_tag LOCUS_38080 911735 912760 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730921.1 protein_id gnl|my_center|LOCUS_38080 912835 913989 gene locus_tag LOCUS_38090 912835 913989 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229291.1 protein_id gnl|my_center|LOCUS_38090 914040 915275 gene locus_tag LOCUS_38100 914040 915275 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079030578.1 protein_id gnl|my_center|LOCUS_38100 915641 915276 gene locus_tag LOCUS_38110 gene bldG 915641 915276 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_38110 915829 916227 gene locus_tag LOCUS_38120 915829 916227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 917107 916469 gene locus_tag LOCUS_38130 917107 916469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 922033 917453 gene locus_tag LOCUS_38140 922033 917453 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109508967.1 protein_id gnl|my_center|LOCUS_38140 922234 922647 gene locus_tag LOCUS_38150 922234 922647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 923415 922996 gene locus_tag LOCUS_38160 923415 922996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 924054 924332 gene locus_tag LOCUS_38170 924054 924332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 924430 927273 gene locus_tag LOCUS_38180 924430 927273 CDS product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727236.1 protein_id gnl|my_center|LOCUS_38180 927270 927743 gene locus_tag LOCUS_38190 927270 927743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 927740 929254 gene locus_tag LOCUS_38200 927740 929254 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776504.1 protein_id gnl|my_center|LOCUS_38200 929251 929937 gene locus_tag LOCUS_38210 929251 929937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 929934 930197 gene locus_tag LOCUS_38220 929934 930197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 930194 930532 gene locus_tag LOCUS_38230 gene mnhG 930194 930532 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727233.1 protein_id gnl|my_center|LOCUS_38230 930675 932051 gene locus_tag LOCUS_38240 930675 932051 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026955.1 protein_id gnl|my_center|LOCUS_38240 932048 933115 gene locus_tag LOCUS_38250 932048 933115 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026954.1 protein_id gnl|my_center|LOCUS_38250 933302 934231 gene locus_tag LOCUS_38260 933302 934231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 934913 934257 gene locus_tag LOCUS_38270 gene leuE 934913 934257 CDS product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095208.1 protein_id gnl|my_center|LOCUS_38270 936166 934922 gene locus_tag LOCUS_38280 936166 934922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 936223 937641 gene locus_tag LOCUS_38290 936223 937641 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027746.1 protein_id gnl|my_center|LOCUS_38290 937909 938613 gene locus_tag LOCUS_38300 937909 938613 CDS product UdgX family uracil-DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726794.1 protein_id gnl|my_center|LOCUS_38300 938803 939108 gene locus_tag LOCUS_38310 938803 939108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 939343 940671 gene locus_tag LOCUS_38320 939343 940671 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902466.1 protein_id gnl|my_center|LOCUS_38320 940662 940862 gene locus_tag LOCUS_38330 940662 940862 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973258.1 protein_id gnl|my_center|LOCUS_38330 941050 942096 gene locus_tag LOCUS_38340 gene recA 941050 942096 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224217.1 protein_id gnl|my_center|LOCUS_38340 942111 942806 gene locus_tag LOCUS_38350 942111 942806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38350 942886 943590 gene locus_tag LOCUS_38360 942886 943590 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090118.1 protein_id gnl|my_center|LOCUS_38360 944054 944404 gene locus_tag LOCUS_38370 944054 944404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 944401 946167 gene locus_tag LOCUS_38380 gene rny 944401 946167 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_38380 946406 946729 gene locus_tag LOCUS_38390 946406 946729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 947105 947431 gene locus_tag LOCUS_38400 947105 947431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 948361 947480 gene locus_tag LOCUS_38410 948361 947480 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030446.1 protein_id gnl|my_center|LOCUS_38410 949035 948361 gene locus_tag LOCUS_38420 949035 948361 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057178.1 protein_id gnl|my_center|LOCUS_38420 949974 949114 gene locus_tag LOCUS_38430 949974 949114 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894111.1 protein_id gnl|my_center|LOCUS_38430 950787 950032 gene locus_tag LOCUS_38440 950787 950032 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973246.1 protein_id gnl|my_center|LOCUS_38440 950984 951973 gene locus_tag LOCUS_38450 gene selD 950984 951973 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226944.1 protein_id gnl|my_center|LOCUS_38450 952206 952685 gene locus_tag LOCUS_38460 952206 952685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 953043 952810 gene locus_tag LOCUS_38470 953043 952810 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028299.1 protein_id gnl|my_center|LOCUS_38470 953110 954666 gene locus_tag LOCUS_38480 gene miaB 953110 954666 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224253.1 protein_id gnl|my_center|LOCUS_38480 956085 954877 gene locus_tag LOCUS_38490 956085 954877 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224256.1 protein_id gnl|my_center|LOCUS_38490 956237 957007 gene locus_tag LOCUS_38500 956237 957007 CDS product class III extradiol dioxygenase subunit B-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030454.1 protein_id gnl|my_center|LOCUS_38500 957004 957942 gene locus_tag LOCUS_38510 gene miaA 957004 957942 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_38510 957951 958790 gene locus_tag LOCUS_38520 gene dapF 957951 958790 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224258.1 protein_id gnl|my_center|LOCUS_38520 960275 958809 gene locus_tag LOCUS_38530 960275 958809 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230249.1 protein_id gnl|my_center|LOCUS_38530 960482 961927 gene locus_tag LOCUS_38540 gene hflX 960482 961927 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 protein_id gnl|my_center|LOCUS_38540 962112 963848 gene locus_tag LOCUS_38550 962112 963848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 964782 963997 gene locus_tag LOCUS_38560 gene lexA 964782 963997 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091617684.1 protein_id gnl|my_center|LOCUS_38560 965436 965951 gene locus_tag LOCUS_38570 gene nrdR 965436 965951 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413973.1 protein_id gnl|my_center|LOCUS_38570 966018 968918 gene locus_tag LOCUS_38580 966018 968918 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_38580 970017 969115 gene locus_tag LOCUS_38590 970017 969115 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228190.1 protein_id gnl|my_center|LOCUS_38590 971248 970061 gene locus_tag LOCUS_38600 971248 970061 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227969.1 protein_id gnl|my_center|LOCUS_38600 971427 972218 gene locus_tag LOCUS_38610 971427 972218 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285566.1 protein_id gnl|my_center|LOCUS_38610 972215 973198 gene locus_tag LOCUS_38620 972215 973198 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223629.1 protein_id gnl|my_center|LOCUS_38620 973283 973525 gene locus_tag LOCUS_38630 973283 973525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 973607 974158 gene locus_tag LOCUS_38640 973607 974158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 974909 974229 gene locus_tag LOCUS_38650 974909 974229 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081890.1 protein_id gnl|my_center|LOCUS_38650 975008 975856 gene locus_tag LOCUS_38660 975008 975856 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224290.1 protein_id gnl|my_center|LOCUS_38660 975940 977121 gene locus_tag LOCUS_38670 975940 977121 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224291.1 protein_id gnl|my_center|LOCUS_38670 977152 979710 gene locus_tag LOCUS_38680 977152 979710 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_38680 980032 980313 gene locus_tag LOCUS_38690 980032 980313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38690 980856 980422 gene locus_tag LOCUS_38700 980856 980422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 988017 980869 gene locus_tag LOCUS_38710 988017 980869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 989823 988807 gene locus_tag LOCUS_38720 989823 988807 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224439.1 protein_id gnl|my_center|LOCUS_38720 990067 990855 gene locus_tag LOCUS_38730 990067 990855 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484222.1 protein_id gnl|my_center|LOCUS_38730 991402 990980 gene locus_tag LOCUS_38740 gene dtd 991402 990980 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804517.1 protein_id gnl|my_center|LOCUS_38740 992886 991402 gene locus_tag LOCUS_38750 992886 991402 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742165.1 protein_id gnl|my_center|LOCUS_38750 993024 993299 gene locus_tag LOCUS_38760 993024 993299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 993346 993615 gene locus_tag LOCUS_38770 993346 993615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 993615 994535 gene locus_tag LOCUS_38780 993615 994535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 994850 994554 gene locus_tag LOCUS_38790 994850 994554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 994916 995284 gene locus_tag LOCUS_38800 994916 995284 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224443.1 protein_id gnl|my_center|LOCUS_38800 996229 995330 gene locus_tag LOCUS_38810 996229 995330 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975796.1 protein_id gnl|my_center|LOCUS_38810 997158 996226 gene locus_tag LOCUS_38820 997158 996226 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976848.1 protein_id gnl|my_center|LOCUS_38820 997247 997465 gene locus_tag LOCUS_38830 997247 997465 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284335.1 protein_id gnl|my_center|LOCUS_38830 997506 998156 gene locus_tag LOCUS_38840 997506 998156 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230062.1 protein_id gnl|my_center|LOCUS_38840 998363 1000096 gene locus_tag LOCUS_38850 998363 1000096 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089243049.1 protein_id gnl|my_center|LOCUS_38850 1000441 1000208 gene locus_tag LOCUS_38860 1000441 1000208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057215.1 protein_id gnl|my_center|LOCUS_38860 1002264 1000687 gene locus_tag LOCUS_38870 1002264 1000687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 1003067 1002711 gene locus_tag LOCUS_38880 1003067 1002711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 1003171 1003989 gene locus_tag LOCUS_38890 1003171 1003989 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153505920.1 protein_id gnl|my_center|LOCUS_38890 1004666 1004151 gene locus_tag LOCUS_38900 1004666 1004151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 1004708 1004860 gene locus_tag LOCUS_38910 1004708 1004860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 1005101 1005397 gene locus_tag LOCUS_38920 1005101 1005397 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057245.1 protein_id gnl|my_center|LOCUS_38920 1005589 1006554 gene locus_tag LOCUS_38930 1005589 1006554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030505.1 protein_id gnl|my_center|LOCUS_38930 1007029 1006571 gene locus_tag LOCUS_38940 1007029 1006571 CDS product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224477.1 protein_id gnl|my_center|LOCUS_38940 1007150 1007656 gene locus_tag LOCUS_38950 gene dut 1007150 1007656 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973153.1 protein_id gnl|my_center|LOCUS_38950 1007682 1008356 gene locus_tag LOCUS_38960 1007682 1008356 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973152.1 protein_id gnl|my_center|LOCUS_38960 1008537 1008920 gene locus_tag LOCUS_38970 1008537 1008920 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224481.1 protein_id gnl|my_center|LOCUS_38970 1008956 1009642 gene locus_tag LOCUS_38980 1008956 1009642 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111515.1 protein_id gnl|my_center|LOCUS_38980 1010373 1009684 gene locus_tag LOCUS_38990 1010373 1009684 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067924.1 protein_id gnl|my_center|LOCUS_38990 1011041 1010376 gene locus_tag LOCUS_39000 1011041 1010376 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_39000 1011213 1013285 gene locus_tag LOCUS_39010 1011213 1013285 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742167.1 protein_id gnl|my_center|LOCUS_39010 1013282 1014613 gene locus_tag LOCUS_39020 1013282 1014613 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224485.1 protein_id gnl|my_center|LOCUS_39020 1014620 1015783 gene locus_tag LOCUS_39030 1014620 1015783 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223798.1 protein_id gnl|my_center|LOCUS_39030 1015856 1017811 gene locus_tag LOCUS_39040 gene dxs 1015856 1017811 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224488.1 protein_id gnl|my_center|LOCUS_39040 1019178 1018009 gene locus_tag LOCUS_39050 1019178 1018009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 1019486 1021381 gene locus_tag LOCUS_39060 1019486 1021381 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630171.1 protein_id gnl|my_center|LOCUS_39060 1021339 1021968 gene locus_tag LOCUS_39070 1021339 1021968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 1021971 1022783 gene locus_tag LOCUS_39080 1021971 1022783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 1022913 1023341 gene locus_tag LOCUS_39090 1022913 1023341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 1023415 1023822 gene locus_tag LOCUS_39100 1023415 1023822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 1025842 1023893 gene locus_tag LOCUS_39110 1025842 1023893 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630171.1 protein_id gnl|my_center|LOCUS_39110 1025941 1027230 gene locus_tag LOCUS_39120 1025941 1027230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 1028442 1027246 gene locus_tag LOCUS_39130 1028442 1027246 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742198.1 protein_id gnl|my_center|LOCUS_39130 1028603 1029271 gene locus_tag LOCUS_39140 1028603 1029271 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284338.1 protein_id gnl|my_center|LOCUS_39140 1029268 1030524 gene locus_tag LOCUS_39150 1029268 1030524 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224496.1 protein_id gnl|my_center|LOCUS_39150 1030933 1033473 gene locus_tag LOCUS_39160 1030933 1033473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 1033719 1034102 gene locus_tag LOCUS_39170 1033719 1034102 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223630.1 protein_id gnl|my_center|LOCUS_39170 1035015 1034284 gene locus_tag LOCUS_39180 1035015 1034284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 1037240 1035171 gene locus_tag LOCUS_39190 1037240 1035171 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224500.1 protein_id gnl|my_center|LOCUS_39190 1038457 1037237 gene locus_tag LOCUS_39200 1038457 1037237 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224501.1 protein_id gnl|my_center|LOCUS_39200 1039991 1038669 gene locus_tag LOCUS_39210 1039991 1038669 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_39210 1040193 1041434 gene locus_tag LOCUS_39220 1040193 1041434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 1041514 1042455 gene locus_tag LOCUS_39230 1041514 1042455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 1043141 1042569 gene locus_tag LOCUS_39240 1043141 1042569 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284339.1 protein_id gnl|my_center|LOCUS_39240 1043276 1044367 gene locus_tag LOCUS_39250 gene hemE 1043276 1044367 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224512.1 protein_id gnl|my_center|LOCUS_39250 1044372 1045787 gene locus_tag LOCUS_39260 gene hemG 1044372 1045787 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_39260 1045784 1046485 gene locus_tag LOCUS_39270 1045784 1046485 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 protein_id gnl|my_center|LOCUS_39270 >Feature sequence24 76 1371 gene locus_tag LOCUS_39280 76 1371 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169733975.1 protein_id gnl|my_center|LOCUS_39280 >Feature sequence25 >Feature sequence26 <1 999 gene locus_tag LOCUS_39290 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256205.1:right-handed parallel beta-helix repeat-containing protein >Feature sequence27 810 160 gene locus_tag LOCUS_39300 810 160 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256576.1 protein_id gnl|my_center|LOCUS_39300 >Feature sequence28 <888 142 gene locus_tag LOCUS_39310 <888 142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227700.1:helix-turn-helix transcriptional regulator >Feature sequence29 >Feature sequence30 628 317 gene locus_tag LOCUS_39320 628 317 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003889857.1 protein_id gnl|my_center|LOCUS_39320 >Feature sequence31 >Feature sequence32 91 954 gene locus_tag LOCUS_39330 91 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39330 1392 2432 gene locus_tag LOCUS_39340 1392 2432 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167468068.1 protein_id gnl|my_center|LOCUS_39340 3875 2442 gene locus_tag LOCUS_39350 3875 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 4307 3960 gene locus_tag LOCUS_39360 4307 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 5602 4316 gene locus_tag LOCUS_39370 5602 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 6206 6829 gene locus_tag LOCUS_39380 gene folE 6206 6829 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072479192.1 protein_id gnl|my_center|LOCUS_39380 6826 7272 gene locus_tag LOCUS_39390 gene queD 6826 7272 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528526.1 protein_id gnl|my_center|LOCUS_39390 7269 8066 gene locus_tag LOCUS_39400 7269 8066 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904152.1 protein_id gnl|my_center|LOCUS_39400 8056 8550 gene locus_tag LOCUS_39410 8056 8550 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250688.1 protein_id gnl|my_center|LOCUS_39410 8547 9581 gene locus_tag LOCUS_39420 8547 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 9578 10681 gene locus_tag LOCUS_39430 9578 10681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 10805 11494 gene locus_tag LOCUS_39440 10805 11494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 11559 12386 gene locus_tag LOCUS_39450 11559 12386 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972721.1 protein_id gnl|my_center|LOCUS_39450 12404 13237 gene locus_tag LOCUS_39460 12404 13237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 13244 13936 gene locus_tag LOCUS_39470 13244 13936 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532941.1 protein_id gnl|my_center|LOCUS_39470 13936 14703 gene locus_tag LOCUS_39480 13936 14703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 14700 15503 gene locus_tag LOCUS_39490 14700 15503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 15500 16606 gene locus_tag LOCUS_39500 15500 16606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 16603 17481 gene locus_tag LOCUS_39510 16603 17481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 17481 18038 gene locus_tag LOCUS_39520 17481 18038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 18035 18844 gene locus_tag LOCUS_39530 18035 18844 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230072.1 protein_id gnl|my_center|LOCUS_39530 18859 19527 gene locus_tag LOCUS_39540 18859 19527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 19622 20569 gene locus_tag LOCUS_39550 19622 20569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 20680 21759 gene locus_tag LOCUS_39560 20680 21759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 21794 22597 gene locus_tag LOCUS_39570 21794 22597 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227838.1 protein_id gnl|my_center|LOCUS_39570 23838 22939 gene locus_tag LOCUS_39580 23838 22939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 24170 23934 gene locus_tag LOCUS_39590 24170 23934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 24756 24508 gene locus_tag LOCUS_39600 24756 24508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 25703 24813 gene locus_tag LOCUS_39610 gene rbsK 25703 24813 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526901.1 protein_id gnl|my_center|LOCUS_39610 26812 25700 gene locus_tag LOCUS_39620 26812 25700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 27069 27287 gene locus_tag LOCUS_39630 27069 27287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 27581 27508 gene locus_tag LOCUS_t00460 27581 27508 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 27707 27616 gene locus_tag LOCUS_t00470 27707 27616 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 28547 28179 gene locus_tag LOCUS_39640 28547 28179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 28585 29244 gene locus_tag LOCUS_39650 28585 29244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 30090 29320 gene locus_tag LOCUS_39660 30090 29320 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027753.1 protein_id gnl|my_center|LOCUS_39660 30234 31352 gene locus_tag LOCUS_39670 30234 31352 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742063.1 protein_id gnl|my_center|LOCUS_39670 33045 31516 gene locus_tag LOCUS_39680 33045 31516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 33437 33054 gene locus_tag LOCUS_39690 33437 33054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 33358 34146 gene locus_tag LOCUS_39700 33358 34146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 36021 34171 gene locus_tag LOCUS_39710 36021 34171 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630171.1 protein_id gnl|my_center|LOCUS_39710 36233 36943 gene locus_tag LOCUS_39720 36233 36943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 37591 37058 gene locus_tag LOCUS_39730 37591 37058 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230876.1 protein_id gnl|my_center|LOCUS_39730 39232 39948 gene locus_tag LOCUS_39740 39232 39948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 40072 40701 gene locus_tag LOCUS_39750 40072 40701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 40925 41161 gene locus_tag LOCUS_39760 40925 41161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 42058 41363 gene locus_tag LOCUS_39770 42058 41363 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974780.1 protein_id gnl|my_center|LOCUS_39770 42966 42055 gene locus_tag LOCUS_39780 42966 42055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 43329 43580 gene locus_tag LOCUS_39790 43329 43580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 43580 43951 gene locus_tag LOCUS_39800 43580 43951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029773.1 protein_id gnl|my_center|LOCUS_39800 43948 44844 gene locus_tag LOCUS_39810 43948 44844 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230499.1 protein_id gnl|my_center|LOCUS_39810 44942 47146 gene locus_tag LOCUS_39820 44942 47146 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230500.1 protein_id gnl|my_center|LOCUS_39820 47288 47536 gene locus_tag LOCUS_39830 47288 47536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 47536 47835 gene locus_tag LOCUS_39840 47536 47835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 47847 48089 gene locus_tag LOCUS_39850 47847 48089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 48103 49011 gene locus_tag LOCUS_39860 48103 49011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 49095 50606 gene locus_tag LOCUS_39870 49095 50606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 51138 51344 gene locus_tag LOCUS_39880 51138 51344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 51341 52750 gene locus_tag LOCUS_39890 51341 52750 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227938.1 protein_id gnl|my_center|LOCUS_39890 52960 52872 gene locus_tag LOCUS_t00480 52960 52872 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 53450 54427 gene locus_tag LOCUS_39900 53450 54427 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_39900 54899 54435 gene locus_tag LOCUS_39910 gene soxR 54899 54435 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529976.1 protein_id gnl|my_center|LOCUS_39910 54931 55659 gene locus_tag LOCUS_39920 54931 55659 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030391327.1 protein_id gnl|my_center|LOCUS_39920 55668 56555 gene locus_tag LOCUS_39930 55668 56555 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224138.1 protein_id gnl|my_center|LOCUS_39930 57269 56562 gene locus_tag LOCUS_39940 57269 56562 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_39940 57394 59571 gene locus_tag LOCUS_39950 57394 59571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 60189 59680 gene locus_tag LOCUS_39960 60189 59680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 61930 60329 gene locus_tag LOCUS_39970 61930 60329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 63021 62053 gene locus_tag LOCUS_39980 63021 62053 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337441.1 protein_id gnl|my_center|LOCUS_39980 64096 63104 gene locus_tag LOCUS_39990 64096 63104 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027205.1 protein_id gnl|my_center|LOCUS_39990 65411 64239 gene locus_tag LOCUS_40000 65411 64239 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225706.1 protein_id gnl|my_center|LOCUS_40000 65528 65977 gene locus_tag LOCUS_40010 65528 65977 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091389441.1 protein_id gnl|my_center|LOCUS_40010 66920 66009 gene locus_tag LOCUS_40020 66920 66009 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495744.1 protein_id gnl|my_center|LOCUS_40020 67515 66985 gene locus_tag LOCUS_40030 67515 66985 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878080.1 protein_id gnl|my_center|LOCUS_40030 67633 68439 gene locus_tag LOCUS_40040 67633 68439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 69793 68651 gene locus_tag LOCUS_40050 gene corA 69793 68651 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059676.1 protein_id gnl|my_center|LOCUS_40050 71287 70193 gene locus_tag LOCUS_40060 71287 70193 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869068.1 protein_id gnl|my_center|LOCUS_40060 71525 72349 gene locus_tag LOCUS_40070 71525 72349 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_40070 72430 73563 gene locus_tag LOCUS_40080 72430 73563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 74490 73567 gene locus_tag LOCUS_40090 74490 73567 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390838.1 protein_id gnl|my_center|LOCUS_40090 75443 74487 gene locus_tag LOCUS_40100 75443 74487 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061504.1 protein_id gnl|my_center|LOCUS_40100 76036 75440 gene locus_tag LOCUS_40110 76036 75440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 76473 76033 gene locus_tag LOCUS_40120 76473 76033 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_40120 76723 77703 gene locus_tag LOCUS_40130 76723 77703 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122762.1 protein_id gnl|my_center|LOCUS_40130 78698 77769 gene locus_tag LOCUS_40140 78698 77769 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920700.1 protein_id gnl|my_center|LOCUS_40140 78848 80707 gene locus_tag LOCUS_40150 78848 80707 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889293.1 protein_id gnl|my_center|LOCUS_40150 80704 81696 gene locus_tag LOCUS_40160 80704 81696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 81889 81683 gene locus_tag LOCUS_40170 81889 81683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 81807 83180 gene locus_tag LOCUS_40180 81807 83180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 83180 84409 gene locus_tag LOCUS_40190 83180 84409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 84406 85266 gene locus_tag LOCUS_40200 84406 85266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 85254 86789 gene locus_tag LOCUS_40210 85254 86789 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148882924.1 protein_id gnl|my_center|LOCUS_40210 86869 87918 gene locus_tag LOCUS_40220 86869 87918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 88151 90229 gene locus_tag LOCUS_40230 88151 90229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 90345 90794 gene locus_tag LOCUS_40240 90345 90794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 90791 91561 gene locus_tag LOCUS_40250 90791 91561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 91643 92374 gene locus_tag LOCUS_40260 91643 92374 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_40260 92362 93426 gene locus_tag LOCUS_40270 92362 93426 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972242.1 protein_id gnl|my_center|LOCUS_40270 93419 94126 gene locus_tag LOCUS_40280 93419 94126 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803937.1 protein_id gnl|my_center|LOCUS_40280 95473 94136 gene locus_tag LOCUS_40290 95473 94136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 97721 95463 gene locus_tag LOCUS_40300 97721 95463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 98175 97750 gene locus_tag LOCUS_40310 98175 97750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 98375 99598 gene locus_tag LOCUS_40320 98375 99598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40320 100258 100076 gene locus_tag LOCUS_40330 100258 100076 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224345.1 protein_id gnl|my_center|LOCUS_40330 101151 100273 gene locus_tag LOCUS_40340 101151 100273 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_40340 101296 101517 gene locus_tag LOCUS_40350 101296 101517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 101505 101684 gene locus_tag LOCUS_40360 101505 101684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 101671 102873 gene locus_tag LOCUS_40370 101671 102873 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227700.1 protein_id gnl|my_center|LOCUS_40370 102876 103091 gene locus_tag LOCUS_40380 102876 103091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 103615 103157 gene locus_tag LOCUS_40390 103615 103157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 104343 103858 gene locus_tag LOCUS_40400 104343 103858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 105653 104394 gene locus_tag LOCUS_40410 105653 104394 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222487.1 protein_id gnl|my_center|LOCUS_40410 105687 106547 gene locus_tag LOCUS_40420 105687 106547 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730610.1 protein_id gnl|my_center|LOCUS_40420 106800 108383 gene locus_tag LOCUS_40430 106800 108383 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978484.1 protein_id gnl|my_center|LOCUS_40430 108424 109647 gene locus_tag LOCUS_40440 108424 109647 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_40440 109644 110432 gene locus_tag LOCUS_40450 109644 110432 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977611.1 protein_id gnl|my_center|LOCUS_40450 110498 111259 gene locus_tag LOCUS_40460 110498 111259 CDS product DUF5701 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029661.1 protein_id gnl|my_center|LOCUS_40460 111432 112094 gene locus_tag LOCUS_40470 111432 112094 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973686.1 protein_id gnl|my_center|LOCUS_40470 112091 113140 gene locus_tag LOCUS_40480 112091 113140 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228416.1 protein_id gnl|my_center|LOCUS_40480 113239 115191 gene locus_tag LOCUS_40490 113239 115191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 115401 115778 gene locus_tag LOCUS_40500 115401 115778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 115780 117438 gene locus_tag LOCUS_40510 115780 117438 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027655.1 protein_id gnl|my_center|LOCUS_40510 117556 118320 gene locus_tag LOCUS_40520 117556 118320 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776310.1 protein_id gnl|my_center|LOCUS_40520 118305 120020 gene locus_tag LOCUS_40530 118305 120020 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029630.1 protein_id gnl|my_center|LOCUS_40530 120325 120071 gene locus_tag LOCUS_40540 120325 120071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 120406 120900 gene locus_tag LOCUS_40550 120406 120900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 121008 121538 gene locus_tag LOCUS_40560 121008 121538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 121762 122166 gene locus_tag LOCUS_40570 121762 122166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 122144 123817 gene locus_tag LOCUS_40580 122144 123817 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977000.1 protein_id gnl|my_center|LOCUS_40580 123919 124896 gene locus_tag LOCUS_40590 123919 124896 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030715.1 protein_id gnl|my_center|LOCUS_40590 125040 126215 gene locus_tag LOCUS_40600 125040 126215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 126436 127626 gene locus_tag LOCUS_40610 126436 127626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 127894 128814 gene locus_tag LOCUS_40620 127894 128814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40620 128884 129228 gene locus_tag LOCUS_40630 128884 129228 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975095.1 protein_id gnl|my_center|LOCUS_40630 129240 130028 gene locus_tag LOCUS_40640 129240 130028 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974967.1 protein_id gnl|my_center|LOCUS_40640 130025 131581 gene locus_tag LOCUS_40650 130025 131581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 131623 132075 gene locus_tag LOCUS_40660 131623 132075 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030759.1 protein_id gnl|my_center|LOCUS_40660 132200 133084 gene locus_tag LOCUS_40670 132200 133084 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 protein_id gnl|my_center|LOCUS_40670 134378 133140 gene locus_tag LOCUS_40680 134378 133140 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466510.1 protein_id gnl|my_center|LOCUS_40680 134543 135283 gene locus_tag LOCUS_40690 134543 135283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 135456 135914 gene locus_tag LOCUS_40700 135456 135914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 136008 136397 gene locus_tag LOCUS_40710 136008 136397 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888350.1 protein_id gnl|my_center|LOCUS_40710 136549 137061 gene locus_tag LOCUS_40720 136549 137061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 137072 138028 gene locus_tag LOCUS_40730 gene pheA 137072 138028 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_40730 138792 138070 gene locus_tag LOCUS_40740 138792 138070 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971849.1 protein_id gnl|my_center|LOCUS_40740 139273 138920 gene locus_tag LOCUS_40750 139273 138920 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222136.1 protein_id gnl|my_center|LOCUS_40750 139826 139395 gene locus_tag LOCUS_40760 139826 139395 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532393.1 protein_id gnl|my_center|LOCUS_40760 139954 140718 gene locus_tag LOCUS_40770 139954 140718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 141018 141839 gene locus_tag LOCUS_40780 141018 141839 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029342.1 protein_id gnl|my_center|LOCUS_40780 141839 142651 gene locus_tag LOCUS_40790 141839 142651 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897816.1 protein_id gnl|my_center|LOCUS_40790 143323 142688 gene locus_tag LOCUS_40800 143323 142688 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731234.1 protein_id gnl|my_center|LOCUS_40800 143374 144171 gene locus_tag LOCUS_40810 143374 144171 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975294.1 protein_id gnl|my_center|LOCUS_40810 144251 145453 gene locus_tag LOCUS_40820 144251 145453 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399632.1 protein_id gnl|my_center|LOCUS_40820 146413 145628 gene locus_tag LOCUS_40830 146413 145628 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222475.1 protein_id gnl|my_center|LOCUS_40830 146522 146977 gene locus_tag LOCUS_40840 146522 146977 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033261465.1 protein_id gnl|my_center|LOCUS_40840 147054 148955 gene locus_tag LOCUS_40850 147054 148955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 150154 149051 gene locus_tag LOCUS_40860 150154 149051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 150548 150294 gene locus_tag LOCUS_40870 150548 150294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 151144 150545 gene locus_tag LOCUS_40880 151144 150545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40880 151364 154291 gene locus_tag LOCUS_40890 151364 154291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 154928 154278 gene locus_tag LOCUS_40900 154928 154278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 157045 154925 gene locus_tag LOCUS_40910 157045 154925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 158378 157188 gene locus_tag LOCUS_40920 158378 157188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 158668 159291 gene locus_tag LOCUS_40930 158668 159291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 159469 160377 gene locus_tag LOCUS_40940 gene fdhD 159469 160377 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876561.1 protein_id gnl|my_center|LOCUS_40940 161306 160359 gene locus_tag LOCUS_40950 161306 160359 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731014.1 protein_id gnl|my_center|LOCUS_40950 161385 162419 gene locus_tag LOCUS_40960 161385 162419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 164020 162983 gene locus_tag LOCUS_40970 164020 162983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 164231 165148 gene locus_tag LOCUS_40980 164231 165148 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226372.1 protein_id gnl|my_center|LOCUS_40980 165145 166158 gene locus_tag LOCUS_40990 gene moaA 165145 166158 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106977887.1 protein_id gnl|my_center|LOCUS_40990 166162 166437 gene locus_tag LOCUS_41000 166162 166437 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083281.1 protein_id gnl|my_center|LOCUS_41000 166448 167692 gene locus_tag LOCUS_41010 166448 167692 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029904.1 protein_id gnl|my_center|LOCUS_41010 167810 171001 gene locus_tag LOCUS_41020 167810 171001 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189169828.1 protein_id gnl|my_center|LOCUS_41020 171691 171062 gene locus_tag LOCUS_41030 171691 171062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 172649 171702 gene locus_tag LOCUS_41040 gene yedA 172649 171702 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268946.1 protein_id gnl|my_center|LOCUS_41040 172819 173736 gene locus_tag LOCUS_41050 172819 173736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 173904 175148 gene locus_tag LOCUS_41060 173904 175148 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_41060 175806 175189 gene locus_tag LOCUS_41070 175806 175189 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175351.1 protein_id gnl|my_center|LOCUS_41070 175891 176433 gene locus_tag LOCUS_41080 175891 176433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 176649 178103 gene locus_tag LOCUS_41090 176649 178103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 178599 178168 gene locus_tag LOCUS_41100 178599 178168 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730722.1 protein_id gnl|my_center|LOCUS_41100 179855 178599 gene locus_tag LOCUS_41110 179855 178599 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029253.1 protein_id gnl|my_center|LOCUS_41110 180410 179940 gene locus_tag LOCUS_41120 180410 179940 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_41120 180898 180407 gene locus_tag LOCUS_41130 gene moaC 180898 180407 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230248.1 protein_id gnl|my_center|LOCUS_41130 181656 184121 gene locus_tag LOCUS_41140 181656 184121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 184118 185497 gene locus_tag LOCUS_41150 184118 185497 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030387.1 protein_id gnl|my_center|LOCUS_41150 185494 186129 gene locus_tag LOCUS_41160 185494 186129 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729648.1 protein_id gnl|my_center|LOCUS_41160 186152 186547 gene locus_tag LOCUS_41170 186152 186547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 189379 186629 gene locus_tag LOCUS_41180 189379 186629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 189531 189881 gene locus_tag LOCUS_41190 189531 189881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 190687 190241 gene locus_tag LOCUS_41200 gene rplI 190687 190241 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_41200 190941 190702 gene locus_tag LOCUS_41210 gene rpsR 190941 190702 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028969.1 protein_id gnl|my_center|LOCUS_41210 191510 190983 gene locus_tag LOCUS_41220 191510 190983 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231003.1 protein_id gnl|my_center|LOCUS_41220 191907 191617 gene locus_tag LOCUS_41230 gene rpsF 191907 191617 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975025.1 protein_id gnl|my_center|LOCUS_41230 192550 193341 gene locus_tag LOCUS_41240 192550 193341 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467888.1 protein_id gnl|my_center|LOCUS_41240 193338 195569 gene locus_tag LOCUS_41250 193338 195569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222074.1 protein_id gnl|my_center|LOCUS_41250 197107 195593 gene locus_tag LOCUS_41260 197107 195593 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_41260 200144 197241 gene locus_tag LOCUS_41270 200144 197241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 200799 200326 gene locus_tag LOCUS_41280 200799 200326 CDS product DUF5318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230992.1 protein_id gnl|my_center|LOCUS_41280 200974 201612 gene locus_tag LOCUS_41290 200974 201612 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230991.1 protein_id gnl|my_center|LOCUS_41290 201636 202715 gene locus_tag LOCUS_41300 201636 202715 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230990.1 protein_id gnl|my_center|LOCUS_41300 203163 202777 gene locus_tag LOCUS_41310 203163 202777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 203579 203160 gene locus_tag LOCUS_41320 203579 203160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 204095 203823 gene locus_tag LOCUS_41330 204095 203823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 204554 205408 gene locus_tag LOCUS_41340 204554 205408 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_41340 205413 205640 gene locus_tag LOCUS_41350 205413 205640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 206160 205681 gene locus_tag LOCUS_41360 206160 205681 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030939.1 protein_id gnl|my_center|LOCUS_41360 206314 206835 gene locus_tag LOCUS_41370 206314 206835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 206890 208386 gene locus_tag LOCUS_41380 206890 208386 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029117.1 protein_id gnl|my_center|LOCUS_41380 209908 208445 gene locus_tag LOCUS_41390 209908 208445 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_41390 210035 211780 gene locus_tag LOCUS_41400 gene murJ 210035 211780 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224759.1 protein_id gnl|my_center|LOCUS_41400 212281 213831 gene locus_tag LOCUS_41410 212281 213831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 213875 214756 gene locus_tag LOCUS_41420 213875 214756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 214753 215757 gene locus_tag LOCUS_41430 214753 215757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 215979 216932 gene locus_tag LOCUS_41440 gene trxB 215979 216932 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731638.1 protein_id gnl|my_center|LOCUS_41440 217004 217327 gene locus_tag LOCUS_41450 gene trxA 217004 217327 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_41450 217548 218717 gene locus_tag LOCUS_41460 217548 218717 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231059.1 protein_id gnl|my_center|LOCUS_41460 219451 218807 gene locus_tag LOCUS_41470 219451 218807 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975043.1 protein_id gnl|my_center|LOCUS_41470 219772 221085 gene locus_tag LOCUS_41480 219772 221085 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_41480 