>Feature sequence1 101 805 gene locus_tag LOCUS_00010 101 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003613.1 protein_id gnl|my_center|LOCUS_00010 1194 1694 gene locus_tag LOCUS_00020 1194 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1591 2457 gene locus_tag LOCUS_00030 1591 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3208 2873 gene locus_tag LOCUS_00040 3208 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3570 3205 gene locus_tag LOCUS_00050 3570 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4537 3749 gene locus_tag LOCUS_00060 4537 3749 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460668.1 protein_id gnl|my_center|LOCUS_00060 5208 4648 gene locus_tag LOCUS_00070 5208 4648 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 protein_id gnl|my_center|LOCUS_00070 5852 5496 gene locus_tag LOCUS_00080 5852 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6749 6123 gene locus_tag LOCUS_00090 6749 6123 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963951.1 protein_id gnl|my_center|LOCUS_00090 7114 7407 gene locus_tag LOCUS_00100 7114 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 7449 7871 gene locus_tag LOCUS_00110 7449 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9348 8491 gene locus_tag LOCUS_00120 9348 8491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10481 9405 gene locus_tag LOCUS_00130 10481 9405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11161 10484 gene locus_tag LOCUS_00140 11161 10484 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948714.1 protein_id gnl|my_center|LOCUS_00140 12753 11224 gene locus_tag LOCUS_00150 12753 11224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00150 13674 12769 gene locus_tag LOCUS_00160 13674 12769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00160 13941 13738 gene locus_tag LOCUS_00170 gene copZ 13941 13738 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832344.1 protein_id gnl|my_center|LOCUS_00170 14287 13958 gene locus_tag LOCUS_00180 14287 13958 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_00180 15394 14678 gene locus_tag LOCUS_00190 15394 14678 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941468.1 protein_id gnl|my_center|LOCUS_00190 16497 15631 gene locus_tag LOCUS_00200 16497 15631 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932077.1 protein_id gnl|my_center|LOCUS_00200 16867 16589 gene locus_tag LOCUS_00210 16867 16589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 17832 17113 gene locus_tag LOCUS_00220 17832 17113 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399223.1 protein_id gnl|my_center|LOCUS_00220 19445 18321 gene locus_tag LOCUS_00230 19445 18321 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398691.1 protein_id gnl|my_center|LOCUS_00230 19725 20864 gene locus_tag LOCUS_00240 19725 20864 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649088.1 protein_id gnl|my_center|LOCUS_00240 22099 21338 gene locus_tag LOCUS_00250 22099 21338 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970020.1 protein_id gnl|my_center|LOCUS_00250 22807 22538 gene locus_tag LOCUS_00260 22807 22538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 23419 23054 gene locus_tag LOCUS_00270 23419 23054 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088126.1 protein_id gnl|my_center|LOCUS_00270 23546 24436 gene locus_tag LOCUS_00280 23546 24436 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409254.1 protein_id gnl|my_center|LOCUS_00280 24433 24942 gene locus_tag LOCUS_00290 24433 24942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 26001 25432 gene locus_tag LOCUS_00300 26001 25432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 26537 26187 gene locus_tag LOCUS_00310 26537 26187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 27592 26696 gene locus_tag LOCUS_00320 27592 26696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 28353 27823 gene locus_tag LOCUS_00330 28353 27823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 29142 28411 gene locus_tag LOCUS_00340 29142 28411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 30084 29146 gene locus_tag LOCUS_00350 30084 29146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 31006 30755 gene locus_tag LOCUS_00360 31006 30755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 31665 31120 gene locus_tag LOCUS_00370 31665 31120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 34171 31571 gene locus_tag LOCUS_00380 34171 31571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 35253 34954 gene locus_tag LOCUS_00390 35253 34954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 35903 35538 gene locus_tag LOCUS_00400 35903 35538 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385269.1 protein_id gnl|my_center|LOCUS_00400 36030 36689 gene locus_tag LOCUS_00410 36030 36689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00410 36706 36918 gene locus_tag LOCUS_00420 36706 36918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 36915 37424 gene locus_tag LOCUS_00430 36915 37424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 38080 38508 gene locus_tag LOCUS_00440 gene exsC 38080 38508 CDS product exosporium protein ExsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148807.1 protein_id gnl|my_center|LOCUS_00440 38916 38584 gene locus_tag LOCUS_00450 38916 38584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 39180 40493 gene locus_tag LOCUS_00460 39180 40493 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233683.1 protein_id gnl|my_center|LOCUS_00460 40490 41656 gene locus_tag LOCUS_00470 40490 41656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 41798 42748 gene locus_tag LOCUS_00480 41798 42748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 43180 42989 gene locus_tag LOCUS_00490 43180 42989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 43363 43734 gene locus_tag LOCUS_00500 43363 43734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 44049 44462 gene locus_tag LOCUS_00510 44049 44462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 44497 45975 gene locus_tag LOCUS_00520 44497 45975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 46306 46097 gene locus_tag LOCUS_00530 46306 46097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 47139 47783 gene locus_tag LOCUS_00540 47139 47783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 49223 48225 gene locus_tag LOCUS_00550 49223 48225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 50038 49247 gene locus_tag LOCUS_00560 50038 49247 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532679.1 protein_id gnl|my_center|LOCUS_00560 50331 51152 gene locus_tag LOCUS_00570 50331 51152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 54796 51149 gene locus_tag LOCUS_00580 54796 51149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 56391 54850 gene locus_tag LOCUS_00590 56391 54850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 57448 56450 gene locus_tag LOCUS_00600 57448 56450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 58094 57456 gene locus_tag LOCUS_00610 58094 57456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 58917 58246 gene locus_tag LOCUS_00620 58917 58246 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_00620 60149 58914 gene locus_tag LOCUS_00630 60149 58914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 63451 60146 gene locus_tag LOCUS_00640 63451 60146 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459091.1 protein_id gnl|my_center|LOCUS_00640 64088 63462 gene locus_tag LOCUS_00650 64088 63462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 65399 64974 gene locus_tag LOCUS_00660 65399 64974 CDS product DUF6157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090582.1 protein_id gnl|my_center|LOCUS_00660 65746 65444 gene locus_tag LOCUS_00670 65746 65444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 66741 65743 gene locus_tag LOCUS_00680 66741 65743 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124128.1 protein_id gnl|my_center|LOCUS_00680 67423 66953 gene locus_tag LOCUS_00690 67423 66953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 68120 67626 gene locus_tag LOCUS_00700 68120 67626 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205378591.1 protein_id gnl|my_center|LOCUS_00700 68580 68260 gene locus_tag LOCUS_00710 68580 68260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 69512 68799 gene locus_tag LOCUS_00720 69512 68799 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784670.1 protein_id gnl|my_center|LOCUS_00720 72088 69998 gene locus_tag LOCUS_00730 72088 69998 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243331.1 protein_id gnl|my_center|LOCUS_00730 72710 72327 gene locus_tag LOCUS_00740 72710 72327 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014828146.1 protein_id gnl|my_center|LOCUS_00740 73673 72969 gene locus_tag LOCUS_00750 73673 72969 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962918.1 protein_id gnl|my_center|LOCUS_00750 74131 73757 gene locus_tag LOCUS_00760 74131 73757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 76156 75269 gene locus_tag LOCUS_00770 76156 75269 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020704.1 protein_id gnl|my_center|LOCUS_00770 76649 76167 gene locus_tag LOCUS_00780 76649 76167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 79290 77215 gene locus_tag LOCUS_00790 79290 77215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 80039 81103 gene locus_tag LOCUS_00800 80039 81103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 81865 81629 gene locus_tag LOCUS_00810 81865 81629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 82165 81962 gene locus_tag LOCUS_00820 82165 81962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 82316 83317 gene locus_tag LOCUS_00830 82316 83317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 84422 83334 gene locus_tag LOCUS_00840 84422 83334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 86052 85141 gene locus_tag LOCUS_00850 gene cmrA 86052 85141 CDS product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_00850 86240 86977 gene locus_tag LOCUS_00860 86240 86977 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816333.1 protein_id gnl|my_center|LOCUS_00860 87921 87160 gene locus_tag LOCUS_00870 87921 87160 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728711.1 protein_id gnl|my_center|LOCUS_00870 88548 88015 gene locus_tag LOCUS_00880 88548 88015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 89133 88609 gene locus_tag LOCUS_00890 89133 88609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 90698 89295 gene locus_tag LOCUS_00900 90698 89295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 92011 90755 gene locus_tag LOCUS_00910 92011 90755 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984707.1 protein_id gnl|my_center|LOCUS_00910 92808 92119 gene locus_tag LOCUS_00920 92808 92119 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 protein_id gnl|my_center|LOCUS_00920 92997 93824 gene locus_tag LOCUS_00930 92997 93824 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071310.1 protein_id gnl|my_center|LOCUS_00930 94305 94042 gene locus_tag LOCUS_00940 94305 94042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 95151 94402 gene locus_tag LOCUS_00950 95151 94402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 95348 95070 gene locus_tag LOCUS_00960 95348 95070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 96039 95446 gene locus_tag LOCUS_00970 96039 95446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 96913 96224 gene locus_tag LOCUS_00980 96913 96224 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018935.1 protein_id gnl|my_center|LOCUS_00980 98290 97070 gene locus_tag LOCUS_00990 98290 97070 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064481.1 protein_id gnl|my_center|LOCUS_00990 98934 98359 gene locus_tag LOCUS_01000 98934 98359 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090904.1 protein_id gnl|my_center|LOCUS_01000 100114 100956 gene locus_tag LOCUS_01010 100114 100956 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224863.1 protein_id gnl|my_center|LOCUS_01010 102107 101193 gene locus_tag LOCUS_01020 102107 101193 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243992.1 protein_id gnl|my_center|LOCUS_01020 103568 102510 gene locus_tag LOCUS_01030 103568 102510 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207677.1 protein_id gnl|my_center|LOCUS_01030 104727 103666 gene locus_tag LOCUS_01040 104727 103666 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082923.1 protein_id gnl|my_center|LOCUS_01040 105932 104943 gene locus_tag LOCUS_01050 105932 104943 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979027.1 protein_id gnl|my_center|LOCUS_01050 107354 105966 gene locus_tag LOCUS_01060 107354 105966 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_01060 108642 107383 gene locus_tag LOCUS_01070 gene pucG 108642 107383 CDS product (S)-ureidoglycine--glyoxylate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244520.1 protein_id gnl|my_center|LOCUS_01070 109880 108639 gene locus_tag LOCUS_01080 gene allC 109880 108639 CDS product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228640.1 protein_id gnl|my_center|LOCUS_01080 111430 109895 gene locus_tag LOCUS_01090 111430 109895 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243112.1 protein_id gnl|my_center|LOCUS_01090 111855 111436 gene locus_tag LOCUS_01100 gene uraH 111855 111436 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242245.1 protein_id gnl|my_center|LOCUS_01100 112829 111852 gene locus_tag LOCUS_01110 112829 111852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01110 113373 112858 gene locus_tag LOCUS_01120 113373 112858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01120 114089 113580 gene locus_tag LOCUS_01130 gene pucE 114089 113580 CDS product xanthine dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243276.1 protein_id gnl|my_center|LOCUS_01130 116397 114079 gene locus_tag LOCUS_01140 gene pucD 116397 114079 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243174.1 protein_id gnl|my_center|LOCUS_01140 117331 116414 gene locus_tag LOCUS_01150 gene pucC 117331 116414 CDS product xanthine dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228646.1 protein_id gnl|my_center|LOCUS_01150 118239 117574 gene locus_tag LOCUS_01160 gene pucB 118239 117574 CDS product xanthine dehydrogenase accessory protein PucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706287.1 protein_id gnl|my_center|LOCUS_01160 119366 118236 gene locus_tag LOCUS_01170 119366 118236 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028402987.1 protein_id gnl|my_center|LOCUS_01170 120804 119482 gene locus_tag LOCUS_01180 120804 119482 CDS product 5'-deoxyadenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392738.1 protein_id gnl|my_center|LOCUS_01180 122335 120917 gene locus_tag LOCUS_01190 122335 120917 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_01190 123720 122401 gene locus_tag LOCUS_01200 123720 122401 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_01200 124646 123753 gene locus_tag LOCUS_01210 124646 123753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 125485 124643 gene locus_tag LOCUS_01220 125485 124643 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223881.1 protein_id gnl|my_center|LOCUS_01220 126796 125600 gene locus_tag LOCUS_01230 126796 125600 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529753.1 protein_id gnl|my_center|LOCUS_01230 127261 126812 gene locus_tag LOCUS_01240 127261 126812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 128040 127258 gene locus_tag LOCUS_01250 gene rutB 128040 127258 CDS product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001446784.1 protein_id gnl|my_center|LOCUS_01250 129368 128310 gene locus_tag LOCUS_01260 129368 128310 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531126.1 protein_id gnl|my_center|LOCUS_01260 130300 129395 gene locus_tag LOCUS_01270 130300 129395 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082921.1 protein_id gnl|my_center|LOCUS_01270 131152 130337 gene locus_tag LOCUS_01280 131152 130337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384594.1 protein_id gnl|my_center|LOCUS_01280 132347 131646 gene locus_tag LOCUS_01290 gene wrbA 132347 131646 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328347.1 protein_id gnl|my_center|LOCUS_01290 133715 132351 gene locus_tag LOCUS_01300 133715 132351 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391998.1 protein_id gnl|my_center|LOCUS_01300 135501 133798 gene locus_tag LOCUS_01310 135501 133798 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025269720.1 protein_id gnl|my_center|LOCUS_01310 135762 137333 gene locus_tag LOCUS_01320 gene pucR 135762 137333 CDS product purine catabolism transcriptional regulator PucR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244351.1 protein_id gnl|my_center|LOCUS_01320 139032 137446 gene locus_tag LOCUS_01330 gene ggt 139032 137446 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227847.1 protein_id gnl|my_center|LOCUS_01330 139958 139359 gene locus_tag LOCUS_01340 139958 139359 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140957.1 protein_id gnl|my_center|LOCUS_01340 140362 139955 gene locus_tag LOCUS_01350 140362 139955 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886646.1 protein_id gnl|my_center|LOCUS_01350 142227 140437 gene locus_tag LOCUS_01360 142227 140437 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_01360 143065 142568 gene locus_tag LOCUS_01370 143065 142568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 143949 143215 gene locus_tag LOCUS_01380 143949 143215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 145357 144917 gene locus_tag LOCUS_01390 145357 144917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 146452 145544 gene locus_tag LOCUS_01400 146452 145544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 147230 146826 gene locus_tag LOCUS_01410 147230 146826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 147832 147245 gene locus_tag LOCUS_01420 147832 147245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 148781 147870 gene locus_tag LOCUS_01430 148781 147870 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_01430 150823 148991 gene locus_tag LOCUS_01440 150823 148991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 151251 151850 gene locus_tag LOCUS_01450 151251 151850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 153135 152083 gene locus_tag LOCUS_01460 153135 152083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 154133 153351 gene locus_tag LOCUS_01470 154133 153351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 155723 154320 gene locus_tag LOCUS_01480 155723 154320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 155993 157708 gene locus_tag LOCUS_01490 155993 157708 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944619.1 protein_id gnl|my_center|LOCUS_01490 157918 158442 gene locus_tag LOCUS_01500 157918 158442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01500 158405 158995 gene locus_tag LOCUS_01510 158405 158995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01510 162257 159060 gene locus_tag LOCUS_01520 162257 159060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 164931 162535 gene locus_tag LOCUS_01530 164931 162535 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974204.1 protein_id gnl|my_center|LOCUS_01530 165718 165110 gene locus_tag LOCUS_01540 165718 165110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289387.1 protein_id gnl|my_center|LOCUS_01540 165933 165730 gene locus_tag LOCUS_01550 165933 165730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 166135 166359 gene locus_tag LOCUS_01560 166135 166359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 167395 166499 gene locus_tag LOCUS_01570 167395 166499 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246592.1 protein_id gnl|my_center|LOCUS_01570 167611 169044 gene locus_tag LOCUS_01580 167611 169044 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392514.1 protein_id gnl|my_center|LOCUS_01580 170515 169163 gene locus_tag LOCUS_01590 170515 169163 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965968.1 protein_id gnl|my_center|LOCUS_01590 172837 170906 gene locus_tag LOCUS_01600 gene fbp 172837 170906 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243329.1 protein_id gnl|my_center|LOCUS_01600 173749 172940 gene locus_tag LOCUS_01610 173749 172940 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594240.1 protein_id gnl|my_center|LOCUS_01610 174518 173727 gene locus_tag LOCUS_01620 gene glcR 174518 173727 CDS product transcriptional regulator GlcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244075.1 protein_id gnl|my_center|LOCUS_01620 174692 174898 gene locus_tag LOCUS_01630 174692 174898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 175466 174996 gene locus_tag LOCUS_01640 175466 174996 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021653.1 protein_id gnl|my_center|LOCUS_01640 176159 175494 gene locus_tag LOCUS_01650 176159 175494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 176681 176295 gene locus_tag LOCUS_01660 176681 176295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 182139 176944 gene locus_tag LOCUS_01670 182139 176944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 182692 182450 gene locus_tag LOCUS_01680 182692 182450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 182938 183882 gene locus_tag LOCUS_01690 182938 183882 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903312.1 protein_id gnl|my_center|LOCUS_01690 185217 184000 gene locus_tag LOCUS_01700 185217 184000 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860963.1 protein_id gnl|my_center|LOCUS_01700 186110 185253 gene locus_tag LOCUS_01710 186110 185253 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777129.1 protein_id gnl|my_center|LOCUS_01710 187025 186183 gene locus_tag LOCUS_01720 187025 186183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 188279 187026 gene locus_tag LOCUS_01730 188279 187026 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_01730 190787 188310 gene locus_tag LOCUS_01740 190787 188310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 192659 190812 gene locus_tag LOCUS_01750 192659 190812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244082.1 protein_id gnl|my_center|LOCUS_01750 194376 192640 gene locus_tag LOCUS_01760 194376 192640 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243936.1 protein_id gnl|my_center|LOCUS_01760 195761 194601 gene locus_tag LOCUS_01770 195761 194601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 196720 195839 gene locus_tag LOCUS_01780 196720 195839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 197701 196745 gene locus_tag LOCUS_01790 197701 196745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 198496 197951 gene locus_tag LOCUS_01800 198496 197951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 202108 198599 gene locus_tag LOCUS_01810 202108 198599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 202576 202439 gene locus_tag LOCUS_01820 202576 202439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 211344 202759 gene locus_tag LOCUS_01830 211344 202759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 213726 211867 gene locus_tag LOCUS_01840 213726 211867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 215356 213719 gene locus_tag LOCUS_01850 215356 213719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 216968 215400 gene locus_tag LOCUS_01860 216968 215400 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010729380.1 protein_id gnl|my_center|LOCUS_01860 218719 217286 gene locus_tag LOCUS_01870 218719 217286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 219817 218840 gene locus_tag LOCUS_01880 219817 218840 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909515.1 protein_id gnl|my_center|LOCUS_01880 220710 219814 gene locus_tag LOCUS_01890 220710 219814 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_01890 222869 220707 gene locus_tag LOCUS_01900 222869 220707 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259692.1 protein_id gnl|my_center|LOCUS_01900 224940 222925 gene locus_tag LOCUS_01910 224940 222925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259691.1 protein_id gnl|my_center|LOCUS_01910 225824 224967 gene locus_tag LOCUS_01920 225824 224967 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259690.1 protein_id gnl|my_center|LOCUS_01920 226797 225829 gene locus_tag LOCUS_01930 226797 225829 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259689.1 protein_id gnl|my_center|LOCUS_01930 229757 226794 gene locus_tag LOCUS_01940 229757 226794 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_01940 230776 229754 gene locus_tag LOCUS_01950 gene ugpC 230776 229754 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_01950 231917 231120 gene locus_tag LOCUS_01960 231917 231120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 232128 232529 gene locus_tag LOCUS_01970 232128 232529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 233273 232632 gene locus_tag LOCUS_01980 233273 232632 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933360.1 protein_id gnl|my_center|LOCUS_01980 235156 233309 gene locus_tag LOCUS_01990 235156 233309 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140584.1 protein_id gnl|my_center|LOCUS_01990 235563 235246 gene locus_tag LOCUS_02000 235563 235246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 235807 236898 gene locus_tag LOCUS_02010 235807 236898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 236905 238359 gene locus_tag LOCUS_02020 gene gerKA 236905 238359 CDS product spore germination protein GerKA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246515.1 protein_id gnl|my_center|LOCUS_02020 238464 239519 gene locus_tag LOCUS_02030 238464 239519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 241146 239668 gene locus_tag LOCUS_02040 241146 239668 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890812.1 protein_id gnl|my_center|LOCUS_02040 241798 241379 gene locus_tag LOCUS_02050 241798 241379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 242005 242211 gene locus_tag LOCUS_02060 242005 242211 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814946.1 protein_id gnl|my_center|LOCUS_02060 242208 242639 gene locus_tag LOCUS_02070 242208 242639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814944.1 protein_id gnl|my_center|LOCUS_02070 243567 242713 gene locus_tag LOCUS_02080 243567 242713 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228166.1 protein_id gnl|my_center|LOCUS_02080 243981 243616 gene locus_tag LOCUS_02090 243981 243616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 245491 244610 gene locus_tag LOCUS_02100 245491 244610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 245793 247487 gene locus_tag LOCUS_02110 245793 247487 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272334.1 protein_id gnl|my_center|LOCUS_02110 248834 247692 gene locus_tag LOCUS_02120 248834 247692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 249728 248850 gene locus_tag LOCUS_02130 249728 248850 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814246.1 protein_id gnl|my_center|LOCUS_02130 250624 249743 gene locus_tag LOCUS_02140 250624 249743 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814244.1 protein_id gnl|my_center|LOCUS_02140 252107 250617 gene locus_tag LOCUS_02150 252107 250617 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814254.1 protein_id gnl|my_center|LOCUS_02150 253481 252330 gene locus_tag LOCUS_02160 253481 252330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 254944 253478 gene locus_tag LOCUS_02170 254944 253478 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948337.1 protein_id gnl|my_center|LOCUS_02170 255647 254949 gene locus_tag LOCUS_02180 255647 254949 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830897.1 protein_id gnl|my_center|LOCUS_02180 256512 255802 gene locus_tag LOCUS_02190 256512 255802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 257618 256713 gene locus_tag LOCUS_02200 257618 256713 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421907.1 protein_id gnl|my_center|LOCUS_02200 257721 258908 gene locus_tag LOCUS_02210 257721 258908 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748725.1 protein_id gnl|my_center|LOCUS_02210 259609 259025 gene locus_tag LOCUS_02220 259609 259025 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082850.1 protein_id gnl|my_center|LOCUS_02220 260100 259645 gene locus_tag LOCUS_02230 260100 259645 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107259.1 protein_id gnl|my_center|LOCUS_02230 260402 260244 gene locus_tag LOCUS_02240 260402 260244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 262397 260919 gene locus_tag LOCUS_02250 262397 260919 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061775.1 protein_id gnl|my_center|LOCUS_02250 263578 263003 gene locus_tag LOCUS_02260 263578 263003 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069765.1 protein_id gnl|my_center|LOCUS_02260 264552 263716 gene locus_tag LOCUS_02270 264552 263716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 265052 264567 gene locus_tag LOCUS_02280 265052 264567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 265592 265059 gene locus_tag LOCUS_02290 265592 265059 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_02290 266938 265637 gene locus_tag LOCUS_02300 266938 265637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 270085 266978 gene locus_tag LOCUS_02310 270085 266978 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033498.1 protein_id gnl|my_center|LOCUS_02310 270242 272881 gene locus_tag LOCUS_02320 gene mprF 270242 272881 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071136.1 protein_id gnl|my_center|LOCUS_02320 272958 273455 gene locus_tag LOCUS_02330 272958 273455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 273623 273805 gene locus_tag LOCUS_02340 273623 273805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 274147 273887 gene locus_tag LOCUS_02350 274147 273887 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456206.1 protein_id gnl|my_center|LOCUS_02350 274681 274199 gene locus_tag LOCUS_02360 274681 274199 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229885.1 protein_id gnl|my_center|LOCUS_02360 274979 274752 gene locus_tag LOCUS_02370 274979 274752 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229888.1 protein_id gnl|my_center|LOCUS_02370 276137 274992 gene locus_tag LOCUS_02380 276137 274992 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967833.1 protein_id gnl|my_center|LOCUS_02380 276720 276148 gene locus_tag LOCUS_02390 276720 276148 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023951.1 protein_id gnl|my_center|LOCUS_02390 276818 277270 gene locus_tag LOCUS_02400 276818 277270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 278558 277824 gene locus_tag LOCUS_02410 278558 277824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 278912 278739 gene locus_tag LOCUS_02420 278912 278739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 279588 278926 gene locus_tag LOCUS_02430 279588 278926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 279832 280443 gene locus_tag LOCUS_02440 279832 280443 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_02440 280433 281674 gene locus_tag LOCUS_02450 280433 281674 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984707.1 protein_id gnl|my_center|LOCUS_02450 281727 282653 gene locus_tag LOCUS_02460 281727 282653 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754259.1 protein_id gnl|my_center|LOCUS_02460 283779 282727 gene locus_tag LOCUS_02470 283779 282727 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017008.1 protein_id gnl|my_center|LOCUS_02470 284923 284135 gene locus_tag LOCUS_02480 284923 284135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 285803 285252 gene locus_tag LOCUS_02490 285803 285252 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227661.1 protein_id gnl|my_center|LOCUS_02490 285995 286417 gene locus_tag LOCUS_02500 285995 286417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 286711 287637 gene locus_tag LOCUS_02510 gene pqqB 286711 287637 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729289.1 protein_id gnl|my_center|LOCUS_02510 287637 288350 gene locus_tag LOCUS_02520 gene pqqC 287637 288350 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729288.1 protein_id gnl|my_center|LOCUS_02520 288347 288625 gene locus_tag LOCUS_02530 gene pqqD 288347 288625 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004792407.1 protein_id gnl|my_center|LOCUS_02530 289077 288853 gene locus_tag LOCUS_02540 289077 288853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 289705 290643 gene locus_tag LOCUS_02550 289705 290643 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688057.1 protein_id gnl|my_center|LOCUS_02550 291858 290671 gene locus_tag LOCUS_02560 291858 290671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 293727 291937 gene locus_tag LOCUS_02570 293727 291937 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895174.1 protein_id gnl|my_center|LOCUS_02570 294158 293916 gene locus_tag LOCUS_02580 294158 293916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 294362 294754 gene locus_tag LOCUS_02590 294362 294754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 295733 295587 gene locus_tag LOCUS_02600 295733 295587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 295977 296216 gene locus_tag LOCUS_02610 295977 296216 CDS product spore coat associated protein CotJA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362188.1 protein_id gnl|my_center|LOCUS_02610 296213 296473 gene locus_tag LOCUS_02620 gene cotJB 296213 296473 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002157501.1 protein_id gnl|my_center|LOCUS_02620 296503 297072 gene locus_tag LOCUS_02630 gene cotJC 296503 297072 CDS product spore coat protein CotJC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233850.1 protein_id gnl|my_center|LOCUS_02630 297399 297148 gene locus_tag LOCUS_02640 297399 297148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 298524 297529 gene locus_tag LOCUS_02650 298524 297529 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_02650 298705 298986 gene locus_tag LOCUS_02660 298705 298986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 299070 300272 gene locus_tag LOCUS_02670 299070 300272 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246471.1 protein_id gnl|my_center|LOCUS_02670 301452 300415 gene locus_tag LOCUS_02680 301452 300415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 301732 301604 gene locus_tag LOCUS_02690 301732 301604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 302716 301814 gene locus_tag LOCUS_02700 302716 301814 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970571.1 protein_id gnl|my_center|LOCUS_02700 303842 302739 gene locus_tag LOCUS_02710 303842 302739 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210025.1 protein_id gnl|my_center|LOCUS_02710 304580 304215 gene locus_tag LOCUS_02720 304580 304215 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424232.1 protein_id gnl|my_center|LOCUS_02720 305245 304577 gene locus_tag LOCUS_02730 305245 304577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 306104 305238 gene locus_tag LOCUS_02740 306104 305238 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890775.1 protein_id gnl|my_center|LOCUS_02740 306260 306964 gene locus_tag LOCUS_02750 306260 306964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 308073 306970 gene locus_tag LOCUS_02760 308073 306970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 309167 308070 gene locus_tag LOCUS_02770 309167 308070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 310495 309173 gene locus_tag LOCUS_02780 gene gerKA 310495 309173 CDS product spore germination protein GerKA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139256.1 protein_id gnl|my_center|LOCUS_02780 310689 311795 gene locus_tag LOCUS_02790 310689 311795 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815022.1 protein_id gnl|my_center|LOCUS_02790 312014 311784 gene locus_tag LOCUS_02800 312014 311784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 313222 312011 gene locus_tag LOCUS_02810 313222 312011 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243672.1 protein_id gnl|my_center|LOCUS_02810 314768 313251 gene locus_tag LOCUS_02820 314768 313251 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233683.1 protein_id gnl|my_center|LOCUS_02820 315828 314899 gene locus_tag LOCUS_02830 315828 314899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 316845 315862 gene locus_tag LOCUS_02840 316845 315862 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268353.1 protein_id gnl|my_center|LOCUS_02840 317671 316979 gene locus_tag LOCUS_02850 317671 316979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 318304 317873 gene locus_tag LOCUS_02860 318304 317873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 318899 318324 gene locus_tag LOCUS_02870 318899 318324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 319596 319132 gene locus_tag LOCUS_02880 319596 319132 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080055.1 protein_id gnl|my_center|LOCUS_02880 319809 320720 gene locus_tag LOCUS_02890 319809 320720 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614448.1 protein_id gnl|my_center|LOCUS_02890 321968 320817 gene locus_tag LOCUS_02900 321968 320817 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651900.1 protein_id gnl|my_center|LOCUS_02900 323086 321971 gene locus_tag LOCUS_02910 323086 321971 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020162.1 protein_id gnl|my_center|LOCUS_02910 324046 323111 gene locus_tag LOCUS_02920 324046 323111 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093836.1 protein_id gnl|my_center|LOCUS_02920 325481 324372 gene locus_tag LOCUS_02930 325481 324372 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397690.1 protein_id gnl|my_center|LOCUS_02930 326241 325507 gene locus_tag LOCUS_02940 326241 325507 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694093.1 protein_id gnl|my_center|LOCUS_02940 327092 326355 gene locus_tag LOCUS_02950 327092 326355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 327551 327198 gene locus_tag LOCUS_02960 gene rtp 327551 327198 CDS product replication termination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220337.1 protein_id gnl|my_center|LOCUS_02960 331398 328048 gene locus_tag LOCUS_02970 331398 328048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027631136.1 protein_id gnl|my_center|LOCUS_02970 332112 331669 gene locus_tag LOCUS_02980 332112 331669 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706722.1 protein_id gnl|my_center|LOCUS_02980 332579 332142 gene locus_tag LOCUS_02990 332579 332142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 333449 332919 gene locus_tag LOCUS_03000 333449 332919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 333949 333347 gene locus_tag LOCUS_03010 333949 333347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 334081 334680 gene locus_tag LOCUS_03020 334081 334680 CDS product DUF2239 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083415.1 protein_id gnl|my_center|LOCUS_03020 334741 335640 gene locus_tag LOCUS_03030 334741 335640 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_03030 336318 335761 gene locus_tag LOCUS_03040 336318 335761 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697198.1 protein_id gnl|my_center|LOCUS_03040 336437 336916 gene locus_tag LOCUS_03050 336437 336916 CDS product cytochrome c biogenesis protein CcdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390279.1 protein_id gnl|my_center|LOCUS_03050 337398 336982 gene locus_tag LOCUS_03060 337398 336982 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090630.1 protein_id gnl|my_center|LOCUS_03060 338480 337398 gene locus_tag LOCUS_03070 338480 337398 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967916.1 protein_id gnl|my_center|LOCUS_03070 339586 338498 gene locus_tag LOCUS_03080 gene dgoD 339586 338498 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975371.1 protein_id gnl|my_center|LOCUS_03080 340616 339786 gene locus_tag LOCUS_03090 340616 339786 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092776.1 protein_id gnl|my_center|LOCUS_03090 340709 341122 gene locus_tag LOCUS_03100 340709 341122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 342603 341197 gene locus_tag LOCUS_03110 342603 341197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 343316 342600 gene locus_tag LOCUS_03120 343316 342600 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461794.1 protein_id gnl|my_center|LOCUS_03120 343479 344252 gene locus_tag LOCUS_03130 343479 344252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 344721 344341 gene locus_tag LOCUS_03140 344721 344341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 345205 345363 gene locus_tag LOCUS_03150 345205 345363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 345680 345495 gene locus_tag LOCUS_03160 345680 345495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 346534 345644 gene locus_tag LOCUS_03170 346534 345644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941367.1 protein_id gnl|my_center|LOCUS_03170 346904 346524 gene locus_tag LOCUS_03180 346904 346524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 347052 347456 gene locus_tag LOCUS_03190 347052 347456 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460168.1 protein_id gnl|my_center|LOCUS_03190 348557 347568 gene locus_tag LOCUS_03200 348557 347568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 350317 348770 gene locus_tag LOCUS_03210 350317 348770 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_03210 350498 351079 gene locus_tag LOCUS_03220 350498 351079 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577794.1 protein_id gnl|my_center|LOCUS_03220 351586 351167 gene locus_tag LOCUS_03230 351586 351167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 352056 351625 gene locus_tag LOCUS_03240 352056 351625 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969510.1 protein_id gnl|my_center|LOCUS_03240 352372 352037 gene locus_tag LOCUS_03250 352372 352037 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224553.1 protein_id gnl|my_center|LOCUS_03250 352705 352532 gene locus_tag LOCUS_03260 352705 352532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 353223 352738 gene locus_tag LOCUS_03270 353223 352738 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903451.1 protein_id gnl|my_center|LOCUS_03270 354062 353265 gene locus_tag LOCUS_03280 354062 353265 CDS product lipid II flippase Amj family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028915.1 protein_id gnl|my_center|LOCUS_03280 354432 354217 gene locus_tag LOCUS_03290 354432 354217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 354837 354505 gene locus_tag LOCUS_03300 354837 354505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 355464 356798 gene locus_tag LOCUS_03310 355464 356798 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233683.1 protein_id gnl|my_center|LOCUS_03310 356831 357982 gene locus_tag LOCUS_03320 356831 357982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 358021 359109 gene locus_tag LOCUS_03330 358021 359109 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393537.1 protein_id gnl|my_center|LOCUS_03330 359735 359205 gene locus_tag LOCUS_03340 gene lspA 359735 359205 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053323.1 protein_id gnl|my_center|LOCUS_03340 360048 359788 gene locus_tag LOCUS_03350 360048 359788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 360575 360150 gene locus_tag LOCUS_03360 360575 360150 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048563.1 protein_id gnl|my_center|LOCUS_03360 361433 360795 gene locus_tag LOCUS_03370 361433 360795 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090403.1 protein_id gnl|my_center|LOCUS_03370 361790 364519 gene locus_tag LOCUS_03380 361790 364519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 364549 365514 gene locus_tag LOCUS_03390 364549 365514 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083943.1 protein_id gnl|my_center|LOCUS_03390 366323 365886 gene locus_tag LOCUS_03400 366323 365886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 366757 366326 gene locus_tag LOCUS_03410 366757 366326 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071181.1 protein_id gnl|my_center|LOCUS_03410 367729 366773 gene locus_tag LOCUS_03420 367729 366773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 368642 367791 gene locus_tag LOCUS_03430 368642 367791 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530905.1 protein_id gnl|my_center|LOCUS_03430 368787 370175 gene locus_tag LOCUS_03440 368787 370175 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088606.1 protein_id gnl|my_center|LOCUS_03440 371312 370194 gene locus_tag LOCUS_03450 371312 370194 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243652.1 protein_id gnl|my_center|LOCUS_03450 371684 371484 gene locus_tag LOCUS_03460 371684 371484 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719639.1 protein_id gnl|my_center|LOCUS_03460 373354 371846 gene locus_tag LOCUS_03470 373354 371846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 374954 373347 gene locus_tag LOCUS_03480 374954 373347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 375162 376145 gene locus_tag LOCUS_03490 375162 376145 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403126.1 protein_id gnl|my_center|LOCUS_03490 377470 376250 gene locus_tag LOCUS_03500 377470 376250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 378361 377636 gene locus_tag LOCUS_03510 378361 377636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 378906 378565 gene locus_tag LOCUS_03520 378906 378565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 379545 379003 gene locus_tag LOCUS_03530 379545 379003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 380486 379542 gene locus_tag LOCUS_03540 380486 379542 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759382.1 protein_id gnl|my_center|LOCUS_03540 380773 381021 gene locus_tag LOCUS_03550 380773 381021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 381392 381078 gene locus_tag LOCUS_03560 381392 381078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 381754 381389 gene locus_tag LOCUS_03570 381754 381389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 