221093 222085 gene locus_tag LOCUS_41490 221093 222085 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_41490 223089 222208 gene locus_tag LOCUS_41500 223089 222208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 226272 225196 gene locus_tag LOCUS_41510 226272 225196 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231063.1 protein_id gnl|my_center|LOCUS_41510 227655 226300 gene locus_tag LOCUS_41520 227655 226300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 228841 227921 gene locus_tag LOCUS_41530 228841 227921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 229430 228846 gene locus_tag LOCUS_41540 229430 228846 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467902.1 protein_id gnl|my_center|LOCUS_41540 230646 229651 gene locus_tag LOCUS_41550 230646 229651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 231269 230934 gene locus_tag LOCUS_41560 231269 230934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 231524 231387 gene locus_tag LOCUS_41570 gene rpmH 231524 231387 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975051.1 protein_id gnl|my_center|LOCUS_41570 232111 233976 gene locus_tag LOCUS_41580 gene dnaA 232111 233976 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029287.1 protein_id gnl|my_center|LOCUS_41580 234835 235968 gene locus_tag LOCUS_41590 gene dnaN 234835 235968 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_41590 236010 236882 gene locus_tag LOCUS_41600 gene gnd 236010 236882 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891330.1 protein_id gnl|my_center|LOCUS_41600 236899 238032 gene locus_tag LOCUS_41610 gene recF 236899 238032 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_41610 238022 238798 gene locus_tag LOCUS_41620 238022 238798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 239029 238802 gene locus_tag LOCUS_41630 239029 238802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 239132 239614 gene locus_tag LOCUS_41640 239132 239614 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225292.1 protein_id gnl|my_center|LOCUS_41640 240153 239599 gene locus_tag LOCUS_41650 240153 239599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 240684 242630 gene locus_tag LOCUS_41660 gene gyrB 240684 242630 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116174448.1 protein_id gnl|my_center|LOCUS_41660 242760 245282 gene locus_tag LOCUS_41670 gene gyrA 242760 245282 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221961.1 protein_id gnl|my_center|LOCUS_41670 245286 246215 gene locus_tag LOCUS_41680 245286 246215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 246369 246444 gene locus_tag LOCUS_t00490 246369 246444 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 246486 246614 gene locus_tag LOCUS_41690 246486 246614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 246658 246733 gene locus_tag LOCUS_t00500 246658 246733 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 247223 246891 gene locus_tag LOCUS_41700 247223 246891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 248356 248114 gene locus_tag LOCUS_41710 248356 248114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 248511 248353 gene locus_tag LOCUS_41720 248511 248353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 248550 249539 gene locus_tag LOCUS_41730 248550 249539 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338457.1 protein_id gnl|my_center|LOCUS_41730 254142 249643 gene locus_tag LOCUS_41740 254142 249643 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909023.1 protein_id gnl|my_center|LOCUS_41740 254448 255872 gene locus_tag LOCUS_41750 254448 255872 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054423.1 protein_id gnl|my_center|LOCUS_41750 256049 256243 gene locus_tag LOCUS_41760 256049 256243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 256366 256914 gene locus_tag LOCUS_41770 256366 256914 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_41770 257602 256967 gene locus_tag LOCUS_41780 257602 256967 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275410.1 protein_id gnl|my_center|LOCUS_41780 258125 257703 gene locus_tag LOCUS_41790 258125 257703 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727923.1 protein_id gnl|my_center|LOCUS_41790 258628 258203 gene locus_tag LOCUS_41800 258628 258203 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027424.1 protein_id gnl|my_center|LOCUS_41800 260484 258688 gene locus_tag LOCUS_41810 260484 258688 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223963.1 protein_id gnl|my_center|LOCUS_41810 260665 261447 gene locus_tag LOCUS_41820 260665 261447 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977577.1 protein_id gnl|my_center|LOCUS_41820 261447 261893 gene locus_tag LOCUS_41830 261447 261893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029727.1 protein_id gnl|my_center|LOCUS_41830 261946 262848 gene locus_tag LOCUS_41840 261946 262848 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077428.1 protein_id gnl|my_center|LOCUS_41840 262940 264727 gene locus_tag LOCUS_41850 262940 264727 CDS product HSP90 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027769.1 protein_id gnl|my_center|LOCUS_41850 264735 267584 gene locus_tag LOCUS_41860 264735 267584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 267656 268279 gene locus_tag LOCUS_41870 267656 268279 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283977.1 protein_id gnl|my_center|LOCUS_41870 268552 269889 gene locus_tag LOCUS_41880 268552 269889 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179728959.1 protein_id gnl|my_center|LOCUS_41880 270882 269941 gene locus_tag LOCUS_41890 270882 269941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 271282 271464 gene locus_tag LOCUS_41900 271282 271464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 271764 272684 gene locus_tag LOCUS_41910 271764 272684 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256277.1 protein_id gnl|my_center|LOCUS_41910 272945 274477 gene locus_tag LOCUS_41920 272945 274477 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886744.1 protein_id gnl|my_center|LOCUS_41920 274568 275722 gene locus_tag LOCUS_41930 274568 275722 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976021.1 protein_id gnl|my_center|LOCUS_41930 275930 278605 gene locus_tag LOCUS_41940 275930 278605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 279369 278845 gene locus_tag LOCUS_41950 279369 278845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 279471 280052 gene locus_tag LOCUS_41960 279471 280052 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 protein_id gnl|my_center|LOCUS_41960 280375 281898 gene locus_tag LOCUS_41970 280375 281898 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031712.1 protein_id gnl|my_center|LOCUS_41970 283441 281906 gene locus_tag LOCUS_41980 283441 281906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 283538 284251 gene locus_tag LOCUS_41990 283538 284251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 284383 285117 gene locus_tag LOCUS_42000 284383 285117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 285615 285172 gene locus_tag LOCUS_42010 285615 285172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 286007 285723 gene locus_tag LOCUS_42020 286007 285723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 286629 287510 gene locus_tag LOCUS_42030 286629 287510 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_42030 287474 287701 gene locus_tag LOCUS_42040 287474 287701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 287933 288340 gene locus_tag LOCUS_42050 287933 288340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 288910 288308 gene locus_tag LOCUS_42060 288910 288308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 290379 289573 gene locus_tag LOCUS_42070 290379 289573 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340251.1 protein_id gnl|my_center|LOCUS_42070 291449 290376 gene locus_tag LOCUS_42080 291449 290376 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_42080 291661 291576 gene locus_tag LOCUS_t00510 291661 291576 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 291895 292671 gene locus_tag LOCUS_42090 gene fhaA 291895 292671 CDS product antibiotic biosynthesis regulator FhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975091.1 protein_id gnl|my_center|LOCUS_42090 292678 293166 gene locus_tag LOCUS_42100 292678 293166 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003079002.1 protein_id gnl|my_center|LOCUS_42100 293163 294587 gene locus_tag LOCUS_42110 293163 294587 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222007.1 protein_id gnl|my_center|LOCUS_42110 294681 296108 gene locus_tag LOCUS_42120 294681 296108 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726618.1 protein_id gnl|my_center|LOCUS_42120 296105 297610 gene locus_tag LOCUS_42130 296105 297610 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776672.1 protein_id gnl|my_center|LOCUS_42130 297612 299069 gene locus_tag LOCUS_42140 297612 299069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 299066 300877 gene locus_tag LOCUS_42150 gene pknB 299066 300877 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222003.1 protein_id gnl|my_center|LOCUS_42150 301636 300986 gene locus_tag LOCUS_42160 301636 300986 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030445363.1 protein_id gnl|my_center|LOCUS_42160 301922 301641 gene locus_tag LOCUS_42170 301922 301641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 303340 301922 gene locus_tag LOCUS_42180 303340 301922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 304143 303337 gene locus_tag LOCUS_42190 304143 303337 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891353.1 protein_id gnl|my_center|LOCUS_42190 304373 304636 gene locus_tag LOCUS_42200 304373 304636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 304946 307141 gene locus_tag LOCUS_42210 304946 307141 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230881.1 protein_id gnl|my_center|LOCUS_42210 307270 308583 gene locus_tag LOCUS_42220 307270 308583 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079373.1 protein_id gnl|my_center|LOCUS_42220 308576 309577 gene locus_tag LOCUS_42230 308576 309577 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977390.1 protein_id gnl|my_center|LOCUS_42230 309869 310774 gene locus_tag LOCUS_42240 309869 310774 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_42240 312840 310849 gene locus_tag LOCUS_42250 312840 310849 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031541.1 protein_id gnl|my_center|LOCUS_42250 313203 314243 gene locus_tag LOCUS_42260 313203 314243 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031385.1 protein_id gnl|my_center|LOCUS_42260 314873 314295 gene locus_tag LOCUS_42270 gene dcd 314873 314295 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898399.1 protein_id gnl|my_center|LOCUS_42270 315259 315352 gene locus_tag LOCUS_t00520 315259 315352 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 315763 315836 gene locus_tag LOCUS_t00530 315763 315836 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 317203 315926 gene locus_tag LOCUS_42280 317203 315926 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_42280 318431 317286 gene locus_tag LOCUS_42290 318431 317286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 318843 320651 gene locus_tag LOCUS_42300 318843 320651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 321917 321408 gene locus_tag LOCUS_42310 321917 321408 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252426.1 protein_id gnl|my_center|LOCUS_42310 322843 321914 gene locus_tag LOCUS_42320 322843 321914 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226532.1 protein_id gnl|my_center|LOCUS_42320 322865 323815 gene locus_tag LOCUS_42330 322865 323815 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485415.1 protein_id gnl|my_center|LOCUS_42330 323957 324340 gene locus_tag LOCUS_42340 323957 324340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 324486 324307 gene locus_tag LOCUS_42350 324486 324307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 324626 326032 gene locus_tag LOCUS_42360 324626 326032 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212987816.1 protein_id gnl|my_center|LOCUS_42360 326047 327279 gene locus_tag LOCUS_42370 326047 327279 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029800.1 protein_id gnl|my_center|LOCUS_42370 327264 327914 gene locus_tag LOCUS_42380 327264 327914 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029801.1 protein_id gnl|my_center|LOCUS_42380 328043 328369 gene locus_tag LOCUS_42390 328043 328369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 329541 328366 gene locus_tag LOCUS_42400 329541 328366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 330037 330768 gene locus_tag LOCUS_42410 330037 330768 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_42410 330771 330965 gene locus_tag LOCUS_42420 330771 330965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 331118 331492 gene locus_tag LOCUS_42430 331118 331492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975153.1 protein_id gnl|my_center|LOCUS_42430 332086 331850 gene locus_tag LOCUS_42440 332086 331850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 333060 332401 gene locus_tag LOCUS_42450 333060 332401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 333527 333057 gene locus_tag LOCUS_42460 333527 333057 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486148.1 protein_id gnl|my_center|LOCUS_42460 333969 333538 gene locus_tag LOCUS_42470 333969 333538 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866702.1 protein_id gnl|my_center|LOCUS_42470 334319 333966 gene locus_tag LOCUS_42480 334319 333966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 334477 335370 gene locus_tag LOCUS_42490 334477 335370 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123743405.1 protein_id gnl|my_center|LOCUS_42490 335423 336313 gene locus_tag LOCUS_42500 335423 336313 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222172.1 protein_id gnl|my_center|LOCUS_42500 336774 336361 gene locus_tag LOCUS_42510 336774 336361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42510 337512 336955 gene locus_tag LOCUS_42520 337512 336955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 338026 337658 gene locus_tag LOCUS_42530 338026 337658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 337911 338375 gene locus_tag LOCUS_42540 337911 338375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 338497 339624 gene locus_tag LOCUS_42550 338497 339624 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030823.1 protein_id gnl|my_center|LOCUS_42550 339926 341782 gene locus_tag LOCUS_42560 339926 341782 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908958.1 protein_id gnl|my_center|LOCUS_42560 342008 342277 gene locus_tag LOCUS_42570 342008 342277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 342949 342419 gene locus_tag LOCUS_42580 342949 342419 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222279.1 protein_id gnl|my_center|LOCUS_42580 343122 343352 gene locus_tag LOCUS_42590 343122 343352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 344163 343486 gene locus_tag LOCUS_42600 344163 343486 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314885.1 protein_id gnl|my_center|LOCUS_42600 344270 344920 gene locus_tag LOCUS_42610 344270 344920 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027119.1 protein_id gnl|my_center|LOCUS_42610 344917 345840 gene locus_tag LOCUS_42620 344917 345840 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027120.1 protein_id gnl|my_center|LOCUS_42620 345824 346573 gene locus_tag LOCUS_42630 345824 346573 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230111.1 protein_id gnl|my_center|LOCUS_42630 348465 346600 gene locus_tag LOCUS_42640 348465 346600 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026880.1 protein_id gnl|my_center|LOCUS_42640 351639 348556 gene locus_tag LOCUS_42650 351639 348556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42650 350805 350970 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tccagccgccggagcgggc 352093 351956 gene locus_tag LOCUS_42660 352093 351956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 353795 352314 gene locus_tag LOCUS_42670 353795 352314 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 protein_id gnl|my_center|LOCUS_42670 354790 353801 gene locus_tag LOCUS_42680 354790 353801 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_42680 355974 354790 gene locus_tag LOCUS_42690 gene pdhA 355974 354790 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_42690 355889 356080 gene locus_tag LOCUS_42700 355889 356080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 356473 357165 gene locus_tag LOCUS_42710 356473 357165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 357306 357830 gene locus_tag LOCUS_42720 357306 357830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 359067 357850 gene locus_tag LOCUS_42730 359067 357850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 360812 359121 gene locus_tag LOCUS_42740 360812 359121 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 protein_id gnl|my_center|LOCUS_42740 362656 360809 gene locus_tag LOCUS_42750 362656 360809 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073255020.1 protein_id gnl|my_center|LOCUS_42750 362852 364741 gene locus_tag LOCUS_42760 gene dnaK 362852 364741 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_42760 364789 365520 gene locus_tag LOCUS_42770 364789 365520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 365599 366786 gene locus_tag LOCUS_42780 gene dnaJ 365599 366786 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230872.1 protein_id gnl|my_center|LOCUS_42780 366819 367253 gene locus_tag LOCUS_42790 366819 367253 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467870.1 protein_id gnl|my_center|LOCUS_42790 367420 367659 gene locus_tag LOCUS_42800 367420 367659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 368165 367734 gene locus_tag LOCUS_42810 368165 367734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 369553 368348 gene locus_tag LOCUS_42820 369553 368348 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973241.1 protein_id gnl|my_center|LOCUS_42820 370016 369561 gene locus_tag LOCUS_42830 370016 369561 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467392.1 protein_id gnl|my_center|LOCUS_42830 370124 371185 gene locus_tag LOCUS_42840 370124 371185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 371532 371266 gene locus_tag LOCUS_42850 371532 371266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 371775 371557 gene locus_tag LOCUS_42860 371775 371557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 372079 372450 gene locus_tag LOCUS_42870 372079 372450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 372447 372698 gene locus_tag LOCUS_42880 372447 372698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 373870 372734 gene locus_tag LOCUS_42890 373870 372734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 373961 374617 gene locus_tag LOCUS_42900 373961 374617 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223251.1 protein_id gnl|my_center|LOCUS_42900 374703 377291 gene locus_tag LOCUS_42910 gene clpB 374703 377291 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230863.1 protein_id gnl|my_center|LOCUS_42910 377382 377753 gene locus_tag LOCUS_42920 377382 377753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 377823 378722 gene locus_tag LOCUS_42930 377823 378722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 378818 379438 gene locus_tag LOCUS_42940 378818 379438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 379441 380004 gene locus_tag LOCUS_42950 379441 380004 CDS product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975282.1 protein_id gnl|my_center|LOCUS_42950 380001 380429 gene locus_tag LOCUS_42960 380001 380429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 380464 380886 gene locus_tag LOCUS_42970 380464 380886 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015321.1 protein_id gnl|my_center|LOCUS_42970 380886 381668 gene locus_tag LOCUS_42980 380886 381668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 381665 383257 gene locus_tag LOCUS_42990 381665 383257 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976349.1 protein_id gnl|my_center|LOCUS_42990 383298 384281 gene locus_tag LOCUS_43000 383298 384281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728696.1 protein_id gnl|my_center|LOCUS_43000 384373 385326 gene locus_tag LOCUS_43010 384373 385326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 385453 386076 gene locus_tag LOCUS_43020 385453 386076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 386086 386895 gene locus_tag LOCUS_43030 386086 386895 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_43030 387063 387602 gene locus_tag LOCUS_43040 gene pyrE 387063 387602 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085722.1 protein_id gnl|my_center|LOCUS_43040 387660 388037 gene locus_tag LOCUS_43050 387660 388037 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112711.1 protein_id gnl|my_center|LOCUS_43050 389180 388245 gene locus_tag LOCUS_43060 389180 388245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 391800 389278 gene locus_tag LOCUS_43070 391800 389278 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229822.1 protein_id gnl|my_center|LOCUS_43070 393335 391797 gene locus_tag LOCUS_43080 393335 391797 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042159660.1 protein_id gnl|my_center|LOCUS_43080 393537 394016 gene locus_tag LOCUS_43090 393537 394016 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226925.1 protein_id gnl|my_center|LOCUS_43090 394019 395086 gene locus_tag LOCUS_43100 394019 395086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 395485 395264 gene locus_tag LOCUS_43110 395485 395264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 395775 395563 gene locus_tag LOCUS_43120 395775 395563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 395909 396292 gene locus_tag LOCUS_43130 395909 396292 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_43130 396472 397494 gene locus_tag LOCUS_43140 gene fbaA 396472 397494 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029142.1 protein_id gnl|my_center|LOCUS_43140 398765 397557 gene locus_tag LOCUS_43150 398765 397557 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284839.1 protein_id gnl|my_center|LOCUS_43150 399089 399517 gene locus_tag LOCUS_43160 399089 399517 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230816.1 protein_id gnl|my_center|LOCUS_43160 402138 399574 gene locus_tag LOCUS_43170 402138 399574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 403343 402345 gene locus_tag LOCUS_43180 403343 402345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 403466 404755 gene locus_tag LOCUS_43190 403466 404755 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230806.1 protein_id gnl|my_center|LOCUS_43190 404926 405867 gene locus_tag LOCUS_43200 404926 405867 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088417.1 protein_id gnl|my_center|LOCUS_43200 405914 407293 gene locus_tag LOCUS_43210 gene purD 405914 407293 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_43210 407351 407869 gene locus_tag LOCUS_43220 407351 407869 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223685.1 protein_id gnl|my_center|LOCUS_43220 407862 408710 gene locus_tag LOCUS_43230 407862 408710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 410050 408752 gene locus_tag LOCUS_43240 410050 408752 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973365.1 protein_id gnl|my_center|LOCUS_43240 411732 410170 gene locus_tag LOCUS_43250 411732 410170 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227752.1 protein_id gnl|my_center|LOCUS_43250 411731 412015 gene locus_tag LOCUS_43260 411731 412015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 413151 411937 gene locus_tag LOCUS_43270 413151 411937 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_43270 413605 413153 gene locus_tag LOCUS_43280 413605 413153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 413680 414318 gene locus_tag LOCUS_43290 413680 414318 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230938.1 protein_id gnl|my_center|LOCUS_43290 414558 415616 gene locus_tag LOCUS_43300 414558 415616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 415891 416754 gene locus_tag LOCUS_43310 415891 416754 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227669.1 protein_id gnl|my_center|LOCUS_43310 416808 417590 gene locus_tag LOCUS_43320 416808 417590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 417673 418605 gene locus_tag LOCUS_43330 417673 418605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 419322 418708 gene locus_tag LOCUS_43340 419322 418708 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222383.1 protein_id gnl|my_center|LOCUS_43340 420618 419365 gene locus_tag LOCUS_43350 420618 419365 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388861.1 protein_id gnl|my_center|LOCUS_43350 421580 420615 gene locus_tag LOCUS_43360 421580 420615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 422565 421591 gene locus_tag LOCUS_43370 422565 421591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 423314 422562 gene locus_tag LOCUS_43380 423314 422562 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226433.1 protein_id gnl|my_center|LOCUS_43380 423610 423516 gene locus_tag LOCUS_t00540 423610 423516 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 425630 424272 gene locus_tag LOCUS_43390 425630 424272 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230940.1 protein_id gnl|my_center|LOCUS_43390 425687 426979 gene locus_tag LOCUS_43400 425687 426979 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230941.1 protein_id gnl|my_center|LOCUS_43400 428462 427107 gene locus_tag LOCUS_43410 428462 427107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 428715 430481 gene locus_tag LOCUS_43420 428715 430481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 430912 432336 gene locus_tag LOCUS_43430 gene purB 430912 432336 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_43430 432971 432510 gene locus_tag LOCUS_43440 432971 432510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 433943 433140 gene locus_tag LOCUS_43450 433943 433140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 434192 434455 gene locus_tag LOCUS_43460 gene purS 434192 434455 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974895.1 protein_id gnl|my_center|LOCUS_43460 434452 435135 gene locus_tag LOCUS_43470 gene purQ 434452 435135 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230758.1 protein_id gnl|my_center|LOCUS_43470 435200 438049 gene locus_tag LOCUS_43480 gene purL 435200 438049 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_43480 438054 438809 gene locus_tag LOCUS_43490 438054 438809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 441110 438933 gene locus_tag LOCUS_43500 441110 438933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 441299 441634 gene locus_tag LOCUS_43510 441299 441634 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284386.1 protein_id gnl|my_center|LOCUS_43510 441795 443333 gene locus_tag LOCUS_43520 gene purF 441795 443333 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230743.1 protein_id gnl|my_center|LOCUS_43520 443399 444553 gene locus_tag LOCUS_43530 gene purM 443399 444553 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404132.1 protein_id gnl|my_center|LOCUS_43530 444653 445789 gene locus_tag LOCUS_43540 gene grrM 444653 445789 CDS product GRRM system radical SAM/SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970460.1 protein_id gnl|my_center|LOCUS_43540 445758 445994 gene locus_tag LOCUS_43550 445758 445994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 446381 446142 gene locus_tag LOCUS_43560 446381 446142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 447777 446695 gene locus_tag LOCUS_43570 447777 446695 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228727.1 protein_id gnl|my_center|LOCUS_43570 447995 448834 gene locus_tag LOCUS_43580 447995 448834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974882.1 protein_id gnl|my_center|LOCUS_43580 449119 449328 gene locus_tag LOCUS_43590 gene bldC 449119 449328 CDS product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 protein_id gnl|my_center|LOCUS_43590 449790 449410 gene locus_tag LOCUS_43600 449790 449410 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978131.1 protein_id gnl|my_center|LOCUS_43600 449835 450623 gene locus_tag LOCUS_43610 449835 450623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 450990 450703 gene locus_tag LOCUS_43620 450990 450703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 451154 452008 gene locus_tag LOCUS_43630 451154 452008 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083218.1 protein_id gnl|my_center|LOCUS_43630 452005 452748 gene locus_tag LOCUS_43640 452005 452748 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113991.1 protein_id gnl|my_center|LOCUS_43640 454182 452839 gene locus_tag LOCUS_43650 454182 452839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 454344 454742 gene locus_tag LOCUS_43660 454344 454742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 455234 454788 gene locus_tag LOCUS_43670 455234 454788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 455358 456059 gene locus_tag LOCUS_43680 455358 456059 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230002.1 protein_id gnl|my_center|LOCUS_43680 456679 456170 gene locus_tag LOCUS_43690 456679 456170 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224554.1 protein_id gnl|my_center|LOCUS_43690 457234 456872 gene locus_tag LOCUS_43700 457234 456872 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028376.1 protein_id gnl|my_center|LOCUS_43700 457295 458212 gene locus_tag LOCUS_43710 457295 458212 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028377.1 protein_id gnl|my_center|LOCUS_43710 458867 458793 gene locus_tag LOCUS_t00550 458867 458793 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 459045 458971 gene locus_tag LOCUS_t00560 459045 458971 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 459149 459076 gene locus_tag LOCUS_t00570 459149 459076 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 460104 459304 gene locus_tag LOCUS_43720 460104 459304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 461135 460176 gene locus_tag LOCUS_43730 461135 460176 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978674.1 protein_id gnl|my_center|LOCUS_43730 461745 461125 gene locus_tag LOCUS_43740 461745 461125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 463223 461742 gene locus_tag LOCUS_43750 gene crtI 463223 461742 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026910.1 protein_id gnl|my_center|LOCUS_43750 464406 463252 gene locus_tag LOCUS_43760 464406 463252 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_43760 464472 465383 gene locus_tag LOCUS_43770 464472 465383 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225923.1 protein_id gnl|my_center|LOCUS_43770 465554 465414 gene locus_tag LOCUS_43780 465554 465414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 465646 467109 gene locus_tag LOCUS_43790 465646 467109 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028984.1 protein_id gnl|my_center|LOCUS_43790 467390 467160 gene locus_tag LOCUS_43800 467390 467160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 467383 468027 gene locus_tag LOCUS_43810 gene bluB 467383 468027 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228822.1 protein_id gnl|my_center|LOCUS_43810 468024 468440 gene locus_tag LOCUS_43820 468024 468440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 468741 468412 gene locus_tag LOCUS_43830 468741 468412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 468656 469507 gene locus_tag LOCUS_43840 468656 469507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 470827 469655 gene locus_tag LOCUS_43850 470827 469655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 471332 470844 gene locus_tag LOCUS_43860 471332 470844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 471988 471332 gene locus_tag LOCUS_43870 471988 471332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 472521 471985 gene locus_tag LOCUS_43880 472521 471985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 472733 472518 gene locus_tag LOCUS_43890 472733 472518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 473635 472763 gene locus_tag LOCUS_43900 473635 472763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 474587 473679 gene locus_tag LOCUS_43910 474587 473679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 476164 474584 gene locus_tag LOCUS_43920 476164 474584 CDS product CpaF/VirB11 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749562.1 protein_id gnl|my_center|LOCUS_43920 476954 476154 gene locus_tag LOCUS_43930 476954 476154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749563.1 protein_id gnl|my_center|LOCUS_43930 477613 476957 gene locus_tag LOCUS_43940 477613 476957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 478614 477610 gene locus_tag LOCUS_43950 478614 477610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 479174 478608 gene locus_tag LOCUS_43960 479174 478608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225440030.1 protein_id gnl|my_center|LOCUS_43960 479720 480706 gene locus_tag LOCUS_43970 479720 480706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 481347 480721 gene locus_tag LOCUS_43980 481347 480721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 481841 481386 gene locus_tag LOCUS_43990 481841 481386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 482006 482848 gene locus_tag LOCUS_44000 482006 482848 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_44000 483513 482911 gene locus_tag LOCUS_44010 483513 482911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 485455 483530 gene locus_tag LOCUS_44020 485455 483530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 485849 485589 gene locus_tag LOCUS_44030 485849 485589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 486051 486587 gene locus_tag LOCUS_44040 486051 486587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 487331 486699 gene locus_tag LOCUS_44050 487331 486699 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976533.1 protein_id gnl|my_center|LOCUS_44050 487437 488270 gene locus_tag LOCUS_44060 487437 488270 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224863.1 protein_id gnl|my_center|LOCUS_44060 488935 488342 gene locus_tag LOCUS_44070 488935 488342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 491179 488984 gene locus_tag LOCUS_44080 491179 488984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 492128 491268 gene locus_tag LOCUS_44090 492128 491268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 492455 493345 gene locus_tag LOCUS_44100 492455 493345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 494510 493521 gene locus_tag LOCUS_44110 494510 493521 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263000.1 protein_id gnl|my_center|LOCUS_44110 495364 494507 gene locus_tag LOCUS_44120 495364 494507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 496827 495976 gene locus_tag LOCUS_44130 496827 495976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 497789 496857 gene locus_tag LOCUS_44140 497789 496857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 497937 498278 gene locus_tag LOCUS_44150 497937 498278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 498415 498341 gene locus_tag LOCUS_t00580 498415 498341 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 498627 499139 gene locus_tag LOCUS_44160 498627 499139 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_44160 499136 499807 gene locus_tag LOCUS_44170 499136 499807 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973942.1 protein_id gnl|my_center|LOCUS_44170 499804 502008 gene locus_tag LOCUS_44180 499804 502008 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230975.1 protein_id gnl|my_center|LOCUS_44180 502677 502033 gene locus_tag LOCUS_44190 502677 502033 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223792.1 protein_id gnl|my_center|LOCUS_44190 502734 503027 gene locus_tag LOCUS_44200 502734 503027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 503027 503923 gene locus_tag LOCUS_44210 503027 503923 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966304.1 protein_id gnl|my_center|LOCUS_44210 504005 504394 gene locus_tag LOCUS_44220 504005 504394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 504550 504777 gene locus_tag LOCUS_44230 504550 504777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 505762 504872 gene locus_tag LOCUS_44240 505762 504872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 506116 505922 gene locus_tag LOCUS_44250 506116 505922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 507162 506122 gene locus_tag LOCUS_44260 507162 506122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 507534 508397 gene locus_tag LOCUS_44270 507534 508397 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_44270 508375 508563 gene locus_tag LOCUS_44280 508375 508563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 508656 509675 gene locus_tag LOCUS_44290 508656 509675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 509726 509914 gene locus_tag LOCUS_44300 509726 509914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 509991 511073 gene locus_tag LOCUS_44310 509991 511073 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226131.1 protein_id gnl|my_center|LOCUS_44310 511851 511105 gene locus_tag LOCUS_44320 511851 511105 CDS product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 protein_id gnl|my_center|LOCUS_44320 513085 511892 gene locus_tag LOCUS_44330 513085 511892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 513857 513165 gene locus_tag LOCUS_44340 513857 513165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 514654 513854 gene locus_tag LOCUS_44350 514654 513854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 515043 514705 gene locus_tag LOCUS_44360 515043 514705 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102033.1 protein_id gnl|my_center|LOCUS_44360 516015 515296 gene locus_tag LOCUS_44370 516015 515296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 516079 517194 gene locus_tag LOCUS_44380 516079 517194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 518364 517870 gene locus_tag LOCUS_44390 518364 517870 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095275.1 protein_id gnl|my_center|LOCUS_44390 518485 519720 gene locus_tag LOCUS_44400 518485 519720 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972186.1 protein_id gnl|my_center|LOCUS_44400 520130 519756 gene locus_tag LOCUS_44410 520130 519756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 520436 520176 gene locus_tag LOCUS_44420 520436 520176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 521065 520592 gene locus_tag LOCUS_44430 gene mscL 521065 520592 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889048.1 protein_id gnl|my_center|LOCUS_44430 521767 521105 gene locus_tag LOCUS_44440 521767 521105 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977010.1 protein_id gnl|my_center|LOCUS_44440 521839 523143 gene locus_tag LOCUS_44450 521839 523143 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486041.1 protein_id gnl|my_center|LOCUS_44450 523509 523153 gene locus_tag LOCUS_44460 523509 523153 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975744.1 protein_id gnl|my_center|LOCUS_44460 523669 524529 gene locus_tag LOCUS_44470 523669 524529 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036368.1 protein_id gnl|my_center|LOCUS_44470 524529 524942 gene locus_tag LOCUS_44480 524529 524942 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036369.1 protein_id gnl|my_center|LOCUS_44480 524939 525358 gene locus_tag LOCUS_44490 524939 525358 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036370.1 protein_id gnl|my_center|LOCUS_44490 525355 526371 gene locus_tag LOCUS_44500 525355 526371 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036371.1 protein_id gnl|my_center|LOCUS_44500 526365 527729 gene locus_tag LOCUS_44510 526365 527729 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883999.