382559 382335 gene locus_tag LOCUS_03580 382559 382335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 383605 382790 gene locus_tag LOCUS_03590 383605 382790 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326902.1 protein_id gnl|my_center|LOCUS_03590 384866 383586 gene locus_tag LOCUS_03600 384866 383586 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171267129.1 protein_id gnl|my_center|LOCUS_03600 384987 385862 gene locus_tag LOCUS_03610 gene nmoR 384987 385862 CDS product LysR family transcriptional regulator NmoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114724.1 protein_id gnl|my_center|LOCUS_03610 386684 385965 gene locus_tag LOCUS_03620 386684 385965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 391653 386998 gene locus_tag LOCUS_03630 391653 386998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 392303 392037 gene locus_tag LOCUS_03640 392303 392037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 393737 392379 gene locus_tag LOCUS_03650 393737 392379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 394442 394062 gene locus_tag LOCUS_03660 394442 394062 CDS product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775211.1 protein_id gnl|my_center|LOCUS_03660 395612 394599 gene locus_tag LOCUS_03670 395612 394599 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670427.1 protein_id gnl|my_center|LOCUS_03670 396280 395609 gene locus_tag LOCUS_03680 gene tenA 396280 395609 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666827.1 protein_id gnl|my_center|LOCUS_03680 397602 396277 gene locus_tag LOCUS_03690 gene ylmB 397602 396277 CDS product N-formyl-4-amino-5-aminomethyl-2-methylpyrimidine deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244730.1 protein_id gnl|my_center|LOCUS_03690 398941 397889 gene locus_tag LOCUS_03700 398941 397889 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089093.1 protein_id gnl|my_center|LOCUS_03700 399641 399129 gene locus_tag LOCUS_03710 399641 399129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 400687 399800 gene locus_tag LOCUS_03720 400687 399800 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243271.1 protein_id gnl|my_center|LOCUS_03720 401537 400827 gene locus_tag LOCUS_03730 401537 400827 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760203.1 protein_id gnl|my_center|LOCUS_03730 402105 401644 gene locus_tag LOCUS_03740 402105 401644 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 protein_id gnl|my_center|LOCUS_03740 402422 402925 gene locus_tag LOCUS_03750 402422 402925 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966791.1 protein_id gnl|my_center|LOCUS_03750 404090 403122 gene locus_tag LOCUS_03760 gene hutG 404090 403122 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399848.1 protein_id gnl|my_center|LOCUS_03760 405397 404087 gene locus_tag LOCUS_03770 gene hutI 405397 404087 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244327.1 protein_id gnl|my_center|LOCUS_03770 407143 405470 gene locus_tag LOCUS_03780 gene hutU 407143 405470 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416948.1 protein_id gnl|my_center|LOCUS_03780 408702 407173 gene locus_tag LOCUS_03790 gene hutH 408702 407173 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243255.1 protein_id gnl|my_center|LOCUS_03790 410404 409043 gene locus_tag LOCUS_03800 410404 409043 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003614.1 protein_id gnl|my_center|LOCUS_03800 411171 410578 gene locus_tag LOCUS_03810 411171 410578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 413310 411190 gene locus_tag LOCUS_03820 413310 411190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 414156 413650 gene locus_tag LOCUS_03830 414156 413650 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016904.1 protein_id gnl|my_center|LOCUS_03830 414755 414213 gene locus_tag LOCUS_03840 414755 414213 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720176.1 protein_id gnl|my_center|LOCUS_03840 414918 415397 gene locus_tag LOCUS_03850 414918 415397 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966218.1 protein_id gnl|my_center|LOCUS_03850 415795 415394 gene locus_tag LOCUS_03860 415795 415394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 416689 416021 gene locus_tag LOCUS_03870 416689 416021 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963636.1 protein_id gnl|my_center|LOCUS_03870 417179 416691 gene locus_tag LOCUS_03880 417179 416691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 418661 417351 gene locus_tag LOCUS_03890 418661 417351 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715835.1 protein_id gnl|my_center|LOCUS_03890 419337 418645 gene locus_tag LOCUS_03900 gene phoB 419337 418645 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 protein_id gnl|my_center|LOCUS_03900 420584 419559 gene locus_tag LOCUS_03910 gene nagA 420584 419559 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722368.1 protein_id gnl|my_center|LOCUS_03910 420531 420749 gene locus_tag LOCUS_03920 420531 420749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 422522 421008 gene locus_tag LOCUS_03930 422522 421008 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285974.1 protein_id gnl|my_center|LOCUS_03930 423508 422579 gene locus_tag LOCUS_03940 423508 422579 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_03940 424460 423528 gene locus_tag LOCUS_03950 424460 423528 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_03950 425488 424781 gene locus_tag LOCUS_03960 425488 424781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 426659 425568 gene locus_tag LOCUS_03970 426659 425568 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927203.1 protein_id gnl|my_center|LOCUS_03970 427781 426849 gene locus_tag LOCUS_03980 427781 426849 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_03980 428998 427853 gene locus_tag LOCUS_03990 428998 427853 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963509.1 protein_id gnl|my_center|LOCUS_03990 430151 429168 gene locus_tag LOCUS_04000 430151 429168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 431129 430185 gene locus_tag LOCUS_04010 gene murQ 431129 430185 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963499.1 protein_id gnl|my_center|LOCUS_04010 432175 431312 gene locus_tag LOCUS_04020 432175 431312 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963515.1 protein_id gnl|my_center|LOCUS_04020 433327 432305 gene locus_tag LOCUS_04030 433327 432305 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_04030 434304 433405 gene locus_tag LOCUS_04040 434304 433405 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144540475.1 protein_id gnl|my_center|LOCUS_04040 435569 434310 gene locus_tag LOCUS_04050 435569 434310 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195356.1 protein_id gnl|my_center|LOCUS_04050 436292 435642 gene locus_tag LOCUS_04060 436292 435642 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345960.1 protein_id gnl|my_center|LOCUS_04060 436968 436312 gene locus_tag LOCUS_04070 436968 436312 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112693.1 protein_id gnl|my_center|LOCUS_04070 437858 437049 gene locus_tag LOCUS_04080 gene glnH 437858 437049 CDS product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916480.1 protein_id gnl|my_center|LOCUS_04080 438634 437906 gene locus_tag LOCUS_04090 438634 437906 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246180.1 protein_id gnl|my_center|LOCUS_04090 439620 439219 gene locus_tag LOCUS_04100 439620 439219 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 protein_id gnl|my_center|LOCUS_04100 440293 439676 gene locus_tag LOCUS_04110 440293 439676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04110 440716 440435 gene locus_tag LOCUS_04120 440716 440435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04120 440901 441449 gene locus_tag LOCUS_04130 440901 441449 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205505.1 protein_id gnl|my_center|LOCUS_04130 444018 441538 gene locus_tag LOCUS_04140 444018 441538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 444561 444286 gene locus_tag LOCUS_04150 444561 444286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 445420 444716 gene locus_tag LOCUS_04160 445420 444716 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015965.1 protein_id gnl|my_center|LOCUS_04160 445617 446468 gene locus_tag LOCUS_04170 445617 446468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 446558 447139 gene locus_tag LOCUS_04180 446558 447139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 447136 447927 gene locus_tag LOCUS_04190 447136 447927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04190 447941 448402 gene locus_tag LOCUS_04200 447941 448402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 448460 450016 gene locus_tag LOCUS_04210 gene gerLA 448460 450016 CDS product spore germination protein GerLA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181475.1 protein_id gnl|my_center|LOCUS_04210 450003 451109 gene locus_tag LOCUS_04220 gene gerLB 450003 451109 CDS product spore germination protein GerLB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802016.1 protein_id gnl|my_center|LOCUS_04220 451106 452311 gene locus_tag LOCUS_04230 451106 452311 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649885.1 protein_id gnl|my_center|LOCUS_04230 452317 452538 gene locus_tag LOCUS_04240 452317 452538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 455304 452680 gene locus_tag LOCUS_04250 455304 452680 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 protein_id gnl|my_center|LOCUS_04250 455760 455572 gene locus_tag LOCUS_04260 455760 455572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 456436 455993 gene locus_tag LOCUS_04270 456436 455993 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583637.1 protein_id gnl|my_center|LOCUS_04270 457370 456489 gene locus_tag LOCUS_04280 457370 456489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 457840 457388 gene locus_tag LOCUS_04290 457840 457388 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583637.1 protein_id gnl|my_center|LOCUS_04290 459174 458134 gene locus_tag LOCUS_04300 gene purR 459174 458134 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660510.1 protein_id gnl|my_center|LOCUS_04300 459349 460185 gene locus_tag LOCUS_04310 459349 460185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 461699 460317 gene locus_tag LOCUS_04320 461699 460317 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246711.1 protein_id gnl|my_center|LOCUS_04320 461847 462650 gene locus_tag LOCUS_04330 gene blaOXA 461847 462650 CDS product class D beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246349.1 protein_id gnl|my_center|LOCUS_04330 464051 462822 gene locus_tag LOCUS_04340 464051 462822 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224293.1 protein_id gnl|my_center|LOCUS_04340 464831 464316 gene locus_tag LOCUS_04350 464831 464316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 466306 464903 gene locus_tag LOCUS_04360 466306 464903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 467235 466300 gene locus_tag LOCUS_04370 467235 466300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 467417 467599 gene locus_tag LOCUS_04380 467417 467599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 467623 467829 gene locus_tag LOCUS_04390 467623 467829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 468103 468318 gene locus_tag LOCUS_04400 468103 468318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 468663 468433 gene locus_tag LOCUS_04410 468663 468433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 468955 469422 gene locus_tag LOCUS_04420 468955 469422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 469457 469621 gene locus_tag LOCUS_04430 469457 469621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 471455 469734 gene locus_tag LOCUS_04440 gene cysI 471455 469734 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243849.1 protein_id gnl|my_center|LOCUS_04440 473326 471494 gene locus_tag LOCUS_04450 473326 471494 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 protein_id gnl|my_center|LOCUS_04450 474883 473648 gene locus_tag LOCUS_04460 474883 473648 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219567.1 protein_id gnl|my_center|LOCUS_04460 476144 474876 gene locus_tag LOCUS_04470 476144 474876 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181867.1 protein_id gnl|my_center|LOCUS_04470 476288 477166 gene locus_tag LOCUS_04480 gene bsdA 476288 477166 CDS product transcriptional regulator BsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246552.1 protein_id gnl|my_center|LOCUS_04480 479044 477287 gene locus_tag LOCUS_04490 gene ade 479044 477287 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286185.1 protein_id gnl|my_center|LOCUS_04490 479643 479269 gene locus_tag LOCUS_04500 479643 479269 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581467.1 protein_id gnl|my_center|LOCUS_04500 480226 479711 gene locus_tag LOCUS_04510 480226 479711 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799620.1 protein_id gnl|my_center|LOCUS_04510 480591 480253 gene locus_tag LOCUS_04520 480591 480253 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224339.1 protein_id gnl|my_center|LOCUS_04520 481694 480744 gene locus_tag LOCUS_04530 481694 480744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 482151 481711 gene locus_tag LOCUS_04540 482151 481711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 483593 482322 gene locus_tag LOCUS_04550 483593 482322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 484137 483613 gene locus_tag LOCUS_04560 gene msrA 484137 483613 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291873.1 protein_id gnl|my_center|LOCUS_04560 485168 484152 gene locus_tag LOCUS_04570 485168 484152 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231400.1 protein_id gnl|my_center|LOCUS_04570 486277 485165 gene locus_tag LOCUS_04580 486277 485165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 488024 486396 gene locus_tag LOCUS_04590 488024 486396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 490873 488273 gene locus_tag LOCUS_04600 gene ppsA 490873 488273 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231379.1 protein_id gnl|my_center|LOCUS_04600 491825 491100 gene locus_tag LOCUS_04610 491825 491100 CDS product Stf0 family sulphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529220.1 protein_id gnl|my_center|LOCUS_04610 492925 492248 gene locus_tag LOCUS_04620 492925 492248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 493472 492987 gene locus_tag LOCUS_04630 493472 492987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 493573 493794 gene locus_tag LOCUS_04640 493573 493794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 495441 493912 gene locus_tag LOCUS_04650 495441 493912 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199961.1 protein_id gnl|my_center|LOCUS_04650 497675 495528 gene locus_tag LOCUS_04660 497675 495528 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856434.1 protein_id gnl|my_center|LOCUS_04660 498871 497696 gene locus_tag LOCUS_04670 498871 497696 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_04670 499592 498864 gene locus_tag LOCUS_04680 499592 498864 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_04680 500751 499585 gene locus_tag LOCUS_04690 500751 499585 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480137.1 protein_id gnl|my_center|LOCUS_04690 501073 500945 gene locus_tag LOCUS_04700 501073 500945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 501302 502537 gene locus_tag LOCUS_04710 501302 502537 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003270289.1 protein_id gnl|my_center|LOCUS_04710 503558 504742 gene locus_tag LOCUS_04720 503558 504742 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225041.1 protein_id gnl|my_center|LOCUS_04720 504889 505815 gene locus_tag LOCUS_04730 504889 505815 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949098.1 protein_id gnl|my_center|LOCUS_04730 507001 505901 gene locus_tag LOCUS_04740 507001 505901 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 protein_id gnl|my_center|LOCUS_04740 507792 507025 gene locus_tag LOCUS_04750 507792 507025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 508953 507829 gene locus_tag LOCUS_04760 508953 507829 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205116563.1 protein_id gnl|my_center|LOCUS_04760 510034 509039 gene locus_tag LOCUS_04770 510034 509039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 511163 510366 gene locus_tag LOCUS_04780 511163 510366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 511417 511160 gene locus_tag LOCUS_04790 511417 511160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 511804 511655 gene locus_tag LOCUS_04800 511804 511655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 511993 511835 gene locus_tag LOCUS_04810 511993 511835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 514596 513787 gene locus_tag LOCUS_04820 514596 513787 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_04820 515190 514714 gene locus_tag LOCUS_04830 515190 514714 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393956.1 protein_id gnl|my_center|LOCUS_04830 515860 515366 gene locus_tag LOCUS_04840 515860 515366 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229066.1 protein_id gnl|my_center|LOCUS_04840 516561 515857 gene locus_tag LOCUS_04850 516561 515857 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431597.1 protein_id gnl|my_center|LOCUS_04850 517022 516597 gene locus_tag LOCUS_04860 517022 516597 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395139.1 protein_id gnl|my_center|LOCUS_04860 518597 517239 gene locus_tag LOCUS_04870 518597 517239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 519728 518601 gene locus_tag LOCUS_04880 519728 518601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 520335 519802 gene locus_tag LOCUS_04890 520335 519802 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465755.1 protein_id gnl|my_center|LOCUS_04890 521541 520558 gene locus_tag LOCUS_04900 521541 520558 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733112.1 protein_id gnl|my_center|LOCUS_04900 522219 521641 gene locus_tag LOCUS_04910 522219 521641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 523077 522256 gene locus_tag LOCUS_04920 523077 522256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 524048 523074 gene locus_tag LOCUS_04930 524048 523074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028123.1 protein_id gnl|my_center|LOCUS_04930 524683 524111 gene locus_tag LOCUS_04940 524683 524111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 525433 524879 gene locus_tag LOCUS_04950 525433 524879 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030768.1 protein_id gnl|my_center|LOCUS_04950 526378 525629 gene locus_tag LOCUS_04960 526378 525629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 527471 526524 gene locus_tag LOCUS_04970 527471 526524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 527979 527614 gene locus_tag LOCUS_04980 527979 527614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 528162 528890 gene locus_tag LOCUS_04990 528162 528890 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943077.1 protein_id gnl|my_center|LOCUS_04990 528990 529367 gene locus_tag LOCUS_05000 528990 529367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 529917 531275 gene locus_tag LOCUS_05010 529917 531275 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228217.1 protein_id gnl|my_center|LOCUS_05010 533611 531365 gene locus_tag LOCUS_05020 533611 531365 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_05020 534217 533648 gene locus_tag LOCUS_05030 534217 533648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 536439 534214 gene locus_tag LOCUS_05040 536439 534214 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_05040 537357 536758 gene locus_tag LOCUS_05050 537357 536758 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 protein_id gnl|my_center|LOCUS_05050 539652 537388 gene locus_tag LOCUS_05060 539652 537388 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731969.1 protein_id gnl|my_center|LOCUS_05060 540054 539746 gene locus_tag LOCUS_05070 540054 539746 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_05070 540297 540506 gene locus_tag LOCUS_05080 540297 540506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 542804 540672 gene locus_tag LOCUS_05090 542804 540672 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612392.1 protein_id gnl|my_center|LOCUS_05090 545231 543018 gene locus_tag LOCUS_05100 545231 543018 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243548.1 protein_id gnl|my_center|LOCUS_05100 545705 545241 gene locus_tag LOCUS_05110 545705 545241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 546041 546463 gene locus_tag LOCUS_05120 546041 546463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 546460 547536 gene locus_tag LOCUS_05130 546460 547536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 548624 547644 gene locus_tag LOCUS_05140 548624 547644 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803888.1 protein_id gnl|my_center|LOCUS_05140 548850 548641 gene locus_tag LOCUS_05150 548850 548641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05150 549036 548866 gene locus_tag LOCUS_05160 549036 548866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05160 549364 550068 gene locus_tag LOCUS_05170 549364 550068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 551224 550241 gene locus_tag LOCUS_05180 551224 550241 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 protein_id gnl|my_center|LOCUS_05180 552362 551577 gene locus_tag LOCUS_05190 552362 551577 CDS product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499399.1 protein_id gnl|my_center|LOCUS_05190 552533 553603 gene locus_tag LOCUS_05200 552533 553603 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147607.1 protein_id gnl|my_center|LOCUS_05200 554928 553711 gene locus_tag LOCUS_05210 554928 553711 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975930.1 protein_id gnl|my_center|LOCUS_05210 555241 555026 gene locus_tag LOCUS_05220 555241 555026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 555785 555234 gene locus_tag LOCUS_05230 555785 555234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 556504 555785 gene locus_tag LOCUS_05240 556504 555785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 557122 556640 gene locus_tag LOCUS_05250 557122 556640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 557567 557334 gene locus_tag LOCUS_05260 557567 557334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 558132 557515 gene locus_tag LOCUS_05270 558132 557515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 560137 558689 gene locus_tag LOCUS_05280 560137 558689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 561367 560165 gene locus_tag LOCUS_05290 561367 560165 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918420.1 protein_id gnl|my_center|LOCUS_05290 562278 561484 gene locus_tag LOCUS_05300 gene fabG 562278 561484 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_05300 564080 562329 gene locus_tag LOCUS_05310 564080 562329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 566584 565502 gene locus_tag LOCUS_05320 566584 565502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 567014 566730 gene locus_tag LOCUS_05330 567014 566730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 568317 567037 gene locus_tag LOCUS_05340 568317 567037 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437980.1 protein_id gnl|my_center|LOCUS_05340 570202 568514 gene locus_tag LOCUS_05350 570202 568514 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 protein_id gnl|my_center|LOCUS_05350 570701 572269 gene locus_tag LOCUS_05360 gene gerKA 570701 572269 CDS product spore germination protein GerKA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246515.1 protein_id gnl|my_center|LOCUS_05360 572302 573519 gene locus_tag LOCUS_05370 572302 573519 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461855.1 protein_id gnl|my_center|LOCUS_05370 573540 574655 gene locus_tag LOCUS_05380 573540 574655 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964835.1 protein_id gnl|my_center|LOCUS_05380 574901 574596 gene locus_tag LOCUS_05390 574901 574596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 575417 575016 gene locus_tag LOCUS_05400 575417 575016 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928641.1 protein_id gnl|my_center|LOCUS_05400 576204 575443 gene locus_tag LOCUS_05410 576204 575443 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535735.1 protein_id gnl|my_center|LOCUS_05410 576970 576221 gene locus_tag LOCUS_05420 576970 576221 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945998.1 protein_id gnl|my_center|LOCUS_05420 582197 577188 gene locus_tag LOCUS_05430 582197 577188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 583289 582462 gene locus_tag LOCUS_05440 gene ldcB 583289 582462 CDS product LD-carboxypeptidase LdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399387.1 protein_id gnl|my_center|LOCUS_05440 584724 583423 gene locus_tag LOCUS_05450 584724 583423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 585928 584765 gene locus_tag LOCUS_05460 585928 584765 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244902.1 protein_id gnl|my_center|LOCUS_05460 586811 585945 gene locus_tag LOCUS_05470 586811 585945 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814246.1 protein_id gnl|my_center|LOCUS_05470 587745 586831 gene locus_tag LOCUS_05480 587745 586831 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814244.1 protein_id gnl|my_center|LOCUS_05480 588918 587833 gene locus_tag LOCUS_05490 588918 587833 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002596.1 protein_id gnl|my_center|LOCUS_05490 589881 588979 gene locus_tag LOCUS_05500 589881 588979 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759382.1 protein_id gnl|my_center|LOCUS_05500 590935 590138 gene locus_tag LOCUS_05510 590935 590138 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231526.1 protein_id gnl|my_center|LOCUS_05510 592650 591079 gene locus_tag LOCUS_05520 592650 591079 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231527.1 protein_id gnl|my_center|LOCUS_05520 593793 592654 gene locus_tag LOCUS_05530 593793 592654 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 protein_id gnl|my_center|LOCUS_05530 594158 593829 gene locus_tag LOCUS_05540 594158 593829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_05540 595526 594162 gene locus_tag LOCUS_05550 595526 594162 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 protein_id gnl|my_center|LOCUS_05550 596025 597047 gene locus_tag LOCUS_05560 596025 597047 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966297.1 protein_id gnl|my_center|LOCUS_05560 597075 598088 gene locus_tag LOCUS_05570 597075 598088 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966298.1 protein_id gnl|my_center|LOCUS_05570 599491 598289 gene locus_tag LOCUS_05580 599491 598289 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965829.1 protein_id gnl|my_center|LOCUS_05580 600155 599523 gene locus_tag LOCUS_05590 600155 599523 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948142.1 protein_id gnl|my_center|LOCUS_05590 601132 600446 gene locus_tag LOCUS_05600 601132 600446 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001993852.1 protein_id gnl|my_center|LOCUS_05600 602608 601142 gene locus_tag LOCUS_05610 602608 601142 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023851.1 protein_id gnl|my_center|LOCUS_05610 603821 602727 gene locus_tag LOCUS_05620 gene gerKB 603821 602727 CDS product spore germination protein GerKB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234509.1 protein_id gnl|my_center|LOCUS_05620 604064 603843 gene locus_tag LOCUS_05630 604064 603843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 605263 604061 gene locus_tag LOCUS_05640 gene gerBC 605263 604061 CDS product spore germination protein GerBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242990.1 protein_id gnl|my_center|LOCUS_05640 606847 605267 gene locus_tag LOCUS_05650 606847 605267 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233683.1 protein_id gnl|my_center|LOCUS_05650 608082 607036 gene locus_tag LOCUS_05660 gene mnmH 608082 607036 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812887.1 protein_id gnl|my_center|LOCUS_05660 609165 608113 gene locus_tag LOCUS_05670 gene selD 609165 608113 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_05670 609549 611576 gene locus_tag LOCUS_05680 609549 611576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 612770 611715 gene locus_tag LOCUS_05690 612770 611715 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171504.1 protein_id gnl|my_center|LOCUS_05690 613160 612861 gene locus_tag LOCUS_05700 gene hbs 613160 612861 CDS product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 protein_id gnl|my_center|LOCUS_05700 613466 613263 gene locus_tag LOCUS_05710 gene cspB 613466 613263 CDS product cold-shock protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723180.1 protein_id gnl|my_center|LOCUS_05710 613644 614561 gene locus_tag LOCUS_05720 gene xerC 613644 614561 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765425.1 protein_id gnl|my_center|LOCUS_05720 615458 614706 gene locus_tag LOCUS_05730 615458 614706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 616848 615592 gene locus_tag LOCUS_05740 616848 615592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 619267 617033 gene locus_tag LOCUS_05750 619267 617033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 619601 619245 gene locus_tag LOCUS_05760 619601 619245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 620140 619598 gene locus_tag LOCUS_05770 620140 619598 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343928.1 protein_id gnl|my_center|LOCUS_05770 620387 621265 gene locus_tag LOCUS_05780 gene mneS 620387 621265 CDS product manganese transporter MneS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233995.1 protein_id gnl|my_center|LOCUS_05780 621563 622336 gene locus_tag LOCUS_05790 gene modA 621563 622336 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031846.1 protein_id gnl|my_center|LOCUS_05790 622363 623028 gene locus_tag LOCUS_05800 gene modB 622363 623028 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906541.1 protein_id gnl|my_center|LOCUS_05800 623169 623498 gene locus_tag LOCUS_05810 623169 623498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 623438 624331 gene locus_tag LOCUS_05820 623438 624331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 625664 624498 gene locus_tag LOCUS_05830 625664 624498 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796113.1 protein_id gnl|my_center|LOCUS_05830 626465 625716 gene locus_tag LOCUS_05840 gene nfsA 626465 625716 CDS product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705684.1 protein_id gnl|my_center|LOCUS_05840 627236 626505 gene locus_tag LOCUS_05850 627236 626505 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567984.1 protein_id gnl|my_center|LOCUS_05850 628506 627238 gene locus_tag LOCUS_05860 628506 627238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 629220 628519 gene locus_tag LOCUS_05870 629220 628519 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816701.1 protein_id gnl|my_center|LOCUS_05870 629928 629284 gene locus_tag LOCUS_05880 629928 629284 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093220.1 protein_id gnl|my_center|LOCUS_05880 630119 631060 gene locus_tag LOCUS_05890 630119 631060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 631151 631408 gene locus_tag LOCUS_05900 631151 631408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 632049 632294 gene locus_tag LOCUS_05910 632049 632294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 634277 632358 gene locus_tag LOCUS_05920 634277 632358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 635206 634472 gene locus_tag LOCUS_05930 635206 634472 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532950.1 protein_id gnl|my_center|LOCUS_05930 635444 635923 gene locus_tag LOCUS_05940 635444 635923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 637652 636000 gene locus_tag LOCUS_05950 637652 636000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 637936 637766 gene locus_tag LOCUS_05960 637936 637766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 637899 639473 gene locus_tag LOCUS_05970 637899 639473 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005166.1 protein_id gnl|my_center|LOCUS_05970 640112 640783 gene locus_tag LOCUS_05980 640112 640783 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082876.1 protein_id gnl|my_center|LOCUS_05980 642028 640952 gene locus_tag LOCUS_05990 642028 640952 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_05990 642162 643067 gene locus_tag LOCUS_06000 gene bsdA 642162 643067 CDS product transcriptional regulator BsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246552.1 protein_id gnl|my_center|LOCUS_06000 644280 643105 gene locus_tag LOCUS_06010 644280 643105 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_06010 644615 644442 gene locus_tag LOCUS_06020 644615 644442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 644807 645598 gene locus_tag LOCUS_06030 644807 645598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 646351 645620 gene locus_tag LOCUS_06040 646351 645620 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085267.1 protein_id gnl|my_center|LOCUS_06040 646849 646499 gene locus_tag LOCUS_06050 646849 646499 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706741.1 protein_id gnl|my_center|LOCUS_06050 647474 646851 gene locus_tag LOCUS_06060 647474 646851 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179831.1 protein_id gnl|my_center|LOCUS_06060 649449 647476 gene locus_tag LOCUS_06070 gene qoxB 649449 647476 CDS product cytochrome aa3 quinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227407.1 protein_id gnl|my_center|LOCUS_06070 650499 649471 gene locus_tag LOCUS_06080 650499 649471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 651072 650800 gene locus_tag LOCUS_06090 651072 650800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 651631 651206 gene locus_tag LOCUS_06100 651631 651206 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524104.1 protein_id gnl|my_center|LOCUS_06100 651821 656176 gene locus_tag LOCUS_06110 651821 656176 CDS product bifunctional nitrate reductase/sulfite reductase flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205569.1 protein_id gnl|my_center|LOCUS_06110 656854 656252 gene locus_tag LOCUS_06120 656854 656252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 657976 656873 gene locus_tag LOCUS_06130 657976 656873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 658837 658202 gene locus_tag LOCUS_06140 gene azoRB 658837 658202 CDS product FMN-dependent NADH-azoreductase AzoRB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243587.1 protein_id gnl|my_center|LOCUS_06140 659106 658867 gene locus_tag LOCUS_06150 659106 658867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 661408 659165 gene locus_tag LOCUS_06160 661408 659165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108861.1 protein_id gnl|my_center|LOCUS_06160 663201 661504 gene locus_tag LOCUS_06170 663201 661504 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831225.1 protein_id gnl|my_center|LOCUS_06170 664236 663340 gene locus_tag LOCUS_06180 664236 663340 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830948.1 protein_id gnl|my_center|LOCUS_06180 665177 664260 gene locus_tag LOCUS_06190 665177 664260 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_06190 666607 665435 gene locus_tag LOCUS_06200 666607 665435 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730052.1 protein_id gnl|my_center|LOCUS_06200 667008 669077 gene locus_tag LOCUS_06210 667008 669077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 669694 669476 gene locus_tag LOCUS_06220 669694 669476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 670463 670765 gene locus_tag LOCUS_06230 670463 670765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 670758 671630 gene locus_tag LOCUS_06240 670758 671630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 671741 672271 gene locus_tag LOCUS_06250 671741 672271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 673240 672395 gene locus_tag LOCUS_06260 673240 672395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 673354 674583 gene locus_tag LOCUS_06270 673354 674583 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149429.1 protein_id gnl|my_center|LOCUS_06270 674706 675482 gene locus_tag LOCUS_06280 674706 675482 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930637.1 protein_id gnl|my_center|LOCUS_06280 675551 675907 gene locus_tag LOCUS_06290 675551 675907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 677349 676015 gene locus_tag LOCUS_06300 677349 676015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 677875 677336 gene locus_tag LOCUS_06310 677875 677336 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460341.1 protein_id gnl|my_center|LOCUS_06310 678821 678075 gene locus_tag LOCUS_06320 678821 678075 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393842.1 protein_id gnl|my_center|LOCUS_06320 680139 678985 gene locus_tag LOCUS_06330 680139 678985 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461855.1 protein_id gnl|my_center|LOCUS_06330 681584 680136 gene locus_tag LOCUS_06340 681584 680136 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_06340 682674 681556 gene locus_tag LOCUS_06350 gene gerKB 682674 681556 CDS product spore germination protein GerKB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234509.1 protein_id gnl|my_center|LOCUS_06350 682843 683799 gene locus_tag LOCUS_06360 682843 683799 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712215.1 protein_id gnl|my_center|LOCUS_06360 684002 684823 gene locus_tag LOCUS_06370 684002 684823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 686913 685057 gene locus_tag LOCUS_06380 686913 685057 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259019.1 protein_id gnl|my_center|LOCUS_06380 688283 687075 gene locus_tag LOCUS_06390 688283 687075 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858621.1 protein_id gnl|my_center|LOCUS_06390 689627 688455 gene locus_tag LOCUS_06400 689627 688455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 690484 689729 gene locus_tag LOCUS_06410 690484 689729 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994060.1 protein_id gnl|my_center|LOCUS_06410 691118 690573 gene locus_tag LOCUS_06420 691118 690573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 692487 691165 gene locus_tag LOCUS_06430 692487 691165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 692687 692463 gene locus_tag LOCUS_06440 692687 692463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 693259 692738 gene locus_tag LOCUS_06450 693259 692738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 694512 693256 gene locus_tag LOCUS_06460 694512 693256 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886562.1 protein_id gnl|my_center|LOCUS_06460 695576 694833 gene locus_tag LOCUS_06470 695576 694833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 696939 695596 gene locus_tag LOCUS_06480 696939 695596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 700923 697153 gene locus_tag LOCUS_06490 700923 697153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 701290 701562 gene locus_tag LOCUS_06500 701290 701562 CDS product excalibur calcium-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233136.1 protein_id gnl|my_center|LOCUS_06500 702538 701876 gene locus_tag LOCUS_06510 702538 701876 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588494.1 protein_id gnl|my_center|LOCUS_06510 704030 702756 gene locus_tag LOCUS_06520 gene aldO 704030 702756 CDS product alditol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030685.1 protein_id gnl|my_center|LOCUS_06520 704305 705372 gene locus_tag LOCUS_06530 704305 705372 CDS product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775736.1 protein_id gnl|my_center|LOCUS_06530 705853 705389 gene locus_tag LOCUS_06540 705853 705389 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686683.1 protein_id gnl|my_center|LOCUS_06540 707453 706080 gene locus_tag LOCUS_06550 707453 706080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 708019 707477 gene locus_tag LOCUS_06560 708019 707477 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824675.1 protein_id gnl|my_center|LOCUS_06560 708793 708032 gene locus_tag LOCUS_06570 708793 708032 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114245.1 protein_id gnl|my_center|LOCUS_06570 709264 710595 gene locus_tag LOCUS_06580 709264 710595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 711156 710650 gene locus_tag LOCUS_06590 711156 710650 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211478017.1 protein_id gnl|my_center|LOCUS_06590 712246 711416 gene locus_tag LOCUS_06600 712246 711416 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226872.1 protein_id gnl|my_center|LOCUS_06600 713109 712243 gene locus_tag LOCUS_06610 713109 712243 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_06610 714658 713225 gene locus_tag LOCUS_06620 714658 713225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 715576 714782 gene locus_tag LOCUS_06630 715576 714782 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922507.1 protein_id gnl|my_center|LOCUS_06630 717274 715580 gene locus_tag LOCUS_06640 717274 715580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 718835 717831 gene locus_tag LOCUS_06650 718835 717831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 719880 719041 gene locus_tag LOCUS_06660 719880 719041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 720217 722349 gene locus_tag LOCUS_06670 720217 722349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 725601 722679 gene locus_tag LOCUS_r00010 725601 722679 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 726050 725938 gene locus_tag LOCUS_r00020 726050 725938 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 727754 726209 gene locus_tag LOCUS_r00030 727754 726209 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 728976 728230 gene locus_tag LOCUS_06680 728976 728230 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723335.1 protein_id gnl|my_center|LOCUS_06680 730005 729121 gene locus_tag LOCUS_06690 730005 729121 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_06690 730964 730065 gene locus_tag LOCUS_06700 730964 730065 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_06700 732814 731069 gene locus_tag LOCUS_06710 732814 731069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 734465 733083 gene locus_tag LOCUS_06720 734465 733083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 736215 734443 gene locus_tag LOCUS_06730 736215 734443 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902683.1 protein_id gnl|my_center|LOCUS_06730 737170 736442 gene locus_tag LOCUS_06740 737170 736442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 737613 737188 gene locus_tag LOCUS_06750 737613 737188 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706722.1 protein_id gnl|my_center|LOCUS_06750 738152 737616 gene locus_tag LOCUS_06760 738152 737616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 738670 738125 gene locus_tag LOCUS_06770 738670 738125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 738990 738712 gene locus_tag LOCUS_06780 738990 738712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 739594 739025 gene locus_tag LOCUS_06790 739594 739025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 739835 739620 gene locus_tag LOCUS_06800 739835 739620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 740107 739850 gene locus_tag LOCUS_06810 740107 739850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 740808 740242 gene locus_tag LOCUS_06820 740808 740242 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963411.1 protein_id gnl|my_center|LOCUS_06820 741673 740903 gene locus_tag LOCUS_06830 741673 740903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 742408 741965 gene locus_tag LOCUS_06840 742408 741965 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355539.1 protein_id gnl|my_center|LOCUS_06840 744853 742457 gene locus_tag LOCUS_06850 gene helD 744853 742457 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035427.1 protein_id gnl|my_center|LOCUS_06850 745643 744987 gene locus_tag LOCUS_06860 gene azoRB 745643 744987 CDS product FMN-dependent NADH-azoreductase AzoRB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243587.1 protein_id gnl|my_center|LOCUS_06860 746864 745944 gene locus_tag LOCUS_06870 746864 745944 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909376.1 protein_id gnl|my_center|LOCUS_06870 747150 748424 gene locus_tag LOCUS_06880 gene thrC 747150 748424 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021620.1 protein_id gnl|my_center|LOCUS_06880 749875 748475 gene locus_tag LOCUS_06890 749875 748475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 750808 750134 gene locus_tag LOCUS_06900 gene hitR 750808 750134 CDS product envelope stress response regulator transcription factor HitR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612413.1 protein_id gnl|my_center|LOCUS_06900 751653 750901 gene locus_tag LOCUS_06910 751653 750901 CDS product (S)-benzoin forming benzil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244421.1 protein_id gnl|my_center|LOCUS_06910 753415 751775 gene locus_tag LOCUS_06920 gene metG 753415 751775 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021571.1 protein_id gnl|my_center|LOCUS_06920 754955 754014 gene locus_tag LOCUS_06930 754955 754014 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849692.1 protein_id gnl|my_center|LOCUS_06930 755451 755047 gene locus_tag LOCUS_06940 755451 755047 CDS product DUF2809 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093444.1 protein_id gnl|my_center|LOCUS_06940 756600 755503 gene locus_tag LOCUS_06950 756600 755503 CDS product DUF3900 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233793.1 protein_id gnl|my_center|LOCUS_06950 758919 756826 gene locus_tag LOCUS_06960 758919 756826 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059519.1 protein_id gnl|my_center|LOCUS_06960 759964 759128 gene locus_tag LOCUS_06970 gene trpA 759964 759128 