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44510 527732 529297 gene locus_tag LOCUS_44520 527732 529297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 530098 529286 gene locus_tag LOCUS_44530 530098 529286 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204082927.1 protein_id gnl|my_center|LOCUS_44530 530130 530708 gene locus_tag LOCUS_44540 530130 530708 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230451.1 protein_id gnl|my_center|LOCUS_44540 530921 531457 gene locus_tag LOCUS_44550 530921 531457 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225030.1 protein_id gnl|my_center|LOCUS_44550 531454 532224 gene locus_tag LOCUS_44560 531454 532224 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973942.1 protein_id gnl|my_center|LOCUS_44560 532221 533756 gene locus_tag LOCUS_44570 532221 533756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 533817 534764 gene locus_tag LOCUS_44580 533817 534764 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230305.1 protein_id gnl|my_center|LOCUS_44580 536914 534821 gene locus_tag LOCUS_44590 536914 534821 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898586.1 protein_id gnl|my_center|LOCUS_44590 537109 538428 gene locus_tag LOCUS_44600 537109 538428 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_44600 540742 538466 gene locus_tag LOCUS_44610 540742 538466 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028427.1 protein_id gnl|my_center|LOCUS_44610 540817 545061 gene locus_tag LOCUS_44620 540817 545061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44620 542619 542628 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 545058 545609 gene locus_tag LOCUS_44630 545058 545609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 546144 545626 gene locus_tag LOCUS_44640 546144 545626 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229692.1 protein_id gnl|my_center|LOCUS_44640 546696 546199 gene locus_tag LOCUS_44650 546696 546199 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867895.1 protein_id gnl|my_center|LOCUS_44650 546787 547704 gene locus_tag LOCUS_44660 546787 547704 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222248.1 protein_id gnl|my_center|LOCUS_44660 547701 549284 gene locus_tag LOCUS_44670 547701 549284 CDS product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228541.1 protein_id gnl|my_center|LOCUS_44670 549622 549335 gene locus_tag LOCUS_44680 549622 549335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 549814 551151 gene locus_tag LOCUS_44690 gene hemL 549814 551151 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892395.1 protein_id gnl|my_center|LOCUS_44690 551216 551863 gene locus_tag LOCUS_44700 551216 551863 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402845.1 protein_id gnl|my_center|LOCUS_44700 551863 552438 gene locus_tag LOCUS_44710 551863 552438 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029677.1 protein_id gnl|my_center|LOCUS_44710 552675 553301 gene locus_tag LOCUS_44720 552675 553301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 553301 554974 gene locus_tag LOCUS_44730 553301 554974 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496094.1 protein_id gnl|my_center|LOCUS_44730 554974 555948 gene locus_tag LOCUS_44740 gene ccsB 554974 555948 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222434.1 protein_id gnl|my_center|LOCUS_44740 557157 556003 gene locus_tag LOCUS_44750 557157 556003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 557876 557400 gene locus_tag LOCUS_44760 557876 557400 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224025.1 protein_id gnl|my_center|LOCUS_44760 557964 558539 gene locus_tag LOCUS_44770 557964 558539 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466773.1 protein_id gnl|my_center|LOCUS_44770 558839 559084 gene locus_tag LOCUS_44780 558839 559084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 559075 559263 gene locus_tag LOCUS_44790 559075 559263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 560232 559360 gene locus_tag LOCUS_44800 gene cif 560232 559360 CDS product CFTR inhibitory factor Cif inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114004.1 protein_id gnl|my_center|LOCUS_44800 560122 561837 gene locus_tag LOCUS_44810 560122 561837 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974459.1 protein_id gnl|my_center|LOCUS_44810 561837 562751 gene locus_tag LOCUS_44820 561837 562751 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029692.1 protein_id gnl|my_center|LOCUS_44820 563753 562782 gene locus_tag LOCUS_44830 563753 562782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 563883 564557 gene locus_tag LOCUS_44840 563883 564557 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974457.1 protein_id gnl|my_center|LOCUS_44840 564889 564623 gene locus_tag LOCUS_44850 564889 564623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 565158 565616 gene locus_tag LOCUS_44860 565158 565616 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466559.1 protein_id gnl|my_center|LOCUS_44860 565662 566495 gene locus_tag LOCUS_44870 565662 566495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 566518 567609 gene locus_tag LOCUS_44880 566518 567609 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977801.1 protein_id gnl|my_center|LOCUS_44880 568327 567698 gene locus_tag LOCUS_44890 568327 567698 CDS product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531407.1 protein_id gnl|my_center|LOCUS_44890 570308 568425 gene locus_tag LOCUS_44900 570308 568425 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223946.1 protein_id gnl|my_center|LOCUS_44900 572166 570505 gene locus_tag LOCUS_44910 572166 570505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 573780 572281 gene locus_tag LOCUS_44920 573780 572281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 574020 575189 gene locus_tag LOCUS_44930 gene mqnE 574020 575189 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974455.1 protein_id gnl|my_center|LOCUS_44930 575212 575646 gene locus_tag LOCUS_44940 575212 575646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 575720 576001 gene locus_tag LOCUS_44950 575720 576001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 577416 576076 gene locus_tag LOCUS_44960 577416 576076 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495115.1 protein_id gnl|my_center|LOCUS_44960 577634 578956 gene locus_tag LOCUS_44970 577634 578956 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230482.1 protein_id gnl|my_center|LOCUS_44970 579352 580290 gene locus_tag LOCUS_44980 579352 580290 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265874.1 protein_id gnl|my_center|LOCUS_44980 580307 581401 gene locus_tag LOCUS_44990 580307 581401 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014890.1 protein_id gnl|my_center|LOCUS_44990 581398 582228 gene locus_tag LOCUS_45000 581398 582228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838698.1 protein_id gnl|my_center|LOCUS_45000 583121 582306 gene locus_tag LOCUS_45010 583121 582306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027166.1 protein_id gnl|my_center|LOCUS_45010 583333 583914 gene locus_tag LOCUS_45020 583333 583914 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229197.1 protein_id gnl|my_center|LOCUS_45020 584682 583924 gene locus_tag LOCUS_45030 584682 583924 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325634.1 protein_id gnl|my_center|LOCUS_45030 585564 584827 gene locus_tag LOCUS_45040 585564 584827 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028267.1 protein_id gnl|my_center|LOCUS_45040 586522 585581 gene locus_tag LOCUS_45050 586522 585581 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889267.1 protein_id gnl|my_center|LOCUS_45050 586679 587137 gene locus_tag LOCUS_45060 586679 587137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 587182 588060 gene locus_tag LOCUS_45070 587182 588060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 588070 588501 gene locus_tag LOCUS_45080 588070 588501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 588506 589102 gene locus_tag LOCUS_45090 588506 589102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 589175 589819 gene locus_tag LOCUS_45100 589175 589819 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230956.1 protein_id gnl|my_center|LOCUS_45100 589823 591370 gene locus_tag LOCUS_45110 589823 591370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 593394 591382 gene locus_tag LOCUS_45120 593394 591382 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029494.1 protein_id gnl|my_center|LOCUS_45120 593600 594181 gene locus_tag LOCUS_45130 593600 594181 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226757.1 protein_id gnl|my_center|LOCUS_45130 594243 595583 gene locus_tag LOCUS_45140 594243 595583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 595617 596468 gene locus_tag LOCUS_45150 595617 596468 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974442.1 protein_id gnl|my_center|LOCUS_45150 597664 596714 gene locus_tag LOCUS_45160 597664 596714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 598644 597664 gene locus_tag LOCUS_45170 598644 597664 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227989.1 protein_id gnl|my_center|LOCUS_45170 599015 600082 gene locus_tag LOCUS_45180 gene paaA 599015 600082 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031683.1 protein_id gnl|my_center|LOCUS_45180 600079 600363 gene locus_tag LOCUS_45190 gene paaB 600079 600363 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454960.1 protein_id gnl|my_center|LOCUS_45190 600360 601085 gene locus_tag LOCUS_45200 gene paaC 600360 601085 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965788.1 protein_id gnl|my_center|LOCUS_45200 601079 601555 gene locus_tag LOCUS_45210 gene paaJ 601079 601555 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223466.1 protein_id gnl|my_center|LOCUS_45210 601552 602661 gene locus_tag LOCUS_45220 gene paaK 601552 602661 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971667.1 protein_id gnl|my_center|LOCUS_45220 603062 602883 gene locus_tag LOCUS_45230 603062 602883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 604846 604082 gene locus_tag LOCUS_45240 604846 604082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 605028 604846 gene locus_tag LOCUS_45250 605028 604846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 605242 606426 gene locus_tag LOCUS_45260 gene mqnC 605242 606426 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029726.1 protein_id gnl|my_center|LOCUS_45260 606889 608127 gene locus_tag LOCUS_45270 606889 608127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 608172 608969 gene locus_tag LOCUS_45280 608172 608969 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061581.1 protein_id gnl|my_center|LOCUS_45280 609042 609266 gene locus_tag LOCUS_45290 609042 609266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 609400 610677 gene locus_tag LOCUS_45300 609400 610677 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_45300 610859 611224 gene locus_tag LOCUS_45310 610859 611224 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_45310 611238 611915 gene locus_tag LOCUS_45320 611238 611915 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081859.1 protein_id gnl|my_center|LOCUS_45320 611912 612649 gene locus_tag LOCUS_45330 611912 612649 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222454.1 protein_id gnl|my_center|LOCUS_45330 612775 613971 gene locus_tag LOCUS_45340 gene nuoD 612775 613971 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728123.1 protein_id gnl|my_center|LOCUS_45340 613968 614987 gene locus_tag LOCUS_45350 613968 614987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 614984 616300 gene locus_tag LOCUS_45360 gene nuoF 614984 616300 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222457.1 protein_id gnl|my_center|LOCUS_45360 616300 618810 gene locus_tag LOCUS_45370 616300 618810 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899937.1 protein_id gnl|my_center|LOCUS_45370 618807 620159 gene locus_tag LOCUS_45380 gene nuoH 618807 620159 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416445.1 protein_id gnl|my_center|LOCUS_45380 620161 620802 gene locus_tag LOCUS_45390 620161 620802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 620799 621569 gene locus_tag LOCUS_45400 620799 621569 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222461.1 protein_id gnl|my_center|LOCUS_45400 621566 621865 gene locus_tag LOCUS_45410 gene nuoK 621566 621865 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_45410 621892 623835 gene locus_tag LOCUS_45420 gene nuoL 621892 623835 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222462.1 protein_id gnl|my_center|LOCUS_45420 623900 625432 gene locus_tag LOCUS_45430 623900 625432 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974372.1 protein_id gnl|my_center|LOCUS_45430 625554 627107 gene locus_tag LOCUS_45440 gene nuoN 625554 627107 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_45440 627330 628280 gene locus_tag LOCUS_45450 627330 628280 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_45450 629494 628313 gene locus_tag LOCUS_45460 629494 628313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 629691 630431 gene locus_tag LOCUS_45470 629691 630431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 630633 631034 gene locus_tag LOCUS_45480 630633 631034 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224600.1 protein_id gnl|my_center|LOCUS_45480 631031 631732 gene locus_tag LOCUS_45490 631031 631732 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224601.1 protein_id gnl|my_center|LOCUS_45490 632743 631802 gene locus_tag LOCUS_45500 gene rarD 632743 631802 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_45500 633228 632740 gene locus_tag LOCUS_45510 633228 632740 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027865.1 protein_id gnl|my_center|LOCUS_45510 633703 633299 gene locus_tag LOCUS_45520 633703 633299 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_45520 635594 633762 gene locus_tag LOCUS_45530 635594 633762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 635789 636196 gene locus_tag LOCUS_45540 635789 636196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 636223 636516 gene locus_tag LOCUS_45550 636223 636516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 637968 636637 gene locus_tag LOCUS_45560 637968 636637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 638121 641600 gene locus_tag LOCUS_45570 638121 641600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 641600 641962 gene locus_tag LOCUS_45580 641600 641962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 642958 642026 gene locus_tag LOCUS_45590 642958 642026 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230544.1 protein_id gnl|my_center|LOCUS_45590 645526 643091 gene locus_tag LOCUS_45600 645526 643091 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028663.1 protein_id gnl|my_center|LOCUS_45600 645816 645487 gene locus_tag LOCUS_45610 645816 645487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 648131 645828 gene locus_tag LOCUS_45620 648131 645828 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028663.1 protein_id gnl|my_center|LOCUS_45620 651278 648486 gene locus_tag LOCUS_45630 651278 648486 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028663.1 protein_id gnl|my_center|LOCUS_45630 653510 651546 gene locus_tag LOCUS_45640 gene acs 653510 651546 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_45640 653775 654521 gene locus_tag LOCUS_45650 653775 654521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230534.1 protein_id gnl|my_center|LOCUS_45650 655287 654655 gene locus_tag LOCUS_45660 655287 654655 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227830.1 protein_id gnl|my_center|LOCUS_45660 656561 655182 gene locus_tag LOCUS_45670 656561 655182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 657730 656558 gene locus_tag LOCUS_45680 657730 656558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 658621 657818 gene locus_tag LOCUS_45690 658621 657818 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 protein_id gnl|my_center|LOCUS_45690 659134 658982 gene locus_tag LOCUS_45700 659134 658982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 659439 659308 gene locus_tag LOCUS_45710 659439 659308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 659764 659432 gene locus_tag LOCUS_45720 659764 659432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 662056 661520 gene locus_tag LOCUS_45730 662056 661520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 663146 662364 gene locus_tag LOCUS_45740 663146 662364 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028906.1 protein_id gnl|my_center|LOCUS_45740 663886 663659 gene locus_tag LOCUS_45750 663886 663659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 664177 664509 gene locus_tag LOCUS_45760 664177 664509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 664553 665599 gene locus_tag LOCUS_45770 664553 665599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 666442 665867 gene locus_tag LOCUS_45780 666442 665867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 667582 666626 gene locus_tag LOCUS_45790 667582 666626 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225042.1 protein_id gnl|my_center|LOCUS_45790 667639 668790 gene locus_tag LOCUS_45800 667639 668790 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225041.1 protein_id gnl|my_center|LOCUS_45800 668841 670010 gene locus_tag LOCUS_45810 668841 670010 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030012.1 protein_id gnl|my_center|LOCUS_45810 670335 670105 gene locus_tag LOCUS_45820 670335 670105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 670571 670840 gene locus_tag LOCUS_45830 670571 670840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 671053 672156 gene locus_tag LOCUS_45840 671053 672156 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029084.1 protein_id gnl|my_center|LOCUS_45840 672153 673430 gene locus_tag LOCUS_45850 672153 673430 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_45850 674117 674902 gene locus_tag LOCUS_45860 674117 674902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 674899 675636 gene locus_tag LOCUS_45870 674899 675636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 675684 675851 gene locus_tag LOCUS_45880 675684 675851 CDS product DUF4244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083512.1 protein_id gnl|my_center|LOCUS_45880 675848 676297 gene locus_tag LOCUS_45890 675848 676297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 676480 676800 gene locus_tag LOCUS_45900 676480 676800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 677393 677022 gene locus_tag LOCUS_45910 677393 677022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 677987 677472 gene locus_tag LOCUS_45920 677987 677472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229320.1 protein_id gnl|my_center|LOCUS_45920 678613 677984 gene locus_tag LOCUS_45930 678613 677984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229320.1 protein_id gnl|my_center|LOCUS_45930 679266 678964 gene locus_tag LOCUS_45940 679266 678964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 679971 679393 gene locus_tag LOCUS_45950 679971 679393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 682458 680074 gene locus_tag LOCUS_45960 682458 680074 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_45960 682651 683007 gene locus_tag LOCUS_45970 gene bldG 682651 683007 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_45970 683007 683441 gene locus_tag LOCUS_45980 683007 683441 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975387.1 protein_id gnl|my_center|LOCUS_45980 683807 686197 gene locus_tag LOCUS_45990 683807 686197 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029076.1 protein_id gnl|my_center|LOCUS_45990 686198 686929 gene locus_tag LOCUS_46000 686198 686929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 686920 687600 gene locus_tag LOCUS_46010 686920 687600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083493.1 protein_id gnl|my_center|LOCUS_46010 688009 690828 gene locus_tag LOCUS_46020 gene topA 688009 690828 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742226.1 protein_id gnl|my_center|LOCUS_46020 692216 690897 gene locus_tag LOCUS_46030 692216 690897 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203926466.1 protein_id gnl|my_center|LOCUS_46030 692440 693036 gene locus_tag LOCUS_46040 692440 693036 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222036.1 protein_id gnl|my_center|LOCUS_46040 694291 693083 gene locus_tag LOCUS_46050 694291 693083 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027880.1 protein_id gnl|my_center|LOCUS_46050 694506 696683 gene locus_tag LOCUS_46060 694506 696683 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230508.1 protein_id gnl|my_center|LOCUS_46060 696683 697975 gene locus_tag LOCUS_46070 696683 697975 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230507.1 protein_id gnl|my_center|LOCUS_46070 698100 698429 gene locus_tag LOCUS_46080 698100 698429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 698431 698736 gene locus_tag LOCUS_46090 698431 698736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 698736 699404 gene locus_tag LOCUS_46100 698736 699404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 699709 700545 gene locus_tag LOCUS_46110 699709 700545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 702314 700560 gene locus_tag LOCUS_46120 702314 700560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 702456 702530 gene locus_tag LOCUS_t00590 702456 702530 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 703055 702660 gene locus_tag LOCUS_46130 gene crcB 703055 702660 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416046.1 protein_id gnl|my_center|LOCUS_46130 703453 703055 gene locus_tag LOCUS_46140 gene crcB 703453 703055 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531444.1 protein_id gnl|my_center|LOCUS_46140 703876 704769 gene locus_tag LOCUS_46150 703876 704769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 704841 705083 gene locus_tag LOCUS_46160 704841 705083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 705906 705247 gene locus_tag LOCUS_46170 705906 705247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 706051 706623 gene locus_tag LOCUS_46180 706051 706623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 707176 706625 gene locus_tag LOCUS_46190 707176 706625 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241839.1 protein_id gnl|my_center|LOCUS_46190 708528 707173 gene locus_tag LOCUS_46200 708528 707173 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226634.1 protein_id gnl|my_center|LOCUS_46200 709144 708518 gene locus_tag LOCUS_46210 709144 708518 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226757.1 protein_id gnl|my_center|LOCUS_46210 709833 709216 gene locus_tag LOCUS_46220 709833 709216 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727382.1 protein_id gnl|my_center|LOCUS_46220 709999 710505 gene locus_tag LOCUS_46230 709999 710505 CDS product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975779.1 protein_id gnl|my_center|LOCUS_46230 710502 711077 gene locus_tag LOCUS_46240 710502 711077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 711084 712187 gene locus_tag LOCUS_46250 711084 712187 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523309.1 protein_id gnl|my_center|LOCUS_46250 713099 712221 gene locus_tag LOCUS_46260 713099 712221 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066795948.1 protein_id gnl|my_center|LOCUS_46260 714952 713096 gene locus_tag LOCUS_46270 714952 713096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 715165 715299 gene locus_tag LOCUS_46280 715165 715299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46280 715444 717120 gene locus_tag LOCUS_46290 715444 717120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 717686 717195 gene locus_tag LOCUS_46300 717686 717195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 717757 719391 gene locus_tag LOCUS_46310 717757 719391 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230133.1 protein_id gnl|my_center|LOCUS_46310 719827 719600 gene locus_tag LOCUS_46320 719827 719600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 720153 720878 gene locus_tag LOCUS_46330 720153 720878 CDS product DUF981 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888021.1 protein_id gnl|my_center|LOCUS_46330 721561 720908 gene locus_tag LOCUS_46340 721561 720908 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230987.1 protein_id gnl|my_center|LOCUS_46340 722459 721599 gene locus_tag LOCUS_46350 722459 721599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223235.1 protein_id gnl|my_center|LOCUS_46350 723251 722583 gene locus_tag LOCUS_46360 723251 722583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 723469 723861 gene locus_tag LOCUS_46370 723469 723861 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228473.1 protein_id gnl|my_center|LOCUS_46370 724903 723905 gene locus_tag LOCUS_46380 724903 723905 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227088.1 protein_id gnl|my_center|LOCUS_46380 724969 725931 gene locus_tag LOCUS_46390 724969 725931 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971796.1 protein_id gnl|my_center|LOCUS_46390 725921 726826 gene locus_tag LOCUS_46400 gene ligD 725921 726826 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467071.1 protein_id gnl|my_center|LOCUS_46400 728021 726858 gene locus_tag LOCUS_46410 728021 726858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 728275 728910 gene locus_tag LOCUS_46420 728275 728910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 730269 730003 gene locus_tag LOCUS_46430 730269 730003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 730529 730266 gene locus_tag LOCUS_46440 730529 730266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 730896 731123 gene locus_tag LOCUS_46450 730896 731123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 731241 732011 gene locus_tag LOCUS_46460 731241 732011 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727932.1 protein_id gnl|my_center|LOCUS_46460 732101 732982 gene locus_tag LOCUS_46470 732101 732982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 733574 733089 gene locus_tag LOCUS_46480 733574 733089 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028555.1 protein_id gnl|my_center|LOCUS_46480 733742 734671 gene locus_tag LOCUS_46490 733742 734671 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028554.1 protein_id gnl|my_center|LOCUS_46490 734808 735053 gene locus_tag LOCUS_46500 734808 735053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 735053 735397 gene locus_tag LOCUS_46510 735053 735397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 735812 735408 gene locus_tag LOCUS_46520 735812 735408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 736360 735926 gene locus_tag LOCUS_46530 736360 735926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 736568 736377 gene locus_tag LOCUS_46540 736568 736377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 738383 736704 gene locus_tag LOCUS_46550 738383 736704 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230272.1 protein_id gnl|my_center|LOCUS_46550 738557 739444 gene locus_tag LOCUS_46560 738557 739444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 739565 739804 gene locus_tag LOCUS_46570 739565 739804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 742299 739840 gene locus_tag LOCUS_46580 742299 739840 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230251.1 protein_id gnl|my_center|LOCUS_46580 742360 743007 gene locus_tag LOCUS_46590 742360 743007 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029580.1 protein_id gnl|my_center|LOCUS_46590 743036 743422 gene locus_tag LOCUS_46600 743036 743422 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230216.1 protein_id gnl|my_center|LOCUS_46600 744282 743383 gene locus_tag LOCUS_46610 744282 743383 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974649.1 protein_id gnl|my_center|LOCUS_46610 745010 745918 gene locus_tag LOCUS_46620 745010 745918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 746710 745928 gene locus_tag LOCUS_46630 746710 745928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 748446 746707 gene locus_tag LOCUS_46640 748446 746707 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029582.1 protein_id gnl|my_center|LOCUS_46640 748553 749389 gene locus_tag LOCUS_46650 748553 749389 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776598.1 protein_id gnl|my_center|LOCUS_46650 749696 749418 gene locus_tag LOCUS_46660 749696 749418 CDS product DUF2530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029585.1 protein_id gnl|my_center|LOCUS_46660 749786 751264 gene locus_tag LOCUS_46670 749786 751264 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230209.1 protein_id gnl|my_center|LOCUS_46670 751392 751841 gene locus_tag LOCUS_46680 751392 751841 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230207.1 protein_id gnl|my_center|LOCUS_46680 751905 753185 gene locus_tag LOCUS_46690 751905 753185 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_46690 753323 753814 gene locus_tag LOCUS_46700 753323 753814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 753828 754406 gene locus_tag LOCUS_46710 gene thpR 753828 754406 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029587.1 protein_id gnl|my_center|LOCUS_46710 755400 754414 gene locus_tag LOCUS_46720 755400 754414 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_46720 756568 755486 gene locus_tag LOCUS_46730 gene sepH 756568 755486 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973165.1 protein_id gnl|my_center|LOCUS_46730 757881 756754 gene locus_tag LOCUS_46740 gene serC 757881 756754 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029607.1 protein_id gnl|my_center|LOCUS_46740 759296 758190 gene locus_tag LOCUS_46750 759296 758190 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029624.1 protein_id gnl|my_center|LOCUS_46750 759578 760228 gene locus_tag LOCUS_46760 gene pdxH 759578 760228 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029623.1 protein_id gnl|my_center|LOCUS_46760 760225 761520 gene locus_tag LOCUS_46770 760225 761520 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742199.1 protein_id gnl|my_center|LOCUS_46770 761539 762468 gene locus_tag LOCUS_46780 761539 762468 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 protein_id gnl|my_center|LOCUS_46780 762491 763093 gene locus_tag LOCUS_46790 762491 763093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 763309 763614 gene locus_tag LOCUS_46800 763309 763614 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003999914.1 protein_id gnl|my_center|LOCUS_46800 763703 764401 gene locus_tag LOCUS_46810 763703 764401 CDS product DUF4230 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027353.1 protein_id gnl|my_center|LOCUS_46810 764682 764476 gene locus_tag LOCUS_46820 764682 764476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 765044 766414 gene locus_tag LOCUS_46830 765044 766414 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 protein_id gnl|my_center|LOCUS_46830 766440 767267 gene locus_tag LOCUS_46840 766440 767267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 767302 768048 gene locus_tag LOCUS_46850 767302 768048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 768045 770042 gene locus_tag LOCUS_46860 768045 770042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 770059 772257 gene locus_tag LOCUS_46870 770059 772257 CDS product bifunctional glycosyltransferase/CDP-glycerol:glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028440.1 protein_id gnl|my_center|LOCUS_46870 772326 773687 gene locus_tag LOCUS_46880 772326 773687 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977118.1 protein_id gnl|my_center|LOCUS_46880 773777 774775 gene locus_tag LOCUS_46890 773777 774775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 775163 775753 gene locus_tag LOCUS_46900 775163 775753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 778106 775908 gene locus_tag LOCUS_46910 778106 775908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 778470 778231 gene locus_tag LOCUS_46920 778470 778231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 779206 778541 gene locus_tag LOCUS_46930 779206 778541 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227310.1 protein_id gnl|my_center|LOCUS_46930 780405 779203 gene locus_tag LOCUS_46940 780405 779203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 780538 781449 gene locus_tag LOCUS_46950 780538 781449 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230969.1 protein_id gnl|my_center|LOCUS_46950 781446 782291 gene locus_tag LOCUS_46960 781446 782291 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228270.1 protein_id gnl|my_center|LOCUS_46960 782667 782332 gene locus_tag LOCUS_46970 782667 782332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 782875 783675 gene locus_tag LOCUS_46980 782875 783675 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031055.1 protein_id gnl|my_center|LOCUS_46980 783666 783854 gene locus_tag LOCUS_46990 783666 783854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 783951 784418 gene locus_tag LOCUS_47000 783951 784418 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977512.1 protein_id gnl|my_center|LOCUS_47000 784497 785249 gene locus_tag LOCUS_47010 784497 785249 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978139.1 protein_id gnl|my_center|LOCUS_47010 785246 787618 gene locus_tag LOCUS_47020 785246 787618 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893013.1 protein_id gnl|my_center|LOCUS_47020 787858 787676 gene locus_tag LOCUS_47030 787858 787676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 788304 787957 gene locus_tag LOCUS_47040 788304 787957 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973560.1 protein_id gnl|my_center|LOCUS_47040 788666 788274 gene locus_tag LOCUS_47050 788666 788274 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973561.1 protein_id gnl|my_center|LOCUS_47050 788790 789473 gene locus_tag LOCUS_47060 788790 789473 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522757.1 protein_id gnl|my_center|LOCUS_47060 790731 789475 gene locus_tag LOCUS_47070 790731 789475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_47070 790912 791097 gene locus_tag LOCUS_47080 790912 791097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 791364 792566 gene locus_tag LOCUS_47090 791364 792566 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228781.1 protein_id gnl|my_center|LOCUS_47090 792583 792831 gene locus_tag LOCUS_47100 792583 792831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 793653 792961 gene locus_tag LOCUS_47110 793653 792961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 794583 794251 gene locus_tag LOCUS_47120 794583 794251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 795800 794682 gene locus_tag LOCUS_47130 795800 794682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 796501 796091 gene locus_tag LOCUS_47140 796501 796091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 799122 796735 gene locus_tag LOCUS_47150 799122 796735 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327169.1 protein_id gnl|my_center|LOCUS_47150 799967 799119 gene locus_tag LOCUS_47160 799967 799119 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973942.1 protein_id gnl|my_center|LOCUS_47160 800488 799964 gene locus_tag LOCUS_47170 800488 799964 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_47170 801884 800595 gene locus_tag LOCUS_47180 801884 800595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 802245 801895 gene locus_tag LOCUS_47190 802245 801895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 803944 802364 gene locus_tag LOCUS_47200 gene eccB 803944 802364 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224123.1 protein_id gnl|my_center|LOCUS_47200 804094 805290 gene locus_tag LOCUS_47210 gene eccE 804094 805290 CDS product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487445.1 protein_id gnl|my_center|LOCUS_47210 806693 805296 gene locus_tag LOCUS_47220 gene eccD 806693 805296 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224120.1 protein_id gnl|my_center|LOCUS_47220 806896 810855 gene locus_tag LOCUS_47230 806896 810855 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222635.1 protein_id gnl|my_center|LOCUS_47230 811193 811501 gene locus_tag LOCUS_47240 811193 811501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 811530 811808 gene locus_tag LOCUS_47250 811530 811808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 811893 813317 gene locus_tag LOCUS_47260 811893 813317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 813355 813894 gene locus_tag LOCUS_47270 813355 813894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 813912 815291 gene locus_tag LOCUS_47280 813912 815291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 816603 815365 gene locus_tag LOCUS_47290 gene mycP 816603 815365 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977220.1 protein_id gnl|my_center|LOCUS_47290 816987 816658 gene locus_tag LOCUS_47300 816987 816658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 817223 818179 gene locus_tag LOCUS_47310 817223 818179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 819294 818257 gene locus_tag LOCUS_47320 819294 818257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 820028 819276 gene locus_tag LOCUS_47330 820028 819276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 820552 821157 gene locus_tag LOCUS_47340 820552 821157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 821249 821878 gene locus_tag LOCUS_47350 821249 821878 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225371.1 protein_id gnl|my_center|LOCUS_47350 822293 821991 gene locus_tag LOCUS_47360 822293 821991 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726761.1 protein_id gnl|my_center|LOCUS_47360 822441 822650 gene locus_tag LOCUS_47370 822441 822650 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 protein_id gnl|my_center|LOCUS_47370 822679 823701 gene locus_tag LOCUS_47380 822679 823701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225367.1 protein_id gnl|my_center|LOCUS_47380 823715 825982 gene locus_tag LOCUS_47390 823715 825982 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027542.1 protein_id gnl|my_center|LOCUS_47390 826159 826332 gene locus_tag LOCUS_47400 826159 826332 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226939.1 protein_id gnl|my_center|LOCUS_47400 827810 826545 gene locus_tag LOCUS_47410 827810 826545 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028973.1 protein_id gnl|my_center|LOCUS_47410 828239 828577 gene locus_tag LOCUS_47420 828239 828577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 829053 828604 gene locus_tag LOCUS_47430 829053 828604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 830008 829109 gene locus_tag LOCUS_47440 830008 829109 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036279.1 protein_id gnl|my_center|LOCUS_47440 830174 830509 gene locus_tag LOCUS_47450 830174 830509 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728925.1 protein_id gnl|my_center|LOCUS_47450 830609 831544 gene locus_tag LOCUS_47460 830609 831544 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728505.1 protein_id gnl|my_center|LOCUS_47460 831602 832249 gene locus_tag LOCUS_47470 831602 832249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 832368 833366 gene locus_tag LOCUS_47480 832368 833366 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529865.1 protein_id gnl|my_center|LOCUS_47480 833429 834196 gene locus_tag LOCUS_47490 833429 834196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728488.1 protein_id gnl|my_center|LOCUS_47490 834193 834993 gene locus_tag LOCUS_47500 834193 834993 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226900.1 protein_id gnl|my_center|LOCUS_47500 834990 836069 gene locus_tag LOCUS_47510 834990 836069 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013798.1 protein_id gnl|my_center|LOCUS_47510 836102 836836 gene locus_tag LOCUS_47520 836102 836836 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727390.1 protein_id gnl|my_center|LOCUS_47520 836833 838437 gene locus_tag LOCUS_47530 836833 838437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 838467 838838 gene locus_tag LOCUS_47540 838467 838838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 838835 839371 gene locus_tag LOCUS_47550 838835 839371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 839393 839809 gene locus_tag LOCUS_47560 839393 839809 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171561.1 protein_id gnl|my_center|LOCUS_47560 839809 840690 gene locus_tag LOCUS_47570 839809 840690 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028618.1 protein_id gnl|my_center|LOCUS_47570 840892 841662 gene locus_tag LOCUS_47580 840892 841662 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_47580 841701 842651 gene locus_tag LOCUS_47590 841701 842651 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731314.1 protein_id gnl|my_center|LOCUS_47590 842738 843514 gene locus_tag LOCUS_47600 842738 843514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 845287 844034 gene locus_tag LOCUS_47610 845287 844034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 845229 845399 gene locus_tag LOCUS_47620 845229 845399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 848844 845611 gene locus_tag LOCUS_47630 848844 845611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 849500 851944 gene locus_tag LOCUS_47640 849500 851944 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030123.1 protein_id gnl|my_center|LOCUS_47640 851941 852984 gene locus_tag LOCUS_47650 851941 852984 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030122.1 protein_id gnl|my_center|LOCUS_47650 854040 853066 gene locus_tag LOCUS_47660 854040 853066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 854765 854046 gene locus_tag LOCUS_47670 854765 854046 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224576.1 protein_id gnl|my_center|LOCUS_47670 854860 855285 gene locus_tag LOCUS_47680 854860 855285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 856649 855444 gene locus_tag LOCUS_47690 856649 855444 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226999.1 protein_id gnl|my_center|LOCUS_47690 856748 857431 gene locus_tag LOCUS_47700 856748 857431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 857459 857806 gene locus_tag LOCUS_47710 857459 857806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 858829 858065 gene locus_tag LOCUS_47720 858829 858065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 859877 858939 gene locus_tag LOCUS_47730 859877 858939 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_47730 860372 860175 gene locus_tag LOCUS_47740 860372 860175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 860374 861576 gene locus_tag LOCUS_47750 860374 861576 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804722.1 protein_id gnl|my_center|LOCUS_47750 861579 862700 gene locus_tag LOCUS_47760 861579 862700 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257104.1 protein_id gnl|my_center|LOCUS_47760 862877 862635 gene locus_tag LOCUS_47770 862877 862635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 862794 863981 gene locus_tag LOCUS_47780 862794 863981 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 protein_id gnl|my_center|LOCUS_47780 863989 864594 gene locus_tag LOCUS_47790 863989 864594 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229701.1 protein_id gnl|my_center|LOCUS_47790 864616 865053 gene locus_tag LOCUS_47800 864616 865053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 866459 865539 gene locus_tag LOCUS_47810 866459 865539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 867186 867476 gene locus_tag LOCUS_47820 867186 867476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47820 867785 868687 gene locus_tag LOCUS_47830 gene gmd 867785 868687 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_47830 868681 870096 gene locus_tag LOCUS_47840 868681 870096 CDS product NDP-hexose 2,3-dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043781848.1 protein_id gnl|my_center|LOCUS_47840 870090 871118 gene locus_tag LOCUS_47850 870090 871118 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222572.1 protein_id gnl|my_center|LOCUS_47850 871820 871623 gene locus_tag LOCUS_47860 871820 871623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 871952 872200 gene locus_tag LOCUS_47870 871952 872200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 872261 873148 gene locus_tag LOCUS_47880 872261 873148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 874014 873127 gene locus_tag LOCUS_47890 874014 873127 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086670594.1 protein_id gnl|my_center|LOCUS_47890 874796 874047 gene locus_tag LOCUS_47900 874796 874047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 875242 875436 gene locus_tag LOCUS_47910 875242 875436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 875492 879298 gene locus_tag LOCUS_47920 875492 879298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 881159 879807 gene locus_tag LOCUS_47930 881159 879807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 882242 881214 gene locus_tag LOCUS_47940 882242 881214 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_47940 883278 882298 gene locus_tag LOCUS_47950 gene rfbB 883278 882298 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_47950 884315 883287 gene locus_tag LOCUS_47960 884315 883287 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_47960 885482 884553 gene locus_tag LOCUS_47970 885482 884553 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530115.1 protein_id gnl|my_center|LOCUS_47970 885799 885485 gene locus_tag LOCUS_47980 885799 885485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 885837 886595 gene locus_tag LOCUS_47990 885837 886595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 887674 886622 gene locus_tag LOCUS_48000 887674 886622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 888684 887671 gene locus_tag LOCUS_48010 888684 887671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 889697 888732 gene locus_tag LOCUS_48020 889697 888732 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004792520.1 protein_id gnl|my_center|LOCUS_48020 890598 889702 gene locus_tag LOCUS_48030 890598 889702 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259508.1 protein_id gnl|my_center|LOCUS_48030 891899 890766 gene locus_tag LOCUS_48040 891899 890766 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304024.1 protein_id gnl|my_center|LOCUS_48040 891813 892079 gene locus_tag LOCUS_48050 891813 892079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 892215 893660 gene locus_tag LOCUS_48060 892215 893660 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192100.1 protein_id gnl|my_center|LOCUS_48060 893657 894388 gene locus_tag LOCUS_48070 893657 894388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 894388 895329 gene locus_tag LOCUS_48080 894388 895329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 895346 896563 gene locus_tag LOCUS_48090 895346 896563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 896835 898151 gene locus_tag LOCUS_48100 896835 898151 CDS product DUF1205 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674794.1 protein_id gnl|my_center|LOCUS_48100 898151 898873 gene locus_tag LOCUS_48110 898151 898873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 900193 899159 gene locus_tag LOCUS_48120 900193 899159 CDS product ketoacyl-ACP synthase III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007445820.1 protein_id gnl|my_center|LOCUS_48120 900603 901436 gene locus_tag LOCUS_48130 900603 901436 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775665.1 protein_id gnl|my_center|LOCUS_48130 901539 902369 gene locus_tag LOCUS_48140 901539 902369 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892805.1 protein_id gnl|my_center|LOCUS_48140 902395 903390 gene locus_tag LOCUS_48150 902395 903390 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169618726.1 protein_id gnl|my_center|LOCUS_48150 903593 904549 gene locus_tag LOCUS_48160 903593 904549 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197236.1 protein_id gnl|my_center|LOCUS_48160 905134 904721 gene locus_tag LOCUS_48170 905134 904721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 906277 905258 gene locus_tag LOCUS_48180 906277 905258 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143157.1 protein_id gnl|my_center|LOCUS_48180 907468 906284 gene locus_tag LOCUS_48190 907468 906284 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227228.1 protein_id gnl|my_center|LOCUS_48190 908664 907465 gene locus_tag LOCUS_48200 908664 907465 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957740.1 protein_id gnl|my_center|LOCUS_48200 909575 908751 gene locus_tag LOCUS_48210 909575 908751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 910306 911775 gene locus_tag LOCUS_48220 910306 911775 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071802696.1 protein_id gnl|my_center|LOCUS_48220 912871 911780 gene locus_tag LOCUS_48230 gene trmN 912871 911780 CDS product tRNA (guanine(6)-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926059.1 protein_id gnl|my_center|LOCUS_48230 914381 913053 gene locus_tag LOCUS_48240 914381 913053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 914869 914549 gene locus_tag LOCUS_48250 914869 914549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 914934 915686 gene locus_tag LOCUS_48260 914934 915686 CDS product TylF/MycF family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296730.1 protein_id gnl|my_center|LOCUS_48260 916345 916419 gene locus_tag LOCUS_t00600 916345 916419 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 918004 916616 gene locus_tag LOCUS_48270 918004 916616 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030198.1 protein_id gnl|my_center|LOCUS_48270 918186 918001 gene locus_tag LOCUS_48280 918186 918001 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031039432.1 protein_id gnl|my_center|LOCUS_48280 919916 918210 gene locus_tag LOCUS_48290 919916 918210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227708.1 protein_id gnl|my_center|LOCUS_48290 920686 919982 gene locus_tag LOCUS_48300 920686 919982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 922122 920683 gene locus_tag LOCUS_48310 922122 920683 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110627.1 protein_id gnl|my_center|LOCUS_48310 922340 922113 gene locus_tag LOCUS_48320 922340 922113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 922946 922509 gene locus_tag LOCUS_48330 922946 922509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 923071 923556 gene locus_tag LOCUS_48340 923071 923556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 924283 923558 gene locus_tag LOCUS_48350 924283 923558 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014894892.1 protein_id gnl|my_center|LOCUS_48350 924874 924641 gene locus_tag LOCUS_48360 924874 924641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 925139 924867 gene locus_tag LOCUS_48370 925139 924867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 925045 925503 gene locus_tag LOCUS_48380 925045 925503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 925508 926731 gene locus_tag LOCUS_48390 925508 926731 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227700.1 protein_id gnl|my_center|LOCUS_48390 926756 927223 gene locus_tag LOCUS_48400 926756 927223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 928812 927406 gene locus_tag LOCUS_48410 928812 927406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 929420 928809 gene locus_tag LOCUS_48420 929420 928809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 929697 930383 gene locus_tag LOCUS_48430 929697 930383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 930975 930571 gene locus_tag LOCUS_48440 930975 930571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 931169 930972 gene locus_tag LOCUS_48450 931169 930972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 931455 931874 gene locus_tag LOCUS_48460 931455 931874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 931977 931837 gene locus_tag LOCUS_48470 931977 931837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 932384 932698 gene locus_tag LOCUS_48480 932384 932698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 933450 933034 gene locus_tag LOCUS_48490 933450 933034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 934722 933460 gene locus_tag LOCUS_48500 934722 933460 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227356.1 protein_id gnl|my_center|LOCUS_48500 934903 936498 gene locus_tag LOCUS_48510 934903 936498 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_48510 937612 936764 gene locus_tag LOCUS_48520 937612 936764 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385588.1 protein_id gnl|my_center|LOCUS_48520 937845 939620 gene locus_tag LOCUS_48530 937845 939620 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227076.1 protein_id gnl|my_center|LOCUS_48530 940397 939801 gene locus_tag LOCUS_48540 940397 939801 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 protein_id gnl|my_center|LOCUS_48540 941028 940552 gene locus_tag LOCUS_48550 941028 940552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 941211 942227 gene locus_tag LOCUS_48560 941211 942227 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223041.1 protein_id gnl|my_center|LOCUS_48560 942615 944375 gene locus_tag LOCUS_48570 942615 944375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 945519 944485 gene locus_tag LOCUS_48580 945519 944485 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_48580 947356 945512 gene locus_tag LOCUS_48590 947356 945512 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_48590 949140 947713 gene locus_tag LOCUS_48600 949140 947713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 949271 949648 gene locus_tag LOCUS_48610 949271 949648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 950192 949752 gene locus_tag LOCUS_48620 950192 949752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 950986 950189 gene locus_tag LOCUS_48630 950986 950189 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113386.1 protein_id gnl|my_center|LOCUS_48630 952070 951201 gene locus_tag LOCUS_48640 gene folP 952070 951201 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327205.1 protein_id gnl|my_center|LOCUS_48640 952238 952900 gene locus_tag LOCUS_48650 952238 952900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 952897 953394 gene locus_tag LOCUS_48660 952897 953394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 953500 954090 gene locus_tag LOCUS_48670 953500 954090 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222967.1 protein_id gnl|my_center|LOCUS_48670 954104 954778 gene locus_tag LOCUS_48680 954104 954778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 954847 955599 gene locus_tag LOCUS_48690 954847 955599 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_48690 956405 955614 gene locus_tag LOCUS_48700 956405 955614 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_48700 957227 956409 gene locus_tag LOCUS_48710 957227 956409 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228978.1 protein_id gnl|my_center|LOCUS_48710 957371 957583 gene locus_tag LOCUS_48720 957371 957583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 957726 959198 gene locus_tag LOCUS_48730 957726 959198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 959976 959368 gene locus_tag LOCUS_48740 959976 959368 CDS product SAM-dependent O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911448.1 protein_id gnl|my_center|LOCUS_48740 960271 961605 gene locus_tag LOCUS_48750 960271 961605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 961679 962104 gene locus_tag LOCUS_48760 961679 962104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 963374 962148 gene locus_tag LOCUS_48770 963374 962148 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286318.1 protein_id gnl|my_center|LOCUS_48770 964223 963495 gene locus_tag LOCUS_48780 964223 963495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 965505 964216 gene locus_tag LOCUS_48790 965505 964216 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222981.1 protein_id gnl|my_center|LOCUS_48790 965557 966402 gene locus_tag LOCUS_48800 965557 966402 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762776.1 protein_id gnl|my_center|LOCUS_48800 966433 966999 gene locus_tag LOCUS_48810 966433 966999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973821.1 protein_id gnl|my_center|LOCUS_48810 968045 967347 gene locus_tag LOCUS_48820 968045 967347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 968154 969125 gene locus_tag LOCUS_48830 968154 969125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 969214 971373 gene locus_tag LOCUS_48840 969214 971373 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_48840 972229 971429 gene locus_tag LOCUS_48850 972229 971429 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_48850 972388 973344 gene locus_tag LOCUS_48860 972388 973344 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_48860 973929 973399 gene locus_tag LOCUS_48870 973929 973399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 974048 974953 gene locus_tag LOCUS_48880 974048 974953 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099690.1 protein_id gnl|my_center|LOCUS_48880 975410 974979 gene locus_tag LOCUS_48890 975410 974979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 975585 976781 gene locus_tag LOCUS_48900 975585 976781 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222986.1 protein_id gnl|my_center|LOCUS_48900 977202 976795 gene locus_tag LOCUS_48910 977202 976795 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230349.1 protein_id gnl|my_center|LOCUS_48910 977544 978020 gene locus_tag LOCUS_48920 977544 978020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 978542 978180 gene locus_tag LOCUS_48930 gene trxA 978542 978180 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224532.1 protein_id gnl|my_center|LOCUS_48930 979090 979605 gene locus_tag LOCUS_48940 979090 979605 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_48940 979679 980215 gene locus_tag LOCUS_48950 979679 980215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 980328 980924 gene locus_tag LOCUS_48960 980328 980924 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323891.1 protein_id gnl|my_center|LOCUS_48960 981123 981779 gene locus_tag LOCUS_48970 981123 981779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973817.1 protein_id gnl|my_center|LOCUS_48970 981897 982055 gene locus_tag LOCUS_48980 981897 982055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 982062 982934 gene locus_tag LOCUS_48990 982062 982934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 983023 983922 gene locus_tag LOCUS_49000 983023 983922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 983973 985214 gene locus_tag LOCUS_49010 983973 985214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 985288 986160 gene locus_tag LOCUS_49020 985288 986160 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973816.1 protein_id gnl|my_center|LOCUS_49020 986198 986812 gene locus_tag LOCUS_49030 986198 986812 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973815.1 protein_id gnl|my_center|LOCUS_49030 986879 987790 gene locus_tag LOCUS_49040 986879 987790 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286316.1 protein_id gnl|my_center|LOCUS_49040 988705 987857 gene locus_tag LOCUS_49050 988705 987857 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971907.1 protein_id gnl|my_center|LOCUS_49050 989180 988752 gene locus_tag LOCUS_49060 gene furA1 989180 988752 CDS product fur family transcriptional regulator FurA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731249.1 protein_id gnl|my_center|LOCUS_49060 989378 989860 gene locus_tag LOCUS_49070 989378 989860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 990314 989886 gene locus_tag LOCUS_49080 990314 989886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 990298 990483 gene locus_tag LOCUS_49090 990298 990483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 991099 990599 gene locus_tag LOCUS_49100 991099 990599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 991249 991533 gene locus_tag LOCUS_49110 991249 991533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 992417 991731 gene locus_tag LOCUS_49120 992417 991731 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028815.1 protein_id gnl|my_center|LOCUS_49120 992521 994836 gene locus_tag LOCUS_49130 992521 994836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 994846 995847 gene locus_tag LOCUS_49140 gene galU 994846 995847 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_49140 995844 997148 gene locus_tag LOCUS_49150 995844 997148 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_49150 997201 997851 gene locus_tag LOCUS_49160 997201 997851 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230037.1 protein_id gnl|my_center|LOCUS_49160 998037 998825 gene locus_tag LOCUS_49170 998037 998825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 999053 999128 gene locus_tag LOCUS_t00610 999053 999128 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 999834 999565 gene locus_tag LOCUS_49180 999834 999565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 1000242 1000823 gene locus_tag LOCUS_49190 1000242 1000823 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229943.1 protein_id gnl|my_center|LOCUS_49190 1000820 1001620 gene locus_tag LOCUS_49200 1000820 1001620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 1001654 1002457 gene locus_tag LOCUS_49210 1001654 1002457 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229941.1 protein_id gnl|my_center|LOCUS_49210 1002454 1003776 gene locus_tag LOCUS_49220 1002454 1003776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845201.1 protein_id gnl|my_center|LOCUS_49220 1003814 1004416 gene locus_tag LOCUS_49230 1003814 1004416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 1005718 1004627 gene locus_tag LOCUS_49240 1005718 1004627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 >Feature sequence33 1775 792 gene locus_tag LOCUS_49250 1775 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 2488 2802 gene locus_tag LOCUS_49260 2488 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 2985 3320 gene locus_tag LOCUS_49270 2985 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49270 4713 3925 gene locus_tag LOCUS_49280 4713 3925 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899614.1 protein_id gnl|my_center|LOCUS_49280 5984 4713 gene locus_tag LOCUS_49290 gene istA 5984 4713 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014001845.1 protein_id gnl|my_center|LOCUS_49290 6416 5994 gene locus_tag LOCUS_49300 6416 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 7046 6744 gene locus_tag LOCUS_49310 7046 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 7742 7521 gene locus_tag LOCUS_49320 7742 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 8615 7812 gene locus_tag LOCUS_49330 8615 7812 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777030.1 protein_id gnl|my_center|LOCUS_49330 9817 8915 gene locus_tag LOCUS_49340 9817 8915 CDS product DUF1963 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227205.1 protein_id gnl|my_center|LOCUS_49340 10728 9964 gene locus_tag LOCUS_49350 10728 9964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 11074 11379 gene locus_tag LOCUS_49360 11074 11379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 14869 11366 gene locus_tag LOCUS_49370 gene metH 14869 11366 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226749.1 protein_id gnl|my_center|LOCUS_49370 14906 15184 gene locus_tag LOCUS_49380 14906 15184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 15181 16050 gene locus_tag LOCUS_49390 15181 16050 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061177.1 protein_id gnl|my_center|LOCUS_49390 16180 16971 gene locus_tag LOCUS_49400 16180 16971 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029507.1 protein_id gnl|my_center|LOCUS_49400 18268 17042 gene locus_tag LOCUS_49410 gene mshC 18268 17042 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226760.1 protein_id gnl|my_center|LOCUS_49410 19194 18376 gene locus_tag LOCUS_49420 19194 18376 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729629.1 protein_id gnl|my_center|LOCUS_49420 19778 19191 gene locus_tag LOCUS_49430 19778 19191 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729630.1 protein_id gnl|my_center|LOCUS_49430 20616 19912 gene locus_tag LOCUS_49440 20616 19912 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226474.1 protein_id gnl|my_center|LOCUS_49440 21112 21711 gene locus_tag LOCUS_49450 21112 21711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49450 22647 21811 gene locus_tag LOCUS_49460 22647 21811 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086563.1 protein_id gnl|my_center|LOCUS_49460 23696 22644 gene locus_tag LOCUS_49470 23696 22644 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_49470 23895 24866 gene locus_tag LOCUS_49480 23895 24866 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977155.1 protein_id gnl|my_center|LOCUS_49480 24955 25146 gene locus_tag LOCUS_49490 24955 25146 CDS product DUF5703 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561940.1 protein_id gnl|my_center|LOCUS_49490 25894 25229 gene locus_tag LOCUS_49500 25894 25229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 27281 25953 gene locus_tag LOCUS_49510 27281 25953 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_49510 27440 28090 gene locus_tag LOCUS_49520 27440 28090 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971771.1 protein_id gnl|my_center|LOCUS_49520 28182 29195 gene locus_tag LOCUS_49530 28182 29195 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029804.1 protein_id gnl|my_center|LOCUS_49530 29216 29452 gene locus_tag LOCUS_49540 29216 29452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 29988 29638 gene locus_tag LOCUS_49550 29988 29638 CDS product DUF3140 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972181.1 protein_id gnl|my_center|LOCUS_49550 30158 29988 gene locus_tag LOCUS_49560 30158 29988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 32731 30176 gene locus_tag LOCUS_49570 32731 30176 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030897.1 protein_id gnl|my_center|LOCUS_49570 32844 33227 gene locus_tag LOCUS_49580 32844 33227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030597.1 protein_id gnl|my_center|LOCUS_49580 33940 34200 gene locus_tag LOCUS_49590 33940 34200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 34209 35249 gene locus_tag LOCUS_49600 34209 35249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 35266 37926 gene locus_tag LOCUS_49610 35266 37926 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230656.1 protein_id gnl|my_center|LOCUS_49610 37923 38588 gene locus_tag LOCUS_49620 37923 38588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 40024 38696 gene locus_tag LOCUS_49630 40024 38696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 40273 40034 gene locus_tag LOCUS_49640 40273 40034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 40387 41055 gene locus_tag LOCUS_49650 40387 41055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 42570 41137 gene locus_tag LOCUS_49660 42570 41137 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742107.1 protein_id gnl|my_center|LOCUS_49660 43153 42584 gene locus_tag LOCUS_49670 43153 42584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 44994 43150 gene locus_tag LOCUS_49680 44994 43150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 45350 45174 gene locus_tag LOCUS_49690 45350 45174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49690 46512 46084 gene locus_tag LOCUS_49700 46512 46084 CDS product DUF2267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930647.1 protein_id gnl|my_center|LOCUS_49700 47013 47927 gene locus_tag LOCUS_49710 47013 47927 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_49710 47920 48795 gene locus_tag LOCUS_49720 47920 48795 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182524933.1 protein_id gnl|my_center|LOCUS_49720 48792 49751 gene locus_tag LOCUS_49730 48792 49751 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_49730 49756 50466 gene locus_tag LOCUS_49740 49756 50466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 51180 50602 gene locus_tag LOCUS_49750 51180 50602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 51349 51591 gene locus_tag LOCUS_49760 51349 51591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 51657 51911 gene locus_tag LOCUS_49770 51657 51911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 52799 51924 gene locus_tag LOCUS_49780 52799 51924 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030936.1 protein_id gnl|my_center|LOCUS_49780 53248 52850 gene locus_tag LOCUS_49790 53248 52850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 54093 53455 gene locus_tag LOCUS_49800 54093 53455 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224090.1 protein_id gnl|my_center|LOCUS_49800 54757 54152 gene locus_tag LOCUS_49810 54757 54152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 55803 55117 gene locus_tag LOCUS_49820 55803 55117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 56347 55856 gene locus_tag LOCUS_49830 56347 55856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 56868 56407 gene locus_tag LOCUS_49840 56868 56407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 57379 56999 gene locus_tag LOCUS_49850 57379 56999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029512.1 protein_id gnl|my_center|LOCUS_49850 57449 57841 gene locus_tag LOCUS_49860 57449 57841 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325767.1 protein_id gnl|my_center|LOCUS_49860 57901 58824 gene locus_tag LOCUS_49870 57901 58824 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027021.1 protein_id gnl|my_center|LOCUS_49870 59552 59052 gene locus_tag LOCUS_49880 59552 59052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 60440 59700 gene locus_tag LOCUS_49890 60440 59700 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029394.1 protein_id gnl|my_center|LOCUS_49890 63043 60665 gene locus_tag LOCUS_49900 gene secA2 63043 60665 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223120.1 protein_id gnl|my_center|LOCUS_49900 64134 63046 gene locus_tag LOCUS_49910 64134 63046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49910 65155 64127 gene locus_tag LOCUS_49920 65155 64127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49920 65355 66368 gene locus_tag LOCUS_49930 65355 66368 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224650.1 protein_id gnl|my_center|LOCUS_49930 66582 67739 gene locus_tag LOCUS_49940 66582 67739 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 protein_id gnl|my_center|LOCUS_49940 67868 68332 gene locus_tag LOCUS_49950 67868 68332 CDS product DUF4383 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466936.1 protein_id gnl|my_center|LOCUS_49950 68421 69152 gene locus_tag LOCUS_49960 68421 69152 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225124.1 protein_id gnl|my_center|LOCUS_49960 69261 71264 gene locus_tag LOCUS_49970 gene ctaD 69261 71264 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229476.1 protein_id gnl|my_center|LOCUS_49970 72286 71315 gene locus_tag LOCUS_49980 72286 71315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49980 73921 72518 gene locus_tag LOCUS_49990 73921 72518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 74156 74377 gene locus_tag LOCUS_50000 74156 74377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 75534 74473 gene locus_tag LOCUS_50010 75534 74473 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027336.1 protein_id gnl|my_center|LOCUS_50010 77346 75586 gene locus_tag LOCUS_50020 77346 75586 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063840.1 protein_id gnl|my_center|LOCUS_50020 78463 77339 gene locus_tag LOCUS_50030 78463 77339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413610.1 protein_id gnl|my_center|LOCUS_50030 78632 79168 gene locus_tag LOCUS_50040 78632 79168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 80140 79256 gene locus_tag LOCUS_50050 80140 79256 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224885.1 protein_id gnl|my_center|LOCUS_50050 80381 81040 gene locus_tag LOCUS_50060 80381 81040 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974718.1 protein_id gnl|my_center|LOCUS_50060 81419 81081 gene locus_tag LOCUS_50070 81419 81081 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084656.1 protein_id gnl|my_center|LOCUS_50070 81602 83080 gene locus_tag LOCUS_50080 81602 83080 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031712.1 protein_id gnl|my_center|LOCUS_50080 84388 83162 gene locus_tag LOCUS_50090 84388 83162 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029495.1 protein_id gnl|my_center|LOCUS_50090 84487 85155 gene locus_tag LOCUS_50100 84487 85155 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974101.1 protein_id gnl|my_center|LOCUS_50100 85325 85783 gene locus_tag LOCUS_50110 85325 85783 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229282.1 protein_id gnl|my_center|LOCUS_50110 85783 85989 gene locus_tag LOCUS_50120 85783 85989 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229283.1 protein_id gnl|my_center|LOCUS_50120 87670 86015 gene locus_tag LOCUS_50130 87670 86015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50130 88865 87918 gene locus_tag LOCUS_50140 88865 87918 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225042.1 protein_id gnl|my_center|LOCUS_50140 88929 90086 gene locus_tag LOCUS_50150 88929 90086 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225041.1 protein_id gnl|my_center|LOCUS_50150 90247 90083 gene locus_tag LOCUS_50160 90247 90083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 90228 91079 gene locus_tag LOCUS_50170 90228 91079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 92364 91225 gene locus_tag LOCUS_50180 92364 91225 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227700.1 protein_id gnl|my_center|LOCUS_50180 92521 92351 gene locus_tag LOCUS_50190 92521 92351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 92879 93103 gene locus_tag LOCUS_50200 92879 93103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 93801 93166 gene locus_tag LOCUS_50210 93801 93166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 94980 97097 gene locus_tag LOCUS_50220 94980 97097 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804687.1 protein_id gnl|my_center|LOCUS_50220 98343 97111 gene locus_tag LOCUS_50230 98343 97111 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029184.1 protein_id gnl|my_center|LOCUS_50230 98456 98782 gene locus_tag LOCUS_50240 gene tnpA 98456 98782 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703865.1 protein_id gnl|my_center|LOCUS_50240 99452 98901 gene locus_tag LOCUS_50250 99452 98901 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031866.1 protein_id gnl|my_center|LOCUS_50250 100501 99827 gene locus_tag LOCUS_50260 100501 99827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222220.1 protein_id gnl|my_center|LOCUS_50260 100767 101642 gene locus_tag LOCUS_50270 100767 101642 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230390.1 protein_id gnl|my_center|LOCUS_50270 103407 101674 gene locus_tag LOCUS_50280 gene treZ 103407 101674 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224465.1 protein_id gnl|my_center|LOCUS_50280 105743 103404 gene locus_tag LOCUS_50290 gene treY 105743 103404 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030639.1 protein_id gnl|my_center|LOCUS_50290 107863 105746 gene locus_tag LOCUS_50300 gene glgX 107863 105746 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 protein_id gnl|my_center|LOCUS_50300 108168 107872 gene locus_tag LOCUS_50310 108168 107872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 108187 109584 gene locus_tag LOCUS_50320 108187 109584 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223543.1 protein_id gnl|my_center|LOCUS_50320 111337 109718 gene locus_tag LOCUS_50330 111337 109718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 112856 111573 gene locus_tag LOCUS_50340 112856 111573 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230153.1 protein_id gnl|my_center|LOCUS_50340 115191 113101 gene locus_tag LOCUS_50350 115191 113101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 116614 115184 gene locus_tag LOCUS_50360 gene noeA 116614 115184 CDS product nodulation protein NoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967406.1 protein_id gnl|my_center|LOCUS_50360 116779 116630 gene locus_tag LOCUS_50370 116779 116630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 116972 117370 gene locus_tag LOCUS_50380 116972 117370 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030668.1 protein_id gnl|my_center|LOCUS_50380 118126 117440 gene locus_tag LOCUS_50390 118126 117440 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030664.1 protein_id gnl|my_center|LOCUS_50390 119735 118227 gene locus_tag LOCUS_50400 119735 118227 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228517.1 protein_id gnl|my_center|LOCUS_50400 120459 119713 gene locus_tag LOCUS_50410 120459 119713 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863629.1 protein_id gnl|my_center|LOCUS_50410 120790 120566 gene locus_tag LOCUS_50420 120790 120566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 120979 121938 gene locus_tag LOCUS_50430 120979 121938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50430 122083 122508 gene locus_tag LOCUS_50440 122083 122508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 122888 123733 gene locus_tag LOCUS_50450 122888 123733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 124262 123789 gene locus_tag LOCUS_50460 124262 123789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 124851 124405 gene locus_tag LOCUS_50470 124851 124405 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229349.1 protein_id gnl|my_center|LOCUS_50470 125268 124921 gene locus_tag LOCUS_50480 125268 124921 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229185.1 protein_id gnl|my_center|LOCUS_50480 125767 125450 gene locus_tag LOCUS_50490 125767 125450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 125979 126632 gene locus_tag LOCUS_50500 125979 126632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50500 126808 127872 gene locus_tag LOCUS_50510 126808 127872 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225393.1 protein_id gnl|my_center|LOCUS_50510 129220 127934 gene locus_tag LOCUS_50520 129220 127934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 129889 129323 gene locus_tag LOCUS_50530 129889 129323 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030960.1 protein_id gnl|my_center|LOCUS_50530 131450 130293 gene locus_tag LOCUS_50540 131450 130293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50540 131963 131670 gene locus_tag LOCUS_50550 131963 131670 CDS product DUF6510 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729807.1 protein_id gnl|my_center|LOCUS_50550 132763 132029 gene locus_tag LOCUS_50560 132763 132029 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223384.1 protein_id gnl|my_center|LOCUS_50560 133371 132772 gene locus_tag LOCUS_50570 133371 132772 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223383.1 protein_id gnl|my_center|LOCUS_50570 134550 133531 gene locus_tag LOCUS_50580 134550 133531 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027421.1 protein_id gnl|my_center|LOCUS_50580 135227 134814 gene locus_tag LOCUS_50590 135227 134814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 135403 135672 gene locus_tag LOCUS_50600 135403 135672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 135693 136355 gene locus_tag LOCUS_50610 135693 136355 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079604.1 protein_id gnl|my_center|LOCUS_50610 137282 136578 gene locus_tag LOCUS_50620 137282 136578 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031342.1 protein_id gnl|my_center|LOCUS_50620 138283 137312 gene locus_tag LOCUS_50630 138283 137312 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027413.1 protein_id gnl|my_center|LOCUS_50630 139102 138503 gene locus_tag LOCUS_50640 139102 138503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 140286 139459 gene locus_tag LOCUS_50650 140286 139459 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897986.1 protein_id gnl|my_center|LOCUS_50650 142141 140414 gene locus_tag LOCUS_50660 142141 140414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50660 143028 142180 gene locus_tag LOCUS_50670 143028 142180 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031761.1 protein_id gnl|my_center|LOCUS_50670 144022 143135 gene locus_tag LOCUS_50680 144022 143135 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_50680 144407 144168 gene locus_tag LOCUS_50690 144407 144168 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028968.1 protein_id gnl|my_center|LOCUS_50690 144610 145323 gene locus_tag LOCUS_50700 144610 145323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 145821 145351 gene locus_tag LOCUS_50710 145821 145351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 145943 146455 gene locus_tag LOCUS_50720 145943 146455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 146485 147744 gene locus_tag LOCUS_50730 146485 147744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 153358 147857 gene locus_tag LOCUS_50740 153358 147857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 156474 153355 gene locus_tag LOCUS_50750 156474 153355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 156659 156471 gene locus_tag LOCUS_50760 156659 156471 CDS product MbtH family NRPS accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226625.1 protein_id gnl|my_center|LOCUS_50760 157612 156659 gene locus_tag LOCUS_50770 157612 156659 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113096.1 protein_id gnl|my_center|LOCUS_50770 163157 157641 gene locus_tag LOCUS_50780 163157 157641 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189716469.1 protein_id gnl|my_center|LOCUS_50780 166675 163157 gene locus_tag LOCUS_50790 166675 163157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 168981 166672 gene locus_tag LOCUS_50800 168981 166672 CDS product lantibiotic dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045694387.1 protein_id gnl|my_center|LOCUS_50800 172118 168978 gene locus_tag LOCUS_50810 172118 168978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 175699 172115 gene locus_tag LOCUS_50820 175699 172115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50820 176930 176310 gene locus_tag LOCUS_50830 176930 176310 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_50830 177195 176995 gene locus_tag LOCUS_50840 177195 176995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 177953 177186 gene locus_tag LOCUS_50850 177953 177186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 178165 178446 gene locus_tag LOCUS_50860 178165 178446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 178464 178736 gene locus_tag LOCUS_50870 178464 178736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 178736 178981 gene locus_tag LOCUS_50880 178736 178981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 179453 179028 gene locus_tag LOCUS_50890 179453 179028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 179503 180186 gene locus_tag LOCUS_50900 179503 180186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 180505 180296 gene locus_tag LOCUS_50910 180505 180296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 180728 181168 gene locus_tag LOCUS_50920 180728 181168 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026951.1 protein_id gnl|my_center|LOCUS_50920 181599 181225 gene locus_tag LOCUS_50930 181599 181225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 182493 182152 gene locus_tag LOCUS_50940 182493 182152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 182515 183288 gene locus_tag LOCUS_50950 182515 183288 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031856.1 protein_id gnl|my_center|LOCUS_50950 183479 183976 gene locus_tag LOCUS_50960 183479 183976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 184121 185650 gene locus_tag LOCUS_50970 184121 185650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 185965 186489 gene locus_tag LOCUS_50980 185965 186489 CDS product HAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028507.1 protein_id gnl|my_center|LOCUS_50980 187329 186604 gene locus_tag LOCUS_50990 187329 186604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 187700 187416 gene locus_tag LOCUS_51000 187700 187416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 187780 188067 gene locus_tag LOCUS_51010 187780 188067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 188652 188260 gene locus_tag LOCUS_51020 188652 188260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225797.1 protein_id gnl|my_center|LOCUS_51020 189421 188867 gene locus_tag LOCUS_51030 189421 188867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 190903 189425 gene locus_tag LOCUS_51040 190903 189425 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031701.1 protein_id gnl|my_center|LOCUS_51040 191718 190900 gene locus_tag LOCUS_51050 191718 190900 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031700.1 protein_id gnl|my_center|LOCUS_51050 192758 191721 gene locus_tag LOCUS_51060 192758 191721 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031699.1 protein_id gnl|my_center|LOCUS_51060 192877 194265 gene locus_tag LOCUS_51070 192877 194265 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031698.1 protein_id gnl|my_center|LOCUS_51070 194262 195230 gene locus_tag LOCUS_51080 194262 195230 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031697.1 protein_id gnl|my_center|LOCUS_51080 195230 196096 gene locus_tag LOCUS_51090 195230 196096 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971654.1 protein_id gnl|my_center|LOCUS_51090 196191 196925 gene locus_tag LOCUS_51100 196191 196925 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031806.1 protein_id gnl|my_center|LOCUS_51100 197044 197661 gene locus_tag LOCUS_51110 197044 197661 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079489.1 protein_id gnl|my_center|LOCUS_51110 199162 197783 gene locus_tag LOCUS_51120 gene eccB 199162 197783 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224123.1 protein_id gnl|my_center|LOCUS_51120 201019 199301 gene locus_tag LOCUS_51130 201019 199301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51130 201909 201016 gene locus_tag LOCUS_51140 201909 201016 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837952.1 protein_id gnl|my_center|LOCUS_51140 202044 203408 gene locus_tag LOCUS_51150 202044 203408 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029800.1 protein_id gnl|my_center|LOCUS_51150 203408 204049 gene locus_tag LOCUS_51160 203408 204049 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029801.1 protein_id gnl|my_center|LOCUS_51160 204576 204106 gene locus_tag LOCUS_51170 204576 204106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 204825 205592 gene locus_tag LOCUS_51180 204825 205592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 205583 205774 gene locus_tag LOCUS_51190 205583 205774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 206861 205977 gene locus_tag LOCUS_51200 206861 205977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51200 207215 207021 gene locus_tag LOCUS_51210 207215 207021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 207112 208176 gene locus_tag LOCUS_51220 207112 208176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51220 208747 214209 gene locus_tag LOCUS_51230 208747 214209 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226015.1 protein_id gnl|my_center|LOCUS_51230 214334 214780 gene locus_tag LOCUS_51240 214334 214780 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228553.1 protein_id gnl|my_center|LOCUS_51240 214773 215141 gene locus_tag LOCUS_51250 214773 215141 CDS product DUF4180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403459.1 protein_id gnl|my_center|LOCUS_51250 217140 215311 gene locus_tag LOCUS_51260 217140 215311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 217892 217146 gene locus_tag LOCUS_51270 217892 217146 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173093.1 protein_id gnl|my_center|LOCUS_51270 218416 217889 gene locus_tag LOCUS_51280 218416 217889 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225030.1 protein_id gnl|my_center|LOCUS_51280 219969 218944 gene locus_tag LOCUS_51290 219969 218944 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978217.1 protein_id gnl|my_center|LOCUS_51290 220181 220894 gene locus_tag LOCUS_51300 220181 220894 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328012.1 protein_id gnl|my_center|LOCUS_51300 221038 221217 gene locus_tag LOCUS_51310 221038 221217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 221359 223041 gene locus_tag LOCUS_51320 221359 223041 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188700193.1 protein_id gnl|my_center|LOCUS_51320 223294 225426 gene locus_tag LOCUS_51330 223294 225426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51330 225536 226726 gene locus_tag LOCUS_51340 225536 226726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 226776 227969 gene locus_tag LOCUS_51350 226776 227969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 229907 228051 gene locus_tag LOCUS_51360 229907 228051 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227358.1 protein_id gnl|my_center|LOCUS_51360 231772 229904 gene locus_tag LOCUS_51370 231772 229904 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227357.1 protein_id gnl|my_center|LOCUS_51370 232962 231781 gene locus_tag LOCUS_51380 232962 231781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028517.1 protein_id gnl|my_center|LOCUS_51380 233055 233579 gene locus_tag LOCUS_51390 233055 233579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 233687 233998 gene locus_tag LOCUS_51400 233687 233998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51400 234001 235614 gene locus_tag LOCUS_51410 234001 235614 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528520.1 protein_id gnl|my_center|LOCUS_51410 236009 239131 gene locus_tag LOCUS_51420 gene ileS 236009 239131 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_51420 240196 239186 gene locus_tag LOCUS_51430 240196 239186 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225221.1 protein_id gnl|my_center|LOCUS_51430 241215 240193 gene locus_tag LOCUS_51440 241215 240193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 242322 241267 gene locus_tag LOCUS_51450 242322 241267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 243128 242319 gene locus_tag LOCUS_51460 243128 242319 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903881.1 protein_id gnl|my_center|LOCUS_51460 243304 244686 gene locus_tag LOCUS_51470 243304 244686 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224490.1 protein_id gnl|my_center|LOCUS_51470 246265 244673 gene locus_tag LOCUS_51480 246265 244673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51480 247164 246262 gene locus_tag LOCUS_51490 247164 246262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 247870 247157 gene locus_tag LOCUS_51500 247870 247157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51500 250282 248108 gene locus_tag LOCUS_51510 gene helR 250282 248108 CDS product RNA polymerase recycling motor ATPase HelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728199.1 protein_id gnl|my_center|LOCUS_51510 251314 252162 gene locus_tag LOCUS_51520 251314 252162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51520 252065 252649 gene locus_tag LOCUS_51530 252065 252649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 253878 252730 gene locus_tag LOCUS_51540 253878 252730 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191279629.1 protein_id gnl|my_center|LOCUS_51540 254984 253893 gene locus_tag LOCUS_51550 254984 253893 CDS product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950854.1 protein_id gnl|my_center|LOCUS_51550 255128 256300 gene locus_tag LOCUS_51560 255128 256300 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223659.1 protein_id gnl|my_center|LOCUS_51560 257514 256504 gene locus_tag LOCUS_51570 257514 256504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51570 258446 257589 gene locus_tag LOCUS_51580 258446 257589 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225013.1 protein_id gnl|my_center|LOCUS_51580 258672 259613 gene locus_tag LOCUS_51590 258672 259613 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225014.1 protein_id gnl|my_center|LOCUS_51590 259692 260732 gene locus_tag LOCUS_51600 259692 260732 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225015.1 protein_id gnl|my_center|LOCUS_51600 260729 261406 gene locus_tag LOCUS_51610 260729 261406 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225016.1 protein_id gnl|my_center|LOCUS_51610 262614 261517 gene locus_tag LOCUS_51620 gene aroF 262614 261517 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_51620 266230 262706 gene locus_tag LOCUS_51630 266230 262706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 266554 267783 gene locus_tag LOCUS_51640 266554 267783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 269467 268016 gene locus_tag LOCUS_51650 269467 268016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 270183 269587 gene locus_tag LOCUS_51660 270183 269587 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_51660 271658 270180 gene locus_tag LOCUS_51670 271658 270180 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224165.1 protein_id gnl|my_center|LOCUS_51670 273103 271694 gene locus_tag LOCUS_51680 273103 271694 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388548.1 protein_id gnl|my_center|LOCUS_51680 273333 274886 gene locus_tag LOCUS_51690 273333 274886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 275951 274968 gene locus_tag LOCUS_51700 275951 274968 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227929.1 protein_id gnl|my_center|LOCUS_51700 276137 277687 gene locus_tag LOCUS_51710 276137 277687 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063688.1 protein_id gnl|my_center|LOCUS_51710 278760 277834 gene locus_tag LOCUS_51720 278760 277834 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200823401.1 protein_id gnl|my_center|LOCUS_51720 280329 278971 gene locus_tag LOCUS_51730 280329 278971 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894330.1 protein_id gnl|my_center|LOCUS_51730 279748 279649 gene locus_tag LOCUS_t00620 