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_06970 761198 759912 gene locus_tag LOCUS_06980 gene trpB 761198 759912 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546381.1 protein_id gnl|my_center|LOCUS_06980 762223 761261 gene locus_tag LOCUS_06990 762223 761261 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453966.1 protein_id gnl|my_center|LOCUS_06990 762736 762458 gene locus_tag LOCUS_07000 762736 762458 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986717.1 protein_id gnl|my_center|LOCUS_07000 765536 762912 gene locus_tag LOCUS_07010 gene hrpB 765536 762912 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_07010 766564 765848 gene locus_tag LOCUS_07020 766564 765848 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249797.1 protein_id gnl|my_center|LOCUS_07020 768440 766584 gene locus_tag LOCUS_07030 768440 766584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 769564 768437 gene locus_tag LOCUS_07040 769564 768437 CDS product pyridoxal phosphate-dependent class II aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038569156.1 protein_id gnl|my_center|LOCUS_07040 770392 769586 gene locus_tag LOCUS_07050 gene cobS 770392 769586 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257084.1 protein_id gnl|my_center|LOCUS_07050 771354 770374 gene locus_tag LOCUS_07060 gene cbiB 771354 770374 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_07060 771956 771360 gene locus_tag LOCUS_07070 gene cobU 771956 771360 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258421.1 protein_id gnl|my_center|LOCUS_07070 773070 772015 gene locus_tag LOCUS_07080 gene cobT 773070 772015 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541537.1 protein_id gnl|my_center|LOCUS_07080 773926 773120 gene locus_tag LOCUS_07090 773926 773120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460056.1 protein_id gnl|my_center|LOCUS_07090 774927 773923 gene locus_tag LOCUS_07100 774927 773923 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_07100 776017 774965 gene locus_tag LOCUS_07110 776017 774965 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243040.1 protein_id gnl|my_center|LOCUS_07110 778914 776704 gene locus_tag LOCUS_07120 778914 776704 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005309.1 protein_id gnl|my_center|LOCUS_07120 779509 779201 gene locus_tag LOCUS_07130 779509 779201 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661811.1 protein_id gnl|my_center|LOCUS_07130 779902 779651 gene locus_tag LOCUS_07140 779902 779651 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637521.1 protein_id gnl|my_center|LOCUS_07140 780924 779968 gene locus_tag LOCUS_07150 780924 779968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 781522 780998 gene locus_tag LOCUS_07160 gene lepB 781522 780998 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948309.1 protein_id gnl|my_center|LOCUS_07160 781700 782917 gene locus_tag LOCUS_07170 781700 782917 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244027.1 protein_id gnl|my_center|LOCUS_07170 783504 783028 gene locus_tag LOCUS_07180 783504 783028 CDS product RicAFT regulatory complex protein RicA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003744056.1 protein_id gnl|my_center|LOCUS_07180 785124 783526 gene locus_tag LOCUS_07190 gene miaB 785124 783526 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005404.1 protein_id gnl|my_center|LOCUS_07190 785920 785348 gene locus_tag LOCUS_07200 785920 785348 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944972.1 protein_id gnl|my_center|LOCUS_07200 786887 786021 gene locus_tag LOCUS_07210 786887 786021 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190155.1 protein_id gnl|my_center|LOCUS_07210 788622 786889 gene locus_tag LOCUS_07220 788622 786889 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625418.1 protein_id gnl|my_center|LOCUS_07220 789867 788917 gene locus_tag LOCUS_07230 789867 788917 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688057.1 protein_id gnl|my_center|LOCUS_07230 790266 790006 gene locus_tag LOCUS_07240 gene spoVS 790266 790006 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459952.1 protein_id gnl|my_center|LOCUS_07240 791242 790448 gene locus_tag LOCUS_07250 gene ymdB 791242 790448 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_07250 792859 791318 gene locus_tag LOCUS_07260 gene rny 792859 791318 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204912.1 protein_id gnl|my_center|LOCUS_07260 793707 793033 gene locus_tag LOCUS_07270 gene recX 793707 793033 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002318634.1 protein_id gnl|my_center|LOCUS_07270 794845 793898 gene locus_tag LOCUS_07280 gene recA 794845 793898 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245789.1 protein_id gnl|my_center|LOCUS_07280 796434 795175 gene locus_tag LOCUS_07290 gene cinA 796434 795175 CDS product competence/damage-inducible protein CinA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990712.1 protein_id gnl|my_center|LOCUS_07290 797145 796561 gene locus_tag LOCUS_07300 gene pgsA 797145 796561 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459962.1 protein_id gnl|my_center|LOCUS_07300 798470 797145 gene locus_tag LOCUS_07310 gene rimO 798470 797145 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_07310 799107 798619 gene locus_tag LOCUS_07320 799107 798619 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_07320 800220 799240 gene locus_tag LOCUS_07330 800220 799240 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732284.1 protein_id gnl|my_center|LOCUS_07330 801044 800280 gene locus_tag LOCUS_07340 801044 800280 CDS product DUF3388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574107.1 protein_id gnl|my_center|LOCUS_07340 801441 801190 gene locus_tag LOCUS_07350 801441 801190 CDS product DUF3243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393333.1 protein_id gnl|my_center|LOCUS_07350 802292 801543 gene locus_tag LOCUS_07360 802292 801543 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_07360 803575 802289 gene locus_tag LOCUS_07370 803575 802289 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411954.1 protein_id gnl|my_center|LOCUS_07370 804860 803580 gene locus_tag LOCUS_07380 804860 803580 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772433.1 protein_id gnl|my_center|LOCUS_07380 805779 804988 gene locus_tag LOCUS_07390 gene sleB 805779 804988 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249045.1 protein_id gnl|my_center|LOCUS_07390 808544 805878 gene locus_tag LOCUS_07400 808544 805878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 808836 808612 gene locus_tag LOCUS_07410 808836 808612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 809597 808833 gene locus_tag LOCUS_07420 gene tepA 809597 808833 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 protein_id gnl|my_center|LOCUS_07420 811465 809786 gene locus_tag LOCUS_07430 811465 809786 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645621.1 protein_id gnl|my_center|LOCUS_07430 812799 811936 gene locus_tag LOCUS_07440 gene dapA 812799 811936 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245816.1 protein_id gnl|my_center|LOCUS_07440 814130 812916 gene locus_tag LOCUS_07450 gene dapG 814130 812916 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692470.1 protein_id gnl|my_center|LOCUS_07450 815244 814204 gene locus_tag LOCUS_07460 gene asd 815244 814204 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414849.1 protein_id gnl|my_center|LOCUS_07460 815908 815321 gene locus_tag LOCUS_07470 815908 815321 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_07470 816804 815905 gene locus_tag LOCUS_07480 gene dpaA 816804 815905 CDS product dipicolinic acid synthetase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954735.1 protein_id gnl|my_center|LOCUS_07480 817508 817065 gene locus_tag LOCUS_07490 gene dut 817508 817065 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174552523.1 protein_id gnl|my_center|LOCUS_07490 818754 817489 gene locus_tag LOCUS_07500 818754 817489 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592994.1 protein_id gnl|my_center|LOCUS_07500 819880 818882 gene locus_tag LOCUS_07510 819880 818882 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244721.1 protein_id gnl|my_center|LOCUS_07510 822113 820008 gene locus_tag LOCUS_07520 gene pnp 822113 820008 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076750.1 protein_id gnl|my_center|LOCUS_07520 822611 822342 gene locus_tag LOCUS_07530 gene rpsO 822611 822342 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220957.1 protein_id gnl|my_center|LOCUS_07530 823733 822777 gene locus_tag LOCUS_07540 gene ribF 823733 822777 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245551.1 protein_id gnl|my_center|LOCUS_07540 824681 823758 gene locus_tag LOCUS_07550 gene truB 824681 823758 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244678.1 protein_id gnl|my_center|LOCUS_07550 825688 824678 gene locus_tag LOCUS_07560 825688 824678 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_07560 826047 825685 gene locus_tag LOCUS_07570 gene rbfA 826047 825685 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776437.1 protein_id gnl|my_center|LOCUS_07570 829030 826055 gene locus_tag LOCUS_07580 829030 826055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 829355 829023 gene locus_tag LOCUS_07590 829355 829023 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357860.1 protein_id gnl|my_center|LOCUS_07590 829659 829339 gene locus_tag LOCUS_07600 829659 829339 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392562.1 protein_id gnl|my_center|LOCUS_07600 830789 829692 gene locus_tag LOCUS_07610 gene nusA 830789 829692 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_07610 831318 830857 gene locus_tag LOCUS_07620 gene rimP 831318 830857 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 protein_id gnl|my_center|LOCUS_07620 836427 832120 gene locus_tag LOCUS_07630 836427 832120 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245843.1 protein_id gnl|my_center|LOCUS_07630 837894 836446 gene locus_tag LOCUS_07640 gene proS 837894 836446 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583195.1 protein_id gnl|my_center|LOCUS_07640 839178 837901 gene locus_tag LOCUS_07650 gene rseP 839178 837901 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090228.1 protein_id gnl|my_center|LOCUS_07650 840395 839256 gene locus_tag LOCUS_07660 840395 839256 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188776689.1 protein_id gnl|my_center|LOCUS_07660 841212 840418 gene locus_tag LOCUS_07670 gene cdsA 841212 840418 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813592.1 protein_id gnl|my_center|LOCUS_07670 842072 841239 gene locus_tag LOCUS_07680 842072 841239 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231925.1 protein_id gnl|my_center|LOCUS_07680 842629 842075 gene locus_tag LOCUS_07690 gene frr 842629 842075 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986799.1 protein_id gnl|my_center|LOCUS_07690 843360 842629 gene locus_tag LOCUS_07700 gene pyrH 843360 842629 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042663.1 protein_id gnl|my_center|LOCUS_07700 844148 843498 gene locus_tag LOCUS_07710 gene tsf 844148 843498 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460416.1 protein_id gnl|my_center|LOCUS_07710 845059 844361 gene locus_tag LOCUS_07720 gene rpsB 845059 844361 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_07720 845839 845258 gene locus_tag LOCUS_07730 845839 845258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 846437 845832 gene locus_tag LOCUS_07740 846437 845832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 846805 846473 gene locus_tag LOCUS_07750 846805 846473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 848277 846871 gene locus_tag LOCUS_07760 848277 846871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 849085 848300 gene locus_tag LOCUS_07770 gene sigD 849085 848300 CDS product RNA polymerase sigma-28 factor SigD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220911.1 protein_id gnl|my_center|LOCUS_07770 849521 849090 gene locus_tag LOCUS_07780 849521 849090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 850017 849523 gene locus_tag LOCUS_07790 gene cheD 850017 849523 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244852.1 protein_id gnl|my_center|LOCUS_07790 850631 850014 gene locus_tag LOCUS_07800 gene cheC 850631 850014 CDS product CheY-P phosphatase CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231935.1 protein_id gnl|my_center|LOCUS_07800 851098 850637 gene locus_tag LOCUS_07810 851098 850637 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 protein_id gnl|my_center|LOCUS_07810 853191 851113 gene locus_tag LOCUS_07820 853191 851113 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192596.1 protein_id gnl|my_center|LOCUS_07820 854556 853237 gene locus_tag LOCUS_07830 gene cheB 854556 853237 CDS product protein-glutamate O-methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245823.1 protein_id gnl|my_center|LOCUS_07830 855455 854586 gene locus_tag LOCUS_07840 855455 854586 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680723.1 protein_id gnl|my_center|LOCUS_07840 856323 855448 gene locus_tag LOCUS_07850 856323 855448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 858902 856869 gene locus_tag LOCUS_07860 gene flhA 858902 856869 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_07860 860023 858932 gene locus_tag LOCUS_07870 gene flhB 860023 858932 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_07870 860927 860139 gene locus_tag LOCUS_07880 gene fliR 860927 860139 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816212.1 protein_id gnl|my_center|LOCUS_07880 861209 860940 gene locus_tag LOCUS_07890 gene fliQ 861209 860940 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_07890 861991 861233 gene locus_tag LOCUS_07900 gene fliP 861991 861233 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245692.1 protein_id gnl|my_center|LOCUS_07900 862602 861988 gene locus_tag LOCUS_07910 862602 861988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 862969 862607 gene locus_tag LOCUS_07920 gene cheY 862969 862607 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244957.1 protein_id gnl|my_center|LOCUS_07920 864219 862990 gene locus_tag LOCUS_07930 gene fliY 864219 862990 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392326.1 protein_id gnl|my_center|LOCUS_07930 865210 864209 gene locus_tag LOCUS_07940 gene fliM 865210 864209 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220879.1 protein_id gnl|my_center|LOCUS_07940 865737 865255 gene locus_tag LOCUS_07950 865737 865255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 865961 865737 gene locus_tag LOCUS_07960 865961 865737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 866839 866018 gene locus_tag LOCUS_07970 gene flgG 866839 866018 CDS product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231968.1 protein_id gnl|my_center|LOCUS_07970 867328 866951 gene locus_tag LOCUS_07980 867328 866951 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941086.1 protein_id gnl|my_center|LOCUS_07980 867776 867321 gene locus_tag LOCUS_07990 867776 867321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 869360 867828 gene locus_tag LOCUS_08000 869360 867828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 870314 869409 gene locus_tag LOCUS_08010 870314 869409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 870814 870368 gene locus_tag LOCUS_08020 870814 870368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 872158 870824 gene locus_tag LOCUS_08030 gene fliI 872158 870824 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090887161.1 protein_id gnl|my_center|LOCUS_08030 872966 872148 gene locus_tag LOCUS_08040 872966 872148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 873969 872959 gene locus_tag LOCUS_08050 gene fliG 873969 872959 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 protein_id gnl|my_center|LOCUS_08050 875540 873981 gene locus_tag LOCUS_08060 gene fliF 875540 873981 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937620.1 protein_id gnl|my_center|LOCUS_08060 875898 875584 gene locus_tag LOCUS_08070 gene fliE 875898 875584 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392291.1 protein_id gnl|my_center|LOCUS_08070 876373 875924 gene locus_tag LOCUS_08080 gene flgC 876373 875924 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245521.1 protein_id gnl|my_center|LOCUS_08080 876516 876376 gene locus_tag LOCUS_08090 876516 876376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 876580 876753 gene locus_tag LOCUS_08100 876580 876753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 877805 877035 gene locus_tag LOCUS_08110 gene codY 877805 877035 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421290.1 protein_id gnl|my_center|LOCUS_08110 879243 877837 gene locus_tag LOCUS_08120 gene hslU 879243 877837 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 protein_id gnl|my_center|LOCUS_08120 879835 879290 gene locus_tag LOCUS_08130 gene hslV 879835 879290 CDS product ATP-dependent protease proteolytic subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526272.1 protein_id gnl|my_center|LOCUS_08130 881360 880008 gene locus_tag LOCUS_08140 gene trmFO 881360 880008 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357486.1 protein_id gnl|my_center|LOCUS_08140 883498 881396 gene locus_tag LOCUS_08150 gene topA 883498 881396 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245599.1 protein_id gnl|my_center|LOCUS_08150 884644 883526 gene locus_tag LOCUS_08160 gene dprA 884644 883526 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_08160 885741 884812 gene locus_tag LOCUS_08170 gene sucD 885741 884812 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 protein_id gnl|my_center|LOCUS_08170 886961 885801 gene locus_tag LOCUS_08180 gene sucC 886961 885801 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_08180 887249 887716 gene locus_tag LOCUS_08190 887249 887716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 887827 889386 gene locus_tag LOCUS_08200 887827 889386 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_08200 889908 889501 gene locus_tag LOCUS_08210 889908 889501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 890225 889905 gene locus_tag LOCUS_08220 890225 889905 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545507.1 protein_id gnl|my_center|LOCUS_08220 892402 890222 gene locus_tag LOCUS_08230 892402 890222 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164545570.1 protein_id gnl|my_center|LOCUS_08230 893168 892554 gene locus_tag LOCUS_08240 893168 892554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 894235 893369 gene locus_tag LOCUS_08250 gene ylqF 894235 893369 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_08250 894950 894249 gene locus_tag LOCUS_08260 gene lepB 894950 894249 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711857.1 protein_id gnl|my_center|LOCUS_08260 895496 895155 gene locus_tag LOCUS_08270 gene rplS 895496 895155 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186516.1 protein_id gnl|my_center|LOCUS_08270 896430 895678 gene locus_tag LOCUS_08280 gene trmD 896430 895678 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686903.1 protein_id gnl|my_center|LOCUS_08280 896952 896434 gene locus_tag LOCUS_08290 gene rimM 896952 896434 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170278.1 protein_id gnl|my_center|LOCUS_08290 897369 897139 gene locus_tag LOCUS_08300 897369 897139 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 protein_id gnl|my_center|LOCUS_08300 897668 897396 gene locus_tag LOCUS_08310 gene rpsP 897668 897396 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268750.1 protein_id gnl|my_center|LOCUS_08310 899085 897712 gene locus_tag LOCUS_08320 gene ffh 899085 897712 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863461.1 protein_id gnl|my_center|LOCUS_08320 899521 899150 gene locus_tag LOCUS_08330 899521 899150 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891062.1 protein_id gnl|my_center|LOCUS_08330 900675 899671 gene locus_tag LOCUS_08340 gene ftsY 900675 899671 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 protein_id gnl|my_center|LOCUS_08340 904355 900780 gene locus_tag LOCUS_08350 gene smc 904355 900780 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478987.1 protein_id gnl|my_center|LOCUS_08350 905347 904655 gene locus_tag LOCUS_08360 gene rncS 905347 904655 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_08360 906578 905337 gene locus_tag LOCUS_08370 gene fabF 906578 905337 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_08370 906956 906720 gene locus_tag LOCUS_08380 gene acpP 906956 906720 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154310.1 protein_id gnl|my_center|LOCUS_08380 907769 907050 gene locus_tag LOCUS_08390 gene fabG 907769 907050 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_08390 909498 908572 gene locus_tag LOCUS_08400 gene fabD 909498 908572 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989819.1 protein_id gnl|my_center|LOCUS_08400 910539 909553 gene locus_tag LOCUS_08410 910539 909553 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 protein_id gnl|my_center|LOCUS_08410 911540 910548 gene locus_tag LOCUS_08420 gene plsX 911540 910548 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232041.1 protein_id gnl|my_center|LOCUS_08420 912138 911521 gene locus_tag LOCUS_08430 gene fapR 912138 911521 CDS product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232044.1 protein_id gnl|my_center|LOCUS_08430 912613 912440 gene locus_tag LOCUS_08440 gene rpmF 912613 912440 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984764.1 protein_id gnl|my_center|LOCUS_08440 913170 912658 gene locus_tag LOCUS_08450 913170 912658 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_08450 913285 914520 gene locus_tag LOCUS_08460 913285 914520 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081862.1 protein_id gnl|my_center|LOCUS_08460 915223 916404 gene locus_tag LOCUS_08470 gene ylbJ 915223 916404 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273100.1 protein_id gnl|my_center|LOCUS_08470 916927 916409 gene locus_tag LOCUS_08480 gene coaD 916927 916409 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245283.1 protein_id gnl|my_center|LOCUS_08480 917524 916931 gene locus_tag LOCUS_08490 gene rsmD 917524 916931 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_08490 918702 917734 gene locus_tag LOCUS_08500 918702 917734 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966891.1 protein_id gnl|my_center|LOCUS_08500 919697 918699 gene locus_tag LOCUS_08510 gene oppD 919697 918699 CDS product oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886477.1 protein_id gnl|my_center|LOCUS_08510 920635 919718 gene locus_tag LOCUS_08520 gene oppC 920635 919718 CDS product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232954.1 protein_id gnl|my_center|LOCUS_08520 921567 920632 gene locus_tag LOCUS_08530 gene oppB 921567 920632 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 protein_id gnl|my_center|LOCUS_08530 923272 921650 gene locus_tag LOCUS_08540 gene oppA 923272 921650 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232957.1 protein_id gnl|my_center|LOCUS_08540 924773 923547 gene locus_tag LOCUS_08550 924773 923547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 925675 924986 gene locus_tag LOCUS_08560 925675 924986 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_08560 926024 925665 gene locus_tag LOCUS_08570 926024 925665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 926985 926029 gene locus_tag LOCUS_08580 926985 926029 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073434.1 protein_id gnl|my_center|LOCUS_08580 928873 927398 gene locus_tag LOCUS_08590 928873 927398 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_08590 930461 929187 gene locus_tag LOCUS_08600 gene kinB 930461 929187 CDS product sporulation sensor histidine kinase KinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002002352.1 protein_id gnl|my_center|LOCUS_08600 932147 930720 gene locus_tag LOCUS_08610 gene glgA 932147 930720 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042515450.1 protein_id gnl|my_center|LOCUS_08610 933288 932176 gene locus_tag LOCUS_08620 gene glgD 933288 932176 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 protein_id gnl|my_center|LOCUS_08620 934394 933285 gene locus_tag LOCUS_08630 gene glgC 934394 933285 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_08630 935996 934974 gene locus_tag LOCUS_08640 935996 934974 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_08640 937034 936081 gene locus_tag LOCUS_08650 937034 936081 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_08650 938060 937080 gene locus_tag LOCUS_08660 938060 937080 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398762.1 protein_id gnl|my_center|LOCUS_08660 939754 938339 gene locus_tag LOCUS_08670 939754 938339 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224359.1 protein_id gnl|my_center|LOCUS_08670 939942 940859 gene locus_tag LOCUS_08680 gene cmrA 939942 940859 CDS product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_08680 941557 940913 gene locus_tag LOCUS_08690 941557 940913 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357697.1 protein_id gnl|my_center|LOCUS_08690 941705 941956 gene locus_tag LOCUS_08700 941705 941956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 942848 942030 gene locus_tag LOCUS_08710 942848 942030 CDS product DUF2935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554487.1 protein_id gnl|my_center|LOCUS_08710 943023 943397 gene locus_tag LOCUS_08720 943023 943397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 943600 944220 gene locus_tag LOCUS_08730 943600 944220 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120574.1 protein_id gnl|my_center|LOCUS_08730 946434 944293 gene locus_tag LOCUS_08740 946434 944293 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769254.1 protein_id gnl|my_center|LOCUS_08740 947423 946629 gene locus_tag LOCUS_08750 947423 946629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 947618 949291 gene locus_tag LOCUS_08760 947618 949291 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645621.1 protein_id gnl|my_center|LOCUS_08760 949590 949396 gene locus_tag LOCUS_08770 949590 949396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 949928 950215 gene locus_tag LOCUS_08780 949928 950215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 951126 950356 gene locus_tag LOCUS_08790 951126 950356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 951302 952699 gene locus_tag LOCUS_08800 951302 952699 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537911.1 protein_id gnl|my_center|LOCUS_08800 952817 952936 gene locus_tag LOCUS_08810 952817 952936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 953073 953834 gene locus_tag LOCUS_08820 953073 953834 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964695.1 protein_id gnl|my_center|LOCUS_08820 954364 953927 gene locus_tag LOCUS_08830 954364 953927 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831164.1 protein_id gnl|my_center|LOCUS_08830 955953 954823 gene locus_tag LOCUS_08840 gene rfbG 955953 954823 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_08840 957305 957141 gene locus_tag LOCUS_08850 957305 957141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 957946 957233 gene locus_tag LOCUS_08860 gene dnaD 957946 957233 CDS product DNA replication protein DnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398499.1 protein_id gnl|my_center|LOCUS_08860 959282 957987 gene locus_tag LOCUS_08870 gene asnS 959282 957987 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398777.1 protein_id gnl|my_center|LOCUS_08870 960524 959319 gene locus_tag LOCUS_08880 gene ackA 960524 959319 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_08880 961396 960521 gene locus_tag LOCUS_08890 961396 960521 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_08890 963016 961496 gene locus_tag LOCUS_08900 963016 961496 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812900.1 protein_id gnl|my_center|LOCUS_08900 963545 963009 gene locus_tag LOCUS_08910 963545 963009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 964218 963697 gene locus_tag LOCUS_08920 964218 963697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 965519 964218 gene locus_tag LOCUS_08930 965519 964218 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_08930 966156 965500 gene locus_tag LOCUS_08940 966156 965500 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259489.1 protein_id gnl|my_center|LOCUS_08940 969056 966153 gene locus_tag LOCUS_08950 gene dinG 969056 966153 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212965591.1 protein_id gnl|my_center|LOCUS_08950 969987 969214 gene locus_tag LOCUS_08960 969987 969214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 970570 970187 gene locus_tag LOCUS_08970 970570 970187 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458949.1 protein_id gnl|my_center|LOCUS_08970 971453 970521 gene locus_tag LOCUS_08980 gene panC 971453 970521 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458948.1 protein_id gnl|my_center|LOCUS_08980 972394 971450 gene locus_tag LOCUS_08990 gene panB 972394 971450 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212979991.1 protein_id gnl|my_center|LOCUS_08990 973768 972782 gene locus_tag LOCUS_09000 973768 972782 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192045.1 protein_id gnl|my_center|LOCUS_09000 975216 973795 gene locus_tag LOCUS_09010 975216 973795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 976406 975246 gene locus_tag LOCUS_09020 gene bshA 976406 975246 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768305.1 protein_id gnl|my_center|LOCUS_09020 977179 976481 gene locus_tag LOCUS_09030 gene bshB1 977179 976481 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015666.1 protein_id gnl|my_center|LOCUS_09030 977595 977179 gene locus_tag LOCUS_09040 gene mgsA 977595 977179 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_09040 978446 977637 gene locus_tag LOCUS_09050 gene dapB 978446 977637 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808837.1 protein_id gnl|my_center|LOCUS_09050 978997 978452 gene locus_tag LOCUS_09060 978997 978452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 979399 979064 gene locus_tag LOCUS_09070 979399 979064 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002108639.1 protein_id gnl|my_center|LOCUS_09070 979552 980418 gene locus_tag LOCUS_09080 979552 980418 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202121.1 protein_id gnl|my_center|LOCUS_09080 981422 980493 gene locus_tag LOCUS_09090 981422 980493 CDS product sporulation protein YpjB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133225906.1 protein_id gnl|my_center|LOCUS_09090 982106 981465 gene locus_tag LOCUS_09100 982106 981465 CDS product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886552.1 protein_id gnl|my_center|LOCUS_09100 983142 982255 gene locus_tag LOCUS_09110 gene qcrC 983142 982255 CDS product menaquinol-cytochrome c reductase cytochrome b/c subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554608.1 protein_id gnl|my_center|LOCUS_09110 983836 983165 gene locus_tag LOCUS_09120 gene qcrB 983836 983165 CDS product menaquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932700.1 protein_id gnl|my_center|LOCUS_09120 984381 983854 gene locus_tag LOCUS_09130 gene qcrA 984381 983854 CDS product menaquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290423.1 protein_id gnl|my_center|LOCUS_09130 985055 984636 gene locus_tag LOCUS_09140 985055 984636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 985443 985261 gene locus_tag LOCUS_09150 985443 985261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 986977 985730 gene locus_tag LOCUS_09160 986977 985730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 987706 987119 gene locus_tag LOCUS_09170 987706 987119 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003289268.1 protein_id gnl|my_center|LOCUS_09170 988389 987787 gene locus_tag LOCUS_09180 988389 987787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 988982 988386 gene locus_tag LOCUS_09190 988982 988386 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_09190 990528 989437 gene locus_tag LOCUS_09200 gene tyrA 990528 989437 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228123.1 protein_id gnl|my_center|LOCUS_09200 991630 990533 gene locus_tag LOCUS_09210 gene hisC 991630 990533 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399129.1 protein_id gnl|my_center|LOCUS_09210 992663 991842 gene locus_tag LOCUS_09220 gene trpA 992663 991842 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392849.1 protein_id gnl|my_center|LOCUS_09220 993861 992668 gene locus_tag LOCUS_09230 gene trpB 993861 992668 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392850.1 protein_id gnl|my_center|LOCUS_09230 994556 993858 gene locus_tag LOCUS_09240 994556 993858 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398742.1 protein_id gnl|my_center|LOCUS_09240 995350 994556 gene locus_tag LOCUS_09250 gene trpC 995350 994556 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_09250 996392 995340 gene locus_tag LOCUS_09260 gene trpD 996392 995340 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_09260 997949 996399 gene locus_tag LOCUS_09270 gene trpE 997949 996399 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_09270 998634 998266 gene locus_tag LOCUS_09280 gene aroH 998634 998266 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967606.1 protein_id gnl|my_center|LOCUS_09280 999742 998636 gene locus_tag LOCUS_09290 gene aroB 999742 998636 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_09290 1000911 999742 gene locus_tag LOCUS_09300 gene aroC 1000911 999742 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398727.1 protein_id gnl|my_center|LOCUS_09300 1001283 1001116 gene locus_tag LOCUS_09310 1001283 1001116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 1002186 1001404 gene locus_tag LOCUS_09320 gene cheR 1002186 1001404 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230589.1 protein_id gnl|my_center|LOCUS_09320 1002669 1002226 gene locus_tag LOCUS_09330 gene ndk 1002669 1002226 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886554.1 protein_id gnl|my_center|LOCUS_09330 1003665 1002691 gene locus_tag LOCUS_09340 gene hepT 1003665 1002691 CDS product heptaprenyl diphosphate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886555.1 protein_id gnl|my_center|LOCUS_09340 1004537 1003662 gene locus_tag LOCUS_09350 1004537 1003662 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942660.1 protein_id gnl|my_center|LOCUS_09350 1005162 1004527 gene locus_tag LOCUS_09360 1005162 1004527 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941109.1 protein_id gnl|my_center|LOCUS_09360 1006031 1005156 gene locus_tag LOCUS_09370 gene ubiA 1006031 1005156 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_09370 1006744 1006028 gene locus_tag LOCUS_09380 gene menG 1006744 1006028 CDS product 2-heptaprenyl-1,4-naphthoquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187674.1 protein_id gnl|my_center|LOCUS_09380 1007622 1006756 gene locus_tag LOCUS_09390 1007622 1006756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1008268 1007735 gene locus_tag LOCUS_09400 1008268 1007735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1008570 1008346 gene locus_tag LOCUS_09410 gene mtrB 1008570 1008346 CDS product trp RNA-binding attenuation protein MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393370.1 protein_id gnl|my_center|LOCUS_09410 1008774 1008698 gene locus_tag LOCUS_t00010 1008774 1008698 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1009209 1008934 gene locus_tag LOCUS_09420 gene hbs 1009209 1008934 CDS product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 protein_id gnl|my_center|LOCUS_09420 1011057 1009579 gene locus_tag LOCUS_09430 gene spoIVA 1011057 1009579 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230572.1 protein_id gnl|my_center|LOCUS_09430 1012128 1011391 gene locus_tag LOCUS_09440 1012128 1011391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755475.1 protein_id gnl|my_center|LOCUS_09440 1012536 1012189 gene locus_tag LOCUS_09450 1012536 1012189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1013207 1012608 gene locus_tag LOCUS_09460 1013207 1012608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 1013503 1013207 gene locus_tag LOCUS_09470 1013503 1013207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1013730 1013551 gene locus_tag LOCUS_09480 1013730 1013551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1014218 1013934 gene locus_tag LOCUS_09490 1014218 1013934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1015606 1014584 gene locus_tag LOCUS_09500 1015606 1014584 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289572.1 protein_id gnl|my_center|LOCUS_09500 1016215 1015619 gene locus_tag LOCUS_09510 gene plsY 1016215 1015619 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056950.1 protein_id gnl|my_center|LOCUS_09510 1017704 1016382 gene locus_tag LOCUS_09520 gene engA 1017704 1016382 CDS product ribosome-associated GTPase EngA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125893.1 protein_id gnl|my_center|LOCUS_09520 1018039 1017854 gene locus_tag LOCUS_09530 1018039 1017854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1018970 1018032 gene locus_tag LOCUS_09540 1018970 1018032 CDS product YIEGIA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230562.1 protein_id gnl|my_center|LOCUS_09540 1019602 1018973 gene locus_tag LOCUS_09550 1019602 1018973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1021057 1019798 gene locus_tag LOCUS_09560 gene rpsA 1021057 1019798 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229574.1 protein_id gnl|my_center|LOCUS_09560 1021741 1021166 gene locus_tag LOCUS_09570 1021741 1021166 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_09570 1022446 1021745 gene locus_tag LOCUS_09580 gene cmk 1022446 1021745 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700259.1 protein_id gnl|my_center|LOCUS_09580 1022957 1022781 gene locus_tag LOCUS_09590 1022957 1022781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1023734 1023084 gene locus_tag LOCUS_09600 1023734 1023084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1025233 1023893 gene locus_tag LOCUS_09610 gene ypeB 1025233 1023893 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943727.1 protein_id gnl|my_center|LOCUS_09610 1025499 1025338 gene locus_tag LOCUS_09620 1025499 1025338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 1026243 1025545 gene locus_tag LOCUS_09630 gene prsW 1026243 1025545 CDS product glutamic-type intramembrane protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230542.1 protein_id gnl|my_center|LOCUS_09630 1027566 1026304 gene locus_tag LOCUS_09640 gene gudB 1027566 1026304 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225172.1 protein_id gnl|my_center|LOCUS_09640 1028307 1027702 gene locus_tag LOCUS_09650 1028307 1027702 CDS product genetic competence negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230533.1 protein_id gnl|my_center|LOCUS_09650 1028885 1028568 gene locus_tag LOCUS_09660 1028885 1028568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1029075 1029989 gene locus_tag LOCUS_09670 1029075 1029989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1030794 1029931 gene locus_tag LOCUS_09680 1030794 1029931 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637817.1 protein_id gnl|my_center|LOCUS_09680 1031086 1030823 gene locus_tag LOCUS_09690 1031086 1030823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1031676 1031083 gene locus_tag LOCUS_09700 1031676 1031083 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025780.1 protein_id gnl|my_center|LOCUS_09700 1031788 1032714 gene locus_tag LOCUS_09710 1031788 1032714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1033054 1032728 gene locus_tag LOCUS_09720 1033054 1032728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1033423 1035012 gene locus_tag LOCUS_09730 gene serA 1033423 1035012 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_09730 1035325 1035897 gene locus_tag LOCUS_09740 1035325 1035897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09740 1035912 1036685 gene locus_tag LOCUS_09750 1035912 1036685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09750 1038242 1036818 gene locus_tag LOCUS_09760 1038242 1036818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1038959 1038243 gene locus_tag LOCUS_09770 gene resD 1038959 1038243 CDS product DNA-binding response regulator ResD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426862.1 protein_id gnl|my_center|LOCUS_09770 1040312 1039053 gene locus_tag LOCUS_09780 gene resC 1040312 1039053 CDS product cytochrome c biogenesis protein ResC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398799.1 protein_id gnl|my_center|LOCUS_09780 1041973 1040309 gene locus_tag LOCUS_09790 gene resB 1041973 1040309 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230515.1 protein_id gnl|my_center|LOCUS_09790 1042520 1041993 gene locus_tag LOCUS_09800 gene resA 1042520 1041993 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230513.1 protein_id gnl|my_center|LOCUS_09800 1043364 1042615 gene locus_tag LOCUS_09810 gene rluB 1043364 1042615 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 protein_id gnl|my_center|LOCUS_09810 1044066 1043530 gene locus_tag LOCUS_09820 gene spmB 1044066 1043530 CDS product spore maturation protein SpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029511.1 protein_id gnl|my_center|LOCUS_09820 1044802 1044059 gene locus_tag LOCUS_09830 gene spmA 1044802 1044059 CDS product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247808.1 protein_id gnl|my_center|LOCUS_09830 1045936 1044836 gene locus_tag LOCUS_09840 gene dacB 1045936 1044836 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230505.1 protein_id gnl|my_center|LOCUS_09840 1046538 1046083 gene locus_tag LOCUS_09850 gene ytfJ 1046538 1046083 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398631.1 protein_id gnl|my_center|LOCUS_09850 1047321 1046620 gene locus_tag LOCUS_09860 1047321 1046620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1048152 1047397 gene locus_tag LOCUS_09870 1048152 1047397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1048900 1048118 gene locus_tag LOCUS_09880 gene scpA 1048900 1048118 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199758.1 protein_id gnl|my_center|LOCUS_09880 1049425 1048955 gene locus_tag LOCUS_09890 gene ribH 1049425 1048955 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230892.1 protein_id gnl|my_center|LOCUS_09890 1050726 1049467 gene locus_tag LOCUS_09900 gene ribBA 1050726 1049467 CDS product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468974.1 protein_id gnl|my_center|LOCUS_09900 1051463 1050783 gene locus_tag LOCUS_09910 gene ribE 1051463 1050783 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493929.1 protein_id gnl|my_center|LOCUS_09910 1052679 1051546 gene locus_tag LOCUS_09920 gene ribD 1052679 1051546 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071741110.1 protein_id gnl|my_center|LOCUS_09920 1053617 1053186 gene locus_tag LOCUS_09930 1053617 1053186 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_09930 1055050 1053719 gene locus_tag LOCUS_09940 gene lysA 1055050 1053719 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280659.1 protein_id gnl|my_center|LOCUS_09940 1056903 1055182 gene locus_tag LOCUS_09950 1056903 1055182 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811050.1 protein_id gnl|my_center|LOCUS_09950 1057368 1056931 gene locus_tag LOCUS_09960 gene spoVAB 1057368 1056931 CDS product stage V sporulation protein SpoVAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572931.1 protein_id gnl|my_center|LOCUS_09960 1058038 1057361 gene locus_tag LOCUS_09970 gene spoVAA 1058038 1057361 CDS product stage V sporulation protein SpoVAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438361.1 protein_id gnl|my_center|LOCUS_09970 1058976 1058221 gene locus_tag LOCUS_09980 gene sigF 1058976 1058221 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 protein_id gnl|my_center|LOCUS_09980 1059443 1058997 gene locus_tag LOCUS_09990 gene spoIIAB 1059443 1058997 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243400.1 protein_id gnl|my_center|LOCUS_09990 1059793 1059440 gene locus_tag LOCUS_10000 gene spoIIAA 1059793 1059440 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059135.1 protein_id gnl|my_center|LOCUS_10000 1061212 1060019 gene locus_tag LOCUS_10010 gene dacF 1061212 1060019 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831985.1 protein_id gnl|my_center|LOCUS_10010 1061384 1061602 gene locus_tag LOCUS_10020 1061384 1061602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 1062819 1061491 gene locus_tag LOCUS_10030 1062819 1061491 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243061.1 protein_id gnl|my_center|LOCUS_10030 1063044 1062868 gene locus_tag LOCUS_10040 1063044 1062868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1063994 1063173 gene locus_tag LOCUS_10050 1063994 1063173 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_10050 1065276 1064101 gene locus_tag LOCUS_10060 gene deoB 1065276 1064101 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723601.1 protein_id gnl|my_center|LOCUS_10060 1066247 1065351 gene locus_tag LOCUS_10070 gene xerD 1066247 1065351 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_10070 1066634 1066398 gene locus_tag LOCUS_10080 1066634 1066398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1067953 1066811 gene locus_tag LOCUS_10090 gene ald 1067953 1066811 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219405.1 protein_id gnl|my_center|LOCUS_10090 1068225 1069574 gene locus_tag LOCUS_10100 1068225 1069574 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393523.1 protein_id gnl|my_center|LOCUS_10100 1070188 1069721 gene locus_tag LOCUS_10110 1070188 1069721 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831103.1 protein_id gnl|my_center|LOCUS_10110 1070930 1070277 gene locus_tag LOCUS_10120 gene spoIIM 1070930 1070277 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269093.1 protein_id gnl|my_center|LOCUS_10120 1072216 1071014 gene locus_tag LOCUS_10130 1072216 1071014 CDS product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246128.1 protein_id gnl|my_center|LOCUS_10130 1072777 1072220 gene locus_tag LOCUS_10140 1072777 