279748 279649 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 282305 280326 gene locus_tag LOCUS_51740 282305 280326 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226499.1 protein_id gnl|my_center|LOCUS_51740 283354 282485 gene locus_tag LOCUS_51750 283354 282485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 289287 283465 gene locus_tag LOCUS_51760 289287 283465 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182288448.1 protein_id gnl|my_center|LOCUS_51760 289533 290342 gene locus_tag LOCUS_51770 289533 290342 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083661.1 protein_id gnl|my_center|LOCUS_51770 291236 290475 gene locus_tag LOCUS_51780 291236 290475 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525108.1 protein_id gnl|my_center|LOCUS_51780 291916 291233 gene locus_tag LOCUS_51790 291916 291233 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966771.1 protein_id gnl|my_center|LOCUS_51790 293369 291990 gene locus_tag LOCUS_51800 293369 291990 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035930.1 protein_id gnl|my_center|LOCUS_51800 297379 293372 gene locus_tag LOCUS_51810 297379 293372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51810 297500 297655 gene locus_tag LOCUS_51820 297500 297655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 297685 298008 gene locus_tag LOCUS_51830 297685 298008 CDS product CU044_2847 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227643.1 protein_id gnl|my_center|LOCUS_51830 302136 298153 gene locus_tag LOCUS_51840 302136 298153 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027111.1 protein_id gnl|my_center|LOCUS_51840 302135 303304 gene locus_tag LOCUS_51850 302135 303304 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027112.1 protein_id gnl|my_center|LOCUS_51850 303773 303345 gene locus_tag LOCUS_51860 303773 303345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 305204 303918 gene locus_tag LOCUS_51870 305204 303918 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084531.1 protein_id gnl|my_center|LOCUS_51870 309085 305420 gene locus_tag LOCUS_51880 309085 305420 CDS product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226454.1 protein_id gnl|my_center|LOCUS_51880 312106 309212 gene locus_tag LOCUS_51890 312106 309212 CDS product glycosyl hydrolase family 28-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228676.1 protein_id gnl|my_center|LOCUS_51890 313973 312288 gene locus_tag LOCUS_51900 313973 312288 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228685.1 protein_id gnl|my_center|LOCUS_51900 315023 314136 gene locus_tag LOCUS_51910 315023 314136 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972133.1 protein_id gnl|my_center|LOCUS_51910 315994 315038 gene locus_tag LOCUS_51920 315994 315038 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_51920 317456 316077 gene locus_tag LOCUS_51930 317456 316077 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972131.1 protein_id gnl|my_center|LOCUS_51930 318992 317991 gene locus_tag LOCUS_51940 318992 317991 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 protein_id gnl|my_center|LOCUS_51940 319672 319115 gene locus_tag LOCUS_51950 319672 319115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 320143 319733 gene locus_tag LOCUS_51960 320143 319733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 320761 320255 gene locus_tag LOCUS_51970 320761 320255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 321206 322279 gene locus_tag LOCUS_51980 321206 322279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51980 322368 323129 gene locus_tag LOCUS_51990 322368 323129 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227682.1 protein_id gnl|my_center|LOCUS_51990 324132 325484 gene locus_tag LOCUS_52000 324132 325484 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928935.1 protein_id gnl|my_center|LOCUS_52000 326281 325541 gene locus_tag LOCUS_52010 326281 325541 CDS product myo-inositol degradation transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030772.1 protein_id gnl|my_center|LOCUS_52010 326454 327497 gene locus_tag LOCUS_52020 326454 327497 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742135.1 protein_id gnl|my_center|LOCUS_52020 327494 328363 gene locus_tag LOCUS_52030 327494 328363 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729986.1 protein_id gnl|my_center|LOCUS_52030 328360 329313 gene locus_tag LOCUS_52040 gene iolC 328360 329313 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972167.1 protein_id gnl|my_center|LOCUS_52040 329366 330175 gene locus_tag LOCUS_52050 329366 330175 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896035.1 protein_id gnl|my_center|LOCUS_52050 330238 331032 gene locus_tag LOCUS_52060 gene iolB 330238 331032 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031348.1 protein_id gnl|my_center|LOCUS_52060 331041 332906 gene locus_tag LOCUS_52070 gene iolD 331041 332906 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_52070 332903 333862 gene locus_tag LOCUS_52080 332903 333862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 333859 334512 gene locus_tag LOCUS_52090 333859 334512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 334654 335844 gene locus_tag LOCUS_52100 334654 335844 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243488.1 protein_id gnl|my_center|LOCUS_52100 335918 337771 gene locus_tag LOCUS_52110 335918 337771 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969594.1 protein_id gnl|my_center|LOCUS_52110 337774 338949 gene locus_tag LOCUS_52120 337774 338949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969593.1 protein_id gnl|my_center|LOCUS_52120 338946 339734 gene locus_tag LOCUS_52130 338946 339734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52130 339731 340576 gene locus_tag LOCUS_52140 339731 340576 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975071.1 protein_id gnl|my_center|LOCUS_52140 340573 341421 gene locus_tag LOCUS_52150 340573 341421 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480161.1 protein_id gnl|my_center|LOCUS_52150 341430 342122 gene locus_tag LOCUS_52160 341430 342122 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_52160 342187 343671 gene locus_tag LOCUS_52170 342187 343671 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224909.1 protein_id gnl|my_center|LOCUS_52170 344568 343723 gene locus_tag LOCUS_52180 344568 343723 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036588.1 protein_id gnl|my_center|LOCUS_52180 344692 345693 gene locus_tag LOCUS_52190 344692 345693 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787724.1 protein_id gnl|my_center|LOCUS_52190 345690 346499 gene locus_tag LOCUS_52200 345690 346499 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926652.1 protein_id gnl|my_center|LOCUS_52200 346489 347478 gene locus_tag LOCUS_52210 gene fepD 346489 347478 CDS product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817185.1 protein_id gnl|my_center|LOCUS_52210 347484 348497 gene locus_tag LOCUS_52220 gene fepG 347484 348497 CDS product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817186.1 protein_id gnl|my_center|LOCUS_52220 348490 349266 gene locus_tag LOCUS_52230 348490 349266 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093530.1 protein_id gnl|my_center|LOCUS_52230 349927 349598 gene locus_tag LOCUS_52240 349927 349598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52240 349869 350081 gene locus_tag LOCUS_52250 349869 350081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 350318 351025 gene locus_tag LOCUS_52260 350318 351025 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_52260 353005 351053 gene locus_tag LOCUS_52270 353005 351053 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226857.1 protein_id gnl|my_center|LOCUS_52270 354708 353002 gene locus_tag LOCUS_52280 354708 353002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891342.1 protein_id gnl|my_center|LOCUS_52280 353921 353831 gene locus_tag LOCUS_t00630 353921 353831 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 355889 354834 gene locus_tag LOCUS_52290 355889 354834 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_52290 356107 357330 gene locus_tag LOCUS_52300 356107 357330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 357067 357076 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 357562 358122 gene locus_tag LOCUS_52310 357562 358122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 358824 358147 gene locus_tag LOCUS_52320 358824 358147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 359029 360645 gene locus_tag LOCUS_52330 359029 360645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 361619 362470 gene locus_tag LOCUS_52340 361619 362470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 362976 362389 gene locus_tag LOCUS_52350 362976 362389 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975857.1 protein_id gnl|my_center|LOCUS_52350 377270 363048 gene locus_tag LOCUS_52360 377270 363048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 378631 377660 gene locus_tag LOCUS_52370 378631 377660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52370 379887 378733 gene locus_tag LOCUS_52380 379887 378733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52380 380350 380054 gene locus_tag LOCUS_52390 380350 380054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 381260 380394 gene locus_tag LOCUS_52400 381260 380394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52400 383086 381257 gene locus_tag LOCUS_52410 383086 381257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52410 386447 383115 gene locus_tag LOCUS_52420 386447 383115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52420 386956 386444 gene locus_tag LOCUS_52430 386956 386444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 388850 386961 gene locus_tag LOCUS_52440 388850 386961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52440 389252 388902 gene locus_tag LOCUS_52450 389252 388902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 391158 389293 gene locus_tag LOCUS_52460 391158 389293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 392285 391155 gene locus_tag LOCUS_52470 392285 391155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52470 392765 392373 gene locus_tag LOCUS_52480 392765 392373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 393141 392839 gene locus_tag LOCUS_52490 393141 392839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 393484 393185 gene locus_tag LOCUS_52500 393484 393185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 395019 393574 gene locus_tag LOCUS_52510 gene eccB 395019 393574 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892036.1 protein_id gnl|my_center|LOCUS_52510 396457 395081 gene locus_tag LOCUS_52520 gene eccD 396457 395081 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224120.1 protein_id gnl|my_center|LOCUS_52520 400467 396454 gene locus_tag LOCUS_52530 400467 396454 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224114.1 protein_id gnl|my_center|LOCUS_52530 401702 400464 gene locus_tag LOCUS_52540 gene mycP 401702 400464 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030414.1 protein_id gnl|my_center|LOCUS_52540 404530 401780 gene locus_tag LOCUS_52550 404530 401780 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030729.1 protein_id gnl|my_center|LOCUS_52550 405781 404639 gene locus_tag LOCUS_52560 405781 404639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968139.1 protein_id gnl|my_center|LOCUS_52560 407526 405778 gene locus_tag LOCUS_52570 407526 405778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 408593 407523 gene locus_tag LOCUS_52580 408593 407523 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784324.1 protein_id gnl|my_center|LOCUS_52580 409453 408707 gene locus_tag LOCUS_52590 409453 408707 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_52590 410256 409450 gene locus_tag LOCUS_52600 410256 409450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 412247 410637 gene locus_tag LOCUS_52610 412247 410637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 413985 412321 gene locus_tag LOCUS_52620 413985 412321 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878169.1 protein_id gnl|my_center|LOCUS_52620 417306 414100 gene locus_tag LOCUS_52630 417306 414100 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224566.1 protein_id gnl|my_center|LOCUS_52630 419387 417345 gene locus_tag LOCUS_52640 419387 417345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 421376 419616 gene locus_tag LOCUS_52650 421376 419616 CDS product substrate-binding and VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222107.1 protein_id gnl|my_center|LOCUS_52650 422309 421743 gene locus_tag LOCUS_52660 422309 421743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52660 423918 422518 gene locus_tag LOCUS_52670 423918 422518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 424420 427122 gene locus_tag LOCUS_52680 424420 427122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 427119 428060 gene locus_tag LOCUS_52690 427119 428060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 428057 429220 gene locus_tag LOCUS_52700 428057 429220 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790914.1 protein_id gnl|my_center|LOCUS_52700 429217 430899 gene locus_tag LOCUS_52710 429217 430899 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230735.1 protein_id gnl|my_center|LOCUS_52710 430941 431738 gene locus_tag LOCUS_52720 430941 431738 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230734.1 protein_id gnl|my_center|LOCUS_52720 434798 431712 gene locus_tag LOCUS_52730 434798 431712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 435172 435846 gene locus_tag LOCUS_52740 435172 435846 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180345.1 protein_id gnl|my_center|LOCUS_52740 438353 435906 gene locus_tag LOCUS_52750 438353 435906 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189955129.1 protein_id gnl|my_center|LOCUS_52750 439542 438346 gene locus_tag LOCUS_52760 439542 438346 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189955127.1 protein_id gnl|my_center|LOCUS_52760 439794 440165 gene locus_tag LOCUS_52770 439794 440165 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112711.1 protein_id gnl|my_center|LOCUS_52770 440590 440081 gene locus_tag LOCUS_52780 440590 440081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 440659 440922 gene locus_tag LOCUS_52790 440659 440922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 441772 441017 gene locus_tag LOCUS_52800 441772 441017 CDS product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779966.1 protein_id gnl|my_center|LOCUS_52800 442155 442003 gene locus_tag LOCUS_52810 442155 442003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52810 442964 442152 gene locus_tag LOCUS_52820 442964 442152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52820 443217 446885 gene locus_tag LOCUS_52830 443217 446885 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972444.1 protein_id gnl|my_center|LOCUS_52830 446885 448582 gene locus_tag LOCUS_52840 gene narH 446885 448582 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730341.1 protein_id gnl|my_center|LOCUS_52840 448579 449199 gene locus_tag LOCUS_52850 448579 449199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52850 449255 450016 gene locus_tag LOCUS_52860 gene narI 449255 450016 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030993.1 protein_id gnl|my_center|LOCUS_52860 450013 450258 gene locus_tag LOCUS_52870 450013 450258 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083281.1 protein_id gnl|my_center|LOCUS_52870 450287 450538 gene locus_tag LOCUS_52880 450287 450538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52880 450535 451728 gene locus_tag LOCUS_52890 450535 451728 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029253.1 protein_id gnl|my_center|LOCUS_52890 451895 453154 gene locus_tag LOCUS_52900 451895 453154 CDS product NarK/NasA family nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026930.1 protein_id gnl|my_center|LOCUS_52900 453194 454042 gene locus_tag LOCUS_52910 453194 454042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113786.1 protein_id gnl|my_center|LOCUS_52910 454860 454162 gene locus_tag LOCUS_52920 454860 454162 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227981.1 protein_id gnl|my_center|LOCUS_52920 455901 454918 gene locus_tag LOCUS_52930 455901 454918 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_52930 456014 456730 gene locus_tag LOCUS_52940 456014 456730 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229251.1 protein_id gnl|my_center|LOCUS_52940 456803 457510 gene locus_tag LOCUS_52950 456803 457510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730804.1 protein_id gnl|my_center|LOCUS_52950 457834 458181 gene locus_tag LOCUS_52960 457834 458181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 459125 458142 gene locus_tag LOCUS_52970 459125 458142 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225244.1 protein_id gnl|my_center|LOCUS_52970 460114 459122 gene locus_tag LOCUS_52980 460114 459122 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950910.1 protein_id gnl|my_center|LOCUS_52980 461274 460141 gene locus_tag LOCUS_52990 461274 460141 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_52990 461889 461275 gene locus_tag LOCUS_53000 461889 461275 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225235.1 protein_id gnl|my_center|LOCUS_53000 461777 461992 gene locus_tag LOCUS_53010 461777 461992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53010 463200 462067 gene locus_tag LOCUS_53020 463200 462067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 463983 463324 gene locus_tag LOCUS_53030 463983 463324 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974575.1 protein_id gnl|my_center|LOCUS_53030 464183 465388 gene locus_tag LOCUS_53040 464183 465388 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_53040 465404 465598 gene locus_tag LOCUS_53050 465404 465598 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228784.1 protein_id gnl|my_center|LOCUS_53050 466149 466496 gene locus_tag LOCUS_53060 466149 466496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 466415 466594 gene locus_tag LOCUS_53070 466415 466594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 466703 468163 gene locus_tag LOCUS_53080 466703 468163 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977903.1 protein_id gnl|my_center|LOCUS_53080 468299 469048 gene locus_tag LOCUS_53090 468299 469048 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972206.1 protein_id gnl|my_center|LOCUS_53090 470170 469034 gene locus_tag LOCUS_53100 470170 469034 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413981.1 protein_id gnl|my_center|LOCUS_53100 471170 470199 gene locus_tag LOCUS_53110 471170 470199 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031181.1 protein_id gnl|my_center|LOCUS_53110 472384 471227 gene locus_tag LOCUS_53120 472384 471227 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031139.1 protein_id gnl|my_center|LOCUS_53120 473202 472381 gene locus_tag LOCUS_53130 473202 472381 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083381.1 protein_id gnl|my_center|LOCUS_53130 473289 473927 gene locus_tag LOCUS_53140 473289 473927 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063765.1 protein_id gnl|my_center|LOCUS_53140 475419 473929 gene locus_tag LOCUS_53150 475419 473929 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_53150 475494 476645 gene locus_tag LOCUS_53160 475494 476645 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064757.1 protein_id gnl|my_center|LOCUS_53160 476859 478805 gene locus_tag LOCUS_53170 476859 478805 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618845.1 protein_id gnl|my_center|LOCUS_53170 480958 478811 gene locus_tag LOCUS_53180 480958 478811 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031184.1 protein_id gnl|my_center|LOCUS_53180 482183 480969 gene locus_tag LOCUS_53190 482183 480969 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031183.1 protein_id gnl|my_center|LOCUS_53190 482365 483564 gene locus_tag LOCUS_53200 482365 483564 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229637.1 protein_id gnl|my_center|LOCUS_53200 483672 484835 gene locus_tag LOCUS_53210 483672 484835 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031177.1 protein_id gnl|my_center|LOCUS_53210 486067 484850 gene locus_tag LOCUS_53220 486067 484850 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972218.1 protein_id gnl|my_center|LOCUS_53220 487309 486215 gene locus_tag LOCUS_53230 487309 486215 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031178.1 protein_id gnl|my_center|LOCUS_53230 487804 487334 gene locus_tag LOCUS_53240 487804 487334 CDS product DUF4334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972215.1 protein_id gnl|my_center|LOCUS_53240 487885 488766 gene locus_tag LOCUS_53250 487885 488766 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 protein_id gnl|my_center|LOCUS_53250 490681 488828 gene locus_tag LOCUS_53260 490681 488828 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229431.1 protein_id gnl|my_center|LOCUS_53260 491854 491087 gene locus_tag LOCUS_53270 491854 491087 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228886.1 protein_id gnl|my_center|LOCUS_53270 493306 492122 gene locus_tag LOCUS_53280 493306 492122 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_53280 493634 494857 gene locus_tag LOCUS_53290 493634 494857 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972218.1 protein_id gnl|my_center|LOCUS_53290 494984 495685 gene locus_tag LOCUS_53300 494984 495685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 496856 495699 gene locus_tag LOCUS_53310 496856 495699 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728068.1 protein_id gnl|my_center|LOCUS_53310 497247 496870 gene locus_tag LOCUS_53320 497247 496870 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929743.1 protein_id gnl|my_center|LOCUS_53320 498389 497244 gene locus_tag LOCUS_53330 498389 497244 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 protein_id gnl|my_center|LOCUS_53330 498829 498386 gene locus_tag LOCUS_53340 498829 498386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 499326 498826 gene locus_tag LOCUS_53350 499326 498826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 500558 499323 gene locus_tag LOCUS_53360 500558 499323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53360 501949 500555 gene locus_tag LOCUS_53370 501949 500555 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_53370 503259 501946 gene locus_tag LOCUS_53380 503259 501946 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_53380 504290 503256 gene locus_tag LOCUS_53390 504290 503256 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086613.1 protein_id gnl|my_center|LOCUS_53390 504841 504287 gene locus_tag LOCUS_53400 504841 504287 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903704.1 protein_id gnl|my_center|LOCUS_53400 506412 504841 gene locus_tag LOCUS_53410 506412 504841 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 protein_id gnl|my_center|LOCUS_53410 507235 506438 gene locus_tag LOCUS_53420 507235 506438 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933431.1 protein_id gnl|my_center|LOCUS_53420 507925 507275 gene locus_tag LOCUS_53430 507925 507275 CDS product N-carbamoylsarcosine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258125.1 protein_id gnl|my_center|LOCUS_53430 509120 507927 gene locus_tag LOCUS_53440 509120 507927 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265979.1 protein_id gnl|my_center|LOCUS_53440 509343 510209 gene locus_tag LOCUS_53450 509343 510209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 510489 511067 gene locus_tag LOCUS_53460 510489 511067 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258313.1 protein_id gnl|my_center|LOCUS_53460 511566 511258 gene locus_tag LOCUS_53470 511566 511258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 513038 511617 gene locus_tag LOCUS_53480 513038 511617 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 protein_id gnl|my_center|LOCUS_53480 513225 512968 gene locus_tag LOCUS_53490 513225 512968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53490 513152 514357 gene locus_tag LOCUS_53500 513152 514357 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041861981.1 protein_id gnl|my_center|LOCUS_53500 514358 515200 gene locus_tag LOCUS_53510 514358 515200 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729452.1 protein_id gnl|my_center|LOCUS_53510 515197 516666 gene locus_tag LOCUS_53520 515197 516666 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_53520 517564 516740 gene locus_tag LOCUS_53530 517564 516740 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028109.1 protein_id gnl|my_center|LOCUS_53530 517686 518393 gene locus_tag LOCUS_53540 517686 518393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53540 519229 518408 gene locus_tag LOCUS_53550 519229 518408 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233792.1 protein_id gnl|my_center|LOCUS_53550 519427 520380 gene locus_tag LOCUS_53560 519427 520380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53560 520386 521663 gene locus_tag LOCUS_53570 520386 521663 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389588.1 protein_id gnl|my_center|LOCUS_53570 521660 523180 gene locus_tag LOCUS_53580 gene hpaE 521660 523180 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085752.1 protein_id gnl|my_center|LOCUS_53580 523177 524130 gene locus_tag LOCUS_53590 gene prpB 523177 524130 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390073.1 protein_id gnl|my_center|LOCUS_53590 524130 525371 gene locus_tag LOCUS_53600 524130 525371 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727834.1 protein_id gnl|my_center|LOCUS_53600 525368 526837 gene locus_tag LOCUS_53610 525368 526837 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030921.1 protein_id gnl|my_center|LOCUS_53610 527233 526871 gene locus_tag LOCUS_53620 527233 526871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53620 527226 528866 gene locus_tag LOCUS_53630 527226 528866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113984430.1 protein_id gnl|my_center|LOCUS_53630 528870 529676 gene locus_tag LOCUS_53640 528870 529676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53640 529673 530647 gene locus_tag LOCUS_53650 529673 530647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53650 530654 531925 gene locus_tag LOCUS_53660 530654 531925 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530079.1 protein_id gnl|my_center|LOCUS_53660 531922 532644 gene locus_tag LOCUS_53670 531922 532644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 532637 533638 gene locus_tag LOCUS_53680 532637 533638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53680 533635 534459 gene locus_tag LOCUS_53690 533635 534459 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932815.1 protein_id gnl|my_center|LOCUS_53690 534479 535162 gene locus_tag LOCUS_53700 534479 535162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257318.1 protein_id gnl|my_center|LOCUS_53700 535159 535902 gene locus_tag LOCUS_53710 535159 535902 CDS product igiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895987.1 protein_id gnl|my_center|LOCUS_53710 538068 536704 gene locus_tag LOCUS_53720 538068 536704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 538871 538065 gene locus_tag LOCUS_53730 538871 538065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53730 541729 538868 gene locus_tag LOCUS_53740 541729 538868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53740 543792 541726 gene locus_tag LOCUS_53750 543792 541726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53750 545137 543779 gene locus_tag LOCUS_53760 545137 543779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53760 546327 545134 gene locus_tag LOCUS_53770 546327 545134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53770 547379 546324 gene locus_tag LOCUS_53780 547379 546324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 549074 547452 gene locus_tag LOCUS_53790 549074 547452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 549369 550187 gene locus_tag LOCUS_53800 549369 550187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 550360 550106 gene locus_tag LOCUS_53810 550360 550106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 552065 550644 gene locus_tag LOCUS_53820 552065 550644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 553092 552208 gene locus_tag LOCUS_53830 553092 552208 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 protein_id gnl|my_center|LOCUS_53830 553968 553186 gene locus_tag LOCUS_53840 gene map 553968 553186 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084151.1 protein_id gnl|my_center|LOCUS_53840 557186 554151 gene locus_tag LOCUS_53850 557186 554151 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_53850 557377 557847 gene locus_tag LOCUS_53860 557377 557847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 558288 558665 gene locus_tag LOCUS_53870 558288 558665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 559243 558746 gene locus_tag LOCUS_53880 559243 558746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 559800 560726 gene locus_tag LOCUS_53890 559800 560726 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674001.1 protein_id gnl|my_center|LOCUS_53890 560851 562035 gene locus_tag LOCUS_53900 560851 562035 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872865.1 protein_id gnl|my_center|LOCUS_53900 562179 562709 gene locus_tag LOCUS_53910 562179 562709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53910 563408 563653 gene locus_tag LOCUS_53920 563408 563653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 563711 564505 gene locus_tag LOCUS_53930 563711 564505 CDS product SCO2525 family SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976278.1 protein_id gnl|my_center|LOCUS_53930 565027 564515 gene locus_tag LOCUS_53940 565027 564515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229066.1 protein_id gnl|my_center|LOCUS_53940 566825 565017 gene locus_tag LOCUS_53950 566825 565017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 571049 566943 gene locus_tag LOCUS_53960 571049 566943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53960 571444 572400 gene locus_tag LOCUS_53970 571444 572400 CDS product SCO2521 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028403.1 protein_id gnl|my_center|LOCUS_53970 573376 572411 gene locus_tag LOCUS_53980 573376 572411 CDS product SCO2522 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485045.1 protein_id gnl|my_center|LOCUS_53980 574302 573373 gene locus_tag LOCUS_53990 574302 573373 CDS product SCO2523 family variant P-loop protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976280.1 protein_id gnl|my_center|LOCUS_53990 576141 574303 gene locus_tag LOCUS_54000 576141 574303 CDS product SCO2524 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028405.1 protein_id gnl|my_center|LOCUS_54000 576553 576795 gene locus_tag LOCUS_54010 576553 576795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54010 577353 576871 gene locus_tag LOCUS_54020 577353 576871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 577678 577358 gene locus_tag LOCUS_54030 577678 577358 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976901.1 protein_id gnl|my_center|LOCUS_54030 578406 577690 gene locus_tag LOCUS_54040 578406 577690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506001.1 protein_id gnl|my_center|LOCUS_54040 579194 578403 gene locus_tag LOCUS_54050 579194 578403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54050 580528 579194 gene locus_tag LOCUS_54060 580528 579194 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229564.1 protein_id gnl|my_center|LOCUS_54060 580959 581849 gene locus_tag LOCUS_54070 580959 581849 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055875.1 protein_id gnl|my_center|LOCUS_54070 581864 582961 gene locus_tag LOCUS_54080 581864 582961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 582910 584025 gene locus_tag LOCUS_54090 582910 584025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 584022 584861 gene locus_tag LOCUS_54100 584022 584861 CDS product 27-O-demethylrifamycin SV methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222580.1 protein_id gnl|my_center|LOCUS_54100 584997 585449 gene locus_tag LOCUS_54110 584997 585449 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222796.1 protein_id gnl|my_center|LOCUS_54110 585496 586545 gene locus_tag LOCUS_54120 585496 586545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 586538 589057 gene locus_tag LOCUS_54130 586538 589057 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227243.1 protein_id gnl|my_center|LOCUS_54130 589054 589641 gene locus_tag LOCUS_54140 589054 589641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 589634 590647 gene locus_tag LOCUS_54150 589634 590647 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_54150 590640 591515 gene locus_tag LOCUS_54160 590640 591515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 593172 592195 gene locus_tag LOCUS_54170 593172 592195 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227740.1 protein_id gnl|my_center|LOCUS_54170 594374 593169 gene locus_tag LOCUS_54180 594374 593169 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223772.1 protein_id gnl|my_center|LOCUS_54180 596113 594374 gene locus_tag LOCUS_54190 596113 594374 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223771.1 protein_id gnl|my_center|LOCUS_54190 598985 596553 gene locus_tag LOCUS_54200 598985 596553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54200 600200 599226 gene locus_tag LOCUS_54210 600200 599226 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866323.1 protein_id gnl|my_center|LOCUS_54210 601450 600197 gene locus_tag LOCUS_54220 601450 600197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018348088.1 protein_id gnl|my_center|LOCUS_54220 602306 601458 gene locus_tag LOCUS_54230 602306 601458 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223061.1 protein_id gnl|my_center|LOCUS_54230 603253 602303 gene locus_tag LOCUS_54240 603253 602303 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976142.1 protein_id gnl|my_center|LOCUS_54240 604584 603259 gene locus_tag LOCUS_54250 604584 603259 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223059.1 protein_id gnl|my_center|LOCUS_54250 605935 604745 gene locus_tag LOCUS_54260 605935 604745 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208195.1 protein_id gnl|my_center|LOCUS_54260 606255 607922 gene locus_tag LOCUS_54270 606255 607922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54270 608404 608916 gene locus_tag LOCUS_54280 608404 608916 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155369284.1 protein_id gnl|my_center|LOCUS_54280 608982 610106 gene locus_tag LOCUS_54290 608982 610106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54290 610085 610438 gene locus_tag LOCUS_54300 610085 610438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54300 614476 610397 gene locus_tag LOCUS_54310 614476 610397 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027111.1 protein_id gnl|my_center|LOCUS_54310 615063 615218 gene locus_tag LOCUS_54320 615063 615218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 615351 615920 gene locus_tag LOCUS_54330 615351 615920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54330 616581 616021 gene locus_tag LOCUS_54340 616581 616021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 616653 617258 gene locus_tag LOCUS_54350 616653 617258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 617359 617700 gene locus_tag LOCUS_54360 617359 617700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 617916 617674 gene locus_tag LOCUS_54370 617916 617674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 620456 617985 gene locus_tag LOCUS_54380 620456 617985 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167338154.1 protein_id gnl|my_center|LOCUS_54380 621214 620453 gene locus_tag LOCUS_54390 621214 620453 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225876.1 protein_id gnl|my_center|LOCUS_54390 621982 621326 gene locus_tag LOCUS_54400 621982 621326 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222406.1 protein_id gnl|my_center|LOCUS_54400 623196 621970 gene locus_tag LOCUS_54410 623196 621970 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029209.1 protein_id gnl|my_center|LOCUS_54410 623366 623596 gene locus_tag LOCUS_54420 623366 623596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 623927 624730 gene locus_tag LOCUS_54430 623927 624730 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728739.1 protein_id gnl|my_center|LOCUS_54430 625122 625736 gene locus_tag LOCUS_54440 625122 625736 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030557.1 protein_id gnl|my_center|LOCUS_54440 626785 626237 gene locus_tag LOCUS_54450 626785 626237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 627609 626782 gene locus_tag LOCUS_54460 627609 626782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 628508 627720 gene locus_tag LOCUS_54470 628508 627720 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178283.1 protein_id gnl|my_center|LOCUS_54470 630306 628855 gene locus_tag LOCUS_54480 630306 628855 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030556.1 protein_id gnl|my_center|LOCUS_54480 630689 631030 gene locus_tag LOCUS_54490 630689 631030 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729797.1 protein_id gnl|my_center|LOCUS_54490 631374 631090 gene locus_tag LOCUS_54500 631374 631090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54500 632815 631835 gene locus_tag LOCUS_54510 632815 631835 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538553.1 protein_id gnl|my_center|LOCUS_54510 632877 633857 gene locus_tag LOCUS_54520 632877 633857 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027744.1 protein_id gnl|my_center|LOCUS_54520 633922 634281 gene locus_tag LOCUS_54530 633922 634281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54530 634292 634771 gene locus_tag LOCUS_54540 634292 634771 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530895.1 protein_id gnl|my_center|LOCUS_54540 634916 636022 gene locus_tag LOCUS_54550 634916 636022 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222736.1 protein_id gnl|my_center|LOCUS_54550 636022 636150 gene locus_tag LOCUS_54560 636022 636150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54560 637054 636245 gene locus_tag LOCUS_54570 637054 636245 CDS product ISAs1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043791004.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54570 637951 637520 gene locus_tag LOCUS_54580 637951 637520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54580 638038 638880 gene locus_tag LOCUS_54590 638038 638880 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976615.1 protein_id gnl|my_center|LOCUS_54590 639431 639273 gene locus_tag LOCUS_54600 639431 639273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 639677 639432 gene locus_tag LOCUS_54610 639677 639432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 640223 640387 gene locus_tag LOCUS_54620 640223 640387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 640727 641155 gene locus_tag LOCUS_54630 640727 641155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029788.1 protein_id gnl|my_center|LOCUS_54630 641560 641261 gene locus_tag LOCUS_54640 641560 641261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54640 >Feature sequence34 5768 267 gene locus_tag LOCUS_54650 gene pulA 5768 267 CDS product pullulanase-type alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486784.1 protein_id gnl|my_center|LOCUS_54650 6635 5970 gene locus_tag LOCUS_54660 6635 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296444.1 protein_id gnl|my_center|LOCUS_54660 6672 6884 gene locus_tag LOCUS_54670 6672 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 7339 8001 gene locus_tag LOCUS_54680 7339 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54680 8751 8086 gene locus_tag LOCUS_54690 8751 8086 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413654.1 protein_id gnl|my_center|LOCUS_54690 9206 8850 gene locus_tag LOCUS_54700 9206 8850 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975682.1 protein_id gnl|my_center|LOCUS_54700 9381 12218 gene locus_tag LOCUS_54710 gene acnA 9381 12218 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_54710 12925 12317 gene locus_tag LOCUS_54720 12925 12317 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977427.1 protein_id gnl|my_center|LOCUS_54720 13292 12906 gene locus_tag LOCUS_54730 13292 12906 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977426.1 protein_id gnl|my_center|LOCUS_54730 13720 13298 gene locus_tag LOCUS_54740 13720 13298 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229428.1 protein_id gnl|my_center|LOCUS_54740 16385 13797 gene locus_tag LOCUS_54750 16385 13797 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027766.1 protein_id gnl|my_center|LOCUS_54750 18217 16484 gene locus_tag LOCUS_54760 18217 16484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533383.1 protein_id gnl|my_center|LOCUS_54760 19128 18214 gene locus_tag LOCUS_54770 19128 18214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 20504 19125 gene locus_tag LOCUS_54780 20504 19125 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289154.1 protein_id gnl|my_center|LOCUS_54780 21265 20666 gene locus_tag LOCUS_54790 21265 20666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54790 21460 21705 gene locus_tag LOCUS_54800 21460 21705 CDS product DUF2630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224533.1 protein_id gnl|my_center|LOCUS_54800 22429 21752 gene locus_tag LOCUS_54810 22429 21752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 23447 22494 gene locus_tag LOCUS_54820 23447 22494 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250866.1 protein_id gnl|my_center|LOCUS_54820 23497 24069 gene locus_tag LOCUS_54830 23497 24069 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226802.1 protein_id gnl|my_center|LOCUS_54830 24184 25095 gene locus_tag LOCUS_54840 24184 25095 CDS product TIGR04222 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224518.1 protein_id gnl|my_center|LOCUS_54840 25092 26045 gene locus_tag LOCUS_54850 25092 26045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54850 26042 26524 gene locus_tag LOCUS_54860 26042 26524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 26558 27319 gene locus_tag LOCUS_54870 26558 27319 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 protein_id gnl|my_center|LOCUS_54870 27319 28101 gene locus_tag LOCUS_54880 27319 28101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 30398 28419 gene locus_tag LOCUS_54890 30398 28419 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_54890 31340 30573 gene locus_tag LOCUS_54900 31340 30573 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 protein_id gnl|my_center|LOCUS_54900 31614 31387 gene locus_tag LOCUS_54910 31614 31387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54910 31826 32419 gene locus_tag LOCUS_54920 31826 32419 CDS product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485755.1 protein_id gnl|my_center|LOCUS_54920 34135 32531 gene locus_tag LOCUS_54930 34135 32531 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224728.1 protein_id gnl|my_center|LOCUS_54930 34365 35294 gene locus_tag LOCUS_54940 34365 35294 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222195.1 protein_id gnl|my_center|LOCUS_54940 35438 36733 gene locus_tag LOCUS_54950 35438 36733 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028203.1 protein_id gnl|my_center|LOCUS_54950 36733 37350 gene locus_tag LOCUS_54960 36733 37350 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028204.1 protein_id gnl|my_center|LOCUS_54960 37585 37337 gene locus_tag LOCUS_54970 37585 37337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 37479 38252 gene locus_tag LOCUS_54980 37479 38252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 39386 38259 gene locus_tag LOCUS_54990 39386 38259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54990 40931 39594 gene locus_tag LOCUS_55000 40931 39594 CDS product alpha-lytic protease prodomain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029803.1 protein_id gnl|my_center|LOCUS_55000 41123 42082 gene locus_tag LOCUS_55010 41123 42082 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229868.1 protein_id gnl|my_center|LOCUS_55010 42161 43003 gene locus_tag LOCUS_55020 42161 43003 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173129680.1 protein_id gnl|my_center|LOCUS_55020 44428 43112 gene locus_tag LOCUS_55030 44428 43112 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222947.1 protein_id gnl|my_center|LOCUS_55030 45750 44425 gene locus_tag LOCUS_55040 45750 44425 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848216.1 protein_id gnl|my_center|LOCUS_55040 46718 46092 gene locus_tag LOCUS_55050 46718 46092 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467104.1 protein_id gnl|my_center|LOCUS_55050 48267 47323 gene locus_tag LOCUS_55060 48267 47323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 49056 48451 gene locus_tag LOCUS_55070 49056 48451 CDS product acVLRF1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224727.1 protein_id gnl|my_center|LOCUS_55070 50296 49931 gene locus_tag LOCUS_55080 50296 49931 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224702.1 protein_id gnl|my_center|LOCUS_55080 50766 50293 gene locus_tag LOCUS_55090 50766 50293 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_55090 52070 50766 gene locus_tag LOCUS_55100 52070 50766 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 protein_id gnl|my_center|LOCUS_55100 52865 52092 gene locus_tag LOCUS_55110 gene sufC 52865 52092 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976897.1 protein_id gnl|my_center|LOCUS_55110 53212 52865 gene locus_tag LOCUS_55120 53212 52865 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_55120 54351 53209 gene locus_tag LOCUS_55130 gene sufD 54351 53209 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_55130 55878 54448 gene locus_tag LOCUS_55140 gene sufB 55878 54448 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_55140 56642 55875 gene locus_tag LOCUS_55150 56642 55875 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742174.1 protein_id gnl|my_center|LOCUS_55150 56757 57707 gene locus_tag LOCUS_55160 56757 57707 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_55160 58874 57951 gene locus_tag LOCUS_55170 58874 57951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_55170 59217 58882 gene locus_tag LOCUS_55180 59217 58882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55180 60466 59558 gene locus_tag LOCUS_55190 60466 59558 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224678.1 protein_id gnl|my_center|LOCUS_55190 60378 60719 gene locus_tag LOCUS_55200 60378 60719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55200 60779 62917 gene locus_tag LOCUS_55210 gene tkt 60779 62917 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022841.1 protein_id gnl|my_center|LOCUS_55210 62925 64112 gene locus_tag LOCUS_55220 gene tal 62925 64112 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224676.1 protein_id gnl|my_center|LOCUS_55220 64171 65835 gene locus_tag LOCUS_55230 64171 65835 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224675.1 protein_id gnl|my_center|LOCUS_55230 65874 67388 gene locus_tag LOCUS_55240 gene zwf 65874 67388 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031084.1 protein_id gnl|my_center|LOCUS_55240 67420 68436 gene locus_tag LOCUS_55250 gene opcA 67420 68436 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972335.1 protein_id gnl|my_center|LOCUS_55250 68551 69321 gene locus_tag LOCUS_55260 gene pgl 68551 69321 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_55260 69731 69387 gene locus_tag LOCUS_55270 69731 69387 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284344.1 protein_id gnl|my_center|LOCUS_55270 70128 69868 gene locus_tag LOCUS_55280 gene secG 70128 69868 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224669.1 protein_id gnl|my_center|LOCUS_55280 71015 70224 gene locus_tag LOCUS_55290 gene tpiA 71015 70224 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_55290 72295 71015 gene locus_tag LOCUS_55300 72295 71015 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028057.1 protein_id gnl|my_center|LOCUS_55300 73296 72292 gene locus_tag LOCUS_55310 gene gap 73296 72292 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_55310 74607 73627 gene locus_tag LOCUS_55320 gene whiA 74607 73627 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224649.1 protein_id gnl|my_center|LOCUS_55320 75642 74662 gene locus_tag LOCUS_55330 gene yvcK 75642 74662 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 protein_id gnl|my_center|LOCUS_55330 76574 75639 gene locus_tag LOCUS_55340 gene rapZ 76574 75639 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466867.1 protein_id gnl|my_center|LOCUS_55340 77141 78142 gene locus_tag LOCUS_55350 77141 78142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224152.1 protein_id gnl|my_center|LOCUS_55350 78381 79097 gene locus_tag LOCUS_55360 78381 79097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55360 80050 79151 gene locus_tag LOCUS_55370 80050 79151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55370 80565 80059 gene locus_tag LOCUS_55380 80565 80059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 80608 81111 gene locus_tag LOCUS_55390 80608 81111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 83154 81187 gene locus_tag LOCUS_55400 gene uvrC 83154 81187 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831611.1 protein_id gnl|my_center|LOCUS_55400 84510 83164 gene locus_tag LOCUS_55410 84510 83164 CDS product jacalin-like lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224244.1 protein_id gnl|my_center|LOCUS_55410 84744 87929 gene locus_tag LOCUS_55420 84744 87929 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742126.1 protein_id gnl|my_center|LOCUS_55420 88465 87980 gene locus_tag LOCUS_55430 88465 87980 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977470.1 protein_id gnl|my_center|LOCUS_55430 91632 88687 gene locus_tag LOCUS_55440 gene uvrA 91632 88687 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467399.1 protein_id gnl|my_center|LOCUS_55440 93035 91983 gene locus_tag LOCUS_55450 gene rsgA 93035 91983 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030687.1 protein_id gnl|my_center|LOCUS_55450 93214 93930 gene locus_tag LOCUS_55460 93214 93930 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028067.1 protein_id gnl|my_center|LOCUS_55460 93935 94588 gene locus_tag LOCUS_55470 93935 94588 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_55470 95356 94694 gene locus_tag LOCUS_55480 95356 94694 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972461.1 protein_id gnl|my_center|LOCUS_55480 95570 95773 gene locus_tag LOCUS_55490 95570 95773 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978336.1 protein_id gnl|my_center|LOCUS_55490 96741 95872 gene locus_tag LOCUS_55500 96741 95872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 97491 96976 gene locus_tag LOCUS_55510 97491 96976 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978019.1 protein_id gnl|my_center|LOCUS_55510 97664 99802 gene locus_tag LOCUS_55520 97664 99802 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876865.1 protein_id gnl|my_center|LOCUS_55520 99960 100343 gene locus_tag LOCUS_55530 99960 100343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 100388 102256 gene locus_tag LOCUS_55540 gene typA 100388 102256 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_55540 102357 103229 gene locus_tag LOCUS_55550 102357 103229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55550 104195 103398 gene locus_tag LOCUS_55560 104195 103398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 104239 105336 gene locus_tag LOCUS_55570 gene ykfB 104239 105336 CDS product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244980.1 protein_id gnl|my_center|LOCUS_55570 105388 106320 gene locus_tag LOCUS_55580 gene eepC 105388 106320 CDS product gamma-D-glutamyl-L-lysine dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245577.1 protein_id gnl|my_center|LOCUS_55580 107375 106383 gene locus_tag LOCUS_55590 107375 106383 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113122.1 protein_id gnl|my_center|LOCUS_55590 107909 108202 gene locus_tag LOCUS_55600 107909 108202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55600 109314 108376 gene locus_tag LOCUS_55610 109314 108376 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_55610 111656 109521 gene locus_tag LOCUS_55620 gene uvrB 111656 109521 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958334.1 protein_id gnl|my_center|LOCUS_55620 111902 113560 gene locus_tag LOCUS_55630 111902 113560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55630 114802 113630 gene locus_tag LOCUS_55640 gene coaE 114802 113630 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286284.1 protein_id gnl|my_center|LOCUS_55640 116473 114980 gene locus_tag LOCUS_55650 gene rpsA 116473 114980 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227916.1 protein_id gnl|my_center|LOCUS_55650 116863 117708 gene locus_tag LOCUS_55660 116863 117708 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_55660 117712 118368 gene locus_tag LOCUS_55670 117712 118368 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227463.1 protein_id gnl|my_center|LOCUS_55670 118411 118629 gene locus_tag LOCUS_55680 118411 118629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55680 118616 118963 gene locus_tag LOCUS_55690 118616 118963 CDS product DUF3140 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978015.1 protein_id gnl|my_center|LOCUS_55690 121743 119080 gene locus_tag LOCUS_55700 gene polA 121743 119080 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111138.1 protein_id gnl|my_center|LOCUS_55700 122657 121947 gene locus_tag LOCUS_55710 122657 121947 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728924.1 protein_id gnl|my_center|LOCUS_55710 123567 122647 gene locus_tag LOCUS_55720 123567 122647 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728923.1 protein_id gnl|my_center|LOCUS_55720 124714 123560 gene locus_tag LOCUS_55730 124714 123560 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075840.1 protein_id gnl|my_center|LOCUS_55730 125661 124711 gene locus_tag LOCUS_55740 125661 124711 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728922.1 protein_id gnl|my_center|LOCUS_55740 126922 125756 gene locus_tag LOCUS_55750 126922 125756 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111150.1 protein_id gnl|my_center|LOCUS_55750 128415 127189 gene locus_tag LOCUS_55760 128415 127189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55760 129210 128560 gene locus_tag LOCUS_55770 129210 128560 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227937.1 protein_id gnl|my_center|LOCUS_55770 129273 129347 gene locus_tag LOCUS_t00640 129273 129347 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 129382 130131 gene locus_tag LOCUS_55780 129382 130131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55780 131370 130174 gene locus_tag LOCUS_55790 131370 130174 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027702.1 protein_id gnl|my_center|LOCUS_55790 131436 131915 gene locus_tag LOCUS_55800 131436 131915 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081784.1 protein_id gnl|my_center|LOCUS_55800 131971 132981 gene locus_tag LOCUS_55810 131971 132981 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223676.1 protein_id gnl|my_center|LOCUS_55810 135445 133184 gene locus_tag LOCUS_55820 135445 133184 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030997.1 protein_id gnl|my_center|LOCUS_55820 135702 137138 gene locus_tag LOCUS_55830 135702 137138 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_55830 138188 137229 gene locus_tag LOCUS_55840 138188 137229 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729296.1 protein_id gnl|my_center|LOCUS_55840 138841 138371 gene locus_tag LOCUS_55850 138841 138371 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406624.1 protein_id gnl|my_center|LOCUS_55850 139048 140382 gene locus_tag LOCUS_55860 139048 140382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55860 140407 142167 gene locus_tag LOCUS_55870 140407 142167 CDS product substrate-binding and VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222107.1 protein_id gnl|my_center|LOCUS_55870 143049 142168 gene locus_tag LOCUS_55880 143049 142168 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_55880 144494 143046 gene locus_tag LOCUS_55890 gene pyk 144494 143046 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728910.1 protein_id gnl|my_center|LOCUS_55890 145132 144767 gene locus_tag LOCUS_55900 145132 144767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55900 145307 146932 gene locus_tag LOCUS_55910 145307 146932 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727011.1 protein_id gnl|my_center|LOCUS_55910 147178 147687 gene locus_tag LOCUS_55920 147178 147687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55920 147838 148710 gene locus_tag LOCUS_55930 147838 148710 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 protein_id gnl|my_center|LOCUS_55930 149201 148776 gene locus_tag LOCUS_55940 149201 148776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55940 151432 149216 gene locus_tag LOCUS_55950 151432 149216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55950 152050 151742 gene locus_tag LOCUS_55960 152050 151742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 152265 152047 gene locus_tag LOCUS_55970 152265 152047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55970 152450 152262 gene locus_tag LOCUS_55980 152450 152262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55980 152531 152746 gene locus_tag LOCUS_55990 152531 152746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55990 152870 153412 gene locus_tag LOCUS_56000 152870 153412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56000 154027 153566 gene locus_tag LOCUS_56010 154027 153566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 155112 154195 gene locus_tag LOCUS_56020 155112 154195 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227049.1 protein_id gnl|my_center|LOCUS_56020 155350 156309 gene locus_tag LOCUS_56030 155350 156309 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224549.1 protein_id gnl|my_center|LOCUS_56030 157158 156328 gene locus_tag LOCUS_56040 157158 156328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56040 159686 157161 gene locus_tag LOCUS_56050 159686 157161 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112141171.1 protein_id gnl|my_center|LOCUS_56050 160625 159825 gene locus_tag LOCUS_56060 160625 159825 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_56060 160826 162370 gene locus_tag LOCUS_56070 160826 162370 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854953.1 protein_id gnl|my_center|LOCUS_56070 162759 162445 gene locus_tag LOCUS_56080 162759 162445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56080 162740 163519 gene locus_tag LOCUS_56090 162740 163519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56090 165726 164218 gene locus_tag LOCUS_56100 165726 164218 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728909.1 protein_id gnl|my_center|LOCUS_56100 170413 165719 gene locus_tag LOCUS_56110 gene gltB 170413 165719 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_56110 170559 171410 gene locus_tag LOCUS_56120 170559 171410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56120 172713 171526 gene locus_tag LOCUS_56130 172713 171526 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896017.1 protein_id gnl|my_center|LOCUS_56130 173959 172730 gene locus_tag LOCUS_56140 173959 172730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56140 174823 174020 gene locus_tag LOCUS_56150 gene trpA 174823 174020 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407999.1 protein_id gnl|my_center|LOCUS_56150 176063 174828 gene locus_tag LOCUS_56160 gene trpB 176063 174828 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728904.1 protein_id gnl|my_center|LOCUS_56160 176967 176104 gene locus_tag LOCUS_56170 gene trpC 176967 176104 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057938.1 protein_id gnl|my_center|LOCUS_56170 177425 177688 gene locus_tag LOCUS_56180 177425 177688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 178325 177696 gene locus_tag LOCUS_56190 178325 177696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 179875 178322 gene locus_tag LOCUS_56200 179875 178322 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224165.1 protein_id gnl|my_center|LOCUS_56200 181212 179872 gene locus_tag LOCUS_56210 181212 179872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56210 182291 181302 gene locus_tag LOCUS_56220 182291 181302 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_56220 182704 182303 gene locus_tag LOCUS_56230 182704 182303 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087349.1 protein_id gnl|my_center|LOCUS_56230 182811 183593 gene locus_tag LOCUS_56240 182811 183593 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895205.1 protein_id gnl|my_center|LOCUS_56240 183590 184345 gene locus_tag LOCUS_56250 183590 184345 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139544.1 protein_id gnl|my_center|LOCUS_56250 184382 184975 gene locus_tag LOCUS_56260 184382 184975 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 protein_id gnl|my_center|LOCUS_56260 185836 185066 gene locus_tag LOCUS_56270 185836 185066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 187719 185932 gene locus_tag LOCUS_56280 187719 185932 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776699.1 protein_id gnl|my_center|LOCUS_56280 189622 187772 gene locus_tag LOCUS_56290 189622 187772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776700.1 protein_id gnl|my_center|LOCUS_56290 189796 190425 gene locus_tag LOCUS_56300 189796 190425 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_56300 190568 192394 gene locus_tag LOCUS_56310 190568 192394 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485037.1 protein_id gnl|my_center|LOCUS_56310 193793 192453 gene locus_tag LOCUS_56320 193793 192453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56320 195370 193907 gene locus_tag LOCUS_56330 195370 193907 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977408.1 protein_id gnl|my_center|LOCUS_56330 195424 196113 gene locus_tag LOCUS_56340 195424 196113 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027777.1 protein_id gnl|my_center|LOCUS_56340 196182 196643 gene locus_tag LOCUS_56350 196182 196643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56350 197446 196679 gene locus_tag LOCUS_56360 gene hisF 197446 196679 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976768.1 protein_id gnl|my_center|LOCUS_56360 198620 197622 gene locus_tag LOCUS_56370 198620 197622 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976409.1 protein_id gnl|my_center|LOCUS_56370 199097 198666 gene locus_tag LOCUS_56380 199097 198666 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063604.1 protein_id gnl|my_center|LOCUS_56380 199578 199099 gene locus_tag LOCUS_56390 199578 199099 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028699.1 protein_id gnl|my_center|LOCUS_56390 200024 199635 gene locus_tag LOCUS_56400 200024 199635 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_56400 200746 200021 gene locus_tag LOCUS_56410 gene priA 200746 200021 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466797.1 protein_id gnl|my_center|LOCUS_56410 201102 200779 gene locus_tag LOCUS_56420 201102 200779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56420 201813 201178 gene locus_tag LOCUS_56430 gene hisH 201813 201178 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894597.1 protein_id gnl|my_center|LOCUS_56430 202143 201970 gene locus_tag LOCUS_56440 202143 201970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56440 202783 202172 gene locus_tag LOCUS_56450 gene hisB 202783 202172 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 protein_id gnl|my_center|LOCUS_56450 203880 202780 gene locus_tag LOCUS_56460 203880 202780 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976762.1 protein_id gnl|my_center|LOCUS_56460 205094 203877 gene locus_tag LOCUS_56470 gene hisD 205094 203877 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224127.1 protein_id gnl|my_center|LOCUS_56470 205074 205319 gene locus_tag LOCUS_56480 205074 205319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56480 205316 206017 gene locus_tag LOCUS_56490 205316 206017 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028120.1 protein_id gnl|my_center|LOCUS_56490 206942 205932 gene locus_tag LOCUS_56500 206942 205932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56500 208664 207000 gene locus_tag LOCUS_56510 208664 207000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56510 209730 208762 gene locus_tag LOCUS_56520 209730 208762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56520 210717 209773 gene locus_tag LOCUS_56530 210717 209773 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 protein_id gnl|my_center|LOCUS_56530 211328 210714 gene locus_tag LOCUS_56540 211328 210714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56540 211811 211392 gene locus_tag LOCUS_56550 211811 211392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56550 213540 212035 gene locus_tag LOCUS_56560 213540 212035 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224832.1 protein_id gnl|my_center|LOCUS_56560 213862 213563 gene locus_tag LOCUS_56570 213862 213563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56570 214531 213869 gene locus_tag LOCUS_56580 214531 213869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 215405 214605 gene locus_tag LOCUS_56590 gene wag31 215405 214605 CDS product cell wall synthesis protein Wag31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411131.1 protein_id gnl|my_center|LOCUS_56590 215760 215458 gene locus_tag LOCUS_56600 215760 215458 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976737.1 protein_id gnl|my_center|LOCUS_56600 216500 215790 gene locus_tag LOCUS_56610 gene sepF 216500 215790 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976736.1 protein_id gnl|my_center|LOCUS_56610 217434 216688 gene locus_tag LOCUS_56620 217434 216688 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224822.1 protein_id gnl|my_center|LOCUS_56620 218559 217444 gene locus_tag LOCUS_56630 218559 217444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56630 219650 218832 gene locus_tag LOCUS_56640 219650 218832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 221131 219647 gene locus_tag LOCUS_56650 gene murC 221131 219647 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411159.1 protein_id gnl|my_center|LOCUS_56650 222308 221202 gene locus_tag LOCUS_56660 gene murG 222308 221202 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_56660 223840 222308 gene locus_tag LOCUS_56670 223840 222308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_56670 225135 224002 gene locus_tag LOCUS_56680 gene mraY 225135 224002 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 protein_id gnl|my_center|LOCUS_56680 226532 225132 gene locus_tag LOCUS_56690 226532 225132 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228041.1 protein_id gnl|my_center|LOCUS_56690 228052 226529 gene locus_tag LOCUS_56700 228052 226529 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228042.1 protein_id gnl|my_center|LOCUS_56700 230369 228144 gene locus_tag LOCUS_56710 gene ftsI 230369 228144 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_56710 230993 230373 gene locus_tag LOCUS_56720 230993 230373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56720 232092 230983 gene locus_tag LOCUS_56730 gene rsmH 232092 230983 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976723.1 protein_id gnl|my_center|LOCUS_56730 232720 232289 gene locus_tag LOCUS_56740 gene mraZ 232720 232289 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467434.1 protein_id gnl|my_center|LOCUS_56740 233257 232937 gene locus_tag LOCUS_56750 233257 232937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56750 233160 234323 gene locus_tag LOCUS_56760 233160 234323 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977619.1 protein_id gnl|my_center|LOCUS_56760 234313 235032 gene locus_tag LOCUS_56770 234313 235032 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977618.1 protein_id gnl|my_center|LOCUS_56770 235029 235712 gene locus_tag LOCUS_56780 235029 235712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56780 238755 235918 gene locus_tag LOCUS_56790 gene leuS 238755 235918 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231035.1 protein_id gnl|my_center|LOCUS_56790 239014 239178 gene locus_tag LOCUS_56800 239014 239178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56800 239340 240395 gene locus_tag LOCUS_56810 239340 240395 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_56810 240398 241696 gene locus_tag LOCUS_56820 240398 241696 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 protein_id gnl|my_center|LOCUS_56820 241865 244333 gene locus_tag LOCUS_56830 241865 244333 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_56830 245060 244665 gene locus_tag LOCUS_56840 245060 244665 CDS product spore wall synthesis complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 protein_id gnl|my_center|LOCUS_56840 246435 245176 gene locus_tag LOCUS_56850 gene dinB 246435 245176 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_56850 247729 246485 gene locus_tag LOCUS_56860 247729 246485 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_56860 248493 247726 gene locus_tag LOCUS_56870 248493 247726 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028138.1 protein_id gnl|my_center|LOCUS_56870 248751 248572 gene locus_tag LOCUS_56880 248751 248572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56880 252220 248843 gene locus_tag LOCUS_56890 252220 248843 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727789.1 protein_id gnl|my_center|LOCUS_56890 254110 252308 gene locus_tag LOCUS_56900 254110 252308 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285994.1 protein_id gnl|my_center|LOCUS_56900 255090 254107 gene locus_tag LOCUS_56910 255090 254107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56910 255627 255178 gene locus_tag LOCUS_56920 255627 255178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56920 256167 257255 gene locus_tag LOCUS_56930 256167 257255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56930 257313 257801 gene locus_tag LOCUS_56940 257313 257801 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224204.1 protein_id gnl|my_center|LOCUS_56940 257798 258535 gene locus_tag LOCUS_56950 257798 258535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56950 258532 259122 gene locus_tag LOCUS_56960 258532 259122 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224203.1 protein_id gnl|my_center|LOCUS_56960 259119 259997 gene locus_tag LOCUS_56970 259119 259997 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225926.1 protein_id gnl|my_center|LOCUS_56970 259994 261121 gene locus_tag LOCUS_56980 259994 261121 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225927.1 protein_id gnl|my_center|LOCUS_56980 261133 262620 gene locus_tag LOCUS_56990 gene crtI 261133 262620 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225928.1 protein_id gnl|my_center|LOCUS_56990 263425 262736 gene locus_tag LOCUS_57000 263425 262736 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191313375.1 protein_id gnl|my_center|LOCUS_57000 264386 263469 gene locus_tag LOCUS_57010 gene metF 264386 263469 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 protein_id gnl|my_center|LOCUS_57010 265087 265440 gene locus_tag LOCUS_57020 265087 265440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 265535 266617 gene locus_tag LOCUS_57030 265535 266617 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_57030 267180 266746 gene locus_tag LOCUS_57040 267180 266746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57040 267314 269299 gene locus_tag LOCUS_57050 gene pknB 267314 269299 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224192.1 protein_id gnl|my_center|LOCUS_57050 269302 270171 gene locus_tag LOCUS_57060 269302 270171 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976705.1 protein_id gnl|my_center|LOCUS_57060 271400 270333 gene locus_tag LOCUS_57070 271400 270333 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618830.1 protein_id gnl|my_center|LOCUS_57070 272821 271415 gene locus_tag LOCUS_57080 272821 271415 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449604.1 protein_id gnl|my_center|LOCUS_57080 273406 272924 gene locus_tag LOCUS_57090 273406 272924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 275201 273585 gene locus_tag LOCUS_57100 275201 273585 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222227.1 protein_id gnl|my_center|LOCUS_57100 275351 275839 gene locus_tag LOCUS_57110 275351 275839 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224296754.1 protein_id gnl|my_center|LOCUS_57110 276736 275933 gene locus_tag LOCUS_57120 276736 275933 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_57120 277004 277837 gene locus_tag LOCUS_57130 277004 277837 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977293.1 protein_id gnl|my_center|LOCUS_57130 278604 277861 gene locus_tag LOCUS_57140 278604 277861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57140 278844 280091 gene locus_tag LOCUS_57150 278844 280091 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228562.1 protein_id gnl|my_center|LOCUS_57150 280088 280621 gene locus_tag LOCUS_57160 280088 280621 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027345.1 protein_id gnl|my_center|LOCUS_57160 281151 280666 gene locus_tag LOCUS_57170 281151 280666 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976424.1 protein_id gnl|my_center|LOCUS_57170 281595 281218 gene locus_tag LOCUS_57180 281595 281218 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222744.1 protein_id gnl|my_center|LOCUS_57180 282497 281679 gene locus_tag LOCUS_57190 gene proC 282497 281679 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 protein_id gnl|my_center|LOCUS_57190 283709 282681 gene locus_tag LOCUS_57200 283709 282681 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_57200 284376 283873 gene locus_tag LOCUS_57210 284376 283873 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_57210 284953 284456 gene locus_tag LOCUS_57220 284953 284456 CDS product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224331.1 protein_id gnl|my_center|LOCUS_57220 285190 285882 gene locus_tag LOCUS_57230 gene crp 285190 285882 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419728.1 protein_id gnl|my_center|LOCUS_57230 286236 285979 gene locus_tag LOCUS_57240 286236 285979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57240 286362 289925 gene locus_tag LOCUS_57250 286362 289925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57250 290289 289963 gene locus_tag LOCUS_57260 290289 289963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57260 290534 291364 gene locus_tag LOCUS_57270 290534 291364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57270 291636 293054 gene locus_tag LOCUS_57280 291636 293054 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230392.1 protein_id gnl|my_center|LOCUS_57280 293930 293106 gene locus_tag LOCUS_57290 293930 293106 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259151.1 protein_id gnl|my_center|LOCUS_57290 295333 293927 gene locus_tag LOCUS_57300 295333 293927 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198286.1 protein_id gnl|my_center|LOCUS_57300 296142 295438 gene locus_tag LOCUS_57310 296142 295438 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976690.1 protein_id gnl|my_center|LOCUS_57310 297110 296154 gene locus_tag LOCUS_57320 297110 296154 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805026.1 protein_id gnl|my_center|LOCUS_57320 297874 297182 gene locus_tag LOCUS_57330 297874 297182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57330 298373 297918 gene locus_tag LOCUS_57340 298373 297918 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_57340 298594 300417 gene locus_tag LOCUS_57350 298594 300417 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224318.1 protein_id gnl|my_center|LOCUS_57350 300432 302129 gene locus_tag LOCUS_57360 300432 302129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57360 302137 302805 gene locus_tag LOCUS_57370 302137 302805 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_57370 303003 303815 gene locus_tag LOCUS_57380 303003 303815 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_57380 303808 305562 gene locus_tag LOCUS_57390 303808 305562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57390 307402 306278 gene locus_tag LOCUS_57400 307402 306278 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_57400 308658 307399 gene locus_tag LOCUS_57410 308658 307399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57410 308864 308655 gene locus_tag LOCUS_57420 308864 308655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57420 309234 309013 gene locus_tag LOCUS_57430 309234 309013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57430 310879 309413 gene locus_tag LOCUS_57440 310879 309413 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028160.1 protein_id gnl|my_center|LOCUS_57440 310998 312764 gene locus_tag LOCUS_57450 310998 312764 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_57450 312893 314680 gene locus_tag LOCUS_57460 312893 314680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57460 314734 315270 gene locus_tag LOCUS_57470 314734 315270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57470 315267 316139 gene locus_tag LOCUS_57480 315267 316139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57480 316263 316550 gene locus_tag LOCUS_57490 316263 316550 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_57490 319153 316616 gene locus_tag LOCUS_57500 319153 316616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57500 320244 319150 gene locus_tag LOCUS_57510 320244 319150 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104375.1 protein_id gnl|my_center|LOCUS_57510 321148 320312 gene locus_tag LOCUS_57520 321148 320312 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086661.1 protein_id gnl|my_center|LOCUS_57520 321764 321222 gene locus_tag LOCUS_57530 321764 321222 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284302.1 protein_id gnl|my_center|LOCUS_57530 321685 321924 gene locus_tag LOCUS_57540 321685 321924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57540 321894 322907 gene locus_tag LOCUS_57550 321894 322907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57550 323013 323408 gene locus_tag LOCUS_57560 323013 323408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224078.1 protein_id gnl|my_center|LOCUS_57560 323554 324600 gene locus_tag LOCUS_57570 gene trpD 323554 324600 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_57570 324831 325034 gene locus_tag LOCUS_57580 324831 325034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57580 325697 325272 gene locus_tag LOCUS_57590 325697 325272 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224074.1 protein_id gnl|my_center|LOCUS_57590 326733 325708 gene locus_tag LOCUS_57600 326733 325708 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466782.1 protein_id gnl|my_center|LOCUS_57600 326848 327999 gene locus_tag LOCUS_57610 326848 327999 CDS product cysteine desulfurase/sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028169.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_57610 327996 328259 gene locus_tag LOCUS_57620 327996 328259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_57620 329168 328929 gene locus_tag LOCUS_57630 329168 328929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57630 329238 330086 gene locus_tag LOCUS_57640 329238 330086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57640 330098 330595 gene locus_tag LOCUS_57650 330098 330595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223347.1 protein_id gnl|my_center|LOCUS_57650 331699 330722 gene locus_tag LOCUS_57660 331699 330722 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_57660 332341 331970 gene locus_tag LOCUS_57670 332341 331970 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_57670 333691 332504 gene locus_tag LOCUS_57680 333691 332504 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082051.1 protein_id gnl|my_center|LOCUS_57680 333739 334929 gene locus_tag LOCUS_57690 gene nadA 333739 334929 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_57690 334997 336499 gene locus_tag LOCUS_57700 gene murA 334997 336499 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975861.1 protein_id gnl|my_center|LOCUS_57700 336554 337207 gene locus_tag LOCUS_57710 336554 337207 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224069.1 protein_id gnl|my_center|LOCUS_57710 338315 337323 gene locus_tag LOCUS_57720 338315 337323 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_57720 339169 338312 gene locus_tag LOCUS_57730 339169 338312 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028652.1 protein_id gnl|my_center|LOCUS_57730 340097 339162 gene locus_tag LOCUS_57740 340097 339162 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975914.1 protein_id gnl|my_center|LOCUS_57740 340177 345573 gene locus_tag LOCUS_57750 340177 345573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57750 345645 346643 gene locus_tag LOCUS_57760 345645 346643 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776829.1 protein_id gnl|my_center|LOCUS_57760 347486 346686 gene locus_tag LOCUS_57770 347486 346686 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976552.1 protein_id gnl|my_center|LOCUS_57770 347686 347486 gene locus_tag LOCUS_57780 347686 347486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 347856 350003 gene locus_tag LOCUS_57790 347856 350003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57790 350122 352134 gene locus_tag LOCUS_57800 350122 352134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57800 352124 352951 gene locus_tag LOCUS_57810 352124 352951 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028180.1 protein_id gnl|my_center|LOCUS_57810 353016 354308 gene locus_tag LOCUS_57820 353016 354308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57820 355493 354363 gene locus_tag LOCUS_57830 gene gcvT 355493 354363 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729697.1 protein_id gnl|my_center|LOCUS_57830 355655 357223 gene locus_tag LOCUS_57840 355655 357223 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224057.1 protein_id gnl|my_center|LOCUS_57840 357641 357312 gene locus_tag LOCUS_57850 357641 357312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466777.1 protein_id gnl|my_center|LOCUS_57850 357820 359211 gene locus_tag LOCUS_57860 gene lpdA 357820 359211 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_57860 359285 361135 gene locus_tag LOCUS_57870 gene sucB 359285 361135 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775679.1 protein_id gnl|my_center|LOCUS_57870 361269 362675 gene locus_tag LOCUS_57880 361269 362675 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229643.1 protein_id gnl|my_center|LOCUS_57880 362752 363267 gene locus_tag LOCUS_57890 362752 363267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57890 363496 364446 gene locus_tag LOCUS_57900 363496 364446 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414686.1 protein_id gnl|my_center|LOCUS_57900 364559 364807 gene locus_tag LOCUS_57910 364559 364807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57910 365044 364817 gene locus_tag LOCUS_57920 365044 364817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57920 365330 365857 gene locus_tag LOCUS_57930 365330 365857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57930 366297 365938 gene locus_tag LOCUS_57940 366297 365938 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224170.1 protein_id gnl|my_center|LOCUS_57940 366351 367361 gene locus_tag LOCUS_57950 366351 367361 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456725.1 protein_id gnl|my_center|LOCUS_57950 367464 368363 gene locus_tag LOCUS_57960 367464 368363 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729703.1 protein_id gnl|my_center|LOCUS_57960 371573 368481 gene locus_tag LOCUS_57970 371573 368481 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221979.1 protein_id gnl|my_center|LOCUS_57970 371696 372616 gene locus_tag LOCUS_57980 371696 372616 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976361.1 protein_id gnl|my_center|LOCUS_57980 372882 374699 gene locus_tag LOCUS_57990 372882 374699 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630171.1 protein_id gnl|my_center|LOCUS_57990 374823 375428 gene locus_tag LOCUS_58000 gene lipB 374823 375428 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224047.1 protein_id gnl|my_center|LOCUS_58000 375466 375858 gene locus_tag LOCUS_58010 375466 375858 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031553.1 protein_id gnl|my_center|LOCUS_58010 376950 375946 gene locus_tag LOCUS_58020 376950 375946 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618818.1 protein_id gnl|my_center|LOCUS_58020 378493 377207 gene locus_tag LOCUS_58030 gene aspS 378493 377207 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466653.1 protein_id gnl|my_center|LOCUS_58030 379051 379959 gene locus_tag LOCUS_58040 gene lipA 379051 379959 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729704.1 protein_id gnl|my_center|LOCUS_58040 380183 381670 gene locus_tag LOCUS_58050 380183 381670 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_58050 381731 382420 gene locus_tag LOCUS_58060 381731 382420 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223136.1 protein_id gnl|my_center|LOCUS_58060 383049 382651 gene locus_tag LOCUS_58070 383049 382651 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976618.1 protein_id gnl|my_center|LOCUS_58070 383303 384727 gene locus_tag LOCUS_58080 gene glnA 383303 384727 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223133.1 protein_id gnl|my_center|LOCUS_58080 385257 385751 gene locus_tag LOCUS_58090 385257 385751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58090 386282 385818 gene locus_tag LOCUS_58100 386282 385818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58100 386674 386297 gene locus_tag LOCUS_58110 386674 386297 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250563.1 protein_id gnl|my_center|LOCUS_58110 389580 388015 gene locus_tag LOCUS_58120 389580 388015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58120 390998 389577 gene locus_tag LOCUS_58130 gene mptB 390998 389577 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224695.1 protein_id gnl|my_center|LOCUS_58130 391034 392617 gene locus_tag LOCUS_58140 391034 392617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028289.1 protein_id gnl|my_center|LOCUS_58140 395723 392649 gene locus_tag LOCUS_58150 395723 392649 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_58150 396617 395727 gene locus_tag LOCUS_58160 396617 395727 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223128.1 protein_id gnl|my_center|LOCUS_58160 396610 397542 gene locus_tag LOCUS_58170 396610 397542 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267274.1 protein_id gnl|my_center|LOCUS_58170 398428 397547 gene locus_tag LOCUS_58180 398428 397547 CDS product virginiamycin B lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029662.1 protein_id gnl|my_center|LOCUS_58180 398616 399083 gene locus_tag LOCUS_58190 398616 399083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58190 399604 399230 gene locus_tag LOCUS_58200 399604 399230 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228813.1 protein_id gnl|my_center|LOCUS_58200 402978 399637 gene locus_tag LOCUS_58210 402978 399637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224774.1 protein_id gnl|my_center|LOCUS_58210 403738 403046 gene locus_tag LOCUS_58220 403738 403046 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640423.1 protein_id gnl|my_center|LOCUS_58220 404237 403794 gene locus_tag LOCUS_58230 404237 403794 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028363.1 protein_id gnl|my_center|LOCUS_58230 405672 404323 gene locus_tag LOCUS_58240 gene glnA 405672 404323 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_58240 405919 407679 gene locus_tag LOCUS_58250 405919 407679 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223119.1 protein_id gnl|my_center|LOCUS_58250 407823 408668 gene locus_tag LOCUS_58260 gene panB 407823 408668 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 protein_id gnl|my_center|LOCUS_58260 409511 408813 gene locus_tag LOCUS_58270 gene npdG 409511 408813 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_58270 411043 409610 gene locus_tag LOCUS_58280 411043 409610 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223097.1 protein_id gnl|my_center|LOCUS_58280 412018 411170 gene locus_tag LOCUS_58290 412018 411170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58290 412340 412101 gene locus_tag LOCUS_58300 412340 412101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58300 412840 413217 gene locus_tag LOCUS_58310 412840 413217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58310 413553 413924 gene locus_tag LOCUS_58320 413553 413924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 protein_id gnl|my_center|LOCUS_58320 413921 414424 gene locus_tag LOCUS_58330 413921 414424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58330 414513 415337 gene locus_tag LOCUS_58340 414513 415337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58340 415444 416667 gene locus_tag LOCUS_58350 415444 416667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58350 416880 417482 gene locus_tag LOCUS_58360 416880 417482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58360 