1072220 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723131.1 protein_id gnl|my_center|LOCUS_10140 1072889 1073047 gene locus_tag LOCUS_10150 1072889 1073047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1074343 1073210 gene locus_tag LOCUS_10160 1074343 1073210 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609811.1 protein_id gnl|my_center|LOCUS_10160 1075219 1074524 gene locus_tag LOCUS_10170 gene lipB 1075219 1074524 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258689.1 protein_id gnl|my_center|LOCUS_10170 1076637 1075237 gene locus_tag LOCUS_10180 gene bfmBB 1076637 1075237 CDS product branched-chain alpha-keto dehydrogenase complex dihydrolipoyllysine-residue (2-methylpropanoyl)transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230323.1 protein_id gnl|my_center|LOCUS_10180 1077741 1076758 gene locus_tag LOCUS_10190 gene bfmBAB 1077741 1076758 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290076.1 protein_id gnl|my_center|LOCUS_10190 1078777 1077743 gene locus_tag LOCUS_10200 gene bfmBAA 1078777 1077743 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852548.1 protein_id gnl|my_center|LOCUS_10200 1080385 1078961 gene locus_tag LOCUS_10210 gene lpdA 1080385 1078961 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230317.1 protein_id gnl|my_center|LOCUS_10210 1080551 1080844 gene locus_tag LOCUS_10220 1080551 1080844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1081528 1080941 gene locus_tag LOCUS_10230 gene clpP 1081528 1080941 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095857.1 protein_id gnl|my_center|LOCUS_10230 1082274 1081552 gene locus_tag LOCUS_10240 1082274 1081552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1083555 1082359 gene locus_tag LOCUS_10250 1083555 1082359 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062784.1 protein_id gnl|my_center|LOCUS_10250 1084398 1083745 gene locus_tag LOCUS_10260 1084398 1083745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1085431 1084415 gene locus_tag LOCUS_10270 1085431 1084415 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957882.1 protein_id gnl|my_center|LOCUS_10270 1086401 1085586 gene locus_tag LOCUS_10280 gene spo0A 1086401 1085586 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226427.1 protein_id gnl|my_center|LOCUS_10280 1088020 1086695 gene locus_tag LOCUS_10290 gene spoIVB 1088020 1086695 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398697.1 protein_id gnl|my_center|LOCUS_10290 1089844 1088144 gene locus_tag LOCUS_10300 gene recN 1089844 1088144 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_10300 1090346 1089897 gene locus_tag LOCUS_10310 gene argR 1090346 1089897 CDS product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124985.1 protein_id gnl|my_center|LOCUS_10310 1090823 1090362 gene locus_tag LOCUS_10320 1090823 1090362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1091876 1091058 gene locus_tag LOCUS_10330 1091876 1091058 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230264.1 protein_id gnl|my_center|LOCUS_10330 1093763 1091898 gene locus_tag LOCUS_10340 gene dxs 1093763 1091898 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366447.1 protein_id gnl|my_center|LOCUS_10340 1094855 1093944 gene locus_tag LOCUS_10350 1094855 1093944 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_10350 1095142 1094858 gene locus_tag LOCUS_10360 1095142 1094858 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226409.1 protein_id gnl|my_center|LOCUS_10360 1096498 1095146 gene locus_tag LOCUS_10370 gene xseA 1096498 1095146 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415249.1 protein_id gnl|my_center|LOCUS_10370 1097368 1096508 gene locus_tag LOCUS_10380 gene folD 1097368 1096508 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226732.1 protein_id gnl|my_center|LOCUS_10380 1097983 1097531 gene locus_tag LOCUS_10390 gene nusB 1097983 1097531 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460271.1 protein_id gnl|my_center|LOCUS_10390 1098356 1098126 gene locus_tag LOCUS_10400 1098356 1098126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1098934 1098371 gene locus_tag LOCUS_10410 1098934 1098371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1099545 1099135 gene locus_tag LOCUS_10420 1099545 1099135 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_10420 1101041 1099671 gene locus_tag LOCUS_10430 gene accC 1101041 1099671 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722484.1 protein_id gnl|my_center|LOCUS_10430 1101583 1101092 gene locus_tag LOCUS_10440 gene accB 1101583 1101092 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472859.1 protein_id gnl|my_center|LOCUS_10440 1102750 1101986 gene locus_tag LOCUS_10450 1102750 1101986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1103445 1102789 gene locus_tag LOCUS_10460 gene spoIIIAG 1103445 1102789 CDS product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230248.1 protein_id gnl|my_center|LOCUS_10460 1104216 1103464 gene locus_tag LOCUS_10470 1104216 1103464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1105618 1104359 gene locus_tag LOCUS_10480 gene spoIIIAE 1105618 1104359 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230230.1 protein_id gnl|my_center|LOCUS_10480 1106019 1105624 gene locus_tag LOCUS_10490 gene spoIIIAD 1106019 1105624 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230228.1 protein_id gnl|my_center|LOCUS_10490 1106264 1106061 gene locus_tag LOCUS_10500 gene spoIIIAC 1106264 1106061 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153142.1 protein_id gnl|my_center|LOCUS_10500 1106798 1106280 gene locus_tag LOCUS_10510 gene spoIIIAB 1106798 1106280 CDS product stage III sporulation protein SpoIIIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230227.1 protein_id gnl|my_center|LOCUS_10510 1107801 1106791 gene locus_tag LOCUS_10520 gene spoIIIAA 1107801 1106791 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230226.1 protein_id gnl|my_center|LOCUS_10520 1108234 1107968 gene locus_tag LOCUS_10530 1108234 1107968 CDS product YqhV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398639.1 protein_id gnl|my_center|LOCUS_10530 1108536 1109393 gene locus_tag LOCUS_10540 1108536 1109393 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391666.1 protein_id gnl|my_center|LOCUS_10540 1109639 1110346 gene locus_tag LOCUS_10550 1109639 1110346 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_10550 1110469 1110933 gene locus_tag LOCUS_10560 1110469 1110933 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391668.1 protein_id gnl|my_center|LOCUS_10560 1112312 1111059 gene locus_tag LOCUS_10570 1112312 1111059 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_10570 1113030 1112473 gene locus_tag LOCUS_10580 gene efp 1113030 1112473 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_10580 1114174 1113098 gene locus_tag LOCUS_10590 gene pepQ 1114174 1113098 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411056.1 protein_id gnl|my_center|LOCUS_10590 1114668 1114231 gene locus_tag LOCUS_10600 gene aroQ 1114668 1114231 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_10600 1115281 1114751 gene locus_tag LOCUS_10610 1115281 1114751 CDS product YqhR family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002003473.1 protein_id gnl|my_center|LOCUS_10610 1115488 1116432 gene locus_tag LOCUS_10620 1115488 1116432 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807112.1 protein_id gnl|my_center|LOCUS_10620 1116484 1116789 gene locus_tag LOCUS_10630 1116484 1116789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1117327 1116899 gene locus_tag LOCUS_10640 gene mntR 1117327 1116899 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143076.1 protein_id gnl|my_center|LOCUS_10640 1117552 1118622 gene locus_tag LOCUS_10650 gene splB 1117552 1118622 CDS product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879610.1 protein_id gnl|my_center|LOCUS_10650 1119594 1118881 gene locus_tag LOCUS_10660 gene ccdA 1119594 1118881 CDS product cytochrome c-type biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152681.1 protein_id gnl|my_center|LOCUS_10660 1120461 1119655 gene locus_tag LOCUS_10670 1120461 1119655 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613822.1 protein_id gnl|my_center|LOCUS_10670 1121268 1120465 gene locus_tag LOCUS_10680 1121268 1120465 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059649.1 protein_id gnl|my_center|LOCUS_10680 1122253 1121303 gene locus_tag LOCUS_10690 1122253 1121303 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458890.1 protein_id gnl|my_center|LOCUS_10690 1124398 1122383 gene locus_tag LOCUS_10700 gene metG 1124398 1122383 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134147.1 protein_id gnl|my_center|LOCUS_10700 1125117 1124842 gene locus_tag LOCUS_10710 gene yidD 1125117 1124842 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229076.1 protein_id gnl|my_center|LOCUS_10710 1125400 1126392 gene locus_tag LOCUS_10720 1125400 1126392 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803779.1 protein_id gnl|my_center|LOCUS_10720 1126422 1127411 gene locus_tag LOCUS_10730 1126422 1127411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1129614 1127584 gene locus_tag LOCUS_10740 1129614 1127584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1129992 1129771 gene locus_tag LOCUS_10750 1129992 1129771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1130176 1130826 gene locus_tag LOCUS_10760 1130176 1130826 CDS product YktB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232300.1 protein_id gnl|my_center|LOCUS_10760 1133928 1130926 gene locus_tag LOCUS_10770 1133928 1130926 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375594.1 protein_id gnl|my_center|LOCUS_10770 1135414 1134206 gene locus_tag LOCUS_10780 1135414 1134206 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_10780 1136690 1135434 gene locus_tag LOCUS_10790 1136690 1135434 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887866.1 protein_id gnl|my_center|LOCUS_10790 1136843 1138309 gene locus_tag LOCUS_10800 gene speA 1136843 1138309 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084899.1 protein_id gnl|my_center|LOCUS_10800 1138463 1139686 gene locus_tag LOCUS_10810 1138463 1139686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1139781 1140200 gene locus_tag LOCUS_10820 1139781 1140200 CDS product DUF1885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163307.1 protein_id gnl|my_center|LOCUS_10820 1140567 1140265 gene locus_tag LOCUS_10830 1140567 1140265 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357933.1 protein_id gnl|my_center|LOCUS_10830 1141249 1140680 gene locus_tag LOCUS_10840 1141249 1140680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1141642 1141427 gene locus_tag LOCUS_10850 1141642 1141427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1141806 1142534 gene locus_tag LOCUS_10860 1141806 1142534 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957681.1 protein_id gnl|my_center|LOCUS_10860 1142984 1142718 gene locus_tag LOCUS_10870 1142984 1142718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1143379 1143128 gene locus_tag LOCUS_10880 1143379 1143128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1143629 1143462 gene locus_tag LOCUS_10890 1143629 1143462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1143776 1143851 gene locus_tag LOCUS_t00020 1143776 1143851 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1145009 1143996 gene locus_tag LOCUS_10900 1145009 1143996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1145143 1145218 gene locus_tag LOCUS_t00030 1145143 1145218 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1146302 1145370 gene locus_tag LOCUS_10910 1146302 1145370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1146570 1146292 gene locus_tag LOCUS_10920 1146570 1146292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1146742 1147080 gene locus_tag LOCUS_10930 1146742 1147080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1147190 1148206 gene locus_tag LOCUS_10940 1147190 1148206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1149140 1148289 gene locus_tag LOCUS_10950 1149140 1148289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1149865 1149146 gene locus_tag LOCUS_10960 1149865 1149146 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432519.1 protein_id gnl|my_center|LOCUS_10960 1150163 1149984 gene locus_tag LOCUS_10970 1150163 1149984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1157237 1150380 gene locus_tag LOCUS_10980 1157237 1150380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1158255 1159187 gene locus_tag LOCUS_10990 1158255 1159187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1159286 1159624 gene locus_tag LOCUS_11000 1159286 1159624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1159939 1159730 gene locus_tag LOCUS_11010 1159939 1159730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1160620 1160955 gene locus_tag LOCUS_11020 1160620 1160955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1161110 1161310 gene locus_tag LOCUS_11030 1161110 1161310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1161279 1161677 gene locus_tag LOCUS_11040 1161279 1161677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1162072 1161982 gene locus_tag LOCUS_t00040 1162072 1161982 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1162169 1162093 gene locus_tag LOCUS_t00050 1162169 1162093 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1162267 1162191 gene locus_tag LOCUS_t00060 1162267 1162191 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1162515 1162351 gene locus_tag LOCUS_11050 1162515 1162351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1164210 1162672 gene locus_tag LOCUS_11060 1164210 1162672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1165088 1164216 gene locus_tag LOCUS_11070 1165088 1164216 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_11070 1168028 1165095 gene locus_tag LOCUS_11080 1168028 1165095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1169102 1168032 gene locus_tag LOCUS_11090 1169102 1168032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1169832 1169068 gene locus_tag LOCUS_11100 1169832 1169068 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 protein_id gnl|my_center|LOCUS_11100 1171199 1170354 gene locus_tag LOCUS_11110 1171199 1170354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1172022 1171183 gene locus_tag LOCUS_11120 1172022 1171183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1173066 1172029 gene locus_tag LOCUS_11130 1173066 1172029 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257671.1 protein_id gnl|my_center|LOCUS_11130 1173717 1173466 gene locus_tag LOCUS_11140 1173717 1173466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1174582 1173935 gene locus_tag LOCUS_11150 gene pyrE 1174582 1173935 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357418.1 protein_id gnl|my_center|LOCUS_11150 1175314 1174583 gene locus_tag LOCUS_11160 gene pyrF 1175314 1174583 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083500.1 protein_id gnl|my_center|LOCUS_11160 1178677 1175459 gene locus_tag LOCUS_11170 gene carB 1178677 1175459 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232113.1 protein_id gnl|my_center|LOCUS_11170 1179809 1178664 gene locus_tag LOCUS_11180 1179809 1178664 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232115.1 protein_id gnl|my_center|LOCUS_11180 1181135 1179849 gene locus_tag LOCUS_11190 1181135 1179849 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245035.1 protein_id gnl|my_center|LOCUS_11190 1182059 1181157 gene locus_tag LOCUS_11200 1182059 1181157 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245123.1 protein_id gnl|my_center|LOCUS_11200 1182605 1182075 gene locus_tag LOCUS_11210 gene pyrR 1182605 1182075 CDS product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156487.1 protein_id gnl|my_center|LOCUS_11210 1184119 1182884 gene locus_tag LOCUS_11220 1184119 1182884 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_11220 1185200 1184232 gene locus_tag LOCUS_11230 1185200 1184232 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005836.1 protein_id gnl|my_center|LOCUS_11230 1185678 1185154 gene locus_tag LOCUS_11240 gene lspA 1185678 1185154 CDS product lipoprotein signal peptidase LspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642181.1 protein_id gnl|my_center|LOCUS_11240 1185914 1186636 gene locus_tag LOCUS_11250 1185914 1186636 CDS product yteA family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229046.1 protein_id gnl|my_center|LOCUS_11250 1186983 1186645 gene locus_tag LOCUS_11260 1186983 1186645 CDS product DUF5665 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392384.1 protein_id gnl|my_center|LOCUS_11260 1190231 1187133 gene locus_tag LOCUS_11270 gene ileS 1190231 1187133 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416534.1 protein_id gnl|my_center|LOCUS_11270 1191202 1190711 gene locus_tag LOCUS_11280 gene divIVA 1191202 1190711 CDS product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131611.1 protein_id gnl|my_center|LOCUS_11280 1192079 1191297 gene locus_tag LOCUS_11290 1192079 1191297 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232140.1 protein_id gnl|my_center|LOCUS_11290 1192339 1192076 gene locus_tag LOCUS_11300 1192339 1192076 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214233.1 protein_id gnl|my_center|LOCUS_11300 1192793 1192347 gene locus_tag LOCUS_11310 gene sepF 1192793 1192347 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 protein_id gnl|my_center|LOCUS_11310 1193576 1192854 gene locus_tag LOCUS_11320 1193576 1192854 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245324.1 protein_id gnl|my_center|LOCUS_11320 1194487 1193573 gene locus_tag LOCUS_11330 gene pgeF 1194487 1193573 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967191.1 protein_id gnl|my_center|LOCUS_11330 1194814 1194539 gene locus_tag LOCUS_11340 1194814 1194539 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232153.1 protein_id gnl|my_center|LOCUS_11340 1195845 1195063 gene locus_tag LOCUS_11350 gene sigG 1195845 1195063 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967190.1 protein_id gnl|my_center|LOCUS_11350 1197232 1196000 gene locus_tag LOCUS_11360 1197232 1196000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1198084 1197245 gene locus_tag LOCUS_11370 1198084 1197245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1198770 1198081 gene locus_tag LOCUS_11380 1198770 1198081 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893181.1 protein_id gnl|my_center|LOCUS_11380 1199164 1198757 gene locus_tag LOCUS_11390 1199164 1198757 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436478.1 protein_id gnl|my_center|LOCUS_11390 1200216 1199356 gene locus_tag LOCUS_11400 1200216 1199356 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099728.1 protein_id gnl|my_center|LOCUS_11400 1200931 1200260 gene locus_tag LOCUS_11410 1200931 1200260 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097004.1 protein_id gnl|my_center|LOCUS_11410 1201983 1200928 gene locus_tag LOCUS_11420 1201983 1200928 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038713.1 protein_id gnl|my_center|LOCUS_11420 1202880 1202158 gene locus_tag LOCUS_11430 gene sigE 1202880 1202158 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976948.1 protein_id gnl|my_center|LOCUS_11430 1203866 1202859 gene locus_tag LOCUS_11440 gene spoIIGA 1203866 1202859 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261975.1 protein_id gnl|my_center|LOCUS_11440 1205342 1204203 gene locus_tag LOCUS_11450 gene ftsZ 1205342 1204203 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888984.1 protein_id gnl|my_center|LOCUS_11450 1206602 1205358 gene locus_tag LOCUS_11460 gene ftsA 1206602 1205358 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087551.1 protein_id gnl|my_center|LOCUS_11460 1207599 1206835 gene locus_tag LOCUS_11470 1207599 1206835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1208990 1207710 gene locus_tag LOCUS_11480 gene murA 1208990 1207710 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_11480 1209911 1209006 gene locus_tag LOCUS_11490 gene murB 1209911 1209006 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_11490 1211222 1210116 gene locus_tag LOCUS_11500 gene murG 1211222 1210116 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110342.1 protein_id gnl|my_center|LOCUS_11500 1212328 1211231 gene locus_tag LOCUS_11510 gene spoVE 1212328 1211231 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753520.1 protein_id gnl|my_center|LOCUS_11510 1213810 1212374 gene locus_tag LOCUS_11520 gene murD 1213810 1212374 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860115.1 protein_id gnl|my_center|LOCUS_11520 1215911 1214955 gene locus_tag LOCUS_11530 gene mraY 1215911 1214955 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_11530 1217333 1215927 gene locus_tag LOCUS_11540 gene murF 1217333 1215927 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595957.1 protein_id gnl|my_center|LOCUS_11540 1218826 1217330 gene locus_tag LOCUS_11550 gene murE 1218826 1217330 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766313.1 protein_id gnl|my_center|LOCUS_11550 1220874 1218934 gene locus_tag LOCUS_11560 1220874 1218934 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245048.1 protein_id gnl|my_center|LOCUS_11560 1223372 1221123 gene locus_tag LOCUS_11570 1223372 1221123 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600106.1 protein_id gnl|my_center|LOCUS_11570 1223816 1223382 gene locus_tag LOCUS_11580 1223816 1223382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1224795 1223860 gene locus_tag LOCUS_11590 gene rsmH 1224795 1223860 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481788.1 protein_id gnl|my_center|LOCUS_11590 1225296 1224859 gene locus_tag LOCUS_11600 gene mraZ 1225296 1224859 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221402.1 protein_id gnl|my_center|LOCUS_11600 1225586 1225873 gene locus_tag LOCUS_11610 1225586 1225873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1227070 1225910 gene locus_tag LOCUS_11620 1227070 1225910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1228557 1227289 gene locus_tag LOCUS_11630 1228557 1227289 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345604.1 protein_id gnl|my_center|LOCUS_11630 1230208 1228577 gene locus_tag LOCUS_11640 gene bshC 1230208 1228577 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403038.1 protein_id gnl|my_center|LOCUS_11640 1230804 1230409 gene locus_tag LOCUS_11650 1230804 1230409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1231772 1230837 gene locus_tag LOCUS_11660 1231772 1230837 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232206.1 protein_id gnl|my_center|LOCUS_11660 1232563 1231916 gene locus_tag LOCUS_11670 1232563 1231916 CDS product RsfA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868358.1 protein_id gnl|my_center|LOCUS_11670 1232832 1233068 gene locus_tag LOCUS_11680 1232832 1233068 CDS product DUF2626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226300.1 protein_id gnl|my_center|LOCUS_11680 1234360 1233158 gene locus_tag LOCUS_11690 1234360 1233158 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941144.1 protein_id gnl|my_center|LOCUS_11690 1234466 1235551 gene locus_tag LOCUS_11700 1234466 1235551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1236887 1235541 gene locus_tag LOCUS_11710 1236887 1235541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1237069 1237533 gene locus_tag LOCUS_11720 1237069 1237533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1238861 1237530 gene locus_tag LOCUS_11730 1238861 1237530 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358083.1 protein_id gnl|my_center|LOCUS_11730 1239156 1239563 gene locus_tag LOCUS_11740 1239156 1239563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1240107 1239655 gene locus_tag LOCUS_11750 1240107 1239655 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024581.1 protein_id gnl|my_center|LOCUS_11750 1241190 1240186 gene locus_tag LOCUS_11760 1241190 1240186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1241477 1241205 gene locus_tag LOCUS_11770 1241477 1241205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258143.1 protein_id gnl|my_center|LOCUS_11770 1241780 1241481 gene locus_tag LOCUS_11780 1241780 1241481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1243752 1241911 gene locus_tag LOCUS_11790 gene typA 1243752 1241911 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232278.1 protein_id gnl|my_center|LOCUS_11790 1244313 1243831 gene locus_tag LOCUS_11800 1244313 1243831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1245080 1244409 gene locus_tag LOCUS_11810 1245080 1244409 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930987.1 protein_id gnl|my_center|LOCUS_11810 1245282 1245992 gene locus_tag LOCUS_11820 1245282 1245992 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346925.1 protein_id gnl|my_center|LOCUS_11820 1247542 1246100 gene locus_tag LOCUS_11830 1247542 1246100 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966741.1 protein_id gnl|my_center|LOCUS_11830 1248179 1247619 gene locus_tag LOCUS_11840 1248179 1247619 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962669.1 protein_id gnl|my_center|LOCUS_11840 1249662 1248442 gene locus_tag LOCUS_11850 gene thiI 1249662 1248442 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188892867.1 protein_id gnl|my_center|LOCUS_11850 1250839 1249670 gene locus_tag LOCUS_11860 1250839 1249670 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638992.1 protein_id gnl|my_center|LOCUS_11860 1251710 1251012 gene locus_tag LOCUS_11870 1251710 1251012 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048229.1 protein_id gnl|my_center|LOCUS_11870 1253025 1252609 gene locus_tag LOCUS_11880 1253025 1252609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1253244 1253032 gene locus_tag LOCUS_11890 1253244 1253032 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115477.1 protein_id gnl|my_center|LOCUS_11890 1253798 1253298 gene locus_tag LOCUS_11900 1253798 1253298 CDS product YpuI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067563.1 protein_id gnl|my_center|LOCUS_11900 1254000 1255880 gene locus_tag LOCUS_11910 1254000 1255880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1257796 1256675 gene locus_tag LOCUS_11920 1257796 1256675 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036241.1 protein_id gnl|my_center|LOCUS_11920 1258551 1257772 gene locus_tag LOCUS_11930 1258551 1257772 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006551.1 protein_id gnl|my_center|LOCUS_11930 1259380 1258553 gene locus_tag LOCUS_11940 1259380 1258553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1260618 1259494 gene locus_tag LOCUS_11950 gene rpoD 1260618 1259494 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764058.1 protein_id gnl|my_center|LOCUS_11950 1262495 1260651 gene locus_tag LOCUS_11960 gene dnaG 1262495 1260651 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230066.1 protein_id gnl|my_center|LOCUS_11960 1263003 1262536 gene locus_tag LOCUS_11970 1263003 1262536 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721962.1 protein_id gnl|my_center|LOCUS_11970 1263898 1263080 gene locus_tag LOCUS_11980 1263898 1263080 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368943.1 protein_id gnl|my_center|LOCUS_11980 1266206 1264122 gene locus_tag LOCUS_11990 gene glyS 1266206 1264122 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230059.1 protein_id gnl|my_center|LOCUS_11990 1267086 1266199 gene locus_tag LOCUS_12000 gene glyQ 1267086 1266199 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226213.1 protein_id gnl|my_center|LOCUS_12000 1268233 1267487 gene locus_tag LOCUS_12010 gene recO 1268233 1267487 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487010.1 protein_id gnl|my_center|LOCUS_12010 1268427 1268278 gene locus_tag LOCUS_12020 1268427 1268278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1269516 1268587 gene locus_tag LOCUS_12030 gene era 1269516 1268587 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080241.1 protein_id gnl|my_center|LOCUS_12030 1270003 1269557 gene locus_tag LOCUS_12040 1270003 1269557 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086294.1 protein_id gnl|my_center|LOCUS_12040 1270372 1270022 gene locus_tag LOCUS_12050 1270372 1270022 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398824.1 protein_id gnl|my_center|LOCUS_12050 1270869 1270372 gene locus_tag LOCUS_12060 gene ybeY 1270869 1270372 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816440.1 protein_id gnl|my_center|LOCUS_12060 1273112 1270866 gene locus_tag LOCUS_12070 gene pgpH 1273112 1270866 CDS product cyclic-di-AMP phosphodiesterase PgpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886570.1 protein_id gnl|my_center|LOCUS_12070 1274710 1273736 gene locus_tag LOCUS_12080 1274710 1273736 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840501.1 protein_id gnl|my_center|LOCUS_12080 1275910 1274717 gene locus_tag LOCUS_12090 gene yqfD 1275910 1274717 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230033.1 protein_id gnl|my_center|LOCUS_12090 1276203 1275925 gene locus_tag LOCUS_12100 gene yqfC 1276203 1275925 CDS product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732266.1 protein_id gnl|my_center|LOCUS_12100 1276896 1276345 gene locus_tag LOCUS_12110 1276896 1276345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1277935 1276943 gene locus_tag LOCUS_12120 gene floA 1277935 1276943 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230026.1 protein_id gnl|my_center|LOCUS_12120 1279324 1277954 gene locus_tag LOCUS_12130 1279324 1277954 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230024.1 protein_id gnl|my_center|LOCUS_12130 1280752 1279403 gene locus_tag LOCUS_12140 1280752 1279403 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_12140 1281331 1280888 gene locus_tag LOCUS_12150 1281331 1280888 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054571.1 protein_id gnl|my_center|LOCUS_12150 1281520 1281347 gene locus_tag LOCUS_12160 gene rpsU 1281520 1281347 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816464.1 protein_id gnl|my_center|LOCUS_12160 1281977 1281639 gene locus_tag LOCUS_12170 1281977 1281639 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816465.1 protein_id gnl|my_center|LOCUS_12170 1282566 1282120 gene locus_tag LOCUS_12180 1282566 1282120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 1282847 1284160 gene locus_tag LOCUS_12190 1282847 1284160 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713000.1 protein_id gnl|my_center|LOCUS_12190 1284927 1284319 gene locus_tag LOCUS_12200 1284927 1284319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1288574 1285059 gene locus_tag LOCUS_12210 gene sbcC 1288574 1285059 CDS product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245201.1 protein_id gnl|my_center|LOCUS_12210 1289797 1288571 gene locus_tag LOCUS_12220 1289797 1288571 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233099.1 protein_id gnl|my_center|LOCUS_12220 1294157 1289823 gene locus_tag LOCUS_12230 1294157 1289823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1297726 1294154 gene locus_tag LOCUS_12240 gene addB 1297726 1294154 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058551.1 protein_id gnl|my_center|LOCUS_12240 1298254 1298601 gene locus_tag LOCUS_12250 1298254 1298601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1300123 1298699 gene locus_tag LOCUS_12260 1300123 1298699 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_12260 1300237 1301223 gene locus_tag LOCUS_12270 1300237 1301223 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945015.1 protein_id gnl|my_center|LOCUS_12270 1301705 1301268 gene locus_tag LOCUS_12280 1301705 1301268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1303224 1301815 gene locus_tag LOCUS_12290 gene mtaB 1303224 1301815 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108686.1 protein_id gnl|my_center|LOCUS_12290 1304065 1303229 gene locus_tag LOCUS_12300 1304065 1303229 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190167.1 protein_id gnl|my_center|LOCUS_12300 1304848 1304135 gene locus_tag LOCUS_12310 1304848 1304135 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243167.1 protein_id gnl|my_center|LOCUS_12310 1305941 1304958 gene locus_tag LOCUS_12320 gene prmA 1305941 1304958 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872105.1 protein_id gnl|my_center|LOCUS_12320 1306692 1306501 gene locus_tag LOCUS_12330 1306692 1306501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1306878 1306702 gene locus_tag LOCUS_12340 1306878 1306702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1308164 1307022 gene locus_tag LOCUS_12350 gene dnaJ 1308164 1307022 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230010.1 protein_id gnl|my_center|LOCUS_12350 1310153 1308315 gene locus_tag LOCUS_12360 gene dnaK 1310153 1308315 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398786.1 protein_id gnl|my_center|LOCUS_12360 1310785 1310207 gene locus_tag LOCUS_12370 gene grpE 1310785 1310207 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_12370 1311847 1310822 gene locus_tag LOCUS_12380 gene hrcA 1311847 1310822 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 protein_id gnl|my_center|LOCUS_12380 1312227 1312072 gene locus_tag LOCUS_12390 1312227 1312072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1313296 1312184 gene locus_tag LOCUS_12400 1313296 1312184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1313971 1313510 gene locus_tag LOCUS_12410 1313971 1313510 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686664.1 protein_id gnl|my_center|LOCUS_12410 1315239 1314085 gene locus_tag LOCUS_12420 gene hemW 1315239 1314085 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398764.1 protein_id gnl|my_center|LOCUS_12420 1317321 1315504 gene locus_tag LOCUS_12430 gene lepA 1317321 1315504 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 protein_id gnl|my_center|LOCUS_12430 1317860 1317387 gene locus_tag LOCUS_12440 1317860 1317387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1319218 1317902 gene locus_tag LOCUS_12450 gene spoIIP 1319218 1317902 CDS product spore autolysin SpoIIP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229993.1 protein_id gnl|my_center|LOCUS_12450 1320476 1319463 gene locus_tag LOCUS_12460 gene gpr 1320476 1319463 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229991.1 protein_id gnl|my_center|LOCUS_12460 1320667 1320939 gene locus_tag LOCUS_12470 gene rpsT 1320667 1320939 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229989.1 protein_id gnl|my_center|LOCUS_12470 1320994 1321155 gene locus_tag LOCUS_12480 1320994 1321155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1322193 1321171 gene locus_tag LOCUS_12490 gene holA 1322193 1321171 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279906.1 protein_id gnl|my_center|LOCUS_12490 1323669 1322440 gene locus_tag LOCUS_12500 1323669 1322440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1324214 1323666 gene locus_tag LOCUS_12510 1324214 1323666 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_12510 1325385 1324426 gene locus_tag LOCUS_12520 1325385 1324426 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289148.1 protein_id gnl|my_center|LOCUS_12520 1325536 1325865 gene locus_tag LOCUS_12530 1325536 1325865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1326373 1325948 gene locus_tag LOCUS_12540 1326373 1325948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1326583 1326386 gene locus_tag LOCUS_12550 1326583 1326386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1327431 1326667 gene locus_tag LOCUS_12560 gene tatC 1327431 1326667 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886426.1 protein_id gnl|my_center|LOCUS_12560 1329149 1327428 gene locus_tag LOCUS_12570 1329149 1327428 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851097.1 protein_id gnl|my_center|LOCUS_12570 1329959 1329171 gene locus_tag LOCUS_12580 1329959 1329171 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857555.1 protein_id gnl|my_center|LOCUS_12580 1333070 1330170 gene locus_tag LOCUS_12590 1333070 1330170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1333827 1333297 gene locus_tag LOCUS_12600 1333827 1333297 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393866.1 protein_id gnl|my_center|LOCUS_12600 1335153 1333861 gene locus_tag LOCUS_12610 1335153 1333861 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 protein_id gnl|my_center|LOCUS_12610 1335801 1335220 gene locus_tag LOCUS_12620 1335801 1335220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1336003 1336842 gene locus_tag LOCUS_12630 gene comER 1336003 1336842 CDS product late competence protein ComER inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398597.1 protein_id gnl|my_center|LOCUS_12630 1339342 1336904 gene locus_tag LOCUS_12640 gene leuS 1339342 1336904 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009461.1 protein_id gnl|my_center|LOCUS_12640 1340588 1339833 gene locus_tag LOCUS_12650 1340588 1339833 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873069.1 protein_id gnl|my_center|LOCUS_12650 1341530 1340601 gene locus_tag LOCUS_12660 1341530 1340601 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886474.1 protein_id gnl|my_center|LOCUS_12660 1341880 1341533 gene locus_tag LOCUS_12670 gene rsfS 1341880 1341533 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229971.1 protein_id gnl|my_center|LOCUS_12670 1342452 1341877 gene locus_tag LOCUS_12680 gene yqeK 1342452 1341877 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078244.1 protein_id gnl|my_center|LOCUS_12680 1343032 1342439 gene locus_tag LOCUS_12690 gene nadD 1343032 1342439 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 protein_id gnl|my_center|LOCUS_12690 1343364 1343071 gene locus_tag LOCUS_12700 gene yhbY 1343364 1343071 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226133.1 protein_id gnl|my_center|LOCUS_12700 1344255 1343398 gene locus_tag LOCUS_12710 1344255 1343398 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_12710 1345420 1344296 gene locus_tag LOCUS_12720 gene yqeH 1345420 1344296 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140799.1 protein_id gnl|my_center|LOCUS_12720 1345944 1345417 gene locus_tag LOCUS_12730 1345944 1345417 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765314.1 protein_id gnl|my_center|LOCUS_12730 1348352 1346115 gene locus_tag LOCUS_12740 1348352 1346115 CDS product transglutaminaseTgpA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631786.1 protein_id gnl|my_center|LOCUS_12740 1349605 1348349 gene locus_tag LOCUS_12750 1349605 1348349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1350567 1349611 gene locus_tag LOCUS_12760 1350567 1349611 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135810.1 protein_id gnl|my_center|LOCUS_12760 1351199 1350849 gene locus_tag LOCUS_12770 gene spoVAE 1351199 1350849 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575919.1 protein_id gnl|my_center|LOCUS_12770 1352239 1351223 gene locus_tag LOCUS_12780 gene spoVAD 1352239 1351223 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938965.1 protein_id gnl|my_center|LOCUS_12780 1352687 1352241 gene locus_tag LOCUS_12790 gene spoVAC 1352687 1352241 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147736.1 protein_id gnl|my_center|LOCUS_12790 1354270 1353197 gene locus_tag LOCUS_12800 1354270 1353197 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972130.1 protein_id gnl|my_center|LOCUS_12800 1354441 1357608 gene locus_tag LOCUS_12810 1354441 1357608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1358331 1357756 gene locus_tag LOCUS_12820 1358331 1357756 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479533.1 protein_id gnl|my_center|LOCUS_12820 1359374 1358535 gene locus_tag LOCUS_12830 1359374 1358535 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_12830 1360471 1359407 gene locus_tag LOCUS_12840 1360471 1359407 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_12840 1360704 1360495 gene locus_tag LOCUS_12850 1360704 1360495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1360603 1361472 gene locus_tag LOCUS_12860 1360603 1361472 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431317.1 protein_id gnl|my_center|LOCUS_12860 1362461 1361583 gene locus_tag LOCUS_12870 1362461 1361583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1362665 1363522 gene locus_tag LOCUS_12880 1362665 1363522 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229423.1 protein_id gnl|my_center|LOCUS_12880 1363964 1363602 gene locus_tag LOCUS_12890 1363964 1363602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1364158 1364373 gene locus_tag LOCUS_12900 1364158 1364373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1366302 1364254 gene locus_tag LOCUS_12910 1366302 1364254 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399552.1 protein_id gnl|my_center|LOCUS_12910 1367478 1366495 gene locus_tag LOCUS_12920 1367478 1366495 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732378.1 protein_id gnl|my_center|LOCUS_12920 1369418 1367547 gene locus_tag LOCUS_12930 gene ltaP 1369418 1367547 CDS product lipoteichoic acid primase LtaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931059.1 protein_id gnl|my_center|LOCUS_12930 1370334 1369717 gene locus_tag LOCUS_12940 1370334 1369717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1371191 1370421 gene locus_tag LOCUS_12950 1371191 1370421 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_12950 1371997 1371188 gene locus_tag LOCUS_12960 1371997 1371188 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776489.1 protein_id gnl|my_center|LOCUS_12960 1373004 1371994 gene locus_tag LOCUS_12970 1373004 1371994 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256295.1 protein_id gnl|my_center|LOCUS_12970 1373876 1373106 gene locus_tag LOCUS_12980 1373876 1373106 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922035.1 protein_id gnl|my_center|LOCUS_12980 1374011 1374904 gene locus_tag LOCUS_12990 1374011 1374904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1376872 1375982 gene locus_tag LOCUS_13000 1376872 1375982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1377973 1376972 gene locus_tag LOCUS_13010 1377973 1376972 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206268.1 protein_id gnl|my_center|LOCUS_13010 1378539 1378006 gene locus_tag LOCUS_13020 1378539 1378006 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704154.1 protein_id gnl|my_center|LOCUS_13020 1381175 1378716 gene locus_tag LOCUS_13030 1381175 1378716 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_13030 1383016 1381226 gene locus_tag LOCUS_13040 gene fucI 1383016 1381226 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_13040 1384080 1383055 gene locus_tag LOCUS_13050 1384080 1383055 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521613.1 protein_id gnl|my_center|LOCUS_13050 1384565 1384254 gene locus_tag LOCUS_13060 1384565 1384254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1384941 1385480 gene locus_tag LOCUS_13070 1384941 1385480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 1386252 1389089 gene locus_tag LOCUS_13080 1386252 1389089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1389851 1389174 gene locus_tag LOCUS_13090 1389851 1389174 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202582.1 protein_id gnl|my_center|LOCUS_13090 1390984 1389848 gene locus_tag LOCUS_13100 1390984 1389848 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990019.1 protein_id gnl|my_center|LOCUS_13100 1392427 1391051 gene locus_tag LOCUS_13110 1392427 1391051 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990020.1 protein_id gnl|my_center|LOCUS_13110 1393101 1392424 gene locus_tag LOCUS_13120 1393101 1392424 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781969.1 protein_id gnl|my_center|LOCUS_13120 1393368 1394513 gene locus_tag LOCUS_13130 1393368 1394513 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_13130 1395483 1394575 gene locus_tag LOCUS_13140 1395483 1394575 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801276.1 protein_id gnl|my_center|LOCUS_13140 1395655 1395395 gene locus_tag LOCUS_13150 1395655 1395395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1396808 1395711 gene locus_tag LOCUS_13160 1396808 1395711 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392970.1 protein_id gnl|my_center|LOCUS_13160 1397965 1396805 gene locus_tag LOCUS_13170 1397965 1396805 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461855.1 protein_id gnl|my_center|LOCUS_13170 1399359 1397962 gene locus_tag LOCUS_13180 1399359 1397962 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_13180 1400411 1399710 gene locus_tag LOCUS_13190 gene sigK 1400411 1399710 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_13190 1401440 1400652 gene locus_tag LOCUS_13200 1401440 1400652 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072245.1 protein_id gnl|my_center|LOCUS_13200 1402405 1401524 gene locus_tag LOCUS_13210 1402405 1401524 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048656812.1 protein_id gnl|my_center|LOCUS_13210 1403471 1402644 gene locus_tag LOCUS_13220 1403471 1402644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1404680 1403487 gene locus_tag LOCUS_13230 1404680 1403487 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_13230 1404812 1405666 gene locus_tag LOCUS_13240 1404812 1405666 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861630.1 protein_id gnl|my_center|LOCUS_13240 1405970 1405755 gene locus_tag LOCUS_13250 1405970 1405755 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231396.1 protein_id gnl|my_center|LOCUS_13250 1406519 1406040 gene locus_tag LOCUS_13260 1406519 1406040 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050142.1 protein_id gnl|my_center|LOCUS_13260 1407051 1406569 gene locus_tag LOCUS_13270 1407051 1406569 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809113.1 protein_id gnl|my_center|LOCUS_13270 1407920 1407249 gene locus_tag LOCUS_13280 1407920 1407249 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588494.1 protein_id gnl|my_center|LOCUS_13280 1408628 1407966 gene locus_tag LOCUS_13290 gene rpiA 1408628 1407966 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364539.1 protein_id gnl|my_center|LOCUS_13290 1409185 1408706 gene locus_tag LOCUS_13300 1409185 1408706 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461766.1 protein_id gnl|my_center|LOCUS_13300 1409768 1409196 gene locus_tag LOCUS_13310 1409768 1409196 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287055.1 protein_id gnl|my_center|LOCUS_13310 1410361 1409822 gene locus_tag LOCUS_13320 1410361 1409822 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506656.1 protein_id gnl|my_center|LOCUS_13320 1410905 1410423 gene locus_tag LOCUS_13330 1410905 1410423 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057909.1 protein_id gnl|my_center|LOCUS_13330 1411421 1410918 gene locus_tag LOCUS_13340 1411421 1410918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 1411917 1411450 gene locus_tag LOCUS_13350 1411917 1411450 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561623.1 protein_id gnl|my_center|LOCUS_13350 1412499 1411984 gene locus_tag LOCUS_13360 1412499 1411984 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804034.1 protein_id gnl|my_center|LOCUS_13360 1413169 1412642 gene locus_tag LOCUS_13370 1413169 1412642 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901178.1 protein_id gnl|my_center|LOCUS_13370 1413292 1413717 gene locus_tag LOCUS_13380 1413292 1413717 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962885.1 protein_id gnl|my_center|LOCUS_13380 1414253 1413873 gene locus_tag LOCUS_13390 1414253 1413873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1415153 1414419 gene locus_tag LOCUS_13400 1415153 1414419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1415953 1415297 gene locus_tag LOCUS_13410 1415953 1415297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1417282 1416179 gene locus_tag LOCUS_13420 1417282 1416179 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530825.1 protein_id gnl|my_center|LOCUS_13420 1418517 1417354 gene locus_tag LOCUS_13430 1418517 1417354 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898047.1 protein_id gnl|my_center|LOCUS_13430 1418846 1418517 gene locus_tag LOCUS_13440 1418846 1418517 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812779.1 protein_id gnl|my_center|LOCUS_13440 1419006 1419866 gene locus_tag LOCUS_13450 gene rhaS 1419006 1419866 CDS product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217112.1 protein_id gnl|my_center|LOCUS_13450 1420128 1419940 gene locus_tag LOCUS_13460 1420128 1419940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1421206 1420118 gene locus_tag LOCUS_13470 1421206 1420118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1422444 1421458 gene locus_tag LOCUS_13480 gene iolU 1422444 1421458 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228926.1 protein_id gnl|my_center|LOCUS_13480 1423516 1422560 gene locus_tag LOCUS_13490 1423516 1422560 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_13490 1424392 1423679 gene locus_tag LOCUS_13500 1424392 1423679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13500 1424786 1424313 gene locus_tag LOCUS_13510 1424786 1424313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13510 1425780 1424896 gene locus_tag LOCUS_13520 1425780 1424896 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_13520 1426706 1425798 gene locus_tag LOCUS_13530 1426706 1425798 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_13530 1428552 1426804 gene locus_tag LOCUS_13540 1428552 1426804 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_13540 1429505 1428738 gene locus_tag LOCUS_13550 1429505 1428738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1431250 1429502 gene locus_tag LOCUS_13560 1431250 1429502 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_13560 1431631 1432722 gene locus_tag LOCUS_13570 1431631 1432722 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721423.1 protein_id gnl|my_center|LOCUS_13570 1433777 1432821 gene locus_tag LOCUS_13580 1433777 1432821 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892805.1 protein_id gnl|my_center|LOCUS_13580 1436332 1433855 gene locus_tag LOCUS_13590 1436332 1433855 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_13590 1437450 1436359 gene locus_tag LOCUS_13600 1437450 1436359 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530504.1 protein_id gnl|my_center|LOCUS_13600 1441010 1437985 gene locus_tag LOCUS_r00040 1441010 1437985 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1441476 1441364 gene locus_tag LOCUS_r00050 1441476 1441364 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1443185 1441636 gene locus_tag LOCUS_r00060 1443185 1441636 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1443709 1444059 gene locus_tag LOCUS_13610 1443709 1444059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1444381 1444935 gene locus_tag LOCUS_13620 1444381 1444935 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771481.1 protein_id gnl|my_center|LOCUS_13620 1445878 1444991 gene locus_tag LOCUS_13630 1445878 1444991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1446554 1445826 gene locus_tag LOCUS_13640 gene ureG 1446554 1445826 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261400.1 protein_id gnl|my_center|LOCUS_13640 1447355 1446639 gene locus_tag LOCUS_13650 1447355 1446639 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694141.1 protein_id gnl|my_center|LOCUS_13650 1449094 1447376 gene locus_tag LOCUS_13660 gene ureC 1449094 1447376 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763096.1 protein_id gnl|my_center|LOCUS_13660 1449459 1449091 gene locus_tag LOCUS_13670 1449459 1449091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13670 1449782 1449480 gene locus_tag LOCUS_13680 gene ureA 1449782 1449480 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317023.1 protein_id gnl|my_center|LOCUS_13680 1450130 1451815 gene locus_tag LOCUS_13690 gene ilvD 1450130 1451815 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967560.1 protein_id gnl|my_center|LOCUS_13690 1452804 1451911 gene locus_tag LOCUS_13700 1452804 1451911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1453073 1452744 gene locus_tag LOCUS_13710 1453073 1452744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1453491 1453192 gene locus_tag LOCUS_13720 1453491 1453192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1455112 1453652 gene locus_tag LOCUS_13730 1455112 1453652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1455311 1456435 gene locus_tag LOCUS_13740 gene ytvI 1455311 1456435 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081388.1 protein_id gnl|my_center|LOCUS_13740 1458279 1456456 gene locus_tag LOCUS_13750 1458279 1456456 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398903.1 protein_id gnl|my_center|LOCUS_13750 1459337 1458429 gene locus_tag LOCUS_13760 gene gltC 1459337 1458429 CDS product glutamate biosynthesis transcriptional regulator GltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399246.1 protein_id gnl|my_center|LOCUS_13760 1460019 1459399 gene locus_tag LOCUS_13770 1460019 1459399 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249737.1 protein_id gnl|my_center|LOCUS_13770 1460122 1460640 gene locus_tag LOCUS_13780 gene tpx 1460122 1460640 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223506.1 protein_id gnl|my_center|LOCUS_13780 1461104 1460712 gene locus_tag LOCUS_13790 1461104 1460712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1462231 1461431 gene locus_tag LOCUS_13800 1462231 1461431 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229218.1 protein_id gnl|my_center|LOCUS_13800 1464212 1462596 gene locus_tag LOCUS_13810 1464212 1462596 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206592.1 protein_id gnl|my_center|LOCUS_13810 1464354 1465178 gene locus_tag LOCUS_13820 1464354 1465178 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251336.1 protein_id gnl|my_center|LOCUS_13820 1465331 1465525 gene locus_tag LOCUS_13830 1465331 1465525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1465686 1466951 gene locus_tag LOCUS_13840 1465686 1466951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 1467614 1467078 gene locus_tag LOCUS_13850 1467614 1467078 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832301.1 protein_id gnl|my_center|LOCUS_13850 1467915 1467709 gene locus_tag LOCUS_13860 1467915 1467709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1469049 1468081 gene locus_tag LOCUS_13870 gene pfkA 1469049 1468081 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429132.1 protein_id gnl|my_center|LOCUS_13870 1470176 1469091 gene locus_tag LOCUS_13880 1470176 1469091 CDS product tetraprenyl-beta-curcumene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657152.1 protein_id gnl|my_center|LOCUS_13880 1470524 1470210 gene locus_tag LOCUS_13890 1470524 1470210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1470775 1470599 gene locus_tag LOCUS_13900 1470775 1470599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1471026 1470829 gene locus_tag LOCUS_13910 gene cspB 1471026 1470829 CDS product cold shock-like protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161732.1 protein_id gnl|my_center|LOCUS_13910 1471801 1471103 gene locus_tag LOCUS_13920 1471801 1471103 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990622.1 protein_id gnl|my_center|LOCUS_13920 1471992 1472225 gene locus_tag LOCUS_13930 1471992 1472225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1472325 1472504 gene locus_tag LOCUS_13940 1472325 1472504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1472691 1474481 gene locus_tag LOCUS_13950 gene pepF 1472691 1474481 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_13950 1475182 1474619 gene locus_tag LOCUS_13960 gene ssuE 1475182 1474619 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142759.1 protein_id gnl|my_center|LOCUS_13960 1476266 1475385 gene locus_tag LOCUS_13970 1476266 1475385 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_13970 1479140 1476270 gene locus_tag LOCUS_13980 1479140 1476270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1480219 1479173 gene locus_tag LOCUS_13990 gene macA 1480219 1479173 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746442.1 protein_id gnl|my_center|LOCUS_13990 1480913 1480197 gene locus_tag LOCUS_14000 1480913 1480197 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 protein_id gnl|my_center|LOCUS_14000 1482300 1481488 gene locus_tag LOCUS_14010 1482300 1481488 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257179.1 protein_id gnl|my_center|LOCUS_14010 1482463 1483626 gene locus_tag LOCUS_14020 1482463 1483626 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545957.1 protein_id gnl|my_center|LOCUS_14020 1484508 1483774 gene locus_tag LOCUS_14030 1484508 1483774 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_14030 1485551 1484514 gene locus_tag LOCUS_14040 1485551 1484514 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854514.1 protein_id gnl|my_center|LOCUS_14040 1485823 1485479 gene locus_tag LOCUS_14050 1485823 1485479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1487027 1486026 gene locus_tag LOCUS_14060 1487027 1486026 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173480.1 protein_id gnl|my_center|LOCUS_14060 1487227 1488555 gene locus_tag LOCUS_14070 1487227 1488555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1488552 1489682 gene locus_tag LOCUS_14080 1488552 1489682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1489679 1490779 gene locus_tag LOCUS_14090 1489679 1490779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1491982 1490921 gene locus_tag LOCUS_14100 gene fni 1491982 1490921 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259707.1 protein_id gnl|my_center|LOCUS_14100 1492191 1492913 gene locus_tag LOCUS_14110 gene nagB 1492191 1492913 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228092.1 protein_id gnl|my_center|LOCUS_14110 1492917 1494107 gene locus_tag LOCUS_14120 gene nagA 1492917 1494107 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775571.1 protein_id gnl|my_center|LOCUS_14120 1495173 1494241 gene locus_tag LOCUS_14130 1495173 1494241 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212337777.1 protein_id gnl|my_center|LOCUS_14130 1496153 1495350 gene locus_tag LOCUS_14140 1496153 1495350 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_14140 1497113 1496154 gene locus_tag LOCUS_14150 1497113 1496154 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550371.1 protein_id gnl|my_center|LOCUS_14150 1497584 1497159 gene locus_tag LOCUS_14160 1497584 1497159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1499871 1497658 gene locus_tag LOCUS_14170 gene recQ 1499871 1497658 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272332.1 protein_id gnl|my_center|LOCUS_14170 1500943 1500002 gene locus_tag LOCUS_14180 gene mdh 1500943 1500002 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229437.1 protein_id gnl|my_center|LOCUS_14180 1502567 1501275 gene locus_tag LOCUS_14190 gene icd 1502567 1501275 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_14190 1503887 1502775 gene locus_tag LOCUS_14200 gene citZ 1503887 1502775 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_14200 1504210 1505730 gene locus_tag LOCUS_14210 gene ppx 1504210 1505730 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963940.1 protein_id gnl|my_center|LOCUS_14210 1507803 1505743 gene locus_tag LOCUS_14220 1507803 1505743 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423561.1 protein_id gnl|my_center|LOCUS_14220 1508007 1509125 gene locus_tag LOCUS_14230 gene ytvI 1508007 1509125 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081398.1 protein_id gnl|my_center|LOCUS_14230 1509937 1509134 gene locus_tag LOCUS_14240 gene murI 1509937 1509134 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229860.1 protein_id gnl|my_center|LOCUS_14240 1510388 1509996 gene locus_tag LOCUS_14250 gene fxsA 1510388 1509996 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246085.1 protein_id gnl|my_center|LOCUS_14250 1510907 1510416 gene locus_tag LOCUS_14260 1510907 1510416 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831194.1 protein_id gnl|my_center|LOCUS_14260 1512747 1510993 gene locus_tag LOCUS_14270 gene pyk 1512747 1510993 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398560.1 protein_id gnl|my_center|LOCUS_14270 1513805 1512792 gene locus_tag LOCUS_14280 1513805 1512792 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931204.1 protein_id gnl|my_center|LOCUS_14280 1514667 1513795 gene locus_tag LOCUS_14290 gene accD 1514667 1513795 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942870.1 protein_id gnl|my_center|LOCUS_14290 1514963 1514769 gene locus_tag LOCUS_14300 1514963 1514769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393369.1 protein_id gnl|my_center|LOCUS_14300 1515747 1515250 gene locus_tag LOCUS_14310 1515747 1515250 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230797.1 protein_id gnl|my_center|LOCUS_14310 1515984 1516154 gene locus_tag LOCUS_14320 1515984 1516154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1520842 1517039 gene locus_tag LOCUS_14330 1520842 1517039 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_14330 1521021 1521347 gene locus_tag LOCUS_14340 gene ytrH 1521021 1521347 CDS product sporulation membrane protein YtrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229410.1 protein_id gnl|my_center|LOCUS_14340 1521351 1521863 gene locus_tag LOCUS_14350 1521351 1521863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 1521976 1522272 gene locus_tag LOCUS_14360 1521976 1522272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1523847 1522501 gene locus_tag LOCUS_14370 1523847 1522501 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398641.1 protein_id gnl|my_center|LOCUS_14370 1524084 1525451 gene locus_tag LOCUS_14380 1524084 1525451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1525472 1526653 gene locus_tag LOCUS_14390 1525472 1526653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 1526650 1528026 gene locus_tag LOCUS_14400 gene yheD 1526650 1528026 CDS product spore coat associated protein YheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245015.1 protein_id gnl|my_center|LOCUS_14400 1528026 1529177 gene locus_tag LOCUS_14410 gene yheD 1528026 1529177 CDS product spore coat associated protein YheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245015.1 protein_id gnl|my_center|LOCUS_14410 1529191 1529640 gene locus_tag LOCUS_14420 1529191 1529640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1529833 1531068 gene locus_tag LOCUS_14430 gene spaC 1529833 1531068 CDS product spore coat associated protein SpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245845.1 protein_id gnl|my_center|LOCUS_14430 1531831 1531145 gene locus_tag LOCUS_14440 1531831 1531145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1533237 1532053 gene locus_tag LOCUS_14450 1533237 1532053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 1534013 1533444 gene locus_tag LOCUS_14460 gene cotJC 1534013 1533444 CDS product spore coat protein CotJC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233850.1 protein_id gnl|my_center|LOCUS_14460 1534304 1534041 gene locus_tag LOCUS_14470 gene cotJB 1534304 1534041 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002157501.1 protein_id gnl|my_center|LOCUS_14470 1534533 1534297 gene locus_tag LOCUS_14480 1534533 1534297 CDS product spore coat associated protein CotJA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362188.1 protein_id gnl|my_center|LOCUS_14480 1536081 1534735 gene locus_tag LOCUS_14490 1536081 1534735 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_14490 1537259 1536144 gene locus_tag LOCUS_14500 gene yfkAB 1537259 1536144 CDS product radical SAM/CxCxxxxC motif protein YfkAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156007.1 protein_id gnl|my_center|LOCUS_14500 1538567 1537452 gene locus_tag LOCUS_14510 1538567 1537452 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156271991.1 protein_id gnl|my_center|LOCUS_14510 1539566 1538715 gene locus_tag LOCUS_14520 gene uppP 1539566 1538715 CDS product bacitracin resistance undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796255.1 protein_id gnl|my_center|LOCUS_14520 1541112 1539670 gene locus_tag LOCUS_14530 1541112 1539670 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139019776.1 protein_id gnl|my_center|LOCUS_14530 1541606 1541136 gene locus_tag LOCUS_14540 1541606 1541136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1542637 1541636 gene locus_tag LOCUS_14550 gene moaA 1542637 1541636 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722673.1 protein_id gnl|my_center|LOCUS_14550 1542748 1543488 gene locus_tag LOCUS_14560 1542748 1543488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1543644 1544699 gene locus_tag LOCUS_14570 1543644 1544699 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 protein_id gnl|my_center|LOCUS_14570 1546182 1544785 gene locus_tag LOCUS_14580 gene sufB 1546182 1544785 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118827.1 protein_id gnl|my_center|LOCUS_14580 1546716 1546291 gene locus_tag LOCUS_14590 gene sufU 1546716 1546291 CDS product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009523.1 protein_id gnl|my_center|LOCUS_14590 1547929 1546703 gene locus_tag LOCUS_14600 gene sufS 1547929 1546703 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228604.1 protein_id gnl|my_center|LOCUS_14600 1549233 1547926 gene locus_tag LOCUS_14610 gene sufD 1549233 1547926 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152183.1 protein_id gnl|my_center|LOCUS_14610 1550069 1549254 gene locus_tag LOCUS_14620 gene sufC 1550069 1549254 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151872.1 protein_id gnl|my_center|LOCUS_14620 1550780 1550193 gene locus_tag LOCUS_14630 1550780 1550193 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 protein_id gnl|my_center|LOCUS_14630 1550936 1552156 gene locus_tag LOCUS_14640 gene mtnK 1550936 1552156 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244973.1 protein_id gnl|my_center|LOCUS_14640 1552176 1553237 gene locus_tag LOCUS_14650 gene mtnA 1552176 1553237 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392493.1 protein_id gnl|my_center|LOCUS_14650 1553634 1553329 gene locus_tag LOCUS_14660 1553634 1553329 CDS product DUF1805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248463.1 protein_id gnl|my_center|LOCUS_14660 1553830 1554291 gene locus_tag LOCUS_14670 1553830 1554291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1554844 1554458 gene locus_tag LOCUS_14680 1554844 1554458 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216764.1 protein_id gnl|my_center|LOCUS_14680 1555018 1555380 gene locus_tag LOCUS_14690 1555018 1555380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1555632 1556792 gene locus_tag LOCUS_14700 gene yhbH 1555632 1556792 CDS product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233432.1 protein_id gnl|my_center|LOCUS_14700 1558119 1556884 gene locus_tag LOCUS_14710 1558119 1556884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1558283 1560139 gene locus_tag LOCUS_14720 gene ltaP 1558283 1560139 CDS product lipoteichoic acid primase LtaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931059.1 protein_id gnl|my_center|LOCUS_14720 1561480 1560197 gene locus_tag LOCUS_14730 gene kinB 1561480 1560197 CDS product sporulation sensor histidine kinase KinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002002352.1 protein_id gnl|my_center|LOCUS_14730 1561685 1563130 gene locus_tag LOCUS_14740 gene spoVR 1561685 1563130 CDS product stage V sporulation protein SpoVR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202693.1 protein_id gnl|my_center|LOCUS_14740 1563589 1563212 gene locus_tag LOCUS_14750 1563589 1563212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1564846 1563962 gene locus_tag LOCUS_14760 1564846 1563962 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729930.1 protein_id gnl|my_center|LOCUS_14760 1565841 1564843 gene locus_tag LOCUS_14770 1565841 1564843 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888673.1 protein_id gnl|my_center|LOCUS_14770 1567325 1565865 gene locus_tag LOCUS_14780 1567325 1565865 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_14780 1567893 1567522 gene locus_tag LOCUS_14790 1567893 1567522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1569943 1568045 gene locus_tag LOCUS_14800 gene prkA 1569943 1568045 CDS product serine/threonine protein kinase PrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233433.1 protein_id gnl|my_center|LOCUS_14800 1570394 1571167 gene locus_tag LOCUS_14810 1570394 1571167 CDS product DUF2161 domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966295.1 protein_id gnl|my_center|LOCUS_14810 1571164 1571484 gene locus_tag LOCUS_14820 1571164 1571484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1572775 1571594 gene locus_tag LOCUS_14830 1572775 1571594 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 protein_id gnl|my_center|LOCUS_14830 1573474 1573226 gene locus_tag LOCUS_14840 1573474 1573226 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965244.1 protein_id gnl|my_center|LOCUS_14840 1574088 1573624 gene locus_tag LOCUS_14850 gene trmL 1574088 1573624 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_14850 1574200 1574922 gene locus_tag LOCUS_14860 gene phoP 1574200 1574922 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229442.1 protein_id gnl|my_center|LOCUS_14860 1576383 1575295 gene locus_tag LOCUS_14870 gene serC 1576383 1575295 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233234.1 protein_id gnl|my_center|LOCUS_14870 1578024 1576600 gene locus_tag LOCUS_14880 gene glnA 1578024 1576600 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125190.1 protein_id gnl|my_center|LOCUS_14880 1579353 1578292 gene locus_tag LOCUS_14890 gene aroF 1579353 1578292 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_14890 1579916 1579494 gene locus_tag LOCUS_14900 1579916 1579494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1581100 1580150 gene locus_tag LOCUS_14910 gene ispH 1581100 1580150 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706669.1 protein_id gnl|my_center|LOCUS_14910 1582721 1581234 gene locus_tag LOCUS_14920 1582721 1581234 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392644.1 protein_id gnl|my_center|LOCUS_14920 1583418 1582726 gene locus_tag LOCUS_14930 1583418 1582726 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392645.1 protein_id gnl|my_center|LOCUS_14930 1585270 1583636 gene locus_tag LOCUS_14940 1585270 1583636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1585865 1585452 gene locus_tag LOCUS_14950 1585865 1585452 CDS product YugN-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612327.1 protein_id gnl|my_center|LOCUS_14950 1586648 1585983 gene locus_tag LOCUS_14960 1586648 1585983 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564604.1 protein_id gnl|my_center|LOCUS_14960 1587681 1586635 gene locus_tag LOCUS_14970 gene liaS 1587681 1586635 CDS product two-component system sensor histidine kinase LiaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244464.1 protein_id gnl|my_center|LOCUS_14970 1588864 1587689 gene locus_tag LOCUS_14980 1588864 1587689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1589185 1590477 gene locus_tag LOCUS_14990 1589185 1590477 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765058.1 protein_id gnl|my_center|LOCUS_14990 1591005 1590628 gene locus_tag LOCUS_15000 1591005 1590628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1592494 1591106 gene locus_tag LOCUS_15010 1592494 1591106 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393525.1 protein_id gnl|my_center|LOCUS_15010 1592735 1592610 gene locus_tag LOCUS_15020 1592735 1592610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 1593344 1592820 gene locus_tag LOCUS_15030 1593344 1592820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 1594047 1593457 gene locus_tag LOCUS_15040 1594047 1593457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1596119 1594182 gene locus_tag LOCUS_15050 gene thrS 1596119 1594182 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786086.1 protein_id gnl|my_center|LOCUS_15050 1597362 1596514 gene locus_tag LOCUS_15060 gene ytxC 1597362 1596514 CDS product putative sporulation protein YtxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393262.1 protein_id gnl|my_center|LOCUS_15060 1599135 1598002 gene locus_tag LOCUS_15070 gene mqnC 1599135 1598002 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393344.1 protein_id gnl|my_center|LOCUS_15070 1600486 1599305 gene locus_tag LOCUS_15080 gene metC 1600486 1599305 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244787.1 protein_id gnl|my_center|LOCUS_15080 1601650 1600490 gene locus_tag LOCUS_15090 1601650 1600490 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817365.1 protein_id gnl|my_center|LOCUS_15090 1602619 1601702 gene locus_tag LOCUS_15100 gene metA 1602619 1601702 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462040.1 protein_id gnl|my_center|LOCUS_15100 1603377 1604312 gene locus_tag LOCUS_15110 gene corA 1603377 1604312 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021725.1 protein_id gnl|my_center|LOCUS_15110 1605073 1604420 gene locus_tag LOCUS_15120 1605073 1604420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1606408 1605134 gene locus_tag LOCUS_15130 1606408 1605134 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964893.1 protein_id gnl|my_center|LOCUS_15130 1606601 1607503 gene locus_tag LOCUS_15140 1606601 1607503 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_15140 1607515 1608324 gene locus_tag LOCUS_15150 gene hisJ 1607515 1608324 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 protein_id gnl|my_center|LOCUS_15150 1608533 1609456 gene locus_tag LOCUS_15160 1608533 1609456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1610290 1609421 gene locus_tag LOCUS_15170 1610290 1609421 CDS product DUF695 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016290.1 protein_id gnl|my_center|LOCUS_15170 1610535 1610843 gene locus_tag LOCUS_15180 1610535 1610843 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721618.1 protein_id gnl|my_center|LOCUS_15180 1610976 1611203 gene locus_tag LOCUS_15190 1610976 1611203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1612759 1611995 gene locus_tag LOCUS_15200 gene sdhB 1612759 1611995 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291827.1 protein_id gnl|my_center|LOCUS_15200 1614522 1612777 gene locus_tag LOCUS_15210 gene sdhA 1614522 1612777 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676751.1 protein_id gnl|my_center|LOCUS_15210 1615219 1614548 gene locus_tag LOCUS_15220 gene sdhC 1615219 1614548 CDS product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678354.1 protein_id gnl|my_center|LOCUS_15220 1615515 1616408 gene locus_tag LOCUS_15230 1615515 1616408 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207332.1 protein_id gnl|my_center|LOCUS_15230 1616799 1618436 gene locus_tag LOCUS_15240 1616799 1618436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1620486 1618405 gene locus_tag LOCUS_15250 1620486 1618405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1620776 1620922 gene locus_tag LOCUS_15260 1620776 1620922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1622191 1623432 gene locus_tag LOCUS_15270 gene rsgA 1622191 1623432 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001073056.1 protein_id gnl|my_center|LOCUS_15270 1623607 1624272 gene locus_tag LOCUS_15280 1623607 1624272 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722596.1 protein_id gnl|my_center|LOCUS_15280 1624372 1626609 gene locus_tag LOCUS_15290 1624372 1626609 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989998.1 protein_id gnl|my_center|LOCUS_15290 1626943 1626725 gene locus_tag LOCUS_15300 1626943 1626725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1628054 1626990 gene locus_tag LOCUS_15310 1628054 1626990 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057527.1 protein_id gnl|my_center|LOCUS_15310 1628935 1628057 gene locus_tag LOCUS_15320 gene cysW 1628935 1628057 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813328.1 protein_id gnl|my_center|LOCUS_15320 1629802 1628954 gene locus_tag LOCUS_15330 gene cysT 1629802 1628954 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_15330 1630993 1629827 gene locus_tag LOCUS_15340 1630993 1629827 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 protein_id gnl|my_center|LOCUS_15340 1631538 1632557 gene locus_tag LOCUS_15350 1631538 1632557 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 protein_id gnl|my_center|LOCUS_15350 1632748 1636653 gene locus_tag LOCUS_15360 1632748 1636653 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886443.1 protein_id gnl|my_center|LOCUS_15360 1636738 1638321 gene locus_tag LOCUS_15370 1636738 1638321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 1639428 1638469 gene locus_tag LOCUS_15380 gene dnaI 1639428 1638469 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229466.1 protein_id gnl|my_center|LOCUS_15380 1640979 1639453 gene locus_tag LOCUS_15390 1640979 1639453 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579580.1 protein_id gnl|my_center|LOCUS_15390 1642050 1641178 gene locus_tag LOCUS_15400 1642050 1641178 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125180.1 protein_id gnl|my_center|LOCUS_15400 1642555 1642250 gene locus_tag LOCUS_15410 1642555 1642250 CDS product YuiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243877.1 protein_id gnl|my_center|LOCUS_15410 1642709 1643455 gene locus_tag LOCUS_15420 1642709 1643455 CDS product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242896.1 protein_id gnl|my_center|LOCUS_15420 1643773 1643510 gene locus_tag LOCUS_15430 1643773 1643510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1644966 1643773 gene locus_tag LOCUS_15440 1644966 1643773 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886605.1 protein_id gnl|my_center|LOCUS_15440 1645400 1646398 gene locus_tag LOCUS_15450 1645400 1646398 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026689.1 protein_id gnl|my_center|LOCUS_15450 1646941 1646792 gene locus_tag LOCUS_15460 1646941 1646792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1647864 1647190 gene locus_tag LOCUS_15470 1647864 1647190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1649919 1648228 gene locus_tag LOCUS_15480 1649919 1648228 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461506.1 protein_id gnl|my_center|LOCUS_15480 1651051 1650692 gene locus_tag LOCUS_15490 1651051 1650692 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244166.1 protein_id gnl|my_center|LOCUS_15490 1651836 1651192 gene locus_tag LOCUS_15500 1651836 1651192 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989831.1 protein_id gnl|my_center|LOCUS_15500 1652158 1653261 gene locus_tag LOCUS_15510 gene mqnE 1652158 1653261 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172898.1 protein_id gnl|my_center|LOCUS_15510 1653394 1654461 gene locus_tag LOCUS_15520 1653394 1654461 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242518.1 protein_id gnl|my_center|LOCUS_15520 1654788 1654528 gene locus_tag LOCUS_15530 1654788 1654528 CDS product YuzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595027.1 protein_id gnl|my_center|LOCUS_15530 1654887 1655132 gene locus_tag LOCUS_15540 1654887 1655132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1656236 1655448 gene locus_tag LOCUS_15550 1656236 1655448 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002024902.1 protein_id gnl|my_center|LOCUS_15550 1656961 1656257 gene locus_tag LOCUS_15560 1656961 1656257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1658009 1657074 gene locus_tag LOCUS_15570 gene ctaA 1658009 1657074 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188743.1 protein_id gnl|my_center|LOCUS_15570 1658509 1658165 gene locus_tag LOCUS_15580 1658509 1658165 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009915789.1 protein_id gnl|my_center|LOCUS_15580 1660204 1658585 gene locus_tag LOCUS_15590 1660204 1658585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1661928 1660279 gene locus_tag LOCUS_15600 1661928 1660279 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_15600 1662680 1661958 gene locus_tag LOCUS_15610 1662680 1661958 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_15610 1663177 1662701 gene locus_tag LOCUS_15620 1663177 1662701 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398518.1 protein_id gnl|my_center|LOCUS_15620 1663937 1663185 gene locus_tag LOCUS_15630 1663937 1663185 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234424.1 protein_id gnl|my_center|LOCUS_15630 1666365 1664332 gene locus_tag LOCUS_15640 1666365 1664332 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903316.1 protein_id gnl|my_center|LOCUS_15640 1667561 1666392 gene locus_tag LOCUS_15650 1667561 1666392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1668064 1667621 gene locus_tag LOCUS_15660 1668064 1667621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1668313 1669524 gene locus_tag LOCUS_15670 1668313 1669524 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440662.1 protein_id gnl|my_center|LOCUS_15670 1669766 1669608 gene locus_tag LOCUS_15680 1669766 1669608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1669864 1670235 gene locus_tag LOCUS_15690 1669864 1670235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1671384 1670440 gene locus_tag LOCUS_15700 1671384 1670440 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497489.1 protein_id gnl|my_center|LOCUS_15700 1672008 1671388 gene locus_tag LOCUS_15710 1672008 1671388 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930124.1 protein_id gnl|my_center|LOCUS_15710 1672929 1672066 gene locus_tag LOCUS_15720 gene cyoE 1672929 1672066 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232818.1 protein_id gnl|my_center|LOCUS_15720 1673145 1673567 gene locus_tag LOCUS_15730 gene cwlJ 1673145 1673567 CDS product cell wall hydrolase CwlJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538169.1 protein_id gnl|my_center|LOCUS_15730 1673607 1674227 gene locus_tag LOCUS_15740 1673607 1674227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1674501 1674205 gene locus_tag LOCUS_15750 1674501 1674205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1674819 1675805 gene locus_tag LOCUS_15760 1674819 1675805 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244136.1 protein_id gnl|my_center|LOCUS_15760 1676210 1675980 gene locus_tag LOCUS_15770 1676210 1675980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1676328 1676504 gene locus_tag LOCUS_15780 1676328 1676504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 1677545 1676559 gene locus_tag LOCUS_15790 gene trpS 1677545 1676559 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110984.1 protein_id gnl|my_center|LOCUS_15790 1678553 1678239 gene locus_tag LOCUS_15800 1678553 1678239 CDS product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136699885.1 protein_id gnl|my_center|LOCUS_15800 1678914 1678699 gene locus_tag LOCUS_15810 1678914 1678699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 1678913 1679794 gene locus_tag LOCUS_15820 1678913 1679794 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_15820 1681939 1680101 gene locus_tag LOCUS_15830 1681939 1680101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1684091 1682064 gene locus_tag LOCUS_15840 1684091 1682064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706312.1 protein_id gnl|my_center|LOCUS_15840 1684346 1685272 gene locus_tag LOCUS_15850 1684346 1685272 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886400.1 protein_id gnl|my_center|LOCUS_15850 1685285 1685617 gene locus_tag LOCUS_15860 1685285 1685617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 1685709 1685921 gene locus_tag LOCUS_15870 gene sasP 1685709 1685921 CDS product small acid-soluble spore protein, SasP family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284598.1 protein_id gnl|my_center|LOCUS_15870 1686410 1686009 gene locus_tag LOCUS_15880 1686410 1686009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1686659 1687918 gene locus_tag LOCUS_15890 1686659 1687918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1688677 1688018 gene locus_tag LOCUS_15900 1688677 1688018 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_15900 1689656 1688694 gene locus_tag LOCUS_15910 1689656 1688694 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109290171.1 protein_id gnl|my_center|LOCUS_15910 1689897 1690820 gene locus_tag LOCUS_15920 1689897 1690820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 1691764 1690931 gene locus_tag LOCUS_15930 1691764 1690931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1693262 1692117 gene locus_tag LOCUS_15940 1693262 1692117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1693988 1693347 gene locus_tag LOCUS_15950 1693988 1693347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1694793 1694101 gene locus_tag LOCUS_15960 1694793 1694101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1696073 1694946 gene locus_tag LOCUS_15970 1696073 1694946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1696974 1696096 gene locus_tag LOCUS_15980 1696974 1696096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1697263 1698189 gene locus_tag LOCUS_15990 1697263 1698189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 1699130 1698225 gene locus_tag LOCUS_16000 1699130 1698225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1699317 1700150 gene locus_tag LOCUS_16010 1699317 1700150 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_16010 1701237 1700218 gene locus_tag LOCUS_16020 1701237 1700218 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_16020 1702043 1701276 gene locus_tag LOCUS_16030 1702043 1701276 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_16030 1702199 1703005 gene locus_tag LOCUS_16040 1702199 1703005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1703521 1703063 gene locus_tag LOCUS_16050 1703521 1703063 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583637.1 protein_id gnl|my_center|LOCUS_16050 1703883 1704629 gene locus_tag LOCUS_16060 1703883 1704629 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022488.1 protein_id gnl|my_center|LOCUS_16060 1705670 1704738 gene locus_tag LOCUS_16070 gene pyrB 1705670 1704738 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_16070 1707168 1705756 gene locus_tag LOCUS_16080 1707168 1705756 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204707.1 protein_id gnl|my_center|LOCUS_16080 1707605 1707228 gene locus_tag LOCUS_16090 1707605 1707228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1708654 1707758 gene locus_tag LOCUS_16100 1708654 1707758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1708798 1709904 gene locus_tag LOCUS_16110 1708798 1709904 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066535.1 protein_id gnl|my_center|LOCUS_16110 1711667 1710015 gene locus_tag LOCUS_16120 1711667 1710015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 1713480 1711684 gene locus_tag LOCUS_16130 gene yesM 1713480 1711684 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_16130 1714458 1713571 gene locus_tag LOCUS_16140 1714458 1713571 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_16140 1715382 1714483 gene locus_tag LOCUS_16150 1715382 1714483 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803821.1 protein_id gnl|my_center|LOCUS_16150 1717206 1715446 gene locus_tag LOCUS_16160 1717206 1715446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 1723256 1717584 gene locus_tag LOCUS_16170 1723256 1717584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 1725384 1723321 gene locus_tag LOCUS_16180 1725384 1723321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1726853 1725540 gene locus_tag LOCUS_16190 1726853 1725540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1727788 1726859 gene locus_tag LOCUS_16200 1727788 1726859 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722208.1 protein_id gnl|my_center|LOCUS_16200 1729404 1727902 gene locus_tag LOCUS_16210 1729404 1727902 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582591.1 protein_id gnl|my_center|LOCUS_16210 1731246 1729600 gene locus_tag LOCUS_16220 1731246 1729600 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_16220 1733089 1731224 gene locus_tag LOCUS_16230 1733089 1731224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1735858 1733381 gene locus_tag LOCUS_16240 1735858 1733381 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_16240 1737245 1735845 gene locus_tag LOCUS_16250 1737245 1735845 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_16250 1737626 1737542 gene locus_tag LOCUS_t00070 1737626 1737542 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1737738 1737665 gene locus_tag LOCUS_t00080 1737738 1737665 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1737828 1737754 gene locus_tag LOCUS_t00090 1737828 1737754 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1738153 1738072 gene locus_tag LOCUS_t00100 1738153 1738072 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1738264 1738190 gene locus_tag LOCUS_t00110 1738264 1738190 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1738427 1738337 gene locus_tag LOCUS_t00120 1738427 1738337 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1738512 1738437 gene locus_tag LOCUS_t00130 1738512 1738437 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1739020 1738541 gene locus_tag LOCUS_16260 1739020 1738541 CDS product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344247.1 protein_id gnl|my_center|LOCUS_16260 1739122 1739475 gene locus_tag LOCUS_16270 1739122 1739475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1739591 1739725 gene locus_tag LOCUS_16280 1739591 1739725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1742125 1739864 gene locus_tag LOCUS_16290 1742125 1739864 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 protein_id gnl|my_center|LOCUS_16290 1742805 1742173 gene locus_tag LOCUS_16300 1742805 1742173 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871236.1 protein_id gnl|my_center|LOCUS_16300 1743376 1742810 gene locus_tag LOCUS_16310 1743376 1742810 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009878789.1 protein_id gnl|my_center|LOCUS_16310 1744085 1743477 gene locus_tag LOCUS_16320 1744085 1743477 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254817.1 protein_id gnl|my_center|LOCUS_16320 1744301 1744747 gene locus_tag LOCUS_16330 1744301 1744747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1744866 1745183 gene locus_tag LOCUS_16340 1744866 1745183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 1745678 1745322 gene locus_tag LOCUS_16350 1745678 1745322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1747906 1745768 gene locus_tag LOCUS_16360 1747906 1745768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1748856 1748140 gene locus_tag LOCUS_16370 1748856 1748140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1750143 1749061 gene locus_tag LOCUS_16380 1750143 1749061 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460119.1 protein_id gnl|my_center|LOCUS_16380 1750866 1750177 gene locus_tag LOCUS_16390 1750866 1750177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1752572 1750887 gene locus_tag LOCUS_16400 1752572 1750887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1753882 1752668 gene locus_tag LOCUS_16410 1753882 1752668 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_16410 1754559 1753900 gene locus_tag LOCUS_16420 1754559 1753900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1755471 1754626 gene locus_tag LOCUS_16430 1755471 1754626 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_16430 1756133 1755558 gene locus_tag LOCUS_16440 gene yyaC 1756133 1755558 CDS product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243890.1 protein_id gnl|my_center|LOCUS_16440 1756296 1756523 gene locus_tag LOCUS_16450 1756296 1756523 CDS product DUF1128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366197.1 protein_id gnl|my_center|LOCUS_16450 1757116 1756661 gene locus_tag LOCUS_16460 1757116 1756661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1757333 1758463 gene locus_tag LOCUS_16470 gene nagC 1757333 1758463 CDS product DNA-binding transcriptional regulator NagC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187578.1 protein_id gnl|my_center|LOCUS_16470 1759714 1758518 gene locus_tag LOCUS_16480 1759714 1758518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_16480 1761031 1759739 gene locus_tag LOCUS_16490 1761031 1759739 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072442.1 protein_id gnl|my_center|LOCUS_16490 1762503 1761226 gene locus_tag LOCUS_16500 1762503 