417668 419242 gene locus_tag LOCUS_58370 417668 419242 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036716.1 protein_id gnl|my_center|LOCUS_58370 419644 419270 gene locus_tag LOCUS_58380 419644 419270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58380 419885 420256 gene locus_tag LOCUS_58390 419885 420256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58390 420965 420402 gene locus_tag LOCUS_58400 420965 420402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58400 421738 421520 gene locus_tag LOCUS_58410 421738 421520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58410 422000 422776 gene locus_tag LOCUS_58420 422000 422776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58420 422975 423118 gene locus_tag LOCUS_58430 422975 423118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58430 424315 423191 gene locus_tag LOCUS_58440 424315 423191 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224252.1 protein_id gnl|my_center|LOCUS_58440 424371 425069 gene locus_tag LOCUS_58450 424371 425069 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971520.1 protein_id gnl|my_center|LOCUS_58450 425812 425222 gene locus_tag LOCUS_58460 425812 425222 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975821.1 protein_id gnl|my_center|LOCUS_58460 425863 426084 gene locus_tag LOCUS_58470 425863 426084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58470 426480 426827 gene locus_tag LOCUS_58480 426480 426827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58480 427231 427482 gene locus_tag LOCUS_58490 427231 427482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58490 427479 427919 gene locus_tag LOCUS_58500 427479 427919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58500 428243 428031 gene locus_tag LOCUS_58510 428243 428031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58510 428315 428512 gene locus_tag LOCUS_58520 428315 428512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 428623 428952 gene locus_tag LOCUS_58530 428623 428952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58530 429769 429005 gene locus_tag LOCUS_58540 429769 429005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58540 >Feature sequence35 566 273 gene locus_tag LOCUS_58550 566 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58550 1398 733 gene locus_tag LOCUS_58560 1398 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973694.1 protein_id gnl|my_center|LOCUS_58560 2252 1407 gene locus_tag LOCUS_58570 2252 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58570 2385 3239 gene locus_tag LOCUS_58580 2385 3239 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226033.1 protein_id gnl|my_center|LOCUS_58580 3310 4446 gene locus_tag LOCUS_58590 3310 4446 CDS product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226367.1 protein_id gnl|my_center|LOCUS_58590 4655 5404 gene locus_tag LOCUS_58600 4655 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58600 5537 6184 gene locus_tag LOCUS_58610 5537 6184 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467175.1 protein_id gnl|my_center|LOCUS_58610 8857 6296 gene locus_tag LOCUS_58620 8857 6296 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_58620 9630 8857 gene locus_tag LOCUS_58630 9630 8857 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_58630 10658 9972 gene locus_tag LOCUS_58640 10658 9972 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_58640 11898 10723 gene locus_tag LOCUS_58650 11898 10723 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_58650 12916 11996 gene locus_tag LOCUS_58660 12916 11996 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226741.1 protein_id gnl|my_center|LOCUS_58660 12810 14177 gene locus_tag LOCUS_58670 12810 14177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_58670 14174 15244 gene locus_tag LOCUS_58680 14174 15244 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_58680 15404 15976 gene locus_tag LOCUS_58690 15404 15976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58690 16321 16025 gene locus_tag LOCUS_58700 16321 16025 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977176.1 protein_id gnl|my_center|LOCUS_58700 16499 18280 gene locus_tag LOCUS_58710 gene arc 16499 18280 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_58710 18461 19978 gene locus_tag LOCUS_58720 gene dop 18461 19978 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_58720 20086 20301 gene locus_tag LOCUS_58730 20086 20301 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_58730 20324 21010 gene locus_tag LOCUS_58740 20324 21010 CDS product endonuclease VII domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027898.1 protein_id gnl|my_center|LOCUS_58740 21028 21768 gene locus_tag LOCUS_58750 gene prcB 21028 21768 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_58750 21826 22674 gene locus_tag LOCUS_58760 gene prcA 21826 22674 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226723.1 protein_id gnl|my_center|LOCUS_58760 22909 24267 gene locus_tag LOCUS_58770 gene pafA 22909 24267 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_58770 24336 24527 gene locus_tag LOCUS_58780 24336 24527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58780 25708 24614 gene locus_tag LOCUS_58790 25708 24614 CDS product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805204.1 protein_id gnl|my_center|LOCUS_58790 26722 25745 gene locus_tag LOCUS_58800 26722 25745 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028575.1 protein_id gnl|my_center|LOCUS_58800 26846 27844 gene locus_tag LOCUS_58810 26846 27844 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226715.1 protein_id gnl|my_center|LOCUS_58810 27841 28878 gene locus_tag LOCUS_58820 27841 28878 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_58820 28889 29137 gene locus_tag LOCUS_58830 28889 29137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58830 29352 29690 gene locus_tag LOCUS_58840 29352 29690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58840 29712 30665 gene locus_tag LOCUS_58850 gene tatC 29712 30665 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080091.1 protein_id gnl|my_center|LOCUS_58850 30948 31937 gene locus_tag LOCUS_58860 30948 31937 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_58860 33382 32033 gene locus_tag LOCUS_58870 33382 32033 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457391.1 protein_id gnl|my_center|LOCUS_58870 33620 34873 gene locus_tag LOCUS_58880 33620 34873 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230103.1 protein_id gnl|my_center|LOCUS_58880 35832 34942 gene locus_tag LOCUS_58890 35832 34942 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730500.1 protein_id gnl|my_center|LOCUS_58890 36431 35829 gene locus_tag LOCUS_58900 36431 35829 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730499.1 protein_id gnl|my_center|LOCUS_58900 37960 36560 gene locus_tag LOCUS_58910 37960 36560 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_58910 38369 38100 gene locus_tag LOCUS_58920 38369 38100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58920 38960 38628 gene locus_tag LOCUS_58930 38960 38628 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029816.1 protein_id gnl|my_center|LOCUS_58930 39190 38999 gene locus_tag LOCUS_58940 39190 38999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58940 39563 39255 gene locus_tag LOCUS_58950 39563 39255 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222326.1 protein_id gnl|my_center|LOCUS_58950 41664 39754 gene locus_tag LOCUS_58960 41664 39754 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284089.1 protein_id gnl|my_center|LOCUS_58960 43374 41971 gene locus_tag LOCUS_58970 43374 41971 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230096.1 protein_id gnl|my_center|LOCUS_58970 44426 43422 gene locus_tag LOCUS_58980 44426 43422 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230097.1 protein_id gnl|my_center|LOCUS_58980 45460 44423 gene locus_tag LOCUS_58990 45460 44423 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230098.1 protein_id gnl|my_center|LOCUS_58990 46444 45464 gene locus_tag LOCUS_59000 46444 45464 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230099.1 protein_id gnl|my_center|LOCUS_59000 47535 46441 gene locus_tag LOCUS_59010 47535 46441 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306915.1 protein_id gnl|my_center|LOCUS_59010 49308 47626 gene locus_tag LOCUS_59020 49308 47626 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467774.1 protein_id gnl|my_center|LOCUS_59020 50452 49451 gene locus_tag LOCUS_59030 50452 49451 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227073.1 protein_id gnl|my_center|LOCUS_59030 51491 50808 gene locus_tag LOCUS_59040 51491 50808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977459.1 protein_id gnl|my_center|LOCUS_59040 52570 51488 gene locus_tag LOCUS_59050 52570 51488 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027750.1 protein_id gnl|my_center|LOCUS_59050 52742 53950 gene locus_tag LOCUS_59060 52742 53950 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027751.1 protein_id gnl|my_center|LOCUS_59060 53943 54578 gene locus_tag LOCUS_59070 53943 54578 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977456.1 protein_id gnl|my_center|LOCUS_59070 54681 55730 gene locus_tag LOCUS_59080 54681 55730 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229198.1 protein_id gnl|my_center|LOCUS_59080 56608 55856 gene locus_tag LOCUS_59090 56608 55856 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036395.1 protein_id gnl|my_center|LOCUS_59090 57828 56659 gene locus_tag LOCUS_59100 57828 56659 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486733.1 protein_id gnl|my_center|LOCUS_59100 57938 58414 gene locus_tag LOCUS_59110 57938 58414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59110 60551 58455 gene locus_tag LOCUS_59120 60551 58455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59120 61131 60565 gene locus_tag LOCUS_59130 61131 60565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59130 61252 61818 gene locus_tag LOCUS_59140 61252 61818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59140 61988 63403 gene locus_tag LOCUS_59150 61988 63403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027710.1 protein_id gnl|my_center|LOCUS_59150 63493 64761 gene locus_tag LOCUS_59160 63493 64761 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977524.1 protein_id gnl|my_center|LOCUS_59160 64758 66044 gene locus_tag LOCUS_59170 64758 66044 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495330.1 protein_id gnl|my_center|LOCUS_59170 66203 65970 gene locus_tag LOCUS_59180 66203 65970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59180 67455 66343 gene locus_tag LOCUS_59190 67455 66343 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225315.1 protein_id gnl|my_center|LOCUS_59190 67746 69419 gene locus_tag LOCUS_59200 67746 69419 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027264.1 protein_id gnl|my_center|LOCUS_59200 70059 69319 gene locus_tag LOCUS_59210 70059 69319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59210 70766 70059 gene locus_tag LOCUS_59220 70766 70059 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804153.1 protein_id gnl|my_center|LOCUS_59220 71305 70766 gene locus_tag LOCUS_59230 71305 70766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59230 71560 73068 gene locus_tag LOCUS_59240 71560 73068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59240 73284 73946 gene locus_tag LOCUS_59250 73284 73946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59250 74864 74034 gene locus_tag LOCUS_59260 74864 74034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59260 77174 75027 gene locus_tag LOCUS_59270 77174 75027 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804150.1 protein_id gnl|my_center|LOCUS_59270 78496 77177 gene locus_tag LOCUS_59280 78496 77177 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_59280 79410 78550 gene locus_tag LOCUS_59290 79410 78550 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971654.1 protein_id gnl|my_center|LOCUS_59290 80363 79407 gene locus_tag LOCUS_59300 80363 79407 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031697.1 protein_id gnl|my_center|LOCUS_59300 81736 80360 gene locus_tag LOCUS_59310 81736 80360 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031698.1 protein_id gnl|my_center|LOCUS_59310 83108 81771 gene locus_tag LOCUS_59320 83108 81771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59320 83056 84228 gene locus_tag LOCUS_59330 83056 84228 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125308321.1 protein_id gnl|my_center|LOCUS_59330 85500 84247 gene locus_tag LOCUS_59340 85500 84247 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087840.1 protein_id gnl|my_center|LOCUS_59340 86698 85493 gene locus_tag LOCUS_59350 86698 85493 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_59350 87406 86747 gene locus_tag LOCUS_59360 87406 86747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59360 89285 87387 gene locus_tag LOCUS_59370 89285 87387 CDS product RiPP maturation radical SAM C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_59370 91446 89440 gene locus_tag LOCUS_59380 91446 89440 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975329.1 protein_id gnl|my_center|LOCUS_59380 91553 91999 gene locus_tag LOCUS_59390 91553 91999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59390 92155 94134 gene locus_tag LOCUS_59400 92155 94134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59400 95242 94154 gene locus_tag LOCUS_59410 gene arsB 95242 94154 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222674.1 protein_id gnl|my_center|LOCUS_59410 95720 95343 gene locus_tag LOCUS_59420 95720 95343 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 protein_id gnl|my_center|LOCUS_59420 95900 96397 gene locus_tag LOCUS_59430 95900 96397 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205378591.1 protein_id gnl|my_center|LOCUS_59430 96469 97881 gene locus_tag LOCUS_59440 96469 97881 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007445862.1 protein_id gnl|my_center|LOCUS_59440 98595 100778 gene locus_tag LOCUS_59450 98595 100778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59450 101624 100890 gene locus_tag LOCUS_59460 101624 100890 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224871.1 protein_id gnl|my_center|LOCUS_59460 101929 102294 gene locus_tag LOCUS_59470 101929 102294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59470 104342 104142 gene locus_tag LOCUS_59480 104342 104142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59480 107205 104452 gene locus_tag LOCUS_59490 107205 104452 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022472.1 protein_id gnl|my_center|LOCUS_59490 108175 107285 gene locus_tag LOCUS_59500 108175 107285 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064726614.1 protein_id gnl|my_center|LOCUS_59500 110000 108414 gene locus_tag LOCUS_59510 110000 108414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59510 111322 110000 gene locus_tag LOCUS_59520 111322 110000 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227131.1 protein_id gnl|my_center|LOCUS_59520 111660 113720 gene locus_tag LOCUS_59530 111660 113720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59530 113764 115134 gene locus_tag LOCUS_59540 113764 115134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59540 115131 115787 gene locus_tag LOCUS_59550 115131 115787 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_59550 118992 115849 gene locus_tag LOCUS_59560 118992 115849 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228797.1 protein_id gnl|my_center|LOCUS_59560 119316 119735 gene locus_tag LOCUS_59570 119316 119735 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230839.1 protein_id gnl|my_center|LOCUS_59570 120258 123377 gene locus_tag LOCUS_59580 120258 123377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59580 123374 124438 gene locus_tag LOCUS_59590 123374 124438 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027908.1 protein_id gnl|my_center|LOCUS_59590 125393 124395 gene locus_tag LOCUS_59600 125393 124395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59600 125578 130962 gene locus_tag LOCUS_59610 125578 130962 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189716469.1 protein_id gnl|my_center|LOCUS_59610 130949 133132 gene locus_tag LOCUS_59620 130949 133132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59620 133302 134273 gene locus_tag LOCUS_59630 133302 134273 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229986.1 protein_id gnl|my_center|LOCUS_59630 134260 139077 gene locus_tag LOCUS_59640 134260 139077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59640 139320 139081 gene locus_tag LOCUS_59650 139320 139081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59650 140403 139330 gene locus_tag LOCUS_59660 140403 139330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59660 142325 141240 gene locus_tag LOCUS_59670 gene trpS 142325 141240 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804845.1 protein_id gnl|my_center|LOCUS_59670 142566 143528 gene locus_tag LOCUS_59680 gene trpS 142566 143528 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883439.1 protein_id gnl|my_center|LOCUS_59680 143827 145596 gene locus_tag LOCUS_59690 143827 145596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59690 145590 146765 gene locus_tag LOCUS_59700 145590 146765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59700 146856 147629 gene locus_tag LOCUS_59710 146856 147629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59710 147634 149118 gene locus_tag LOCUS_59720 147634 149118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59720 149115 150245 gene locus_tag LOCUS_59730 149115 150245 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937482.1 protein_id gnl|my_center|LOCUS_59730 151267 150266 gene locus_tag LOCUS_59740 151267 150266 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_59740 152184 151354 gene locus_tag LOCUS_59750 152184 151354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59750 152957 152181 gene locus_tag LOCUS_59760 152957 152181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59760 153874 152954 gene locus_tag LOCUS_59770 153874 152954 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250976.1 protein_id gnl|my_center|LOCUS_59770 154117 155016 gene locus_tag LOCUS_59780 154117 155016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59780 155509 155096 gene locus_tag LOCUS_59790 155509 155096 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728621.1 protein_id gnl|my_center|LOCUS_59790 155549 156406 gene locus_tag LOCUS_59800 155549 156406 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923261.1 protein_id gnl|my_center|LOCUS_59800 157155 156541 gene locus_tag LOCUS_59810 gene prfH 157155 156541 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602086.1 protein_id gnl|my_center|LOCUS_59810 158351 157152 gene locus_tag LOCUS_59820 158351 157152 CDS product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114117.1 protein_id gnl|my_center|LOCUS_59820 160274 158571 gene locus_tag LOCUS_59830 160274 158571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59830 160775 160596 gene locus_tag LOCUS_59840 160775 160596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59840 161362 162414 gene locus_tag LOCUS_59850 161362 162414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59850 162547 163443 gene locus_tag LOCUS_59860 162547 163443 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978149.1 protein_id gnl|my_center|LOCUS_59860 163579 164736 gene locus_tag LOCUS_59870 163579 164736 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_59870 164769 165848 gene locus_tag LOCUS_59880 164769 165848 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225001.1 protein_id gnl|my_center|LOCUS_59880 166032 166817 gene locus_tag LOCUS_59890 166032 166817 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223279.1 protein_id gnl|my_center|LOCUS_59890 166814 167536 gene locus_tag LOCUS_59900 166814 167536 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223280.1 protein_id gnl|my_center|LOCUS_59900 167563 168441 gene locus_tag LOCUS_59910 167563 168441 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223281.1 protein_id gnl|my_center|LOCUS_59910 168438 169550 gene locus_tag LOCUS_59920 168438 169550 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223282.1 protein_id gnl|my_center|LOCUS_59920 169635 170927 gene locus_tag LOCUS_59930 169635 170927 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223283.1 protein_id gnl|my_center|LOCUS_59930 171065 171676 gene locus_tag LOCUS_59940 171065 171676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59940 171785 174496 gene locus_tag LOCUS_59950 171785 174496 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131337810.1 protein_id gnl|my_center|LOCUS_59950 175845 174508 gene locus_tag LOCUS_59960 175845 174508 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466721.1 protein_id gnl|my_center|LOCUS_59960 175943 176773 gene locus_tag LOCUS_59970 175943 176773 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228665.1 protein_id gnl|my_center|LOCUS_59970 177946 176873 gene locus_tag LOCUS_59980 177946 176873 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027929.1 protein_id gnl|my_center|LOCUS_59980 179361 177943 gene locus_tag LOCUS_59990 179361 177943 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027930.1 protein_id gnl|my_center|LOCUS_59990 180075 179410 gene locus_tag LOCUS_60000 180075 179410 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977123.1 protein_id gnl|my_center|LOCUS_60000 180162 181310 gene locus_tag LOCUS_60010 180162 181310 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027926.1 protein_id gnl|my_center|LOCUS_60010 181327 182085 gene locus_tag LOCUS_60020 gene fabG 181327 182085 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_60020 182116 183288 gene locus_tag LOCUS_60030 182116 183288 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_60030 184484 183918 gene locus_tag LOCUS_60040 184484 183918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60040 184780 189171 gene locus_tag LOCUS_60050 184780 189171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60050 189828 189262 gene locus_tag LOCUS_60060 189828 189262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60060 190355 190648 gene locus_tag LOCUS_60070 190355 190648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60070 190661 190939 gene locus_tag LOCUS_60080 190661 190939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60080 191088 192320 gene locus_tag LOCUS_60090 191088 192320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60090 193551 192538 gene locus_tag LOCUS_60100 193551 192538 CDS product cupin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207486.1 protein_id gnl|my_center|LOCUS_60100 193832 193548 gene locus_tag LOCUS_60110 193832 193548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60110 193951 194949 gene locus_tag LOCUS_60120 193951 194949 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109964.1 protein_id gnl|my_center|LOCUS_60120 196574 194994 gene locus_tag LOCUS_60130 196574 194994 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403977.1 protein_id gnl|my_center|LOCUS_60130 197187 196885 gene locus_tag LOCUS_60140 197187 196885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60140 197678 207403 gene locus_tag LOCUS_60150 197678 207403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60150 207462 207902 gene locus_tag LOCUS_60160 207462 207902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60160 207906 209393 gene locus_tag LOCUS_60170 207906 209393 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902557.1 protein_id gnl|my_center|LOCUS_60170 210262 211668 gene locus_tag LOCUS_60180 210262 211668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60180 211931 214885 gene locus_tag LOCUS_60190 211931 214885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60190 216452 215034 gene locus_tag LOCUS_60200 216452 215034 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_60200 216697 217806 gene locus_tag LOCUS_60210 216697 217806 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226390.1 protein_id gnl|my_center|LOCUS_60210 218301 220847 gene locus_tag LOCUS_60220 218301 220847 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227076.1 protein_id gnl|my_center|LOCUS_60220 223612 220910 gene locus_tag LOCUS_60230 223612 220910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60230 224147 223596 gene locus_tag LOCUS_60240 224147 223596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60240 224451 225566 gene locus_tag LOCUS_60250 224451 225566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60250 226890 225634 gene locus_tag LOCUS_60260 226890 225634 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085441.1 protein_id gnl|my_center|LOCUS_60260 227218 226940 gene locus_tag LOCUS_60270 227218 226940 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804826.1 protein_id gnl|my_center|LOCUS_60270 227825 227445 gene locus_tag LOCUS_60280 227825 227445 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230234.1 protein_id gnl|my_center|LOCUS_60280 228489 227866 gene locus_tag LOCUS_60290 228489 227866 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226392.1 protein_id gnl|my_center|LOCUS_60290 229106 228486 gene locus_tag LOCUS_60300 229106 228486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60300 230813 229341 gene locus_tag LOCUS_60310 230813 229341 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226235.1 protein_id gnl|my_center|LOCUS_60310 231379 233013 gene locus_tag LOCUS_60320 gene kdpA 231379 233013 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730504.1 protein_id gnl|my_center|LOCUS_60320 233034 235244 gene locus_tag LOCUS_60330 gene kdpB 233034 235244 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730505.1 protein_id gnl|my_center|LOCUS_60330 235244 236125 gene locus_tag LOCUS_60340 235244 236125 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730506.1 protein_id gnl|my_center|LOCUS_60340 236223 238775 gene locus_tag LOCUS_60350 236223 238775 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 protein_id gnl|my_center|LOCUS_60350 238772 239458 gene locus_tag LOCUS_60360 238772 239458 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223789.1 protein_id gnl|my_center|LOCUS_60360 240690 239488 gene locus_tag LOCUS_60370 240690 239488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60370 240917 241972 gene locus_tag LOCUS_60380 240917 241972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486834.1 protein_id gnl|my_center|LOCUS_60380 242285 243619 gene locus_tag LOCUS_60390 242285 243619 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027699.1 protein_id gnl|my_center|LOCUS_60390 243616 246243 gene locus_tag LOCUS_60400 243616 246243 CDS product DUF6493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484745.1 protein_id gnl|my_center|LOCUS_60400 246334 247911 gene locus_tag LOCUS_60410 246334 247911 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467246.1 protein_id gnl|my_center|LOCUS_60410 248077 249633 gene locus_tag LOCUS_60420 248077 249633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60420 249689 250939 gene locus_tag LOCUS_60430 249689 250939 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230104.1 protein_id gnl|my_center|LOCUS_60430 252348 251119 gene locus_tag LOCUS_60440 252348 251119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60440 252561 253607 gene locus_tag LOCUS_60450 252561 253607 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390074.1 protein_id gnl|my_center|LOCUS_60450 253881 253609 gene locus_tag LOCUS_60460 253881 253609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60460 253769 253987 gene locus_tag LOCUS_60470 253769 253987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60470 254863 254012 gene locus_tag LOCUS_60480 254863 254012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60480 255673 255161 gene locus_tag LOCUS_60490 255673 255161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60490 256181 255660 gene locus_tag LOCUS_60500 256181 255660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60500 256888 256178 gene locus_tag LOCUS_60510 256888 256178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60510 257069 260191 gene locus_tag LOCUS_60520 257069 260191 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223275.1 protein_id gnl|my_center|LOCUS_60520 261105 260188 gene locus_tag LOCUS_60530 261105 260188 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466931.1 protein_id gnl|my_center|LOCUS_60530 262694 261465 gene locus_tag LOCUS_60540 262694 261465 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973478.1 protein_id gnl|my_center|LOCUS_60540 262981 263871 gene locus_tag LOCUS_60550 262981 263871 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225097.1 protein_id gnl|my_center|LOCUS_60550 264049 266094 gene locus_tag LOCUS_60560 264049 266094 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229532.1 protein_id gnl|my_center|LOCUS_60560 266182 266616 gene locus_tag LOCUS_60570 266182 266616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60570 266613 267194 gene locus_tag LOCUS_60580 266613 267194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60580 267419 268666 gene locus_tag LOCUS_60590 267419 268666 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142191.1 protein_id gnl|my_center|LOCUS_60590 268694 269239 gene locus_tag LOCUS_60600 268694 269239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60600 269971 269309 gene locus_tag LOCUS_60610 269971 269309 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229399.1 protein_id gnl|my_center|LOCUS_60610 270233 271747 gene locus_tag LOCUS_60620 270233 271747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60620 271744 272925 gene locus_tag LOCUS_60630 271744 272925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60630 272935 274605 gene locus_tag LOCUS_60640 272935 274605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60640 274602 275447 gene locus_tag LOCUS_60650 274602 275447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60650 276859 275549 gene locus_tag LOCUS_60660 276859 275549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60660 277914 277027 gene locus_tag LOCUS_60670 277914 277027 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_60670 278842 277907 gene locus_tag LOCUS_60680 278842 277907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60680 279077 280321 gene locus_tag LOCUS_60690 279077 280321 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061295.1 protein_id gnl|my_center|LOCUS_60690 280406 280312 gene locus_tag LOCUS_t00650 280406 280312 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 280318 281322 gene locus_tag LOCUS_60700 280318 281322 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331969.1 protein_id gnl|my_center|LOCUS_60700 281326 282237 gene locus_tag LOCUS_60710 281326 282237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60710 282360 284255 gene locus_tag LOCUS_60720 282360 284255 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189868312.1 protein_id gnl|my_center|LOCUS_60720 284426 285178 gene locus_tag LOCUS_60730 284426 285178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60730 285304 286092 gene locus_tag LOCUS_60740 285304 286092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60740 289261 286103 gene locus_tag LOCUS_60750 289261 286103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_60750 289596 290417 gene locus_tag LOCUS_60760 289596 290417 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222578.1 protein_id gnl|my_center|LOCUS_60760 290407 291144 gene locus_tag LOCUS_60770 290407 291144 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228015.1 protein_id gnl|my_center|LOCUS_60770 291141 292895 gene locus_tag LOCUS_60780 291141 292895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60780 292892 294145 gene locus_tag LOCUS_60790 292892 294145 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228024.1 protein_id gnl|my_center|LOCUS_60790 294142 295689 gene locus_tag LOCUS_60800 294142 295689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60800 295689 296963 gene locus_tag LOCUS_60810 295689 296963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60810 296960 297700 gene locus_tag LOCUS_60820 296960 297700 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973620.1 protein_id gnl|my_center|LOCUS_60820 299395 297791 gene locus_tag LOCUS_60830 299395 297791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60830 300615 299659 gene locus_tag LOCUS_60840 300615 299659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60840 302029 300767 gene locus_tag LOCUS_60850 302029 300767 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110111.1 protein_id gnl|my_center|LOCUS_60850 303588 302026 gene locus_tag LOCUS_60860 303588 302026 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084147.1 protein_id gnl|my_center|LOCUS_60860 304708 303626 gene locus_tag LOCUS_60870 304708 303626 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_60870 304985 307822 gene locus_tag LOCUS_60880 304985 307822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60880 309452 307833 gene locus_tag LOCUS_60890 309452 307833 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_60890 310710 309478 gene locus_tag LOCUS_60900 310710 309478 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044856615.1 protein_id gnl|my_center|LOCUS_60900 315029 310707 gene locus_tag LOCUS_60910 315029 310707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60910 319427 315036 gene locus_tag LOCUS_60920 319427 315036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60920 324550 319424 gene locus_tag LOCUS_60930 324550 319424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60930 325455 324565 gene locus_tag LOCUS_60940 325455 324565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60940 325686 326795 gene locus_tag LOCUS_60950 325686 326795 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078864641.1 protein_id gnl|my_center|LOCUS_60950 326822 327064 gene locus_tag LOCUS_60960 326822 327064 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973134.1 protein_id gnl|my_center|LOCUS_60960 327061 328275 gene locus_tag LOCUS_60970 327061 328275 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030513.1 protein_id gnl|my_center|LOCUS_60970 328328 329875 gene locus_tag LOCUS_60980 328328 329875 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887610.1 protein_id gnl|my_center|LOCUS_60980 329979 330515 gene locus_tag LOCUS_60990 329979 330515 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977747.1 protein_id gnl|my_center|LOCUS_60990 330732 330941 gene locus_tag LOCUS_61000 330732 330941 CDS product MbtH family NRPS accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226600.1 protein_id gnl|my_center|LOCUS_61000 333735 331678 gene locus_tag LOCUS_61010 333735 331678 CDS product glycosyl hydrolase family 28-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201368745.1 protein_id gnl|my_center|LOCUS_61010 335940 333823 gene locus_tag LOCUS_61020 335940 333823 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228262.1 protein_id gnl|my_center|LOCUS_61020 336170 336961 gene locus_tag LOCUS_61030 336170 336961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61030 337109 338686 gene locus_tag LOCUS_61040 337109 338686 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411714.1 protein_id gnl|my_center|LOCUS_61040 340100 338754 gene locus_tag LOCUS_61050 340100 338754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029515.1 protein_id gnl|my_center|LOCUS_61050 340152 340511 gene locus_tag LOCUS_61060 340152 340511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61060 340593 341486 gene locus_tag LOCUS_61070 340593 341486 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230149.1 protein_id gnl|my_center|LOCUS_61070 341483 342550 gene locus_tag LOCUS_61080 341483 342550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61080 >Feature sequence36 755 90 gene locus_tag LOCUS_61090 755 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61090 2030 1155 gene locus_tag LOCUS_61100 2030 1155 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222042.1 protein_id gnl|my_center|LOCUS_61100 3523 2066 gene locus_tag LOCUS_61110 3523 2066 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222041.1 protein_id gnl|my_center|LOCUS_61110 6089 4188 gene locus_tag LOCUS_61120 6089 4188 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031107.1 protein_id gnl|my_center|LOCUS_61120 9835 6086 gene locus_tag LOCUS_61130 9835 6086 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031106.1 protein_id gnl|my_center|LOCUS_61130 11022 9832 gene locus_tag LOCUS_61140 11022 9832 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977648.1 protein_id gnl|my_center|LOCUS_61140 16134 11059 gene locus_tag LOCUS_61150 16134 11059 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031105.1 protein_id gnl|my_center|LOCUS_61150 17060 16194 gene locus_tag LOCUS_61160 17060 16194 CDS product DUF4132 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031104.1 protein_id gnl|my_center|LOCUS_61160 19666 17564 gene locus_tag LOCUS_61170 gene glgB 19666 17564 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_61170 21747 19654 gene locus_tag LOCUS_61180 21747 19654 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110136.1 protein_id gnl|my_center|LOCUS_61180 22675 21830 gene locus_tag LOCUS_61190 22675 21830 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729274.1 protein_id gnl|my_center|LOCUS_61190 23423 22950 gene locus_tag LOCUS_61200 23423 22950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61200 23663 23436 gene locus_tag LOCUS_61210 23663 23436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61210 24159 23743 gene locus_tag LOCUS_61220 24159 23743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61220 24215 24373 gene locus_tag LOCUS_61230 24215 24373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61230 24423 24710 gene locus_tag LOCUS_61240 24423 24710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61240 24700 25155 gene locus_tag LOCUS_61250 24700 25155 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972683.1 protein_id gnl|my_center|LOCUS_61250 26383 25163 gene locus_tag LOCUS_61260 gene glgA 26383 25163 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805185.1 protein_id gnl|my_center|LOCUS_61260 26446 27678 gene locus_tag LOCUS_61270 gene glgC 26446 27678 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805186.1 protein_id gnl|my_center|LOCUS_61270 27746 29389 gene locus_tag LOCUS_61280 gene pgm 27746 29389 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_61280 30146 29376 gene locus_tag LOCUS_61290 30146 29376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61290 30826 30131 gene locus_tag LOCUS_61300 30826 30131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61300 34164 31054 gene locus_tag LOCUS_61310 34164 31054 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028058.1 protein_id gnl|my_center|LOCUS_61310 34392 34961 gene locus_tag LOCUS_61320 34392 34961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61320 34961 35665 gene locus_tag LOCUS_61330 34961 35665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61330 36843 35551 gene locus_tag LOCUS_61340 36843 35551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61340 36952 38079 gene locus_tag LOCUS_61350 36952 38079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61350 38083 39417 gene locus_tag LOCUS_61360 38083 39417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61360 39531 40490 gene locus_tag LOCUS_61370 39531 40490 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_61370 40490 41899 gene locus_tag LOCUS_61380 gene wzx 40490 41899 CDS product O157 family O-antigen flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033576.1 protein_id gnl|my_center|LOCUS_61380 41880 43298 gene locus_tag LOCUS_61390 41880 43298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61390 44758 43436 gene locus_tag LOCUS_61400 44758 43436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61400 45244 46284 gene locus_tag LOCUS_61410 45244 46284 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942886.1 protein_id gnl|my_center|LOCUS_61410 46278 47405 gene locus_tag LOCUS_61420 46278 47405 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963418.1 protein_id gnl|my_center|LOCUS_61420 47402 48640 gene locus_tag LOCUS_61430 47402 48640 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_61430 48649 49761 gene locus_tag LOCUS_61440 gene wecB 48649 49761 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817161.1 protein_id gnl|my_center|LOCUS_61440 50865 49810 gene locus_tag LOCUS_61450 50865 49810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61450 51995 50862 gene locus_tag LOCUS_61460 51995 50862 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013588.1 protein_id gnl|my_center|LOCUS_61460 52819 52439 gene locus_tag LOCUS_61470 52819 52439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61470 53384 52953 gene locus_tag LOCUS_61480 53384 52953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61480 54174 53743 gene locus_tag LOCUS_61490 54174 53743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61490 56764 54248 gene locus_tag LOCUS_61500 56764 54248 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223450.1 protein_id gnl|my_center|LOCUS_61500 56803 58452 gene locus_tag LOCUS_61510 gene dgt 56803 58452 CDS product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224725.1 protein_id gnl|my_center|LOCUS_61510 59659 58520 gene locus_tag LOCUS_61520 59659 58520 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224399.1 protein_id gnl|my_center|LOCUS_61520 60776 59766 gene locus_tag LOCUS_61530 60776 59766 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850119.1 protein_id gnl|my_center|LOCUS_61530 60676 60930 gene locus_tag LOCUS_61540 60676 60930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61540 62092 60908 gene locus_tag LOCUS_61550 62092 60908 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226129.1 protein_id gnl|my_center|LOCUS_61550 63135 62374 gene locus_tag LOCUS_61560 63135 62374 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225083.1 protein_id gnl|my_center|LOCUS_61560 65069 63132 gene locus_tag LOCUS_61570 65069 63132 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977936.1 protein_id gnl|my_center|LOCUS_61570 65704 65072 gene locus_tag LOCUS_61580 65704 65072 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225081.1 protein_id gnl|my_center|LOCUS_61580 65833 66768 gene locus_tag LOCUS_61590 65833 66768 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977934.1 protein_id gnl|my_center|LOCUS_61590 66964 68004 gene locus_tag LOCUS_61600 gene rfbB 66964 68004 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_61600 72060 68020 gene locus_tag LOCUS_61610 gene hrpA 72060 68020 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029425.1 protein_id gnl|my_center|LOCUS_61610 72165 72602 gene locus_tag LOCUS_61620 72165 72602 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030385.1 protein_id gnl|my_center|LOCUS_61620 72993 72634 gene locus_tag LOCUS_61630 72993 72634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61630 73134 75194 gene locus_tag LOCUS_61640 73134 75194 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943296.1 protein_id gnl|my_center|LOCUS_61640 75248 76294 gene locus_tag LOCUS_61650 75248 76294 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 protein_id gnl|my_center|LOCUS_61650 76291 77355 gene locus_tag LOCUS_61660 76291 77355 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868181.1 protein_id gnl|my_center|LOCUS_61660 77442 78320 gene locus_tag LOCUS_61670 77442 78320 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 protein_id gnl|my_center|LOCUS_61670 78332 79273 gene locus_tag LOCUS_61680 78332 79273 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106346642.1 protein_id gnl|my_center|LOCUS_61680 80281 79382 gene locus_tag LOCUS_61690 80281 79382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727284.1 protein_id gnl|my_center|LOCUS_61690 81206 80559 gene locus_tag LOCUS_61700 81206 80559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61700 81403 82236 gene locus_tag LOCUS_61710 81403 82236 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027106.1 protein_id gnl|my_center|LOCUS_61710 82229 82783 gene locus_tag LOCUS_61720 82229 82783 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027107.1 protein_id gnl|my_center|LOCUS_61720 85381 82868 gene locus_tag LOCUS_61730 85381 82868 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 protein_id gnl|my_center|LOCUS_61730 86200 85460 gene locus_tag LOCUS_61740 gene trmB 86200 85460 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974862.1 protein_id gnl|my_center|LOCUS_61740 86330 87118 gene locus_tag LOCUS_61750 86330 87118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61750 87127 87843 gene locus_tag LOCUS_61760 87127 87843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61760 88274 88723 gene locus_tag LOCUS_61770 88274 