1761226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1764592 1763012 gene locus_tag LOCUS_16510 gene galT 1764592 1763012 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227402.1 protein_id gnl|my_center|LOCUS_16510 1765627 1764638 gene locus_tag LOCUS_16520 gene galE 1765627 1764638 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987061.1 protein_id gnl|my_center|LOCUS_16520 1766944 1765772 gene locus_tag LOCUS_16530 1766944 1765772 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016043.1 protein_id gnl|my_center|LOCUS_16530 1767190 1768047 gene locus_tag LOCUS_16540 1767190 1768047 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209550464.1 protein_id gnl|my_center|LOCUS_16540 1768696 1768887 gene locus_tag LOCUS_16550 1768696 1768887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1770132 1769971 gene locus_tag LOCUS_16560 1770132 1769971 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096961.1 protein_id gnl|my_center|LOCUS_16560 1770760 1770365 gene locus_tag LOCUS_16570 1770760 1770365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1772241 1771147 gene locus_tag LOCUS_16580 1772241 1771147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1772517 1772729 gene locus_tag LOCUS_16590 1772517 1772729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 1772835 1774088 gene locus_tag LOCUS_16600 1772835 1774088 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365630.1 protein_id gnl|my_center|LOCUS_16600 1776656 1775229 gene locus_tag LOCUS_16610 1776656 1775229 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799194.1 protein_id gnl|my_center|LOCUS_16610 1776811 1777257 gene locus_tag LOCUS_16620 1776811 1777257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 1777831 1777430 gene locus_tag LOCUS_16630 1777831 1777430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 1778330 1778148 gene locus_tag LOCUS_16640 1778330 1778148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1778609 1778421 gene locus_tag LOCUS_16650 1778609 1778421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1779662 1778868 gene locus_tag LOCUS_16660 1779662 1778868 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233421.1 protein_id gnl|my_center|LOCUS_16660 1780590 1779655 gene locus_tag LOCUS_16670 1780590 1779655 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245448.1 protein_id gnl|my_center|LOCUS_16670 1780974 1780723 gene locus_tag LOCUS_16680 1780974 1780723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 1781675 1781220 gene locus_tag LOCUS_16690 1781675 1781220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1782229 1781735 gene locus_tag LOCUS_16700 1782229 1781735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1784124 1782307 gene locus_tag LOCUS_16710 1784124 1782307 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528118.1 protein_id gnl|my_center|LOCUS_16710 1785057 1784137 gene locus_tag LOCUS_16720 1785057 1784137 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389035.1 protein_id gnl|my_center|LOCUS_16720 1785395 1785177 gene locus_tag LOCUS_16730 1785395 1785177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1785892 1785401 gene locus_tag LOCUS_16740 1785892 1785401 CDS product lasso peptide biosynthesis B2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390771.1 protein_id gnl|my_center|LOCUS_16740 1786202 1785894 gene locus_tag LOCUS_16750 1786202 1785894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1787521 1786343 gene locus_tag LOCUS_16760 1787521 1786343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 1788114 1787620 gene locus_tag LOCUS_16770 1788114 1787620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 1788643 1788143 gene locus_tag LOCUS_16780 1788643 1788143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 1789616 1788654 gene locus_tag LOCUS_16790 gene lytR 1789616 1788654 CDS product transcription antiterminator LytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227949.1 protein_id gnl|my_center|LOCUS_16790 1791045 1789669 gene locus_tag LOCUS_16800 1791045 1789669 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046233294.1 protein_id gnl|my_center|LOCUS_16800 1792166 1791135 gene locus_tag LOCUS_16810 1792166 1791135 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288210.1 protein_id gnl|my_center|LOCUS_16810 1793517 1792147 gene locus_tag LOCUS_16820 1793517 1792147 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861675.1 protein_id gnl|my_center|LOCUS_16820 1795035 1793569 gene locus_tag LOCUS_16830 1795035 1793569 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549892.1 protein_id gnl|my_center|LOCUS_16830 1796263 1795007 gene locus_tag LOCUS_16840 1796263 1795007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1797325 1796276 gene locus_tag LOCUS_16850 1797325 1796276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1798438 1797353 gene locus_tag LOCUS_16860 1798438 1797353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 1799551 1798457 gene locus_tag LOCUS_16870 1799551 1798457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 1800356 1799553 gene locus_tag LOCUS_16880 1800356 1799553 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288211.1 protein_id gnl|my_center|LOCUS_16880 1801416 1800421 gene locus_tag LOCUS_16890 gene gmd 1801416 1800421 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_16890 1802378 1801440 gene locus_tag LOCUS_16900 1802378 1801440 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_16900 1802839 1802405 gene locus_tag LOCUS_16910 1802839 1802405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1804026 1803136 gene locus_tag LOCUS_16920 gene bpsC 1804026 1803136 CDS product UTP--glucose-1-phosphate uridylyltransferase BpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757832.1 protein_id gnl|my_center|LOCUS_16920 1804771 1804292 gene locus_tag LOCUS_16930 1804771 1804292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 1805714 1804965 gene locus_tag LOCUS_16940 1805714 1804965 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393128.1 protein_id gnl|my_center|LOCUS_16940 1806503 1805748 gene locus_tag LOCUS_16950 1806503 1805748 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227815.1 protein_id gnl|my_center|LOCUS_16950 1806756 1807124 gene locus_tag LOCUS_16960 1806756 1807124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 1807416 1807222 gene locus_tag LOCUS_16970 1807416 1807222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 1812276 1807672 gene locus_tag LOCUS_16980 gene gltB 1812276 1807672 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_16980 1812721 1814112 gene locus_tag LOCUS_16990 1812721 1814112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1816764 1814743 gene locus_tag LOCUS_17000 1816764 1814743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1817968 1817378 gene locus_tag LOCUS_17010 1817968 1817378 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963381.1 protein_id gnl|my_center|LOCUS_17010 1818571 1818185 gene locus_tag LOCUS_17020 gene kapB 1818571 1818185 CDS product kinase-associated lipoprotein KapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228851.1 protein_id gnl|my_center|LOCUS_17020 1818768 1819883 gene locus_tag LOCUS_17030 1818768 1819883 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_17030 1820575 1819943 gene locus_tag LOCUS_17040 1820575 1819943 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397610.1 protein_id gnl|my_center|LOCUS_17040 1822061 1820778 gene locus_tag LOCUS_17050 1822061 1820778 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903185.1 protein_id gnl|my_center|LOCUS_17050 1822619 1822383 gene locus_tag LOCUS_17060 1822619 1822383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1823319 1822825 gene locus_tag LOCUS_17070 1823319 1822825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1825158 1823536 gene locus_tag LOCUS_17080 1825158 1823536 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633861.1 protein_id gnl|my_center|LOCUS_17080 1826152 1825229 gene locus_tag LOCUS_17090 1826152 1825229 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129615.1 protein_id gnl|my_center|LOCUS_17090 1826827 1827993 gene locus_tag LOCUS_17100 1826827 1827993 CDS product conserved virulence factor C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398677.1 protein_id gnl|my_center|LOCUS_17100 1831164 1828795 gene locus_tag LOCUS_17110 1831164 1828795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1831302 1832192 gene locus_tag LOCUS_17120 1831302 1832192 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256476.1 protein_id gnl|my_center|LOCUS_17120 1833004 1832231 gene locus_tag LOCUS_17130 1833004 1832231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1834287 1833211 gene locus_tag LOCUS_17140 1834287 1833211 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089629.1 protein_id gnl|my_center|LOCUS_17140 1834899 1834384 gene locus_tag LOCUS_17150 gene snaB 1834899 1834384 CDS product sulfur-containing aminoacid acetyltransferase SnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242734.1 protein_id gnl|my_center|LOCUS_17150 1836239 1834986 gene locus_tag LOCUS_17160 1836239 1834986 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939838.1 protein_id gnl|my_center|LOCUS_17160 1836968 1836327 gene locus_tag LOCUS_17170 1836968 1836327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1836917 1837099 gene locus_tag LOCUS_17180 1836917 1837099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1838193 1837192 gene locus_tag LOCUS_17190 gene bchC 1838193 1837192 CDS product chlorophyll synthesis pathway protein BchC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720428.1 protein_id gnl|my_center|LOCUS_17190 1839212 1838265 gene locus_tag LOCUS_17200 1839212 1838265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 1839483 1840295 gene locus_tag LOCUS_17210 1839483 1840295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1840546 1840863 gene locus_tag LOCUS_17220 1840546 1840863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 1841220 1842089 gene locus_tag LOCUS_17230 1841220 1842089 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 protein_id gnl|my_center|LOCUS_17230 1842533 1842324 gene locus_tag LOCUS_17240 1842533 1842324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810836.1 protein_id gnl|my_center|LOCUS_17240 1843518 1842601 gene locus_tag LOCUS_17250 1843518 1842601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1845824 1843656 gene locus_tag LOCUS_17260 1845824 1843656 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922617.1 protein_id gnl|my_center|LOCUS_17260 1845999 1848344 gene locus_tag LOCUS_17270 1845999 1848344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 1849106 1850035 gene locus_tag LOCUS_17280 1849106 1850035 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289657.1 protein_id gnl|my_center|LOCUS_17280 1850054 1850998 gene locus_tag LOCUS_17290 1850054 1850998 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_17290 1851177 1852355 gene locus_tag LOCUS_17300 1851177 1852355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17300 1852451 1852771 gene locus_tag LOCUS_17310 1852451 1852771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17310 1853524 1852835 gene locus_tag LOCUS_17320 1853524 1852835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1853523 1853774 gene locus_tag LOCUS_17330 1853523 1853774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1854746 1853892 gene locus_tag LOCUS_17340 1854746 1853892 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689435.1 protein_id gnl|my_center|LOCUS_17340 1855756 1854803 gene locus_tag LOCUS_17350 1855756 1854803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1858158 1855939 gene locus_tag LOCUS_17360 1858158 1855939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 1860566 1858533 gene locus_tag LOCUS_17370 1860566 1858533 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243269.1 protein_id gnl|my_center|LOCUS_17370 1861170 1860652 gene locus_tag LOCUS_17380 1861170 1860652 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002080246.1 protein_id gnl|my_center|LOCUS_17380 1861679 1861233 gene locus_tag LOCUS_17390 1861679 1861233 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025600.1 protein_id gnl|my_center|LOCUS_17390 1861848 1861621 gene locus_tag LOCUS_17400 1861848 1861621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 1862659 1861871 gene locus_tag LOCUS_17410 1862659 1861871 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966921.1 protein_id gnl|my_center|LOCUS_17410 1862864 1863838 gene locus_tag LOCUS_17420 1862864 1863838 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861264.1 protein_id gnl|my_center|LOCUS_17420 1864843 1863902 gene locus_tag LOCUS_17430 1864843 1863902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 1865318 1864920 gene locus_tag LOCUS_17440 1865318 1864920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 1865940 1865557 gene locus_tag LOCUS_17450 1865940 1865557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1866096 1871606 gene locus_tag LOCUS_17460 1866096 1871606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1871960 1871826 gene locus_tag LOCUS_17470 1871960 1871826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1873006 1872101 gene locus_tag LOCUS_17480 1873006 1872101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1874810 1873128 gene locus_tag LOCUS_17490 1874810 1873128 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 protein_id gnl|my_center|LOCUS_17490 1875822 1874923 gene locus_tag LOCUS_17500 1875822 1874923 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_17500 1876810 1875836 gene locus_tag LOCUS_17510 1876810 1875836 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_17510 1877002 1877512 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggcggccgggcgtgctggccgggcg 1878371 1878234 gene locus_tag LOCUS_17520 1878371 1878234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 1881378 1878871 gene locus_tag LOCUS_17530 1881378 1878871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1881742 1882509 gene locus_tag LOCUS_17540 1881742 1882509 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490911.1 protein_id gnl|my_center|LOCUS_17540 1883415 1882606 gene locus_tag LOCUS_17550 1883415 1882606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 1883981 1884175 gene locus_tag LOCUS_17560 1883981 1884175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1884395 1884625 gene locus_tag LOCUS_17570 1884395 1884625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1885707 1884547 gene locus_tag LOCUS_17580 1885707 1884547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 1887642 1885837 gene locus_tag LOCUS_17590 gene aguA 1887642 1885837 CDS product xylan alpha-(1->2)-glucuronosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082543.1 protein_id gnl|my_center|LOCUS_17590 1887835 1887644 gene locus_tag LOCUS_17600 1887835 1887644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1888253 1889170 gene locus_tag LOCUS_17610 1888253 1889170 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948837.1 protein_id gnl|my_center|LOCUS_17610 1889301 1890401 gene locus_tag LOCUS_17620 gene uxuA 1889301 1890401 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244855.1 protein_id gnl|my_center|LOCUS_17620 1890398 1891252 gene locus_tag LOCUS_17630 1890398 1891252 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245605.1 protein_id gnl|my_center|LOCUS_17630 1892970 1892176 gene locus_tag LOCUS_17640 1892970 1892176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1894520 1893042 gene locus_tag LOCUS_17650 1894520 1893042 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144042.1 protein_id gnl|my_center|LOCUS_17650 1895478 1894522 gene locus_tag LOCUS_17660 1895478 1894522 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028521.1 protein_id gnl|my_center|LOCUS_17660 1895661 1896551 gene locus_tag LOCUS_17670 1895661 1896551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 1896881 1898068 gene locus_tag LOCUS_17680 1896881 1898068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 1899155 1898238 gene locus_tag LOCUS_17690 1899155 1898238 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222982.1 protein_id gnl|my_center|LOCUS_17690 1901017 1899242 gene locus_tag LOCUS_17700 1901017 1899242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 1902659 1901706 gene locus_tag LOCUS_17710 1902659 1901706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1903101 1902919 gene locus_tag LOCUS_17720 1903101 1902919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17720 1903818 1903162 gene locus_tag LOCUS_17730 1903818 1903162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1904265 1906028 gene locus_tag LOCUS_17740 1904265 1906028 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493192.1 protein_id gnl|my_center|LOCUS_17740 1906206 1908230 gene locus_tag LOCUS_17750 1906206 1908230 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116616.1 protein_id gnl|my_center|LOCUS_17750 1909911 1908529 gene locus_tag LOCUS_17760 1909911 1908529 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_17760 1912048 1909904 gene locus_tag LOCUS_17770 1912048 1909904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 1913159 1912077 gene locus_tag LOCUS_17780 1913159 1912077 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_17780 1914221 1913235 gene locus_tag LOCUS_17790 1914221 1913235 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732378.1 protein_id gnl|my_center|LOCUS_17790 1915881 1914235 gene locus_tag LOCUS_17800 1915881 1914235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 1917632 1915878 gene locus_tag LOCUS_17810 1917632 1915878 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_17810 1918606 1917722 gene locus_tag LOCUS_17820 1918606 1917722 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_17820 1919518 1918622 gene locus_tag LOCUS_17830 gene rmgP 1919518 1918622 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_17830 1921379 1919622 gene locus_tag LOCUS_17840 1921379 1919622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 1922422 1921616 gene locus_tag LOCUS_17850 1922422 1921616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 1923534 1922440 gene locus_tag LOCUS_17860 1923534 1922440 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705009.1 protein_id gnl|my_center|LOCUS_17860 1924424 1923531 gene locus_tag LOCUS_17870 1924424 1923531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 1926290 1924644 gene locus_tag LOCUS_17880 1926290 1924644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 1927598 1926468 gene locus_tag LOCUS_17890 1927598 1926468 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066535.1 protein_id gnl|my_center|LOCUS_17890 1927854 1929080 gene locus_tag LOCUS_17900 1927854 1929080 CDS product Bcr/CflA family efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234132.1 protein_id gnl|my_center|LOCUS_17900 1929333 1929184 gene locus_tag LOCUS_17910 1929333 1929184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1929982 1929809 gene locus_tag LOCUS_17920 1929982 1929809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 1931359 1930169 gene locus_tag LOCUS_17930 1931359 1930169 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114757.1 protein_id gnl|my_center|LOCUS_17930 1931938 1931360 gene locus_tag LOCUS_17940 1931938 1931360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 1933197 1932199 gene locus_tag LOCUS_17950 1933197 1932199 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723125.1 protein_id gnl|my_center|LOCUS_17950 1934458 1933268 gene locus_tag LOCUS_17960 1934458 1933268 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095906.1 protein_id gnl|my_center|LOCUS_17960 1934592 1935143 gene locus_tag LOCUS_17970 1934592 1935143 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071745902.1 protein_id gnl|my_center|LOCUS_17970 1936569 1935292 gene locus_tag LOCUS_17980 1936569 1935292 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_17980 1937854 1936805 gene locus_tag LOCUS_17990 1937854 1936805 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_17990 1939670 1938042 gene locus_tag LOCUS_18000 1939670 1938042 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 protein_id gnl|my_center|LOCUS_18000 1940592 1939702 gene locus_tag LOCUS_18010 1940592 1939702 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_18010 1941403 1940597 gene locus_tag LOCUS_18020 1941403 1940597 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_18020 1943366 1941870 gene locus_tag LOCUS_18030 1943366 1941870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 1945102 1943363 gene locus_tag LOCUS_18040 1945102 1943363 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_18040 1945932 1945114 gene locus_tag LOCUS_18050 1945932 1945114 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398630.1 protein_id gnl|my_center|LOCUS_18050 1946870 1945932 gene locus_tag LOCUS_18060 1946870 1945932 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968010.1 protein_id gnl|my_center|LOCUS_18060 1948361 1946943 gene locus_tag LOCUS_18070 1948361 1946943 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398680.1 protein_id gnl|my_center|LOCUS_18070 1949700 1948558 gene locus_tag LOCUS_18080 1949700 1948558 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031081.1 protein_id gnl|my_center|LOCUS_18080 1950150 1950737 gene locus_tag LOCUS_18090 1950150 1950737 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124366.1 protein_id gnl|my_center|LOCUS_18090 1950864 1951742 gene locus_tag LOCUS_18100 1950864 1951742 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950743.1 protein_id gnl|my_center|LOCUS_18100 1952248 1952051 gene locus_tag LOCUS_18110 1952248 1952051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1952951 1952517 gene locus_tag LOCUS_18120 1952951 1952517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 1953728 1953174 gene locus_tag LOCUS_18130 1953728 1953174 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399321.1 protein_id gnl|my_center|LOCUS_18130 1953831 1953676 gene locus_tag LOCUS_18140 1953831 1953676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 1954171 1953836 gene locus_tag LOCUS_18150 1954171 1953836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 1956100 1954814 gene locus_tag LOCUS_18160 1956100 1954814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1956595 1956260 gene locus_tag LOCUS_18170 1956595 1956260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1957798 1957496 gene locus_tag LOCUS_18180 1957798 1957496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1959282 1958641 gene locus_tag LOCUS_18190 gene eda 1959282 1958641 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775173.1 protein_id gnl|my_center|LOCUS_18190 1960773 1959382 gene locus_tag LOCUS_18200 1960773 1959382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1961636 1960770 gene locus_tag LOCUS_18210 1961636 1960770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 1961805 1962155 gene locus_tag LOCUS_18220 1961805 1962155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 1962497 1962264 gene locus_tag LOCUS_18230 1962497 1962264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1962974 1962579 gene locus_tag LOCUS_18240 gene acpS 1962974 1962579 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583416.1 protein_id gnl|my_center|LOCUS_18240 1964112 1962994 gene locus_tag LOCUS_18250 1964112 1962994 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068619877.1 protein_id gnl|my_center|LOCUS_18250 1964921 1964247 gene locus_tag LOCUS_18260 1964921 1964247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1966031 1965222 gene locus_tag LOCUS_18270 gene nadE 1966031 1965222 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174904.1 protein_id gnl|my_center|LOCUS_18270 1966477 1966046 gene locus_tag LOCUS_18280 1966477 1966046 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063706.1 protein_id gnl|my_center|LOCUS_18280 1967079 1966687 gene locus_tag LOCUS_18290 1967079 1966687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 1967231 1967097 gene locus_tag LOCUS_18300 1967231 1967097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 1968884 1967325 gene locus_tag LOCUS_18310 1968884 1967325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 1969267 1970532 gene locus_tag LOCUS_18320 1969267 1970532 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989840.1 protein_id gnl|my_center|LOCUS_18320 1971004 1970603 gene locus_tag LOCUS_18330 1971004 1970603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 1971284 1972144 gene locus_tag LOCUS_18340 1971284 1972144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1973897 1972398 gene locus_tag LOCUS_18350 gene xylB 1973897 1972398 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245233.1 protein_id gnl|my_center|LOCUS_18350 1975225 1973912 gene locus_tag LOCUS_18360 gene xylA 1975225 1973912 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245235.1 protein_id gnl|my_center|LOCUS_18360 1975479 1976642 gene locus_tag LOCUS_18370 1975479 1976642 CDS product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244935.1 protein_id gnl|my_center|LOCUS_18370 1977435 1976692 gene locus_tag LOCUS_18380 1977435 1976692 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768018.1 protein_id gnl|my_center|LOCUS_18380 1977768 1977565 gene locus_tag LOCUS_18390 1977768 1977565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1977662 1978621 gene locus_tag LOCUS_18400 gene mraY 1977662 1978621 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_18400 1980623 1978683 gene locus_tag LOCUS_18410 1980623 1978683 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094944.1 protein_id gnl|my_center|LOCUS_18410 1980754 1981608 gene locus_tag LOCUS_18420 1980754 1981608 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966961.1 protein_id gnl|my_center|LOCUS_18420 1982118 1981714 gene locus_tag LOCUS_18430 1982118 1981714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 1983195 1982344 gene locus_tag LOCUS_18440 1983195 1982344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1984670 1983678 gene locus_tag LOCUS_18450 1984670 1983678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1984864 1985439 gene locus_tag LOCUS_18460 1984864 1985439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1985447 1985950 gene locus_tag LOCUS_18470 1985447 1985950 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869257.1 protein_id gnl|my_center|LOCUS_18470 1986649 1986086 gene locus_tag LOCUS_18480 gene hxlB 1986649 1986086 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246343.1 protein_id gnl|my_center|LOCUS_18480 1987286 1986654 gene locus_tag LOCUS_18490 gene hxlA 1987286 1986654 CDS product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246452.1 protein_id gnl|my_center|LOCUS_18490 1987894 1987496 gene locus_tag LOCUS_18500 gene hxlR 1987894 1987496 CDS product transcriptional activator HxlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246265.1 protein_id gnl|my_center|LOCUS_18500 1989279 1987954 gene locus_tag LOCUS_18510 1989279 1987954 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727004.1 protein_id gnl|my_center|LOCUS_18510 1989550 1990467 gene locus_tag LOCUS_18520 1989550 1990467 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256476.1 protein_id gnl|my_center|LOCUS_18520 1990605 1990859 gene locus_tag LOCUS_18530 1990605 1990859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1991463 1990939 gene locus_tag LOCUS_18540 1991463 1990939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 1991938 1991648 gene locus_tag LOCUS_18550 1991938 1991648 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953396.1 protein_id gnl|my_center|LOCUS_18550 1992463 1992059 gene locus_tag LOCUS_18560 1992463 1992059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 1993045 1994628 gene locus_tag LOCUS_18570 1993045 1994628 CDS product putative thiazole-containing bacteriocin maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067621.1 protein_id gnl|my_center|LOCUS_18570 1994625 1996556 gene locus_tag LOCUS_18580 1994625 1996556 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075677560.1 protein_id gnl|my_center|LOCUS_18580 1998007 1996859 gene locus_tag LOCUS_18590 1998007 1996859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1999162 1998017 gene locus_tag LOCUS_18600 1999162 1998017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 1999880 1999152 gene locus_tag LOCUS_18610 1999880 1999152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 2000102 1999911 gene locus_tag LOCUS_18620 2000102 1999911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 2000500 2000099 gene locus_tag LOCUS_18630 2000500 2000099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 2000606 2000457 gene locus_tag LOCUS_18640 2000606 2000457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 2000794 2005944 gene locus_tag LOCUS_18650 2000794 2005944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 2008623 2006020 gene locus_tag LOCUS_18660 2008623 2006020 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_18660 2008787 2009683 gene locus_tag LOCUS_18670 2008787 2009683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2010507 2009728 gene locus_tag LOCUS_18680 2010507 2009728 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763940.1 protein_id gnl|my_center|LOCUS_18680 2010760 2013396 gene locus_tag LOCUS_18690 2010760 2013396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 2013785 2013594 gene locus_tag LOCUS_18700 2013785 2013594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 2014509 2014069 gene locus_tag LOCUS_18710 2014509 2014069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 2014639 2015226 gene locus_tag LOCUS_18720 2014639 2015226 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101673.1 protein_id gnl|my_center|LOCUS_18720 2015404 2016210 gene locus_tag LOCUS_18730 2015404 2016210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 2017030 2016269 gene locus_tag LOCUS_18740 2017030 2016269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2018929 2017559 gene locus_tag LOCUS_18750 2018929 2017559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2020479 2018926 gene locus_tag LOCUS_18760 2020479 2018926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2021045 2020476 gene locus_tag LOCUS_18770 2021045 2020476 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438330.1 protein_id gnl|my_center|LOCUS_18770 2022435 2021434 gene locus_tag LOCUS_18780 2022435 2021434 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112660.1 protein_id gnl|my_center|LOCUS_18780 2023523 2022723 gene locus_tag LOCUS_18790 2023523 2022723 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729455.1 protein_id gnl|my_center|LOCUS_18790 2024992 2023637 gene locus_tag LOCUS_18800 2024992 2023637 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727463.1 protein_id gnl|my_center|LOCUS_18800 2025912 2025046 gene locus_tag LOCUS_18810 2025912 2025046 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748363.1 protein_id gnl|my_center|LOCUS_18810 2026783 2025905 gene locus_tag LOCUS_18820 2026783 2025905 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727461.1 protein_id gnl|my_center|LOCUS_18820 2027856 2026798 gene locus_tag LOCUS_18830 2027856 2026798 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727460.1 protein_id gnl|my_center|LOCUS_18830 2028607 2028152 gene locus_tag LOCUS_18840 2028607 2028152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2029402 2028638 gene locus_tag LOCUS_18850 2029402 2028638 CDS product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280291.1 protein_id gnl|my_center|LOCUS_18850 2029550 2030065 gene locus_tag LOCUS_18860 2029550 2030065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 2030331 2030146 gene locus_tag LOCUS_18870 2030331 2030146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 2031098 2030694 gene locus_tag LOCUS_18880 2031098 2030694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 2032949 2031099 gene locus_tag LOCUS_18890 2032949 2031099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 2034999 2032933 gene locus_tag LOCUS_18900 2034999 2032933 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766176.1 protein_id gnl|my_center|LOCUS_18900 2036366 2035005 gene locus_tag LOCUS_18910 2036366 2035005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 2038285 2036798 gene locus_tag LOCUS_18920 2038285 2036798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2039085 2038306 gene locus_tag LOCUS_18930 2039085 2038306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 2040549 2039326 gene locus_tag LOCUS_18940 2040549 2039326 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543417.1 protein_id gnl|my_center|LOCUS_18940 2040734 2041777 gene locus_tag LOCUS_18950 2040734 2041777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2045053 2041925 gene locus_tag LOCUS_18960 2045053 2041925 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475723.1 protein_id gnl|my_center|LOCUS_18960 2046417 2045245 gene locus_tag LOCUS_18970 2046417 2045245 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963643.1 protein_id gnl|my_center|LOCUS_18970 2047114 2046383 gene locus_tag LOCUS_18980 2047114 2046383 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722723.1 protein_id gnl|my_center|LOCUS_18980 2048655 2047114 gene locus_tag LOCUS_18990 2048655 2047114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 2049404 2048652 gene locus_tag LOCUS_19000 2049404 2048652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 2050913 2049777 gene locus_tag LOCUS_19010 2050913 2049777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 2051437 2050910 gene locus_tag LOCUS_19020 2051437 2050910 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864729.1 protein_id gnl|my_center|LOCUS_19020 2052350 2051577 gene locus_tag LOCUS_19030 2052350 2051577 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776832.1 protein_id gnl|my_center|LOCUS_19030 2052487 2053365 gene locus_tag LOCUS_19040 2052487 2053365 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243004.1 protein_id gnl|my_center|LOCUS_19040 2055314 2053386 gene locus_tag LOCUS_19050 2055314 2053386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 2056304 2055549 gene locus_tag LOCUS_19060 2056304 2055549 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815859.1 protein_id gnl|my_center|LOCUS_19060 2057200 2056370 gene locus_tag LOCUS_19070 2057200 2056370 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_19070 2058088 2057204 gene locus_tag LOCUS_19080 2058088 2057204 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19080 2059534 2058185 gene locus_tag LOCUS_19090 2059534 2058185 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_19090 2060186 2059794 gene locus_tag LOCUS_19100 2060186 2059794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 2060842 2060183 gene locus_tag LOCUS_19110 2060842 2060183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2062041 2060842 gene locus_tag LOCUS_19120 2062041 2060842 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287856.1 protein_id gnl|my_center|LOCUS_19120 2062784 2062038 gene locus_tag LOCUS_19130 2062784 2062038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2063025 2062810 gene locus_tag LOCUS_19140 2063025 2062810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 2064656 2063316 gene locus_tag LOCUS_19150 2064656 2063316 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_19150 2066506 2064653 gene locus_tag LOCUS_19160 2066506 2064653 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_19160 2067333 2066731 gene locus_tag LOCUS_19170 gene sigW 2067333 2066731 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_19170 2068673 2067447 gene locus_tag LOCUS_19180 gene rhaI 2068673 2067447 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582814.1 protein_id gnl|my_center|LOCUS_19180 2069382 2068708 gene locus_tag LOCUS_19190 gene rpe 2069382 2068708 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_19190 2070442 2069405 gene locus_tag LOCUS_19200 2070442 2069405 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_19200 2072205 2071147 gene locus_tag LOCUS_19210 2072205 2071147 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004058044.1 protein_id gnl|my_center|LOCUS_19210 2073120 2072218 gene locus_tag LOCUS_19220 2073120 2072218 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976282.1 protein_id gnl|my_center|LOCUS_19220 2073319 2073786 gene locus_tag LOCUS_19230 2073319 2073786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2075519 2074335 gene locus_tag LOCUS_19240 2075519 2074335 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730052.1 protein_id gnl|my_center|LOCUS_19240 2075908 2075681 gene locus_tag LOCUS_19250 2075908 2075681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 2076097 2076705 gene locus_tag LOCUS_19260 gene ytaF 2076097 2076705 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100738.1 protein_id gnl|my_center|LOCUS_19260 2077208 2076786 gene locus_tag LOCUS_19270 2077208 2076786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2077466 2078434 gene locus_tag LOCUS_19280 2077466 2078434 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732615.1 protein_id gnl|my_center|LOCUS_19280 2078585 2079838 gene locus_tag LOCUS_19290 2078585 2079838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2079904 2081082 gene locus_tag LOCUS_19300 2079904 2081082 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706159.1 protein_id gnl|my_center|LOCUS_19300 2081294 2084044 gene locus_tag LOCUS_19310 2081294 2084044 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369316.1 protein_id gnl|my_center|LOCUS_19310 2085712 2084180 gene locus_tag LOCUS_19320 2085712 2084180 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_19320 2086535 2085888 gene locus_tag LOCUS_19330 2086535 2085888 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734004.1 protein_id gnl|my_center|LOCUS_19330 2087627 2086599 gene locus_tag LOCUS_19340 2087627 2086599 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082555.1 protein_id gnl|my_center|LOCUS_19340 2088355 2087624 gene locus_tag LOCUS_19350 2088355 2087624 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812699.1 protein_id gnl|my_center|LOCUS_19350 2090018 2088642 gene locus_tag LOCUS_19360 2090018 2088642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 2090556 2090011 gene locus_tag LOCUS_19370 gene sigM 2090556 2090011 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087658.1 protein_id gnl|my_center|LOCUS_19370 2091552 2090680 gene locus_tag LOCUS_19380 2091552 2090680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 2092204 2091611 gene locus_tag LOCUS_19390 2092204 2091611 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258084.1 protein_id gnl|my_center|LOCUS_19390 2092351 2093625 gene locus_tag LOCUS_19400 2092351 2093625 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_19400 2093693 2094274 gene locus_tag LOCUS_19410 gene thpR 2093693 2094274 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418986.1 protein_id gnl|my_center|LOCUS_19410 2095270 2094341 gene locus_tag LOCUS_19420 gene ppaC 2095270 2094341 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416849.1 protein_id gnl|my_center|LOCUS_19420 2096357 2095443 gene locus_tag LOCUS_19430 2096357 2095443 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027649.1 protein_id gnl|my_center|LOCUS_19430 2096590 2097117 gene locus_tag LOCUS_19440 2096590 2097117 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231441.1 protein_id gnl|my_center|LOCUS_19440 2097263 2097565 gene locus_tag LOCUS_19450 2097263 2097565 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309828.1 protein_id gnl|my_center|LOCUS_19450 2097670 2098410 gene locus_tag LOCUS_19460 2097670 2098410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 2098592 2099392 gene locus_tag LOCUS_19470 2098592 2099392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 2099410 2100399 gene locus_tag LOCUS_19480 2099410 2100399 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897285.1 protein_id gnl|my_center|LOCUS_19480 2100472 2100696 gene locus_tag LOCUS_19490 2100472 2100696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2100914 2102506 gene locus_tag LOCUS_19500 2100914 2102506 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229620.1 protein_id gnl|my_center|LOCUS_19500 2102513 2103193 gene locus_tag LOCUS_19510 2102513 2103193 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062063.1 protein_id gnl|my_center|LOCUS_19510 2104872 2103502 gene locus_tag LOCUS_19520 2104872 2103502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2105839 2105006 gene locus_tag LOCUS_19530 2105839 2105006 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_19530 2106737 2105841 gene locus_tag LOCUS_19540 2106737 2105841 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 protein_id gnl|my_center|LOCUS_19540 2106899 2108755 gene locus_tag LOCUS_19550 2106899 2108755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 2108752 2110377 gene locus_tag LOCUS_19560 2108752 2110377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 2110513 2111895 gene locus_tag LOCUS_19570 2110513 2111895 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_19570 2112049 2111885 gene locus_tag LOCUS_19580 2112049 2111885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2112031 2113470 gene locus_tag LOCUS_19590 2112031 2113470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 2115094 2113772 gene locus_tag LOCUS_19600 2115094 2113772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 2115690 2115472 gene locus_tag LOCUS_19610 2115690 2115472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 2117462 2115792 gene locus_tag LOCUS_19620 2117462 2115792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 2119224 2117500 gene locus_tag LOCUS_19630 gene yesM 2119224 2117500 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_19630 2121062 2119221 gene locus_tag LOCUS_19640 2121062 2119221 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_19640 2121264 2123147 gene locus_tag LOCUS_19650 2121264 2123147 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_19650 2123738 2123358 gene locus_tag LOCUS_19660 2123738 2123358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2123999 2124157 gene locus_tag LOCUS_19670 2123999 2124157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2124193 2124393 gene locus_tag LOCUS_19680 2124193 2124393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2126875 2124743 gene locus_tag LOCUS_19690 2126875 2124743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 2128267 2127002 gene locus_tag LOCUS_19700 2128267 2127002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967480.1 protein_id gnl|my_center|LOCUS_19700 2129258 2128302 gene locus_tag LOCUS_19710 2129258 2128302 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_19710 2130206 2129280 gene locus_tag LOCUS_19720 2130206 2129280 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_19720 2132815 2130203 gene locus_tag LOCUS_19730 2132815 2130203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 2133481 2132861 gene locus_tag LOCUS_19740 2133481 2132861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19740 2134955 2133474 gene locus_tag LOCUS_19750 2134955 2133474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19750 2135990 2135052 gene locus_tag LOCUS_19760 2135990 2135052 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_19760 2136890 2135994 gene locus_tag LOCUS_19770 2136890 2135994 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_19770 2139836 2136903 gene locus_tag LOCUS_19780 2139836 2136903 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_19780 2141399 2139975 gene locus_tag LOCUS_19790 2141399 2139975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2144040 2141971 gene locus_tag LOCUS_19800 2144040 2141971 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903359.1 protein_id gnl|my_center|LOCUS_19800 2146894 2144837 gene locus_tag LOCUS_19810 2146894 2144837 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118144.1 protein_id gnl|my_center|LOCUS_19810 2147138 2147935 gene locus_tag LOCUS_19820 2147138 2147935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 2149320 2148049 gene locus_tag LOCUS_19830 2149320 2148049 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391264.1 protein_id gnl|my_center|LOCUS_19830 2149660 2151165 gene locus_tag LOCUS_19840 gene gerKA 2149660 2151165 CDS product spore germination protein GerKA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246515.1 protein_id gnl|my_center|LOCUS_19840 2151190 2152368 gene locus_tag LOCUS_19850 2151190 2152368 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461855.1 protein_id gnl|my_center|LOCUS_19850 2152390 2153478 gene locus_tag LOCUS_19860 gene gerKB 2152390 2153478 CDS product spore germination protein GerKB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234509.1 protein_id gnl|my_center|LOCUS_19860 2154387 2153914 gene locus_tag LOCUS_19870 2154387 2153914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2155540 2154479 gene locus_tag LOCUS_19880 2155540 2154479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 2156250 2155537 gene locus_tag LOCUS_19890 2156250 2155537 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651982.1 protein_id gnl|my_center|LOCUS_19890 2156654 2156340 gene locus_tag LOCUS_19900 2156654 2156340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2156989 2156735 gene locus_tag LOCUS_19910 2156989 2156735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2157304 2158638 gene locus_tag LOCUS_19920 2157304 2158638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2158641 2159750 gene locus_tag LOCUS_19930 2158641 2159750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2159741 2160835 gene locus_tag LOCUS_19940 2159741 2160835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2160882 2161448 gene locus_tag LOCUS_19950 2160882 2161448 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165203633.1 protein_id gnl|my_center|LOCUS_19950 2162828 2161896 gene locus_tag LOCUS_19960 2162828 2161896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 2163256 2163008 gene locus_tag LOCUS_19970 2163256 2163008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2163490 2163341 gene locus_tag LOCUS_19980 2163490 2163341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2165212 2163926 gene locus_tag LOCUS_19990 gene murC 2165212 2163926 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219470.1 protein_id gnl|my_center|LOCUS_19990 2166550 2166089 gene