88723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61770 88804 89085 gene locus_tag LOCUS_61780 88804 89085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61780 89549 90049 gene locus_tag LOCUS_61790 89549 90049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61790 90485 90162 gene locus_tag LOCUS_61800 gene mhuD 90485 90162 CDS product mycobilin-forming heme oxygenase MhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065009.1 protein_id gnl|my_center|LOCUS_61800 91321 90524 gene locus_tag LOCUS_61810 91321 90524 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030841.1 protein_id gnl|my_center|LOCUS_61810 92279 91359 gene locus_tag LOCUS_61820 92279 91359 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229588.1 protein_id gnl|my_center|LOCUS_61820 92691 93668 gene locus_tag LOCUS_61830 92691 93668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61830 93756 93902 gene locus_tag LOCUS_61840 93756 93902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61840 93950 94732 gene locus_tag LOCUS_61850 93950 94732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61850 95681 94833 gene locus_tag LOCUS_61860 95681 94833 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976414.1 protein_id gnl|my_center|LOCUS_61860 95896 96123 gene locus_tag LOCUS_61870 95896 96123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61870 96137 97549 gene locus_tag LOCUS_61880 96137 97549 CDS product NADP-dependent succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081095.1 protein_id gnl|my_center|LOCUS_61880 97588 98550 gene locus_tag LOCUS_61890 97588 98550 CDS product TIGR03885 family FMN-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975020.1 protein_id gnl|my_center|LOCUS_61890 98579 100150 gene locus_tag LOCUS_61900 98579 100150 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973724.1 protein_id gnl|my_center|LOCUS_61900 100150 100407 gene locus_tag LOCUS_61910 100150 100407 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727177.1 protein_id gnl|my_center|LOCUS_61910 100651 101847 gene locus_tag LOCUS_61920 100651 101847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61920 102417 101926 gene locus_tag LOCUS_61930 102417 101926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61930 102483 102635 gene locus_tag LOCUS_61940 102483 102635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61940 105486 102865 gene locus_tag LOCUS_61950 105486 102865 CDS product cellulase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027340.1 protein_id gnl|my_center|LOCUS_61950 105707 106435 gene locus_tag LOCUS_61960 105707 106435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61960 109277 106611 gene locus_tag LOCUS_61970 gene hrpB 109277 106611 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129699620.1 protein_id gnl|my_center|LOCUS_61970 109605 110231 gene locus_tag LOCUS_61980 109605 110231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61980 110435 110244 gene locus_tag LOCUS_61990 110435 110244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61990 110350 111798 gene locus_tag LOCUS_62000 110350 111798 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027916.1 protein_id gnl|my_center|LOCUS_62000 111795 112388 gene locus_tag LOCUS_62010 111795 112388 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973719.1 protein_id gnl|my_center|LOCUS_62010 113372 112545 gene locus_tag LOCUS_62020 113372 112545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62020 113842 114594 gene locus_tag LOCUS_62030 113842 114594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62030 116132 114543 gene locus_tag LOCUS_62040 116132 114543 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104297.1 protein_id gnl|my_center|LOCUS_62040 116277 116405 gene locus_tag LOCUS_62050 116277 116405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62050 117447 116461 gene locus_tag LOCUS_62060 117447 116461 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_62060 117961 117458 gene locus_tag LOCUS_62070 117961 117458 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228449.1 protein_id gnl|my_center|LOCUS_62070 118014 118622 gene locus_tag LOCUS_62080 118014 118622 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870827.1 protein_id gnl|my_center|LOCUS_62080 119832 118894 gene locus_tag LOCUS_62090 119832 118894 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027747.1 protein_id gnl|my_center|LOCUS_62090 120783 120196 gene locus_tag LOCUS_62100 120783 120196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62100 121008 122852 gene locus_tag LOCUS_62110 121008 122852 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186147.1 protein_id gnl|my_center|LOCUS_62110 122852 123631 gene locus_tag LOCUS_62120 gene gdh 122852 123631 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246720.1 protein_id gnl|my_center|LOCUS_62120 125167 123806 gene locus_tag LOCUS_62130 125167 123806 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020638993.1 protein_id gnl|my_center|LOCUS_62130 125301 125801 gene locus_tag LOCUS_62140 125301 125801 CDS product YfcE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228757.1 protein_id gnl|my_center|LOCUS_62140 126476 125865 gene locus_tag LOCUS_62150 126476 125865 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027648.1 protein_id gnl|my_center|LOCUS_62150 126564 127592 gene locus_tag LOCUS_62160 126564 127592 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 protein_id gnl|my_center|LOCUS_62160 129091 127814 gene locus_tag LOCUS_62170 129091 127814 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389104.1 protein_id gnl|my_center|LOCUS_62170 131578 129452 gene locus_tag LOCUS_62180 131578 129452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62180 131790 132665 gene locus_tag LOCUS_62190 131790 132665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223993.1 protein_id gnl|my_center|LOCUS_62190 133167 132721 gene locus_tag LOCUS_62200 133167 132721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62200 133261 133707 gene locus_tag LOCUS_62210 133261 133707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250160.1 protein_id gnl|my_center|LOCUS_62210 133957 133745 gene locus_tag LOCUS_62220 133957 133745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62220 134145 135341 gene locus_tag LOCUS_62230 134145 135341 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256286.1 protein_id gnl|my_center|LOCUS_62230 135927 135529 gene locus_tag LOCUS_62240 135927 135529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62240 136363 135902 gene locus_tag LOCUS_62250 136363 135902 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227042.1 protein_id gnl|my_center|LOCUS_62250 136835 136419 gene locus_tag LOCUS_62260 136835 136419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62260 137968 136904 gene locus_tag LOCUS_62270 137968 136904 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226134.1 protein_id gnl|my_center|LOCUS_62270 138175 138576 gene locus_tag LOCUS_62280 138175 138576 CDS product ChaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228348.1 protein_id gnl|my_center|LOCUS_62280 140025 138622 gene locus_tag LOCUS_62290 140025 138622 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226111.1 protein_id gnl|my_center|LOCUS_62290 140128 141732 gene locus_tag LOCUS_62300 140128 141732 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092532455.1 protein_id gnl|my_center|LOCUS_62300 142713 141946 gene locus_tag LOCUS_62310 142713 141946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62310 143300 142872 gene locus_tag LOCUS_62320 143300 142872 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226133.1 protein_id gnl|my_center|LOCUS_62320 143616 145352 gene locus_tag LOCUS_62330 143616 145352 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206025215.1 protein_id gnl|my_center|LOCUS_62330 145349 146323 gene locus_tag LOCUS_62340 145349 146323 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030720.1 protein_id gnl|my_center|LOCUS_62340 146308 147525 gene locus_tag LOCUS_62350 146308 147525 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 protein_id gnl|my_center|LOCUS_62350 147525 148328 gene locus_tag LOCUS_62360 147525 148328 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030722.1 protein_id gnl|my_center|LOCUS_62360 148341 149843 gene locus_tag LOCUS_62370 gene rfaE2 148341 149843 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270276.1 protein_id gnl|my_center|LOCUS_62370 149840 150541 gene locus_tag LOCUS_62380 149840 150541 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226117.1 protein_id gnl|my_center|LOCUS_62380 150538 151536 gene locus_tag LOCUS_62390 150538 151536 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226116.1 protein_id gnl|my_center|LOCUS_62390 151520 152503 gene locus_tag LOCUS_62400 151520 152503 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727903.1 protein_id gnl|my_center|LOCUS_62400 153855 152836 gene locus_tag LOCUS_62410 153855 152836 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487139.1 protein_id gnl|my_center|LOCUS_62410 153755 154060 gene locus_tag LOCUS_62420 153755 154060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62420 154251 154003 gene locus_tag LOCUS_62430 154251 154003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62430 155381 154248 gene locus_tag LOCUS_62440 155381 154248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62440 155622 155443 gene locus_tag LOCUS_62450 155622 155443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62450 155917 155600 gene locus_tag LOCUS_62460 155917 155600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62460 157216 156005 gene locus_tag LOCUS_62470 157216 156005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62470 157589 157861 gene locus_tag LOCUS_62480 157589 157861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62480 158374 157871 gene locus_tag LOCUS_62490 158374 157871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62490 160176 158449 gene locus_tag LOCUS_62500 160176 158449 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226038.1 protein_id gnl|my_center|LOCUS_62500 160521 162062 gene locus_tag LOCUS_62510 160521 162062 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030606.1 protein_id gnl|my_center|LOCUS_62510 162573 162238 gene locus_tag LOCUS_62520 162573 162238 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888479.1 protein_id gnl|my_center|LOCUS_62520 162629 163039 gene locus_tag LOCUS_62530 162629 163039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62530 163100 163924 gene locus_tag LOCUS_62540 163100 163924 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222911.1 protein_id gnl|my_center|LOCUS_62540 164005 165219 gene locus_tag LOCUS_62550 164005 165219 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226510.1 protein_id gnl|my_center|LOCUS_62550 165432 165866 gene locus_tag LOCUS_62560 165432 165866 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225267572.1 protein_id gnl|my_center|LOCUS_62560 165863 166201 gene locus_tag LOCUS_62570 165863 166201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62570 166198 166470 gene locus_tag LOCUS_62580 166198 166470 CDS product DUF4235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978083.1 protein_id gnl|my_center|LOCUS_62580 166764 166967 gene locus_tag LOCUS_62590 166764 166967 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551414.1 protein_id gnl|my_center|LOCUS_62590 167269 167075 gene locus_tag LOCUS_62600 167269 167075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62600 167308 167985 gene locus_tag LOCUS_62610 167308 167985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62610 167982 169007 gene locus_tag LOCUS_62620 167982 169007 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030372.1 protein_id gnl|my_center|LOCUS_62620 170649 169246 gene locus_tag LOCUS_62630 170649 169246 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027197.1 protein_id gnl|my_center|LOCUS_62630 171320 170679 gene locus_tag LOCUS_62640 171320 170679 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_62640 171441 172361 gene locus_tag LOCUS_62650 171441 172361 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_62650 172469 174478 gene locus_tag LOCUS_62660 gene thrS 172469 174478 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227149.1 protein_id gnl|my_center|LOCUS_62660 175294 174557 gene locus_tag LOCUS_62670 175294 174557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62670 175483 176028 gene locus_tag LOCUS_62680 175483 176028 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227148.1 protein_id gnl|my_center|LOCUS_62680 176123 177160 gene locus_tag LOCUS_62690 176123 177160 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394598.1 protein_id gnl|my_center|LOCUS_62690 179479 177317 gene locus_tag LOCUS_62700 179479 177317 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227139.1 protein_id gnl|my_center|LOCUS_62700 179733 180359 gene locus_tag LOCUS_62710 179733 180359 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227146.1 protein_id gnl|my_center|LOCUS_62710 180362 181309 gene locus_tag LOCUS_62720 180362 181309 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_62720 181326 182486 gene locus_tag LOCUS_62730 181326 182486 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_62730 182569 183069 gene locus_tag LOCUS_62740 182569 183069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227143.1 protein_id gnl|my_center|LOCUS_62740 183232 184149 gene locus_tag LOCUS_62750 gene pdxS 183232 184149 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_62750 184222 184824 gene locus_tag LOCUS_62760 gene pdxT 184222 184824 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_62760 185067 185816 gene locus_tag LOCUS_62770 185067 185816 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413464.1 protein_id gnl|my_center|LOCUS_62770 185800 186513 gene locus_tag LOCUS_62780 185800 186513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62780 186754 188010 gene locus_tag LOCUS_62790 186754 188010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62790 189017 188070 gene locus_tag LOCUS_62800 189017 188070 CDS product permease prefix domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804079.1 protein_id gnl|my_center|LOCUS_62800 189355 189014 gene locus_tag LOCUS_62810 189355 189014 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804080.1 protein_id gnl|my_center|LOCUS_62810 189551 193084 gene locus_tag LOCUS_62820 gene dnaE 189551 193084 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976751.1 protein_id gnl|my_center|LOCUS_62820 193302 194339 gene locus_tag LOCUS_62830 193302 194339 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228127.1 protein_id gnl|my_center|LOCUS_62830 195239 194379 gene locus_tag LOCUS_62840 195239 194379 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416086.1 protein_id gnl|my_center|LOCUS_62840 196692 196093 gene locus_tag LOCUS_62850 196692 196093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62850 197296 198816 gene locus_tag LOCUS_62860 197296 198816 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030040.1 protein_id gnl|my_center|LOCUS_62860 198828 199436 gene locus_tag LOCUS_62870 198828 199436 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140673.1 protein_id gnl|my_center|LOCUS_62870 199572 200099 gene locus_tag LOCUS_62880 gene ruvC 199572 200099 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 protein_id gnl|my_center|LOCUS_62880 200096 200698 gene locus_tag LOCUS_62890 gene ruvA 200096 200698 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_62890 200695 202779 gene locus_tag LOCUS_62900 200695 202779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62900 202920 203267 gene locus_tag LOCUS_62910 gene yajC 202920 203267 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723533.1 protein_id gnl|my_center|LOCUS_62910 203488 205401 gene locus_tag LOCUS_62920 gene secD 203488 205401 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467234.1 protein_id gnl|my_center|LOCUS_62920 205403 206593 gene locus_tag LOCUS_62930 gene secF 205403 206593 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227118.1 protein_id gnl|my_center|LOCUS_62930 206697 207263 gene locus_tag LOCUS_62940 206697 207263 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 protein_id gnl|my_center|LOCUS_62940 207586 210072 gene locus_tag LOCUS_62950 gene relA 207586 210072 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_62950 210970 210131 gene locus_tag LOCUS_62960 210970 210131 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977316.1 protein_id gnl|my_center|LOCUS_62960 211918 211034 gene locus_tag LOCUS_62970 211918 211034 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728734.1 protein_id gnl|my_center|LOCUS_62970 212181 212900 gene locus_tag LOCUS_62980 212181 212900 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_62980 212971 214305 gene locus_tag LOCUS_62990 gene hisS 212971 214305 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805006.1 protein_id gnl|my_center|LOCUS_62990 214406 215341 gene locus_tag LOCUS_63000 214406 215341 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225966.1 protein_id gnl|my_center|LOCUS_63000 215834 216886 gene locus_tag LOCUS_63010 215834 216886 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027949.1 protein_id gnl|my_center|LOCUS_63010 217621 217010 gene locus_tag LOCUS_63020 217621 217010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63020 217812 219617 gene locus_tag LOCUS_63030 gene aspS 217812 219617 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027660890.1 protein_id gnl|my_center|LOCUS_63030 219687 220502 gene locus_tag LOCUS_63040 219687 220502 CDS product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031499.1 protein_id gnl|my_center|LOCUS_63040 220588 221181 gene locus_tag LOCUS_63050 220588 221181 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976769.1 protein_id gnl|my_center|LOCUS_63050 221178 222632 gene locus_tag LOCUS_63060 221178 222632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63060 223421 222681 gene locus_tag LOCUS_63070 223421 222681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63070 223560 223790 gene locus_tag LOCUS_63080 223560 223790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63080 223866 225362 gene locus_tag LOCUS_63090 223866 225362 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224577.1 protein_id gnl|my_center|LOCUS_63090 225359 228388 gene locus_tag LOCUS_63100 225359 228388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63100 228538 228999 gene locus_tag LOCUS_63110 228538 228999 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224580.1 protein_id gnl|my_center|LOCUS_63110 229028 229333 gene locus_tag LOCUS_63120 229028 229333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63120 229330 232008 gene locus_tag LOCUS_63130 gene alaS 229330 232008 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 protein_id gnl|my_center|LOCUS_63130 232079 232543 gene locus_tag LOCUS_63140 gene ruvX 232079 232543 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051736371.1 protein_id gnl|my_center|LOCUS_63140 232540 233742 gene locus_tag LOCUS_63150 gene mltG 232540 233742 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775669.1 protein_id gnl|my_center|LOCUS_63150 233742 234584 gene locus_tag LOCUS_63160 233742 234584 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_63160 234773 235537 gene locus_tag LOCUS_63170 234773 235537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63170 235686 236801 gene locus_tag LOCUS_63180 gene aroC 235686 236801 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_63180 236798 237310 gene locus_tag LOCUS_63190 236798 237310 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027814.1 protein_id gnl|my_center|LOCUS_63190 238131 237337 gene locus_tag LOCUS_63200 238131 237337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63200 238682 238128 gene locus_tag LOCUS_63210 238682 238128 CDS product DUF2243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878720.1 protein_id gnl|my_center|LOCUS_63210 238837 239913 gene locus_tag LOCUS_63220 gene aroB 238837 239913 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_63220 239910 240359 gene locus_tag LOCUS_63230 gene aroQ 239910 240359 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224605.1 protein_id gnl|my_center|LOCUS_63230 240433 240990 gene locus_tag LOCUS_63240 gene efp 240433 240990 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_63240 240990 241424 gene locus_tag LOCUS_63250 gene nusB 240990 241424 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224611.1 protein_id gnl|my_center|LOCUS_63250 241993 241505 gene locus_tag LOCUS_63260 gene bldD 241993 241505 CDS product transcriptional regulator BldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_63260 242276 242863 gene locus_tag LOCUS_63270 gene pyrR 242276 242863 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_63270 242860 243786 gene locus_tag LOCUS_63280 242860 243786 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_63280 243783 245060 gene locus_tag LOCUS_63290 243783 245060 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_63290 245119 246303 gene locus_tag LOCUS_63300 gene carA 245119 246303 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_63300 246296 249643 gene locus_tag LOCUS_63310 gene carB 246296 249643 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224620.1 protein_id gnl|my_center|LOCUS_63310 249690 250730 gene locus_tag LOCUS_63320 249690 250730 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228062.1 protein_id gnl|my_center|LOCUS_63320 250906 252180 gene locus_tag LOCUS_63330 250906 252180 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224093.1 protein_id gnl|my_center|LOCUS_63330 252307 253143 gene locus_tag LOCUS_63340 gene pyrF 252307 253143 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485777.1 protein_id gnl|my_center|LOCUS_63340 253323 253640 gene locus_tag LOCUS_63350 gene mihF 253323 253640 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224622.1 protein_id gnl|my_center|LOCUS_63350 253691 254224 gene locus_tag LOCUS_63360 253691 254224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63360 254271 254534 gene locus_tag LOCUS_63370 gene rpoZ 254271 254534 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_63370 254550 255758 gene locus_tag LOCUS_63380 gene coaBC 254550 255758 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_63380 255843 257036 gene locus_tag LOCUS_63390 gene metK 255843 257036 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_63390 257096 259006 gene locus_tag LOCUS_63400 257096 259006 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224627.1 protein_id gnl|my_center|LOCUS_63400 259314 260297 gene locus_tag LOCUS_63410 259314 260297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63410 260507 261067 gene locus_tag LOCUS_63420 gene def 260507 261067 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856004.1 protein_id gnl|my_center|LOCUS_63420 261073 261999 gene locus_tag LOCUS_63430 gene fmt 261073 261999 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_63430 261996 263522 gene locus_tag LOCUS_63440 261996 263522 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296596.1 protein_id gnl|my_center|LOCUS_63440 264461 263601 gene locus_tag LOCUS_63450 264461 263601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63450 264913 265593 gene locus_tag LOCUS_63460 gene rpe 264913 265593 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898866.1 protein_id gnl|my_center|LOCUS_63460 265595 266551 gene locus_tag LOCUS_63470 265595 266551 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255942.1 protein_id gnl|my_center|LOCUS_63470 267031 266765 gene locus_tag LOCUS_63480 267031 266765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63480 266952 268013 gene locus_tag LOCUS_63490 gene ribD 266952 268013 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035932.1 protein_id gnl|my_center|LOCUS_63490 268015 268629 gene locus_tag LOCUS_63500 268015 268629 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057751.1 protein_id gnl|my_center|LOCUS_63500 268626 269327 gene locus_tag LOCUS_63510 gene pnuC 268626 269327 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013360.1 protein_id gnl|my_center|LOCUS_63510 269324 270589 gene locus_tag LOCUS_63520 269324 270589 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 protein_id gnl|my_center|LOCUS_63520 270592 271089 gene locus_tag LOCUS_63530 gene ribH 270592 271089 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728796.1 protein_id gnl|my_center|LOCUS_63530 271991 271248 gene locus_tag LOCUS_63540 271991 271248 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937416.1 protein_id gnl|my_center|LOCUS_63540 272839 271994 gene locus_tag LOCUS_63550 272839 271994 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053659.1 protein_id gnl|my_center|LOCUS_63550 273711 272836 gene locus_tag LOCUS_63560 273711 272836 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 protein_id gnl|my_center|LOCUS_63560 273849 274133 gene locus_tag LOCUS_63570 273849 274133 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061184.1 protein_id gnl|my_center|LOCUS_63570 274181 275026 gene locus_tag LOCUS_63580 gene hisG 274181 275026 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_63580 275023 276105 gene locus_tag LOCUS_63590 275023 276105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63590 276190 276651 gene locus_tag LOCUS_63600 276190 276651 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224643.1 protein_id gnl|my_center|LOCUS_63600 277108 277758 gene locus_tag LOCUS_63610 gene infC 277108 277758 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_63610 277778 277972 gene locus_tag LOCUS_63620 gene rpmI 277778 277972 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776198.1 protein_id gnl|my_center|LOCUS_63620 278006 278398 gene locus_tag LOCUS_63630 gene rplT 278006 278398 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559056.1 protein_id gnl|my_center|LOCUS_63630 278482 279279 gene locus_tag LOCUS_63640 278482 279279 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_63640 279529 280608 gene locus_tag LOCUS_63650 gene pheS 279529 280608 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227844.1 protein_id gnl|my_center|LOCUS_63650 280648 283197 gene locus_tag LOCUS_63660 gene pheT 280648 283197 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093159782.1 protein_id gnl|my_center|LOCUS_63660 283224 283670 gene locus_tag LOCUS_63670 283224 283670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63670 283953 283738 gene locus_tag LOCUS_63680 283953 283738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63680 284115 284666 gene locus_tag LOCUS_63690 284115 284666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63690 284694 285233 gene locus_tag LOCUS_63700 284694 285233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63700 285230 287074 gene locus_tag LOCUS_63710 285230 287074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851158.1 protein_id gnl|my_center|LOCUS_63710 288873 287044 gene locus_tag LOCUS_63720 288873 287044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63720 289152 290153 gene locus_tag LOCUS_63730 gene argC 289152 290153 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 protein_id gnl|my_center|LOCUS_63730 290150 291322 gene locus_tag LOCUS_63740 gene argJ 290150 291322 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_63740 291319 292206 gene locus_tag LOCUS_63750 gene argB 291319 292206 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_63750 292203 293384 gene locus_tag LOCUS_63760 292203 293384 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977247.1 protein_id gnl|my_center|LOCUS_63760 293381 294307 gene locus_tag LOCUS_63770 gene argF 293381 294307 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729314.1 protein_id gnl|my_center|LOCUS_63770 294304 294819 gene locus_tag LOCUS_63780 294304 294819 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227833.1 protein_id gnl|my_center|LOCUS_63780 294816 296021 gene locus_tag LOCUS_63790 294816 296021 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079277.1 protein_id gnl|my_center|LOCUS_63790 296036 297499 gene locus_tag LOCUS_63800 gene argH 296036 297499 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027854.1 protein_id gnl|my_center|LOCUS_63800 297957 297601 gene locus_tag LOCUS_63810 297957 297601 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113498.1 protein_id gnl|my_center|LOCUS_63810 298559 297954 gene locus_tag LOCUS_63820 298559 297954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63820 299310 299690 gene locus_tag LOCUS_63830 299310 299690 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730705.1 protein_id gnl|my_center|LOCUS_63830 299945 301252 gene locus_tag LOCUS_63840 299945 301252 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214261.1 protein_id gnl|my_center|LOCUS_63840 301342 301983 gene locus_tag LOCUS_63850 301342 301983 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_63850 302078 303163 gene locus_tag LOCUS_63860 302078 303163 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_63860 303164 303439 gene locus_tag LOCUS_63870 303164 303439 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223899.1 protein_id gnl|my_center|LOCUS_63870 303542 304684 gene locus_tag LOCUS_63880 303542 304684 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223202.1 protein_id gnl|my_center|LOCUS_63880 304681 305304 gene locus_tag LOCUS_63890 304681 305304 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223203.1 protein_id gnl|my_center|LOCUS_63890 306263 305394 gene locus_tag LOCUS_63900 306263 305394 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064726614.1 protein_id gnl|my_center|LOCUS_63900 307394 306498 gene locus_tag LOCUS_63910 307394 306498 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064726614.1 protein_id gnl|my_center|LOCUS_63910 310159 307391 gene locus_tag LOCUS_63920 310159 307391 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139455818.1 protein_id gnl|my_center|LOCUS_63920 310429 310905 gene locus_tag LOCUS_63930 310429 310905 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 protein_id gnl|my_center|LOCUS_63930 311045 311527 gene locus_tag LOCUS_63940 311045 311527 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976947.1 protein_id gnl|my_center|LOCUS_63940 311586 312227 gene locus_tag LOCUS_63950 311586 312227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63950 312403 313740 gene locus_tag LOCUS_63960 312403 313740 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803904.1 protein_id gnl|my_center|LOCUS_63960 314116 313808 gene locus_tag LOCUS_63970 314116 313808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63970 314483 314103 gene locus_tag LOCUS_63980 314483 314103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225139.1 protein_id gnl|my_center|LOCUS_63980 315719 314493 gene locus_tag LOCUS_63990 315719 314493 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225140.1 protein_id gnl|my_center|LOCUS_63990 316197 315808 gene locus_tag LOCUS_64000 316197 315808 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079384.1 protein_id gnl|my_center|LOCUS_64000 316293 317606 gene locus_tag LOCUS_64010 gene tyrS 316293 317606 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_64010 >Feature sequence37 71 370 gene locus_tag LOCUS_64020 71 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64020 524 2323 gene locus_tag LOCUS_64030 524 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64030 3157 2912 gene locus_tag LOCUS_64040 3157 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64040 3497 3093 gene locus_tag LOCUS_64050 3497 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64050 3737 5113 gene locus_tag LOCUS_64060 3737 5113 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222041.1 protein_id gnl|my_center|LOCUS_64060 5110 6087 gene locus_tag LOCUS_64070 5110 6087 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222042.1 protein_id gnl|my_center|LOCUS_64070 6936 6175 gene locus_tag LOCUS_64080 6936 6175 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222578.1 protein_id gnl|my_center|LOCUS_64080 7225 12825 gene locus_tag LOCUS_64090 7225 12825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64090 12869 32347 gene locus_tag LOCUS_64100 12869 32347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64100 32628 33485 gene locus_tag LOCUS_64110 32628 33485 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_64110 33821 56497 gene locus_tag LOCUS_64120 33821 56497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64120 57041 56823 gene locus_tag LOCUS_64130 57041 56823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64130 57899 57051 gene locus_tag LOCUS_64140 57899 57051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64140 59030 58806 gene locus_tag LOCUS_64150 59030 58806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64150 59396 86959 gene locus_tag LOCUS_64160 59396 86959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64160 87698 88060 gene locus_tag LOCUS_64170 87698 88060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64170 88936 89835 gene locus_tag LOCUS_64180 gene cdtA 88936 89835 CDS product siderophore ABC transporter ATP-binding protein CdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971743.1 protein_id gnl|my_center|LOCUS_64180 89832 90890 gene locus_tag LOCUS_64190 gene cdtB 89832 90890 CDS product siderophore ABC transporter substrate-binding protein CdtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971744.1 protein_id gnl|my_center|LOCUS_64190 90887 92977 gene locus_tag LOCUS_64200 gene cdtC 90887 92977 CDS product siderophore ABC transporter permease CdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031636.1 protein_id gnl|my_center|LOCUS_64200 93717 92941 gene locus_tag LOCUS_64210 93717 92941 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535735.1 protein_id gnl|my_center|LOCUS_64210 94509 94147 gene locus_tag LOCUS_64220 94509 94147 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176604057.1 protein_id gnl|my_center|LOCUS_64220 95192 96415 gene locus_tag LOCUS_64230 95192 96415 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227319.1 protein_id gnl|my_center|LOCUS_64230 97087 96542 gene locus_tag LOCUS_64240 97087 96542 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390927.1 protein_id gnl|my_center|LOCUS_64240 97538 98872 gene locus_tag LOCUS_64250 97538 98872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64250 98874 99269 gene locus_tag LOCUS_64260 98874 99269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64260 100467 100027 gene locus_tag LOCUS_64270 100467 100027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64270 100715 100494 gene locus_tag LOCUS_64280 100715 100494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64280 100902 101333 gene locus_tag LOCUS_64290 100902 101333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64290 101326 101820 gene locus_tag LOCUS_64300 101326 101820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64300 101807 103030 gene locus_tag LOCUS_64310 101807 103030 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228562.1 protein_id gnl|my_center|LOCUS_64310 103510 113784 gene locus_tag LOCUS_64320 103510 113784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64320 113828 128758 gene locus_tag LOCUS_64330 113828 128758 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206334115.1 protein_id gnl|my_center|LOCUS_64330 128804 139975 gene locus_tag LOCUS_64340 128804 139975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64340 140019 154436 gene locus_tag LOCUS_64350 140019 154436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64350 154484 165478 gene locus_tag LOCUS_64360 154484 165478 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030786.1 protein_id gnl|my_center|LOCUS_64360 165515 170506 gene locus_tag LOCUS_64370 165515 170506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64370 170594 179998 gene locus_tag LOCUS_64380 170594 179998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64380 180024 185552 gene locus_tag LOCUS_64390 180024 185552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64390 185641 186675 gene locus_tag LOCUS_64400 185641 186675 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066146.1 protein_id gnl|my_center|LOCUS_64400 186672 187514 gene locus_tag LOCUS_64410 186672 187514 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146599.1 protein_id gnl|my_center|LOCUS_64410 190415 187578 gene locus_tag LOCUS_64420 190415 187578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64420 193743 190909 gene locus_tag LOCUS_64430 193743 190909 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223082.1 protein_id gnl|my_center|LOCUS_64430 195319 196698 gene locus_tag LOCUS_64440 195319 196698 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908096.1 protein_id gnl|my_center|LOCUS_64440 197166 196732 gene locus_tag LOCUS_64450 197166 196732 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030920.1 protein_id gnl|my_center|LOCUS_64450 197323 197985 gene locus_tag LOCUS_64460 197323 197985 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031096.1 protein_id gnl|my_center|LOCUS_64460 199418 198009 gene locus_tag LOCUS_64470 199418 198009 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406218.1 protein_id gnl|my_center|LOCUS_64470 199678 199968 gene locus_tag LOCUS_64480 199678 199968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64480 200132 201079 gene locus_tag LOCUS_64490 200132 201079 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 protein_id gnl|my_center|LOCUS_64490 201076 201813 gene locus_tag LOCUS_64500 201076 201813 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221994.1 protein_id gnl|my_center|LOCUS_64500 202528 202839 gene locus_tag LOCUS_64510 202528 202839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64510 205183 202928 gene locus_tag LOCUS_64520 205183 202928 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028552.1 protein_id gnl|my_center|LOCUS_64520 205730 205215 gene locus_tag LOCUS_64530 205730 205215 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730399.1 protein_id gnl|my_center|LOCUS_64530 205812 206321 gene locus_tag LOCUS_64540 205812 206321 CDS product DUF664 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224874.1 protein_id gnl|my_center|LOCUS_64540 207497 206367 gene locus_tag LOCUS_64550 207497 206367 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_64550 208033 207653 gene locus_tag LOCUS_64560 208033 207653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64560 208619 208224 gene locus_tag LOCUS_64570 208619 208224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64570 209347 208718 gene locus_tag LOCUS_64580 209347 208718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64580 210300 209434 gene locus_tag LOCUS_64590 210300 209434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64590 211574 210369 gene locus_tag LOCUS_64600 211574 210369 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 protein_id gnl|my_center|LOCUS_64600 212141 211905 gene locus_tag LOCUS_64610 212141 211905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64610 212597 212899 gene locus_tag LOCUS_64620 212597 212899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64620 214173 212950 gene locus_tag LOCUS_64630 214173 212950 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 protein_id gnl|my_center|LOCUS_64630 214353 214778 gene locus_tag LOCUS_64640 gene rirA 214353 214778 CDS product iron-responsive transcriptional regulator RirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531245.1 protein_id gnl|my_center|LOCUS_64640 216083 214827 gene locus_tag LOCUS_64650 216083 214827 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742147.1 protein_id gnl|my_center|LOCUS_64650 216476 218533 gene locus_tag LOCUS_64660 216476 218533 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223200.1 protein_id gnl|my_center|LOCUS_64660 218611 222387 gene locus_tag LOCUS_64670 218611 222387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64670 223853 222507 gene locus_tag LOCUS_64680 223853 222507 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014768.1 protein_id gnl|my_center|LOCUS_64680 225050 223974 gene locus_tag LOCUS_64690 225050 223974 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 protein_id gnl|my_center|LOCUS_64690 226108 225473 gene locus_tag LOCUS_64700 226108 225473 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225286.1 protein_id gnl|my_center|LOCUS_64700 227480 226155 gene locus_tag LOCUS_64710 227480 226155 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775825.1 protein_id gnl|my_center|LOCUS_64710 227911 229011 gene locus_tag LOCUS_64720 227911 229011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64720 229158 229664 gene locus_tag LOCUS_64730 229158 229664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64730 229796 230560 gene locus_tag LOCUS_64740 229796 230560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64740 231875 232708 gene locus_tag LOCUS_64750 231875 232708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64750 234659 232953 gene locus_tag LOCUS_64760 234659 232953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64760 236205 234703 gene locus_tag LOCUS_64770 236205 234703 CDS product bifunctional cytidylyltransferase/SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107920.1 protein_id gnl|my_center|LOCUS_64770 237168 236350 gene locus_tag LOCUS_64780 237168 236350 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972238.1 protein_id gnl|my_center|LOCUS_64780 238174 237161 gene locus_tag LOCUS_64790 238174 237161 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975816.1 protein_id gnl|my_center|LOCUS_64790 238246 238917 gene locus_tag LOCUS_64800 238246 238917 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229516.1 protein_id gnl|my_center|LOCUS_64800 240165 238969 gene locus_tag LOCUS_64810 gene lhgO 240165 238969 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222145.1 protein_id gnl|my_center|LOCUS_64810 240284 241423 gene locus_tag LOCUS_64820 240284 241423 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878081.1 protein_id gnl|my_center|LOCUS_64820 241450 242382 gene locus_tag LOCUS_64830 241450 242382 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222151.1 protein_id gnl|my_center|LOCUS_64830 242379 242846 gene locus_tag LOCUS_64840 242379 242846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64840 242859 244046 gene locus_tag LOCUS_64850 242859 244046 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091305229.1 protein_id gnl|my_center|LOCUS_64850 245288 244119 gene locus_tag LOCUS_64860 245288 244119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64860 245520 246620 gene locus_tag LOCUS_64870 245520 246620 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222158.1 protein_id gnl|my_center|LOCUS_64870 246617 247582 gene locus_tag LOCUS_64880 246617 247582 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222157.1 protein_id gnl|my_center|LOCUS_64880 249691 247661 gene locus_tag LOCUS_64890 249691 247661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64890 249769 250056 gene locus_tag LOCUS_64900 249769 250056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64900 250207 251964 gene locus_tag LOCUS_64910 250207 251964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109032946.1 protein_id gnl|my_center|LOCUS_64910 252564 252025 gene locus_tag LOCUS_64920 252564 252025 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868278.1 protein_id gnl|my_center|LOCUS_64920 253060 252722 gene locus_tag LOCUS_64930 253060 252722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64930 253219 253875 gene locus_tag LOCUS_64940 253219 253875 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466811.1 protein_id gnl|my_center|LOCUS_64940 253882 255255 gene locus_tag LOCUS_64950 253882 255255 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224238.1 protein_id gnl|my_center|LOCUS_64950 256195 255260 gene locus_tag LOCUS_64960 256195 255260 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224239.1 protein_id gnl|my_center|LOCUS_64960 256988 256293 gene locus_tag LOCUS_64970 256988 256293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64970 257914 257117 gene locus_tag LOCUS_64980 gene yaaA 257914 257117 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_64980 259601 257982 gene locus_tag LOCUS_64990 259601 257982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64990 258792 258701 gene locus_tag LOCUS_t00660 258792 258701 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 259680 260756 gene locus_tag LOCUS_65000 259680 260756 CDS product DUF2183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930149.1 protein_id gnl|my_center|LOCUS_65000 262196 260970 gene locus_tag LOCUS_65010 262196 260970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65010 262081 262341 gene locus_tag LOCUS_65020 262081 262341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65020 262628 264694 gene locus_tag LOCUS_65030 262628 264694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65030 265711 264806 gene locus_tag LOCUS_65040 265711 264806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65040