locus_tag LOCUS_20000 2166550 2166089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 2166829 2166620 gene locus_tag LOCUS_20010 2166829 2166620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 2166853 2167542 gene locus_tag LOCUS_20020 2166853 2167542 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401467.1 protein_id gnl|my_center|LOCUS_20020 2167763 2167548 gene locus_tag LOCUS_20030 2167763 2167548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 2168878 2167784 gene locus_tag LOCUS_20040 2168878 2167784 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027022.1 protein_id gnl|my_center|LOCUS_20040 2170364 2169051 gene locus_tag LOCUS_20050 2170364 2169051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 2171270 2170398 gene locus_tag LOCUS_20060 2171270 2170398 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777129.1 protein_id gnl|my_center|LOCUS_20060 2174451 2171305 gene locus_tag LOCUS_20070 2174451 2171305 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204437144.1 protein_id gnl|my_center|LOCUS_20070 2176394 2174742 gene locus_tag LOCUS_20080 2176394 2174742 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_20080 2177518 2176619 gene locus_tag LOCUS_20090 2177518 2176619 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_20090 2178438 2177533 gene locus_tag LOCUS_20100 2178438 2177533 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_20100 2181071 2178846 gene locus_tag LOCUS_20110 2181071 2178846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2182631 2181195 gene locus_tag LOCUS_20120 2182631 2181195 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_20120 2184390 2182624 gene locus_tag LOCUS_20130 2184390 2182624 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196552.1 protein_id gnl|my_center|LOCUS_20130 2185460 2184771 gene locus_tag LOCUS_20140 2185460 2184771 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522961.1 protein_id gnl|my_center|LOCUS_20140 2186502 2185732 gene locus_tag LOCUS_20150 2186502 2185732 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921962.1 protein_id gnl|my_center|LOCUS_20150 2187563 2186514 gene locus_tag LOCUS_20160 2187563 2186514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 2189250 2187649 gene locus_tag LOCUS_20170 2189250 2187649 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800407.1 protein_id gnl|my_center|LOCUS_20170 2190218 2189319 gene locus_tag LOCUS_20180 2190218 2189319 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_20180 2191178 2190234 gene locus_tag LOCUS_20190 2191178 2190234 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_20190 2192614 2191622 gene locus_tag LOCUS_20200 2192614 2191622 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931171.1 protein_id gnl|my_center|LOCUS_20200 2193785 2193024 gene locus_tag LOCUS_20210 2193785 2193024 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180933263.1 protein_id gnl|my_center|LOCUS_20210 2194820 2193825 gene locus_tag LOCUS_20220 2194820 2193825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2195293 2194826 gene locus_tag LOCUS_20230 2195293 2194826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2196135 2195290 gene locus_tag LOCUS_20240 2196135 2195290 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008272.1 protein_id gnl|my_center|LOCUS_20240 2197379 2196132 gene locus_tag LOCUS_20250 2197379 2196132 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385612.1 protein_id gnl|my_center|LOCUS_20250 2198589 2197453 gene locus_tag LOCUS_20260 2198589 2197453 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_20260 2199447 2198623 gene locus_tag LOCUS_20270 2199447 2198623 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538207.1 protein_id gnl|my_center|LOCUS_20270 2200591 2199551 gene locus_tag LOCUS_20280 2200591 2199551 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_20280 2203132 2201840 gene locus_tag LOCUS_20290 gene ltrA 2203132 2201840 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561483.1 protein_id gnl|my_center|LOCUS_20290 2205444 2203786 gene locus_tag LOCUS_20300 2205444 2203786 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_20300 2205957 2207285 gene locus_tag LOCUS_20310 2205957 2207285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2207291 2208361 gene locus_tag LOCUS_20320 2207291 2208361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 2208354 2209436 gene locus_tag LOCUS_20330 2208354 2209436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2210066 2209440 gene locus_tag LOCUS_20340 gene kynB 2210066 2209440 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858074.1 protein_id gnl|my_center|LOCUS_20340 2211043 2210123 gene locus_tag LOCUS_20350 gene kynA 2211043 2210123 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661957.1 protein_id gnl|my_center|LOCUS_20350 2211104 2212075 gene locus_tag LOCUS_20360 2211104 2212075 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732378.1 protein_id gnl|my_center|LOCUS_20360 2213285 2212155 gene locus_tag LOCUS_20370 2213285 2212155 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098730.1 protein_id gnl|my_center|LOCUS_20370 2213409 2214275 gene locus_tag LOCUS_20380 2213409 2214275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 2214972 2214319 gene locus_tag LOCUS_20390 2214972 2214319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 2215713 2214988 gene locus_tag LOCUS_20400 2215713 2214988 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583993.1 protein_id gnl|my_center|LOCUS_20400 2216608 2215799 gene locus_tag LOCUS_20410 2216608 2215799 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723335.1 protein_id gnl|my_center|LOCUS_20410 2219805 2216908 gene locus_tag LOCUS_20420 2219805 2216908 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_20420 2220751 2219837 gene locus_tag LOCUS_20430 2220751 2219837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 2221923 2220784 gene locus_tag LOCUS_20440 2221923 2220784 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084677518.1 protein_id gnl|my_center|LOCUS_20440 2222699 2221938 gene locus_tag LOCUS_20450 gene rhaR 2222699 2221938 CDS product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 protein_id gnl|my_center|LOCUS_20450 2223198 2222737 gene locus_tag LOCUS_20460 2223198 2222737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 2223580 2223173 gene locus_tag LOCUS_20470 2223580 2223173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 2224596 2223577 gene locus_tag LOCUS_20480 2224596 2223577 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_20480 2225636 2224623 gene locus_tag LOCUS_20490 2225636 2224623 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584052.1 protein_id gnl|my_center|LOCUS_20490 2226809 2225649 gene locus_tag LOCUS_20500 2226809 2225649 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082547.1 protein_id gnl|my_center|LOCUS_20500 2227804 2226806 gene locus_tag LOCUS_20510 2227804 2226806 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584054.1 protein_id gnl|my_center|LOCUS_20510 2229953 2227923 gene locus_tag LOCUS_20520 2229953 2227923 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584050.1 protein_id gnl|my_center|LOCUS_20520 2231070 2230201 gene locus_tag LOCUS_20530 2231070 2230201 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296705.1 protein_id gnl|my_center|LOCUS_20530 2232290 2231400 gene locus_tag LOCUS_20540 2232290 2231400 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_20540 2235588 2232298 gene locus_tag LOCUS_20550 2235588 2232298 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 protein_id gnl|my_center|LOCUS_20550 2237945 2235606 gene locus_tag LOCUS_20560 2237945 2235606 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_20560 2238966 2237974 gene locus_tag LOCUS_20570 2238966 2237974 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909515.1 protein_id gnl|my_center|LOCUS_20570 2239859 2238963 gene locus_tag LOCUS_20580 2239859 2238963 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_20580 2242012 2239856 gene locus_tag LOCUS_20590 2242012 2239856 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583938.1 protein_id gnl|my_center|LOCUS_20590 2244095 2242080 gene locus_tag LOCUS_20600 2244095 2242080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259691.1 protein_id gnl|my_center|LOCUS_20600 2244992 2244123 gene locus_tag LOCUS_20610 2244992 2244123 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259690.1 protein_id gnl|my_center|LOCUS_20610 2245971 2244997 gene locus_tag LOCUS_20620 2245971 2244997 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259689.1 protein_id gnl|my_center|LOCUS_20620 2248910 2245968 gene locus_tag LOCUS_20630 2248910 2245968 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_20630 2250040 2248907 gene locus_tag LOCUS_20640 gene ugpC 2250040 2248907 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_20640 2251653 2250211 gene locus_tag LOCUS_20650 2251653 2250211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 2253104 2252919 gene locus_tag LOCUS_20660 2253104 2252919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 2254670 2253189 gene locus_tag LOCUS_20670 gene araA 2254670 2253189 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229499.1 protein_id gnl|my_center|LOCUS_20670 2256300 2254702 gene locus_tag LOCUS_20680 2256300 2254702 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964653.1 protein_id gnl|my_center|LOCUS_20680 2257074 2256385 gene locus_tag LOCUS_20690 gene araD 2257074 2256385 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964650.1 protein_id gnl|my_center|LOCUS_20690 2258259 2257162 gene locus_tag LOCUS_20700 gene araR 2258259 2257162 CDS product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 protein_id gnl|my_center|LOCUS_20700 2259821 2258484 gene locus_tag LOCUS_20710 2259821 2258484 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244912.1 protein_id gnl|my_center|LOCUS_20710 2260716 2259814 gene locus_tag LOCUS_20720 2260716 2259814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233262.1 protein_id gnl|my_center|LOCUS_20720 2261628 2260747 gene locus_tag LOCUS_20730 2261628 2260747 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392678.1 protein_id gnl|my_center|LOCUS_20730 2262068 2261625 gene locus_tag LOCUS_20740 2262068 2261625 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392679.1 protein_id gnl|my_center|LOCUS_20740 2262840 2262109 gene locus_tag LOCUS_20750 2262840 2262109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 2263033 2263986 gene locus_tag LOCUS_20760 gene argC 2263033 2263986 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523123.1 protein_id gnl|my_center|LOCUS_20760 2264361 2265707 gene locus_tag LOCUS_20770 2264361 2265707 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065157.1 protein_id gnl|my_center|LOCUS_20770 2266794 2265916 gene locus_tag LOCUS_20780 2266794 2265916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807011.1 protein_id gnl|my_center|LOCUS_20780 2268659 2266791 gene locus_tag LOCUS_20790 2268659 2266791 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064744.1 protein_id gnl|my_center|LOCUS_20790 2270209 2269397 gene locus_tag LOCUS_20800 2270209 2269397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 2270886 2270368 gene locus_tag LOCUS_20810 2270886 2270368 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_20810 2271403 2270891 gene locus_tag LOCUS_20820 2271403 2270891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 2271546 2271403 gene locus_tag LOCUS_20830 2271546 2271403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2271632 2273017 gene locus_tag LOCUS_20840 2271632 2273017 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902283.1 protein_id gnl|my_center|LOCUS_20840 2273818 2273162 gene locus_tag LOCUS_20850 2273818 2273162 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971974.1 protein_id gnl|my_center|LOCUS_20850 2275063 2274101 gene locus_tag LOCUS_20860 gene uxuA 2275063 2274101 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082566.1 protein_id gnl|my_center|LOCUS_20860 2276498 2275155 gene locus_tag LOCUS_20870 2276498 2275155 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393244.1 protein_id gnl|my_center|LOCUS_20870 2277364 2276534 gene locus_tag LOCUS_20880 2277364 2276534 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532486.1 protein_id gnl|my_center|LOCUS_20880 2278320 2277361 gene locus_tag LOCUS_20890 2278320 2277361 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972768.1 protein_id gnl|my_center|LOCUS_20890 2278637 2279542 gene locus_tag LOCUS_20900 2278637 2279542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2280795 2279623 gene locus_tag LOCUS_20910 2280795 2279623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 2281564 2280917 gene locus_tag LOCUS_20920 2281564 2280917 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971974.1 protein_id gnl|my_center|LOCUS_20920 2282628 2281936 gene locus_tag LOCUS_20930 2282628 2281936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 2283331 2282675 gene locus_tag LOCUS_20940 2283331 2282675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2284282 2283380 gene locus_tag LOCUS_20950 2284282 2283380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2284833 2284309 gene locus_tag LOCUS_20960 2284833 2284309 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709765.1 protein_id gnl|my_center|LOCUS_20960 2285402 2284830 gene locus_tag LOCUS_20970 2285402 2284830 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024248.1 protein_id gnl|my_center|LOCUS_20970 2286007 2285450 gene locus_tag LOCUS_20980 2286007 2285450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 2286080 2286262 gene locus_tag LOCUS_20990 2286080 2286262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 2287035 2286514 gene locus_tag LOCUS_21000 2287035 2286514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2287940 2287047 gene locus_tag LOCUS_21010 2287940 2287047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2288209 2287880 gene locus_tag LOCUS_21020 2288209 2287880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 2289155 2288337 gene locus_tag LOCUS_21030 gene ssuB 2289155 2288337 CDS product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102311.1 protein_id gnl|my_center|LOCUS_21030 2289922 2289125 gene locus_tag LOCUS_21040 gene ssuC 2289922 2289125 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407339.1 protein_id gnl|my_center|LOCUS_21040 2291080 2289935 gene locus_tag LOCUS_21050 gene ssuD 2291080 2289935 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192866.1 protein_id gnl|my_center|LOCUS_21050 2292213 2291200 gene locus_tag LOCUS_21060 2292213 2291200 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269279.1 protein_id gnl|my_center|LOCUS_21060 2294207 2292723 gene locus_tag LOCUS_21070 2294207 2292723 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209630.1 protein_id gnl|my_center|LOCUS_21070 2295615 2294200 gene locus_tag LOCUS_21080 gene glcD 2295615 2294200 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398865.1 protein_id gnl|my_center|LOCUS_21080 2295787 2296494 gene locus_tag LOCUS_21090 gene lutR 2295787 2296494 CDS product L-lactate utilization/bacilysin biosynthesis transcriptional regulator LutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968191.1 protein_id gnl|my_center|LOCUS_21090 2297304 2296573 gene locus_tag LOCUS_21100 2297304 2296573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 2298042 2297497 gene locus_tag LOCUS_21110 2298042 2297497 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583077.1 protein_id gnl|my_center|LOCUS_21110 2299326 2298097 gene locus_tag LOCUS_21120 2299326 2298097 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527149.1 protein_id gnl|my_center|LOCUS_21120 2300488 2299328 gene locus_tag LOCUS_21130 2300488 2299328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 2301335 2300490 gene locus_tag LOCUS_21140 2301335 2300490 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975359.1 protein_id gnl|my_center|LOCUS_21140 2302195 2301434 gene locus_tag LOCUS_21150 2302195 2301434 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_21150 2303256 2302192 gene locus_tag LOCUS_21160 2303256 2302192 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787054.1 protein_id gnl|my_center|LOCUS_21160 2303870 2303403 gene locus_tag LOCUS_21170 2303870 2303403 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538766.1 protein_id gnl|my_center|LOCUS_21170 2304821 2303913 gene locus_tag LOCUS_21180 gene ctaG 2304821 2303913 CDS product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069023.1 protein_id gnl|my_center|LOCUS_21180 2305229 2304909 gene locus_tag LOCUS_21190 2305229 2304909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2305853 2305233 gene locus_tag LOCUS_21200 gene ctaE 2305853 2305233 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557860.1 protein_id gnl|my_center|LOCUS_21200 2307742 2305850 gene locus_tag LOCUS_21210 gene ctaD 2307742 2305850 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011371630.1 protein_id gnl|my_center|LOCUS_21210 2308674 2307772 gene locus_tag LOCUS_21220 gene coxB 2308674 2307772 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745271.1 protein_id gnl|my_center|LOCUS_21220 2309165 2309893 gene locus_tag LOCUS_21230 2309165 2309893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 2310335 2310781 gene locus_tag LOCUS_21240 gene mhqR 2310335 2310781 CDS product MarR family transcriptional regulator MhqR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232475.1 protein_id gnl|my_center|LOCUS_21240 2310864 2311247 gene locus_tag LOCUS_21250 2310864 2311247 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968616.1 protein_id gnl|my_center|LOCUS_21250 2311301 2312077 gene locus_tag LOCUS_21260 2311301 2312077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2313701 2312193 gene locus_tag LOCUS_21270 2313701 2312193 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110815093.1 protein_id gnl|my_center|LOCUS_21270 2314745 2313846 gene locus_tag LOCUS_21280 2314745 2313846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2315900 2314755 gene locus_tag LOCUS_21290 2315900 2314755 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234986.1 protein_id gnl|my_center|LOCUS_21290 2317689 2316097 gene locus_tag LOCUS_21300 2317689 2316097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 2317995 2318168 gene locus_tag LOCUS_21310 2317995 2318168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 2318169 2318759 gene locus_tag LOCUS_21320 2318169 2318759 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457314.1 protein_id gnl|my_center|LOCUS_21320 2319073 2319942 gene locus_tag LOCUS_21330 2319073 2319942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 2320904 2320164 gene locus_tag LOCUS_21340 2320904 2320164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 2321823 2320897 gene locus_tag LOCUS_21350 2321823 2320897 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986750.1 protein_id gnl|my_center|LOCUS_21350 2322780 2321935 gene locus_tag LOCUS_21360 2322780 2321935 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392476.1 protein_id gnl|my_center|LOCUS_21360 2323766 2322780 gene locus_tag LOCUS_21370 2323766 2322780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943953.1 protein_id gnl|my_center|LOCUS_21370 2325004 2323763 gene locus_tag LOCUS_21380 2325004 2323763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2325525 2325001 gene locus_tag LOCUS_21390 2325525 2325001 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392473.1 protein_id gnl|my_center|LOCUS_21390 2327408 2325765 gene locus_tag LOCUS_21400 2327408 2325765 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_21400 2328450 2327539 gene locus_tag LOCUS_21410 2328450 2327539 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_21410 2329437 2328466 gene locus_tag LOCUS_21420 2329437 2328466 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_21420 2332347 2329441 gene locus_tag LOCUS_21430 2332347 2329441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 2333723 2332659 gene locus_tag LOCUS_21440 2333723 2332659 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119158.1 protein_id gnl|my_center|LOCUS_21440 2334430 2333897 gene locus_tag LOCUS_21450 2334430 2333897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 2335644 2335024 gene locus_tag LOCUS_21460 2335644 2335024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2336056 2335823 gene locus_tag LOCUS_21470 2336056 2335823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 2336900 2336049 gene locus_tag LOCUS_21480 2336900 2336049 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234236.1 protein_id gnl|my_center|LOCUS_21480 2337761 2338081 gene locus_tag LOCUS_21490 2337761 2338081 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429306.1 protein_id gnl|my_center|LOCUS_21490 2338240 2338716 gene locus_tag LOCUS_21500 gene rsbW 2338240 2338716 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234299.1 protein_id gnl|my_center|LOCUS_21500 2338713 2339486 gene locus_tag LOCUS_21510 gene sigB 2338713 2339486 CDS product RNA polymerase sigma factor SigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246715.1 protein_id gnl|my_center|LOCUS_21510 2339680 2340924 gene locus_tag LOCUS_21520 2339680 2340924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 2342214 2340997 gene locus_tag LOCUS_21530 2342214 2340997 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025547.1 protein_id gnl|my_center|LOCUS_21530 2342414 2343199 gene locus_tag LOCUS_21540 2342414 2343199 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260128.1 protein_id gnl|my_center|LOCUS_21540 2343619 2343263 gene locus_tag LOCUS_21550 2343619 2343263 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028411.1 protein_id gnl|my_center|LOCUS_21550 2344081 2343632 gene locus_tag LOCUS_21560 2344081 2343632 CDS product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057304.1 protein_id gnl|my_center|LOCUS_21560 2344384 2344166 gene locus_tag LOCUS_21570 2344384 2344166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2344667 2344491 gene locus_tag LOCUS_21580 2344667 2344491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 2346427 2344802 gene locus_tag LOCUS_21590 2346427 2344802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 2346664 2347536 gene locus_tag LOCUS_21600 gene ldcB 2346664 2347536 CDS product LD-carboxypeptidase LdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399387.1 protein_id gnl|my_center|LOCUS_21600 2348692 2347775 gene locus_tag LOCUS_21610 2348692 2347775 CDS product Rv2407 family type 3 sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412350.1 protein_id gnl|my_center|LOCUS_21610 2349762 2348725 gene locus_tag LOCUS_21620 2349762 2348725 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963433.1 protein_id gnl|my_center|LOCUS_21620 2350627 2349863 gene locus_tag LOCUS_21630 2350627 2349863 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963435.1 protein_id gnl|my_center|LOCUS_21630 2351399 2350560 gene locus_tag LOCUS_21640 2351399 2350560 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015261606.1 protein_id gnl|my_center|LOCUS_21640 2352113 2351430 gene locus_tag LOCUS_21650 2352113 2351430 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126987297.1 protein_id gnl|my_center|LOCUS_21650 2352303 2352127 gene locus_tag LOCUS_21660 2352303 2352127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 2353278 2352334 gene locus_tag LOCUS_21670 2353278 2352334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811522.1 protein_id gnl|my_center|LOCUS_21670 2354338 2353427 gene locus_tag LOCUS_21680 2354338 2353427 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_21680 2354552 2355331 gene locus_tag LOCUS_21690 gene rhaS 2354552 2355331 CDS product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217149.1 protein_id gnl|my_center|LOCUS_21690 2355653 2355297 gene locus_tag LOCUS_21700 2355653 2355297 CDS product DUF1904 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895429.1 protein_id gnl|my_center|LOCUS_21700 2356229 2355672 gene locus_tag LOCUS_21710 2356229 2355672 CDS product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862921.1 protein_id gnl|my_center|LOCUS_21710 2357364 2356423 gene locus_tag LOCUS_21720 2357364 2356423 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785904.1 protein_id gnl|my_center|LOCUS_21720 2358737 2358492 gene locus_tag LOCUS_21730 2358737 2358492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 2359425 2358685 gene locus_tag LOCUS_21740 2359425 2358685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2360458 2359631 gene locus_tag LOCUS_21750 gene hisJ 2360458 2359631 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732654.1 protein_id gnl|my_center|LOCUS_21750 2360689 2362506 gene locus_tag LOCUS_21760 2360689 2362506 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062822707.1 protein_id gnl|my_center|LOCUS_21760 2364156 2363146 gene locus_tag LOCUS_21770 2364156 2363146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2364668 2364153 gene locus_tag LOCUS_21780 gene def 2364668 2364153 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_21780 2364944 2364690 gene locus_tag LOCUS_21790 2364944 2364690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 2365104 2365487 gene locus_tag LOCUS_21800 2365104 2365487 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_21800 2366157 2365702 gene locus_tag LOCUS_21810 2366157 2365702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 2366336 2366115 gene locus_tag LOCUS_21820 2366336 2366115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 2367482 2366487 gene locus_tag LOCUS_21830 2367482 2366487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 2368560 2367499 gene locus_tag LOCUS_21840 2368560 2367499 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_21840 2370181 2368598 gene locus_tag LOCUS_21850 2370181 2368598 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027258.1 protein_id gnl|my_center|LOCUS_21850 2371283 2370204 gene locus_tag LOCUS_21860 2371283 2370204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2372321 2371371 gene locus_tag LOCUS_21870 2372321 2371371 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080850.1 protein_id gnl|my_center|LOCUS_21870 2373216 2372314 gene locus_tag LOCUS_21880 2373216 2372314 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080851.1 protein_id gnl|my_center|LOCUS_21880 2374678 2373278 gene locus_tag LOCUS_21890 2374678 2373278 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080852.1 protein_id gnl|my_center|LOCUS_21890 2375717 2374809 gene locus_tag LOCUS_21900 2375717 2374809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 2376653 2376015 gene locus_tag LOCUS_21910 2376653 2376015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 2376777 2377748 gene locus_tag LOCUS_21920 2376777 2377748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2379730 2378738 gene locus_tag LOCUS_21930 2379730 2378738 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172178.1 protein_id gnl|my_center|LOCUS_21930 2380665 2379826 gene locus_tag LOCUS_21940 2380665 2379826 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775269.1 protein_id gnl|my_center|LOCUS_21940 2381608 2380826 gene locus_tag LOCUS_21950 2381608 2380826 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_21950 2382519 2381605 gene locus_tag LOCUS_21960 2382519 2381605 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_21960 2383189 2382506 gene locus_tag LOCUS_21970 2383189 2382506 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120388.1 protein_id gnl|my_center|LOCUS_21970 2384377 2383253 gene locus_tag LOCUS_21980 2384377 2383253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 2386032 2384587 gene locus_tag LOCUS_21990 2386032 2384587 CDS product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444489.1 protein_id gnl|my_center|LOCUS_21990 2387353 2386055 gene locus_tag LOCUS_22000 gene prpC 2387353 2386055 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947259.1 protein_id gnl|my_center|LOCUS_22000 2388421 2387357 gene locus_tag LOCUS_22010 gene prpB 2388421 2387357 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945814.1 protein_id gnl|my_center|LOCUS_22010 2389711 2388452 gene locus_tag LOCUS_22020 2389711 2388452 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_22020 2390585 2389719 gene locus_tag LOCUS_22030 2390585 2389719 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 protein_id gnl|my_center|LOCUS_22030 2391826 2390621 gene locus_tag LOCUS_22040 2391826 2390621 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047982.1 protein_id gnl|my_center|LOCUS_22040 2392992 2391865 gene locus_tag LOCUS_22050 gene acdA 2392992 2391865 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545532.1 protein_id gnl|my_center|LOCUS_22050 2393134 2394030 gene locus_tag LOCUS_22060 2393134 2394030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 2394824 2395219 gene locus_tag LOCUS_22070 2394824 2395219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 2396547 2395123 gene locus_tag LOCUS_22080 2396547 2395123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 2398419 2396674 gene locus_tag LOCUS_22090 2398419 2396674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 2399861 2398659 gene locus_tag LOCUS_22100 2399861 2398659 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890714.1 protein_id gnl|my_center|LOCUS_22100 2400889 2400386 gene locus_tag LOCUS_22110 gene queF 2400889 2400386 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218613.1 protein_id gnl|my_center|LOCUS_22110 2400994 2401512 gene locus_tag LOCUS_22120 2400994 2401512 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076327.1 protein_id gnl|my_center|LOCUS_22120 2402301 2401609 gene locus_tag LOCUS_22130 gene deoC 2402301 2401609 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356166.1 protein_id gnl|my_center|LOCUS_22130 2403273 2402320 gene locus_tag LOCUS_22140 gene deoR 2403273 2402320 CDS product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227124.1 protein_id gnl|my_center|LOCUS_22140 2404263 2403307 gene locus_tag LOCUS_22150 2404263 2403307 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044979586.1 protein_id gnl|my_center|LOCUS_22150 2405351 2404266 gene locus_tag LOCUS_22160 2405351 2404266 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679664.1 protein_id gnl|my_center|LOCUS_22160 2406871 2405348 gene locus_tag LOCUS_22170 2406871 2405348 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456939.1 protein_id gnl|my_center|LOCUS_22170 2408124 2406991 gene locus_tag LOCUS_22180 2408124 2406991 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669780.1 protein_id gnl|my_center|LOCUS_22180 2410935 2408635 gene locus_tag LOCUS_22190 2410935 2408635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 2412297 2411188 gene locus_tag LOCUS_22200 2412297 2411188 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723525.1 protein_id gnl|my_center|LOCUS_22200 2413247 2412543 gene locus_tag LOCUS_22210 2413247 2412543 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021737.1 protein_id gnl|my_center|LOCUS_22210 2413940 2413404 gene locus_tag LOCUS_22220 2413940 2413404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460205.1 protein_id gnl|my_center|LOCUS_22220 2414565 2414053 gene locus_tag LOCUS_22230 2414565 2414053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 2415626 2414709 gene locus_tag LOCUS_22240 2415626 2414709 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164690802.1 protein_id gnl|my_center|LOCUS_22240 2416792 2415641 gene locus_tag LOCUS_22250 2416792 2415641 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_22250 2417619 2416978 gene locus_tag LOCUS_22260 2417619 2416978 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243016.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22260 2417711 2418343 gene locus_tag LOCUS_22270 2417711 2418343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2423532 2418526 gene locus_tag LOCUS_22280 2423532 2418526 CDS product DUF4132 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860739.1 protein_id gnl|my_center|LOCUS_22280 2423967 2423545 gene locus_tag LOCUS_22290 2423967 2423545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434832.1 protein_id gnl|my_center|LOCUS_22290 2424225 2424149 gene locus_tag LOCUS_t00140 2424225 2424149 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2424331 2424255 gene locus_tag LOCUS_t00150 2424331 2424255 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2424412 2424338 gene locus_tag LOCUS_t00160 2424412 2424338 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2424503 2424421 gene locus_tag LOCUS_t00170 2424503 2424421 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2424607 2424532 gene locus_tag LOCUS_t00180 2424607 2424532 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2424693 2424618 gene locus_tag LOCUS_t00190 2424693 2424618 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2424789 2424714 gene locus_tag LOCUS_t00200 2424789 2424714 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2424886 2424810 gene locus_tag LOCUS_t00210 2424886 2424810 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2425005 2424929 gene locus_tag LOCUS_t00220 2425005 2424929 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2425107 2425032 gene locus_tag LOCUS_t00230 2425107 2425032 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2425259 2425185 gene locus_tag LOCUS_t00240 2425259 2425185 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2425369 2425279 gene locus_tag LOCUS_t00250 2425369 2425279 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2425449 2425374 gene locus_tag LOCUS_t00260 2425449 2425374 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2428458 2425539 gene locus_tag LOCUS_r00070 2428458 2425539 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2428924 2428812 gene locus_tag LOCUS_r00080 2428924 2428812 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2430634 2429082 gene locus_tag LOCUS_r00090 2430634 2429082 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2431605 2431048 gene locus_tag LOCUS_22300 2431605 2431048 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003499036.1 protein_id gnl|my_center|LOCUS_22300 2432097 2431750 gene locus_tag LOCUS_22310 2432097 2431750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 2433704 2432262 gene locus_tag LOCUS_22320 2433704 2432262 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150184.1 protein_id gnl|my_center|LOCUS_22320 2434277 2433720 gene locus_tag LOCUS_22330 2434277 2433720 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243099.1 protein_id gnl|my_center|LOCUS_22330 2435072 2434299 gene locus_tag LOCUS_22340 2435072 2434299 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989490.1 protein_id gnl|my_center|LOCUS_22340 2435561 2435331 gene locus_tag LOCUS_22350 2435561 2435331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2436029 2435568 gene locus_tag LOCUS_22360 2436029 2435568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 2437135 2436155 gene locus_tag LOCUS_22370 2437135 2436155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 2438358 2437156 gene locus_tag LOCUS_22380 2438358 2437156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2438886 2438473 gene locus_tag LOCUS_22390 2438886 2438473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 2439640 2438972 gene locus_tag LOCUS_22400 2439640 2438972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2439737 2440429 gene locus_tag LOCUS_22410 2439737 2440429 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207380.1 protein_id gnl|my_center|LOCUS_22410 2441598 2440543 gene locus_tag LOCUS_22420 2441598 2440543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2445561 2441743 gene locus_tag LOCUS_22430 2445561 2441743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 2445912 2447300 gene locus_tag LOCUS_22440 2445912 2447300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2448704 2447463 gene locus_tag LOCUS_22450 2448704 2447463 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528639.1 protein_id gnl|my_center|LOCUS_22450 2449059 2448712 gene locus_tag LOCUS_22460 2449059 2448712 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265538.1 protein_id gnl|my_center|LOCUS_22460 2449988 2449413 gene locus_tag LOCUS_22470 2449988 2449413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2451736 2450186 gene locus_tag LOCUS_22480 2451736 2450186 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055404.1 protein_id gnl|my_center|LOCUS_22480 2452683 2452054 gene locus_tag LOCUS_22490 2452683 2452054 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167344383.1 protein_id gnl|my_center|LOCUS_22490 2454088 2452940 gene locus_tag LOCUS_22500 2454088 2452940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 2454500 2455600 gene locus_tag LOCUS_22510 2454500 2455600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 2458250 2456766 gene locus_tag LOCUS_22520 2458250 2456766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490128.1 protein_id gnl|my_center|LOCUS_22520 2459051 2458701 gene locus_tag LOCUS_22530 2459051 2458701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 2460061 2459216 gene locus_tag LOCUS_22540 2460061 2459216 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_22540 2460977 2460075 gene locus_tag LOCUS_22550 2460977 2460075 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_22550 2462499 2461084 gene locus_tag LOCUS_22560 2462499 2461084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2463019 2462837 gene locus_tag LOCUS_22570 2463019 2462837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 2464460 2463186 gene locus_tag LOCUS_22580 2464460 2463186 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528982.1 protein_id gnl|my_center|LOCUS_22580 2465482 2464496 gene locus_tag LOCUS_22590 2465482 2464496 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974549.1 protein_id gnl|my_center|LOCUS_22590 2467286 2465508 gene locus_tag LOCUS_22600 2467286 2465508 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_22600 2468913 2467288 gene locus_tag LOCUS_22610 2468913 2467288 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_22610 2470710 2470003 gene locus_tag LOCUS_22620 2470710 2470003 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_22620 2472269 2470707 gene locus_tag LOCUS_22630 2472269 2470707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22630 2474601 2472244 gene locus_tag LOCUS_22640 2474601 2472244 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110899006.1 protein_id gnl|my_center|LOCUS_22640 2475248 2474682 gene locus_tag LOCUS_22650 gene kdpC 2475248 2474682 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943119.1 protein_id gnl|my_center|LOCUS_22650 2477314 2475275 gene locus_tag LOCUS_22660 gene kdpB 2477314 2475275 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430007.1 protein_id gnl|my_center|LOCUS_22660 2479235 2477556 gene locus_tag LOCUS_22670 gene kdpA 2479235 2477556 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161471071.1 protein_id gnl|my_center|LOCUS_22670 2480151 2479606 gene locus_tag LOCUS_22680 2480151 2479606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 2480780 2480307 gene locus_tag LOCUS_22690 2480780 2480307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2481352 2482464 gene locus_tag LOCUS_22700 2481352 2482464 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974677.1 protein_id gnl|my_center|LOCUS_22700 2482576 2482740 gene locus_tag LOCUS_22710 2482576 2482740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2483555 2482695 gene locus_tag LOCUS_22720 2483555 2482695 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_22720 2483677 2484429 gene locus_tag LOCUS_22730 2483677 2484429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 2484539 2485342 gene locus_tag LOCUS_22740 2484539 2485342 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976119.1 protein_id gnl|my_center|LOCUS_22740 2487803 2485479 gene locus_tag LOCUS_22750 2487803 2485479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 2488670 2487819 gene locus_tag LOCUS_22760 2488670 2487819 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429025.1 protein_id gnl|my_center|LOCUS_22760 2492433 2488693 gene locus_tag LOCUS_22770 2492433 2488693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 2492924 2492586 gene locus_tag LOCUS_22780 2492924 2492586 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233729.1 protein_id gnl|my_center|LOCUS_22780 2493164 2494909 gene locus_tag LOCUS_22790 2493164 2494909 CDS product alpha-glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471779.1 protein_id gnl|my_center|LOCUS_22790 2495476 2496705 gene locus_tag LOCUS_22800 gene glgC 2495476 2496705 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_22800 2497164 2496862 gene locus_tag LOCUS_22810 2497164 2496862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231564.1 protein_id gnl|my_center|LOCUS_22810 2499835 2497394 gene locus_tag LOCUS_22820 2499835 2497394 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967094.1 protein_id gnl|my_center|LOCUS_22820 2501411 2500359 gene locus_tag LOCUS_22830 2501411 2500359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 2503552 2501885 gene locus_tag LOCUS_22840 2503552 2501885 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_22840 2504499 2503615 gene locus_tag LOCUS_22850 2504499 2503615 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_22850 2505486 2504512 gene locus_tag LOCUS_22860 2505486 2504512 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_22860 2505826 2506053 gene locus_tag LOCUS_22870 2505826 2506053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 2512290 2506201 gene locus_tag LOCUS_22880 2512290 2506201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 2512598 2513590 gene locus_tag LOCUS_22890 2512598 2513590 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803779.1 protein_id gnl|my_center|LOCUS_22890 2515374 2513737 gene locus_tag LOCUS_22900 2515374 2513737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 2517127 2515367 gene locus_tag LOCUS_22910 2517127 2515367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 2518994 2517513 gene locus_tag LOCUS_22920 2518994 2517513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 2520852 2519140 gene locus_tag LOCUS_22930 2520852 2519140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 2524547 2521389 gene locus_tag LOCUS_22940 2524547 2521389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 2525430 2524606 gene locus_tag LOCUS_22950 2525430 2524606 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173998.1 protein_id gnl|my_center|LOCUS_22950 2526341 2525436 gene locus_tag LOCUS_22960 2526341 2525436 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898777.1 protein_id gnl|my_center|LOCUS_22960 2527877 2526480 gene locus_tag LOCUS_22970 2527877 2526480 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973776.1 protein_id gnl|my_center|LOCUS_22970 2529409 2528306 gene locus_tag LOCUS_22980 2529409 2528306 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_22980 2529786 2529487 gene locus_tag LOCUS_22990 2529786 2529487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 2530437 2530279 gene locus_tag LOCUS_23000 2530437 2530279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2532081 2530471 gene locus_tag LOCUS_23010 2532081 2530471 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 protein_id gnl|my_center|LOCUS_23010 2532612 2533097 gene locus_tag LOCUS_23020 2532612 2533097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 2533625 2533296 gene locus_tag LOCUS_23030 2533625 2533296 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389676.1 protein_id gnl|my_center|LOCUS_23030 2534334 2533627 gene locus_tag LOCUS_23040 2534334 2533627 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939330.1 protein_id gnl|my_center|LOCUS_23040 2535361 2534336 gene locus_tag LOCUS_23050 2535361 2534336 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_23050 2536732 2535368 gene locus_tag LOCUS_23060 2536732 2535368 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090851.1 protein_id gnl|my_center|LOCUS_23060 2536982 2537425 gene locus_tag LOCUS_23070 2536982 2537425 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728367.1 protein_id gnl|my_center|LOCUS_23070 2537598 2538059 gene locus_tag LOCUS_23080 2537598 2538059 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627261.1 protein_id gnl|my_center|LOCUS_23080 2538307 2539287 gene locus_tag LOCUS_23090 2538307 2539287 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930069.1 protein_id gnl|my_center|LOCUS_23090 2541390 2539621 gene locus_tag LOCUS_23100 gene ilvB 2541390 2539621 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_23100 2541568 2541795 gene locus_tag LOCUS_23110 2541568 2541795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 2542485 2543648 gene locus_tag LOCUS_23120 2542485 2543648 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234334.1 protein_id gnl|my_center|LOCUS_23120 2544544 2543834 gene locus_tag LOCUS_23130 gene bshB2 2544544 2543834 CDS product bacillithiol biosynthesis deacetylase BshB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439472.1 protein_id gnl|my_center|LOCUS_23130 2544852 2544541 gene locus_tag LOCUS_23140 2544852 2544541 CDS product YojF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438722.1 protein_id gnl|my_center|LOCUS_23140 2545037 2545915 gene locus_tag LOCUS_23150 2545037 2545915 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377714.1 protein_id gnl|my_center|LOCUS_23150 2546317 2545925 gene locus_tag LOCUS_23160 2546317 2545925 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_23160 2547822 2546482 gene locus_tag LOCUS_23170 2547822 2546482 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804146.1 protein_id gnl|my_center|LOCUS_23170 2550169 2547872 gene locus_tag LOCUS_23180 2550169 2547872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 2551114 2550434 gene locus_tag LOCUS_23190 gene bshB2 2551114 2550434 CDS product bacillithiol biosynthesis deacetylase BshB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129068.1 protein_id gnl|my_center|LOCUS_23190 2551458 2551114 gene locus_tag LOCUS_23200 2551458 2551114 CDS product YojF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000407043.1 protein_id gnl|my_center|LOCUS_23200 2552223 2551648 gene locus_tag LOCUS_23210 2552223 2551648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2552668 2552381 gene locus_tag LOCUS_23220 2552668 2552381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 2554059 2552851 gene locus_tag LOCUS_23230 2554059 2552851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 2554354 2555376 gene locus_tag LOCUS_23240 2554354 2555376 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031699.1 protein_id gnl|my_center|LOCUS_23240 2555734 2557509 gene locus_tag LOCUS_23250 2555734 2557509 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721734.1 protein_id gnl|my_center|LOCUS_23250 2557496 2559271 gene locus_tag LOCUS_23260 2557496 2559271 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732216.1 protein_id gnl|my_center|LOCUS_23260 2559975 2559355 gene locus_tag LOCUS_23270 2559975 2559355 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227382.1 protein_id gnl|my_center|LOCUS_23270 2560154 2560591 gene locus_tag LOCUS_23280 2560154 2560591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 2560952 2560713 gene locus_tag LOCUS_23290 2560952 2560713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 2563710 2561146 gene locus_tag LOCUS_23300 2563710 2561146 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107276.1 protein_id gnl|my_center|LOCUS_23300 2565181 2564081 gene locus_tag LOCUS_23310 2565181 2564081 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776742.1 protein_id gnl|my_center|LOCUS_23310 2566240 2565209 gene locus_tag LOCUS_23320 2566240 2565209 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_23320 2567122 2566244 gene locus_tag LOCUS_23330 2567122 2566244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2567608 2567369 gene locus_tag LOCUS_23340 2567608 2567369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2568755 2567637 gene locus_tag LOCUS_23350 gene nagA 2568755 2567637 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704755.1 protein_id gnl|my_center|LOCUS_23350 2568871 2568704 gene locus_tag LOCUS_23360 2568871 2568704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 2569747 2569004 gene locus_tag LOCUS_23370 2569747 2569004 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 protein_id gnl|my_center|LOCUS_23370 2570985 2569765 gene locus_tag LOCUS_23380 2570985 2569765 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167274874.1 protein_id gnl|my_center|LOCUS_23380 2572276 2571050 gene locus_tag LOCUS_23390 2572276 2571050 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100954.1 protein_id gnl|my_center|LOCUS_23390 2572542 2574794 gene locus_tag LOCUS_23400 2572542 2574794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 2574816 2575157 gene locus_tag LOCUS_23410 2574816 2575157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 2577195 2576230 gene locus_tag LOCUS_23420 2577195 2576230 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454499.1 protein_id gnl|my_center|LOCUS_23420 2579329 2577200 gene locus_tag LOCUS_23430 2579329 2577200 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_23430 2581210 2579522 gene locus_tag LOCUS_23440 2581210 2579522 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_23440 2582165 2581278 gene locus_tag LOCUS_23450 2582165 2581278 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_23450 2583152 2582187 gene locus_tag LOCUS_23460 2583152 2582187 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_23460 2583982 2583179 gene locus_tag LOCUS_23470 2583982 2583179 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976046.1 protein_id gnl|my_center|LOCUS_23470 2584229 2585995 gene locus_tag LOCUS_23480 2584229 2585995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 2586257 2587348 gene locus_tag LOCUS_23490 2586257 2587348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 2587413 2588414 gene locus_tag LOCUS_23500 gene corA 2587413 2588414 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002003436.1 protein_id gnl|my_center|LOCUS_23500 2588651 2589679 gene locus_tag LOCUS_23510 2588651 2589679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 2589943 2590899 gene locus_tag LOCUS_23520 2589943 2590899 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974078.1 protein_id gnl|my_center|LOCUS_23520 2590974 2591399 gene locus_tag LOCUS_23530 2590974 2591399 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966951.1 protein_id gnl|my_center|LOCUS_23530 2594186 2591691 gene locus_tag LOCUS_23540 2594186 2591691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 2595141 2594272 gene locus_tag LOCUS_23550 2595141 2594272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 2595489 2595166 gene locus_tag LOCUS_23560 2595489 2595166 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198610.1 protein_id gnl|my_center|LOCUS_23560 2596279 2595497 gene locus_tag LOCUS_23570 2596279 2595497 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057310.1 protein_id gnl|my_center|LOCUS_23570 2596478 2597038 gene locus_tag LOCUS_23580 gene gbsR 2596478 2597038 CDS product transcriptional regulator GbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244320.1 protein_id gnl|my_center|LOCUS_23580 2598595 2597180 gene locus_tag LOCUS_23590 gene araE 2598595 2597180 CDS product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243899.1 protein_id gnl|my_center|LOCUS_23590 2600224 2598908 gene locus_tag LOCUS_23600 2600224 2598908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 2601731 2600199 gene locus_tag LOCUS_23610 2601731 2600199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 2602747 2601728 gene locus_tag LOCUS_23620 2602747 2601728 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965268.1 protein_id gnl|my_center|LOCUS_23620 2603348 2603019 gene locus_tag LOCUS_23630 2603348 2603019 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277353.1 protein_id gnl|my_center|LOCUS_23630 2603749 2603594 gene locus_tag LOCUS_23640 2603749 2603594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2606979 2604028 gene locus_tag LOCUS_23650 2606979 2604028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 2608576 2607491 gene locus_tag LOCUS_23660 2608576 2607491 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_23660 2610257 2608848 gene locus_tag LOCUS_23670 2610257 2608848 CDS product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704479.1 protein_id gnl|my_center|LOCUS_23670 2612134 2610236 gene locus_tag LOCUS_23680 2612134 2610236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 2612592 2612146 gene locus_tag LOCUS_23690 2612592 2612146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 2614311 2612686 gene locus_tag LOCUS_23700 2614311 2612686 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_23700 2615310 2614423 gene locus_tag LOCUS_23710 2615310 2614423 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_23710 2616294 2615332 gene locus_tag LOCUS_23720 2616294 2615332 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_23720 2616468 2616719 gene locus_tag LOCUS_23730 2616468 2616719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 2618219 2617722 gene locus_tag LOCUS_23740 2618219 2617722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 2619994 2618366 gene locus_tag LOCUS_23750 2619994 2618366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 2621823 2619991 gene locus_tag LOCUS_23760 2621823 2619991 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_23760 2625333 2622262 gene locus_tag LOCUS_23770 2625333 2622262 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_23770 2626579 2625710 gene locus_tag LOCUS_23780 2626579 2625710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 2627057 2626557 gene locus_tag LOCUS_23790 2627057 2626557 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_23790 2627449 2627676 gene locus_tag LOCUS_23800 2627449 2627676 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381043.1 protein_id gnl|my_center|LOCUS_23800 2628083 2627739 gene locus_tag LOCUS_23810 2628083 2627739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 2628233 2628460 gene locus_tag LOCUS_23820 2628233 2628460 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381043.1 protein_id gnl|my_center|LOCUS_23820 2629273 2628536 gene locus_tag LOCUS_23830 2629273 2628536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 2629612 2630370 gene locus_tag LOCUS_23840 2629612 2630370 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145171390.1 protein_id gnl|my_center|LOCUS_23840 2632891 2630474 gene locus_tag LOCUS_23850 2632891 2630474 CDS product restriction endonuclease-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459237.1 protein_id gnl|my_center|LOCUS_23850 2635055 2632863 gene locus_tag LOCUS_23860 2635055 2632863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 2639577 2635330 gene locus_tag LOCUS_23870 2639577 2635330 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143843.1 protein_id gnl|my_center|LOCUS_23870 2640494 2639574 gene locus_tag LOCUS_23880 2640494 2639574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 2640839 2642104 gene locus_tag LOCUS_23890 2640839 2642104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 2643454 2643041 gene locus_tag LOCUS_23900 2643454 2643041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2644402 2643464 gene locus_tag LOCUS_23910 2644402 2643464 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267092.1 protein_id gnl|my_center|LOCUS_23910 2645559 2644714 gene locus_tag LOCUS_23920 2645559 2644714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 2648050 2646422 gene locus_tag LOCUS_23930 gene rlmD 2648050 2646422 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_23930 2649040 2648126 gene locus_tag LOCUS_23940 2649040 2648126 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_23940 2650260 2649349 gene locus_tag LOCUS_23950 2650260 2649349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 2650555 2650265 gene locus_tag LOCUS_23960 2650555 2650265 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_23960 2650778 2651407 gene locus_tag LOCUS_23970 2650778 2651407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 2652569 2651565 gene locus_tag LOCUS_23980 2652569 2651565 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232642.1 protein_id gnl|my_center|LOCUS_23980 2653204 2652590 gene locus_tag LOCUS_23990 2653204 2652590 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231449.1 protein_id gnl|my_center|LOCUS_23990 2654608 2653490 gene locus_tag LOCUS_24000 2654608 2653490 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_24000 2656055 2654703 gene locus_tag LOCUS_24010 2656055 2654703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 2656668 2656036 gene locus_tag LOCUS_24020 2656668 2656036 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948534.1 protein_id gnl|my_center|LOCUS_24020 2656708 2656827 gene locus_tag LOCUS_24030 2656708 2656827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 2658333 2656912 gene locus_tag LOCUS_24040 2658333 2656912 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_24040 2659646 2658330 gene locus_tag LOCUS_24050 2659646 2658330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 2661097 2659709 gene locus_tag LOCUS_24060 2661097 2659709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 2662612 2661119 gene locus_tag LOCUS_24070 2662612 2661119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2664123 2662855 gene locus_tag LOCUS_24080 gene purD 2664123 2662855 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_24080 2664882 2664124 gene locus_tag LOCUS_24090 2664882 2664124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 2666090 2664909 gene locus_tag LOCUS_24100 2666090 2664909 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788311.1 protein_id gnl|my_center|LOCUS_24100 2666763 2666137 gene locus_tag LOCUS_24110 gene purN 2666763 2666137 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088592.1 protein_id gnl|my_center|LOCUS_24110 2667806 2666763 gene locus_tag LOCUS_24120 gene purM 2667806 2666763 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_24120 2669559 2668081 gene locus_tag LOCUS_24130 gene purF 2669559 2668081 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879029.1 protein_id gnl|my_center|LOCUS_24130 2671787 2669544 gene locus_tag LOCUS_24140 gene purL 2671787 2669544 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244429.1 protein_id gnl|my_center|LOCUS_24140 2672460 2671765 gene locus_tag LOCUS_24150 gene purQ 2672460 2671765 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666779.1 protein_id gnl|my_center|LOCUS_24150 2672706 2672464 gene locus_tag LOCUS_24160 gene purS 2672706 2672464 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219409.1 protein_id gnl|my_center|LOCUS_24160 2673983 2673093 gene locus_tag LOCUS_24170 2673983 2673093 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922494.1 protein_id gnl|my_center|LOCUS_24170 2675463 2674168 gene locus_tag LOCUS_24180 gene purB 2675463 2674168 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733238.1 protein_id gnl|my_center|LOCUS_24180 2676639 2675467 gene locus_tag LOCUS_24190 gene purK 2676639 2675467 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196812.1 protein_id gnl|my_center|LOCUS_24190 2677121 2676636 gene locus_tag LOCUS_24200 gene purE 2677121 2676636 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722253.1 protein_id gnl|my_center|LOCUS_24200 2677685 2678566 gene locus_tag LOCUS_24210 2677685 2678566 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_24210 2678587 2679384 gene locus_tag LOCUS_24220 2678587 2679384 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080494.1 protein_id gnl|my_center|LOCUS_24220 2679473 2680126 gene locus_tag LOCUS_24230 2679473 2680126 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816849.1 protein_id gnl|my_center|LOCUS_24230 2681623 2680232 gene locus_tag LOCUS_24240 2681623 2680232 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392746.1 protein_id gnl|my_center|LOCUS_24240 2682998 2681919 gene locus_tag LOCUS_24250 2682998 2681919 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814873.1 protein_id gnl|my_center|LOCUS_24250 2683263 2684414 gene locus_tag LOCUS_24260 2683263 2684414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 2686025 2684487 gene locus_tag LOCUS_24270 gene guaA 2686025 2684487 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162837124.1 protein_id gnl|my_center|LOCUS_24270 2687856 2686738 gene locus_tag LOCUS_24280 2687856 2686738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 2688094 2689104 gene locus_tag LOCUS_24290 2688094 2689104 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582467.1 protein_id gnl|my_center|LOCUS_24290 2689073 2690662 gene locus_tag LOCUS_24300 2689073 2690662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 2693536 2690876 gene locus_tag LOCUS_24310 2693536 2690876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 2694977 2693514 gene locus_tag LOCUS_24320 2694977 2693514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 2696005 2694974 gene locus_tag LOCUS_24330 2696005 2694974 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_24330 2696340 2697578 gene locus_tag LOCUS_24340 2696340 2697578 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963042.1 protein_id gnl|my_center|LOCUS_24340 2697700 2698566 gene locus_tag LOCUS_24350 2697700 2698566 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195676.1 protein_id gnl|my_center|LOCUS_24350 2698727 2698569 gene locus_tag LOCUS_24360 2698727 2698569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 2699311 2698832 gene locus_tag LOCUS_24370 gene bcp 2699311 2698832 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633710.1 protein_id gnl|my_center|LOCUS_24370 2700132 2699341 gene locus_tag LOCUS_24380 2700132 2699341 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639351.1 protein_id gnl|my_center|LOCUS_24380 2700933 2700139 gene locus_tag LOCUS_24390 2700933 2700139 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521519.1 protein_id gnl|my_center|LOCUS_24390 2702258 2700930 gene locus_tag LOCUS_24400 2702258 2700930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 2702512 2703606 gene locus_tag LOCUS_24410 2702512 2703606 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729005.1 protein_id gnl|my_center|LOCUS_24410 2703768 2705093 gene locus_tag LOCUS_24420 gene hemL 2703768 2705093 CDS product glutamate-1-semialdehyde-2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181462.1 protein_id gnl|my_center|LOCUS_24420 2706052 2705339 gene locus_tag LOCUS_24430 2706052 2705339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 2706459 2706049 gene locus_tag LOCUS_24440 2706459 2706049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 2707413 2706559 gene locus_tag LOCUS_24450 2707413 2706559 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_24450 2708273 2707656 gene locus_tag LOCUS_24460 2708273 2707656 CDS product CalY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172838.1 protein_id gnl|my_center|LOCUS_24460 2708942 2708355 gene locus_tag LOCUS_24470 2708942 2708355 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767813.1 protein_id gnl|my_center|LOCUS_24470 2710111 2708939 gene locus_tag LOCUS_24480 2710111 2708939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 2710590 2710934 gene locus_tag LOCUS_24490 2710590 2710934 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578885.1 protein_id gnl|my_center|LOCUS_24490 2711117 2710944 gene locus_tag LOCUS_24500 2711117 2710944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 2712200 2711430 gene locus_tag LOCUS_24510 gene fabI 2712200 2711430 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421886.1 protein_id gnl|my_center|LOCUS_24510 2713368 2712367 gene locus_tag LOCUS_24520 gene uvsE 2713368 2712367 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961166.1 protein_id gnl|my_center|LOCUS_24520 2713685 2713365 gene locus_tag LOCUS_24530 2713685 2713365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 2715859 2714657 gene locus_tag LOCUS_24540 2715859 2714657 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161413.1 protein_id gnl|my_center|LOCUS_24540 2717109 2716033 gene locus_tag LOCUS_24550 2717109 2716033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 2717520 2720240 gene locus_tag LOCUS_24560 gene acnA 2717520 2720240 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238567.1 protein_id gnl|my_center|LOCUS_24560 2721419 2720328 gene locus_tag LOCUS_24570 2721419 2720328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 2722645 2721416 gene locus_tag LOCUS_24580 2722645 2721416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 2723199 2722828 gene locus_tag LOCUS_24590 2723199 2722828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 2723417 2724667 gene locus_tag LOCUS_24600 2723417 2724667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2725538 2724792 gene locus_tag LOCUS_24610 gene ndgR 2725538 2724792 CDS product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_24610 2725770 2726933 gene locus_tag LOCUS_24620 2725770 2726933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 2727618 2727025 gene locus_tag LOCUS_24630 gene folE 2727618 2727025 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225516.1 protein_id gnl|my_center|LOCUS_24630 2727890 2727666 gene locus_tag LOCUS_24640 2727890 2727666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 2729150 2727996 gene locus_tag LOCUS_24650 gene queG 2729150 2727996 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345215.1 protein_id gnl|my_center|LOCUS_24650 2729864 2729175 gene locus_tag LOCUS_24660 gene lepB 2729864 2729175 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_24660 2730422 2729871 gene locus_tag LOCUS_24670 2730422 2729871 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896978.1 protein_id gnl|my_center|LOCUS_24670 2731050 2730628 gene locus_tag LOCUS_24680 2731050 2730628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 2732399 2731422 gene locus_tag LOCUS_24690 2732399 2731422 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113718.1 protein_id gnl|my_center|LOCUS_24690 2733795 2732389 gene locus_tag LOCUS_24700 2733795 2732389 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_24700 2734917 2734057 gene locus_tag LOCUS_24710 gene rfbD 2734917 2734057 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_24710 2735937 2734921 gene locus_tag LOCUS_24720 gene rfbB 2735937 2734921 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_24720 2736506 2735946 gene locus_tag LOCUS_24730 gene rfbC 2736506 2735946 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721499.1 protein_id gnl|my_center|LOCUS_24730 2737272 2736529 gene locus_tag LOCUS_24740 2737272 2736529 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676157.1 protein_id gnl|my_center|LOCUS_24740 2737502 2737365 gene locus_tag LOCUS_24750 2737502 2737365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 2738127 2737495 gene locus_tag LOCUS_24760 gene gmhA 2738127 2737495 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194315.1 protein_id gnl|my_center|LOCUS_24760 2739246 2738155 gene locus_tag LOCUS_24770 2739246 2738155 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974005.1 protein_id gnl|my_center|LOCUS_24770 2741482 2739281 gene locus_tag LOCUS_24780 2741482 2739281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 2742055 2741513 gene locus_tag LOCUS_24790 gene gmhB 2742055 2741513 CDS product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194255.1 protein_id gnl|my_center|LOCUS_24790 2742743 2742048 gene locus_tag LOCUS_24800 gene hddC 2742743 2742048 CDS product D-glycero-D-manno-heptose 1-phosphate guanosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857908.1 protein_id gnl|my_center|LOCUS_24800 2743788 2742763 gene locus_tag LOCUS_24810 2743788 2742763 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194045.1 protein_id gnl|my_center|LOCUS_24810 2747246 2743785 gene locus_tag LOCUS_24820 2747246 2743785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 2748539 2747259 gene locus_tag LOCUS_24830 2748539 2747259 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289079.1 protein_id gnl|my_center|LOCUS_24830 2750276 2750121 gene locus_tag LOCUS_24840 2750276 2750121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 2751235 2752047 gene locus_tag LOCUS_24850 2751235 2752047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 2752184 2753767 gene locus_tag LOCUS_24860 2752184 2753767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 2754772 2753903 gene locus_tag LOCUS_24870 gene rfbD 2754772 2753903 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_24870 2755803 2754769 gene locus_tag LOCUS_24880 gene rfbB 2755803 2754769 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_24880 2756377 2755811 gene locus_tag LOCUS_24890 gene rfbC 2756377 2755811 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721499.1 protein_id gnl|my_center|LOCUS_24890 2756633 2757244 gene locus_tag LOCUS_24900 gene sodA 2756633 2757244 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_24900 2757681 2759891 gene locus_tag LOCUS_24910 2757681 2759891 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060825866.1 protein_id gnl|my_center|LOCUS_24910 2760008 2760877 gene locus_tag LOCUS_24920 2760008 2760877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 2763759 2762080 gene locus_tag LOCUS_24930 gene araB 2763759 2762080 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 protein_id gnl|my_center|LOCUS_24930 2765196 2764213 gene locus_tag LOCUS_24940 2765196 2764213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 2766128 2765250 gene locus_tag LOCUS_24950 gene galU 2766128 2765250 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890959.1 protein_id gnl|my_center|LOCUS_24950 2766851 2766237 gene locus_tag LOCUS_24960 2766851 2766237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 2767022 2767972 gene locus_tag LOCUS_24970 gene trxB 2767022 2767972 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_24970 2768006 2768449 gene locus_tag LOCUS_24980 2768006 2768449 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229083.1 protein_id gnl|my_center|LOCUS_24980 2769489 2768602 gene locus_tag LOCUS_24990 2769489 2768602 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966961.1 protein_id gnl|my_center|LOCUS_24990 2769673 2771130 gene locus_tag LOCUS_25000 2769673 2771130 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233074.1 protein_id gnl|my_center|LOCUS_25000 2771286 2771504 gene locus_tag LOCUS_25010 2771286 2771504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 2772484 2771930 gene locus_tag LOCUS_25020 2772484 2771930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 2774515 2772578 gene locus_tag LOCUS_25030 2774515 2772578 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460031.1 protein_id gnl|my_center|LOCUS_25030 2775808 2774765 gene locus_tag LOCUS_25040 2775808 2774765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 2775935 2776723 gene locus_tag LOCUS_25050 2775935 2776723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 2777566 2776868 gene locus_tag LOCUS_25060 2777566 2776868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 2778517 2777873 gene locus_tag LOCUS_25070 2778517 2777873 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461702.1 protein_id gnl|my_center|LOCUS_25070 2778624 2779589 gene locus_tag LOCUS_25080 gene rhaR 2778624 2779589 CDS product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230731.1 protein_id gnl|my_center|LOCUS_25080 2780475 2779732 gene locus_tag LOCUS_25090 2780475 2779732 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628423.1 protein_id gnl|my_center|LOCUS_25090 2780773 2780585 gene locus_tag LOCUS_25100 2780773 2780585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 2781139 2780966 gene locus_tag LOCUS_25110 2781139 2780966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 2781690 2781253 gene locus_tag LOCUS_25120 2781690 2781253 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944306.1 protein_id gnl|my_center|LOCUS_25120 2783417 2781687 gene locus_tag LOCUS_25130 gene lcfA 2783417 2781687 CDS product long-chain-fatty-acid--CoA ligase LcfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399166.1 protein_id gnl|my_center|LOCUS_25130 2786073 2784280 gene locus_tag LOCUS_25140 2786073 2784280 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416279.1 protein_id gnl|my_center|LOCUS_25140 2787522 2786323 gene locus_tag LOCUS_25150 2787522 2786323 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228574.1 protein_id gnl|my_center|LOCUS_25150 2790057 2787640 gene locus_tag LOCUS_25160 2790057 2787640 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243831.1 protein_id gnl|my_center|LOCUS_25160 2792548 2790224 gene locus_tag LOCUS_25170 2792548 2790224 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086770.1 protein_id gnl|my_center|LOCUS_25170 2792784 2793752 gene locus_tag LOCUS_25180 2792784 2793752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 2793992 2794375 gene locus_tag LOCUS_25190 2793992 2794375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 2794336 2795013 gene locus_tag LOCUS_25200 2794336 2795013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25200 2799707 2795427 gene locus_tag LOCUS_25210 2799707 2795427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 2800135 2799965 gene locus_tag LOCUS_25220 2800135 2799965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 2800575 2800264 gene locus_tag LOCUS_25230 2800575 2800264 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527935.1 protein_id gnl|my_center|LOCUS_25230 2801308 2800733 gene locus_tag LOCUS_25240 2801308 2800733 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016125602.1 protein_id gnl|my_center|LOCUS_25240 2801439 2802260 gene locus_tag LOCUS_25250 2801439 2802260 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_25250 2802695 2803966 gene locus_tag LOCUS_25260 gene ilvA 2802695 2803966 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250222.1 protein_id gnl|my_center|LOCUS_25260 2804159 2805295 gene locus_tag LOCUS_25270 2804159 2805295 CDS product diglucosyl diacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594708.1 protein_id gnl|my_center|LOCUS_25270 2805337 2806521 gene locus_tag LOCUS_25280 2805337 2806521 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795545.1 protein_id gnl|my_center|LOCUS_25280 2806551 2807156 gene locus_tag LOCUS_25290 2806551 2807156 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886465.1 protein_id gnl|my_center|LOCUS_25290 2807186 2807488 gene locus_tag LOCUS_25300 2807186 2807488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 2807612 2807755 gene locus_tag LOCUS_25310 2807612 2807755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 2807858 2808151 gene locus_tag LOCUS_25320 2807858 2808151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 2808317 2808898 gene locus_tag LOCUS_25330 2808317 2808898 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789731.1 protein_id gnl|my_center|LOCUS_25330 2808858 2810060 gene locus_tag LOCUS_25340 2808858 2810060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 2811262 2810222 gene locus_tag LOCUS_25350 2811262 2810222 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765785.1 protein_id gnl|my_center|LOCUS_25350 2811531 2812514 gene locus_tag LOCUS_25360 2811531 2812514 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411603.1 protein_id gnl|my_center|LOCUS_25360 2814344 2812542 gene locus_tag LOCUS_25370 2814344 2812542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 2814522 2815013 gene locus_tag LOCUS_25380 gene mscL 2814522 2815013 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_25380 2815017 2815676 gene locus_tag LOCUS_25390 2815017 2815676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 2816325 2815600 gene locus_tag LOCUS_25400 2816325 2815600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2816936 2816520 gene locus_tag LOCUS_25410 2816936 2816520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 2817016 2817180 gene locus_tag LOCUS_25420 2817016 2817180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 2817580 2817506 gene locus_tag LOCUS_t00270 2817580 2817506 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2819252 2817678 gene locus_tag LOCUS_25430 2819252 2817678 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173227432.1 protein_id gnl|my_center|LOCUS_25430 2819497 2819715 gene locus_tag LOCUS_25440 2819497 2819715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 2820753 2820028 gene locus_tag LOCUS_25450 2820753 2820028 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_25450 2824796 2820882 gene locus_tag LOCUS_25460 2824796 2820882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 2825123 2824869 gene locus_tag LOCUS_25470 2825123 2824869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 2825574 2826467 gene locus_tag LOCUS_25480 2825574 2826467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 2828213 2826756 gene locus_tag LOCUS_25490 2828213 2826756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 2829141 2828254 gene locus_tag LOCUS_25500 2829141 2828254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 2830297 2829344 gene locus_tag LOCUS_25510 2830297 2829344 CDS product DUF4097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989527.1 protein_id gnl|my_center|LOCUS_25510 2830851 2830294 gene locus_tag LOCUS_25520 2830851 2830294 CDS product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032393.1 protein_id gnl|my_center|LOCUS_25520 2831168 2830848 gene locus_tag LOCUS_25530 2831168 2830848 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102620.1 protein_id gnl|my_center|LOCUS_25530 2831387 2832262 gene locus_tag LOCUS_25540 2831387 2832262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142558.1 protein_id gnl|my_center|LOCUS_25540 2832509 2833582 gene locus_tag LOCUS_25550 2832509 2833582 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289709.1 protein_id gnl|my_center|LOCUS_25550 2833847 2833656 gene locus_tag LOCUS_25560 2833847 2833656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 2837117 2833995 gene locus_tag LOCUS_25570 gene lacZ 2837117 2833995 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_25570 2838800 2837322 gene locus_tag LOCUS_25580 2838800 2837322 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582770.1 protein_id gnl|my_center|LOCUS_25580 2839833 2839003 gene locus_tag LOCUS_25590 2839833 2839003 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975929.1 protein_id gnl|my_center|LOCUS_25590 2840739 2839837 gene locus_tag LOCUS_25600 2840739 2839837 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233835.1 protein_id gnl|my_center|LOCUS_25600 2842236 2840803 gene locus_tag LOCUS_25610 2842236 2840803 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582770.1 protein_id gnl|my_center|LOCUS_25610 2845403 2842659 gene locus_tag LOCUS_25620 2845403 2842659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2846755 2845421 gene locus_tag LOCUS_25630 2846755 2845421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 2848053 2847091 gene locus_tag LOCUS_25640 2848053 2847091 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059329.1 protein_id gnl|my_center|LOCUS_25640 2848979 2848065 gene locus_tag LOCUS_25650 2848979 2848065 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058303659.1 protein_id gnl|my_center|LOCUS_25650 2849143 2850654 gene locus_tag LOCUS_25660 gene abfA 2849143 2850654 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_25660 2851036 2851407 gene locus_tag LOCUS_25670 2851036 2851407 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800772.1 protein_id gnl|my_center|LOCUS_25670 2853437 2851713 gene locus_tag LOCUS_25680 2853437 2851713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 2854117 2853434 gene locus_tag LOCUS_25690 2854117 2853434 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424455.1 protein_id gnl|my_center|LOCUS_25690 2854637 2854344 gene locus_tag LOCUS_25700 2854637 2854344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 2855685 2854735 gene locus_tag LOCUS_25710 gene corA 2855685 2854735 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233650.1 protein_id gnl|my_center|LOCUS_25710 2856472 2855768 gene locus_tag LOCUS_25720 2856472 2855768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 2857916 2856501 gene locus_tag LOCUS_25730 2857916 2856501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 2858796 2858197 gene locus_tag LOCUS_25740 2858796 2858197 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619237.1 protein_id gnl|my_center|LOCUS_25740 2860023 2858878 gene locus_tag LOCUS_25750 2860023 2858878 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890391.1 protein_id gnl|my_center|LOCUS_25750 2860780 2860028 gene locus_tag LOCUS_25760 2860780 2860028 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202429.1 protein_id gnl|my_center|LOCUS_25760 2861752 2860862 gene locus_tag LOCUS_25770 2861752 2860862 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411125.1 protein_id gnl|my_center|LOCUS_25770 2863222 2862275 gene locus_tag LOCUS_25780 2863222 2862275 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832962.1 protein_id gnl|my_center|LOCUS_25780 2863780 2863325 gene locus_tag LOCUS_25790 2863780 2863325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 2864538 2863972 gene locus_tag LOCUS_25800 gene padR 2864538 2863972 CDS product transcriptional regulator PadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233588.1 protein_id gnl|my_center|LOCUS_25800 2864752 2865252 gene locus_tag LOCUS_25810 2864752 2865252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 2865371 2865739 gene locus_tag LOCUS_25820 2865371 2865739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 2865962 2868346 gene locus_tag LOCUS_25830 2865962 2868346 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256094.1 protein_id gnl|my_center|LOCUS_25830 2868459 2869250 gene locus_tag LOCUS_25840 gene fdhD 2868459 2869250 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227709.1 protein_id gnl|my_center|LOCUS_25840 2869303 2869740 gene locus_tag LOCUS_25850 2869303 2869740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 2869785 2870228 gene locus_tag LOCUS_25860 2869785 2870228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 2871987 2870374 gene locus_tag LOCUS_25870 2871987 2870374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 2873791 2871998 gene locus_tag LOCUS_25880 2873791 2871998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 2874688 2873810 gene locus_tag LOCUS_25890 2874688 2873810 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_25890 2875597 2874701 gene locus_tag LOCUS_25900 2875597 2874701 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_25900 2877500 2875704 gene locus_tag LOCUS_25910 2877500 2875704 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_25910 2878242 2877739 gene locus_tag LOCUS_25920 2878242 2877739 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905907.1 protein_id gnl|my_center|LOCUS_25920 2878521 2878811 gene locus_tag LOCUS_25930 2878521 2878811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 2878804 2879604 gene locus_tag LOCUS_25940 2878804 2879604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 2880536 2879682 gene locus_tag LOCUS_25950 2880536 2879682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 2882136 2880643 gene locus_tag LOCUS_25960 2882136 2880643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 2884057 2882258 gene locus_tag LOCUS_25970 2884057 2882258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2884589 2884227 gene locus_tag LOCUS_25980 2884589 2884227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 2885512 2884679 gene locus_tag LOCUS_25990 2885512 2884679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 2886420 2885539 gene locus_tag LOCUS_26000 2886420 2885539 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375198.1 protein_id gnl|my_center|LOCUS_26000 2887611 2886538 gene locus_tag LOCUS_26010 2887611 2886538 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_26010 2887726 2888583 gene locus_tag LOCUS_26020 2887726 2888583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 2888730 2889932 gene locus_tag LOCUS_26030 2888730 2889932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 2890612 2890025 gene locus_tag LOCUS_26040 gene gmk 2890612 2890025 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185877.1 protein_id gnl|my_center|LOCUS_26040 2890912 2891742 gene locus_tag LOCUS_26050 2890912 2891742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 2891901 2893193 gene locus_tag LOCUS_26060 2891901 2893193 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247133.1 protein_id gnl|my_center|LOCUS_26060 2893477 2893704 gene locus_tag LOCUS_26070 2893477 2893704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 2893779 2894483 gene locus_tag LOCUS_26080 2893779 2894483 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243047.1 protein_id gnl|my_center|LOCUS_26080 2894684 2894499 gene locus_tag LOCUS_26090 2894684 2894499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 2895202 2894693 gene locus_tag LOCUS_26100 2895202 2894693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955014.1 protein_id gnl|my_center|LOCUS_26100 2895753 2896676 gene locus_tag LOCUS_26110 2895753 2896676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 2896687 2897685 gene locus_tag LOCUS_26120 2896687 2897685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 2897707 2898675 gene locus_tag LOCUS_26130 2897707 2898675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 2898785 2899039 gene locus_tag LOCUS_26140 2898785 2899039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 2900308 2899112 gene locus_tag LOCUS_26150 2900308 2899112 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531927.1 protein_id gnl|my_center|LOCUS_26150 2901132 2900305 gene locus_tag LOCUS_26160 2901132 2900305 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531924.1 protein_id gnl|my_center|LOCUS_26160 2902013 2901132 gene locus_tag LOCUS_26170 2902013 2901132 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434064.1 protein_id gnl|my_center|LOCUS_26170 2903405 2902089 gene locus_tag LOCUS_26180 2903405 2902089 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972818.1 protein_id gnl|my_center|LOCUS_26180 2904183 2903506 gene locus_tag LOCUS_26190 2904183 2903506 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039573.1 protein_id gnl|my_center|LOCUS_26190 2904860 2904366 gene locus_tag LOCUS_26200 gene infC 2904860 2904366 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583670.1 protein_id gnl|my_center|LOCUS_26200 2905095 2911109 gene locus_tag LOCUS_26210 2905095 2911109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 2912135 2911245 gene locus_tag LOCUS_26220 2912135 2911245 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722221.1 protein_id gnl|my_center|LOCUS_26220 2912743 2912288 gene locus_tag LOCUS_26230 2912743 2912288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 2913349 2912834 gene locus_tag LOCUS_26240 2913349 2912834 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947340.1 protein_id gnl|my_center|LOCUS_26240 2913975 2913391 gene locus_tag LOCUS_26250 2913975 2913391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 2914411 2913977 gene locus_tag LOCUS_26260 2914411 2913977 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016124783.1 protein_id gnl|my_center|LOCUS_26260 2915010 2914483 gene locus_tag LOCUS_26270 2915010 2914483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 2915784 2915155 gene locus_tag LOCUS_26280 2915784 2915155 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_26280 2916545 2915976 gene locus_tag LOCUS_26290 2916545 2915976 CDS product methylated-DNA--protein-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089815.1 protein_id gnl|my_center|LOCUS_26290 2917140 2916703 gene locus_tag LOCUS_26300 2917140 2916703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 2918079 2917168 gene locus_tag LOCUS_26310 2918079 2917168 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544125.1 protein_id gnl|my_center|LOCUS_26310 2919092 2918076 gene locus_tag LOCUS_26320 2919092 2918076 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291145.1 protein_id gnl|my_center|LOCUS_26320 2919962 2919120 gene locus_tag LOCUS_26330 2919962 2919120 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065285.1 protein_id gnl|my_center|LOCUS_26330 2920917 2919967 gene locus_tag LOCUS_26340 2920917 2919967 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278778.1 protein_id gnl|my_center|LOCUS_26340 2922616 2920991 gene locus_tag LOCUS_26350 2922616 2920991 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727693.1 protein_id gnl|my_center|LOCUS_26350 2923472 2922918 gene locus_tag LOCUS_26360 2923472 2922918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 2924106 2923525 gene locus_tag LOCUS_26370 2924106 2923525 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540175.1 protein_id gnl|my_center|LOCUS_26370 2924298 2925278 gene locus_tag LOCUS_26380 2924298 2925278 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272199.1 protein_id gnl|my_center|LOCUS_26380 2925697 2925428 gene locus_tag LOCUS_26390 2925697 2925428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 2925720 2926742 gene locus_tag LOCUS_26400 2925720 2926742 CDS product MsnO8 family LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228318.1 protein_id gnl|my_center|LOCUS_26400 2927197 2926847 gene locus_tag LOCUS_26410 2927197 2926847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 2928256 2927312 gene locus_tag LOCUS_26420 2928256 2927312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065581.1 protein_id gnl|my_center|LOCUS_26420 2929346 2928282 gene locus_tag LOCUS_26430 2929346 2928282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 2931177 2929369 gene locus_tag LOCUS_26440 gene bmrD 2931177 2929369 CDS product multidrug resistance ABC transporter ATP-binding protein/permease BmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233292.1 protein_id gnl|my_center|LOCUS_26440 2932989 2931247 gene locus_tag LOCUS_26450 2932989 2931247 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493192.1 protein_id gnl|my_center|LOCUS_26450 2933943 2933023 gene locus_tag LOCUS_26460 2933943 2933023 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226734.1 protein_id gnl|my_center|LOCUS_26460 2934294 2933986 gene locus_tag LOCUS_26470 2934294 2933986 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017800955.1 protein_id gnl|my_center|LOCUS_26470 2934619 2935854 gene locus_tag LOCUS_26480 2934619 2935854 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007349.1 protein_id gnl|my_center|LOCUS_26480 2936798 2936055 gene locus_tag LOCUS_26490 2936798 2936055 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774590.1 protein_id gnl|my_center|LOCUS_26490 2937449 2936799 gene locus_tag LOCUS_26500 2937449 2936799 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705158.1 protein_id gnl|my_center|LOCUS_26500 2938391 2937489 gene locus_tag LOCUS_26510 2938391 2937489 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462202.1 protein_id gnl|my_center|LOCUS_26510 2940908 2938572 gene locus_tag LOCUS_26520 2940908 2938572 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110899006.1 protein_id gnl|my_center|LOCUS_26520 2942812 2941553 gene locus_tag LOCUS_26530 2942812 2941553 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058331.1 protein_id gnl|my_center|LOCUS_26530 2945198 2944017 gene locus_tag LOCUS_26540 2945198 2944017 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161410139.1 protein_id gnl|my_center|LOCUS_26540 2947029 2945170 gene locus_tag LOCUS_26550 2947029 2945170 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_26550 2947905 2947081 gene locus_tag LOCUS_26560 2947905 2947081 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385216.1 protein_id gnl|my_center|LOCUS_26560 2948813 2947923 gene locus_tag LOCUS_26570 2948813 2947923 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_26570 2950334 2948970 gene locus_tag LOCUS_26580 2950334 2948970 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243455.1 protein_id gnl|my_center|LOCUS_26580 2950525 2951163 gene locus_tag LOCUS_26590 2950525 2951163 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461121.1 protein_id gnl|my_center|LOCUS_26590 2951868 2951263 gene locus_tag LOCUS_26600 2951868 2951263 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438383.1 protein_id gnl|my_center|LOCUS_26600 2952024 2952785 gene locus_tag LOCUS_26610 2952024 2952785 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722299.1 protein_id gnl|my_center|LOCUS_26610 2954079 2952892 gene locus_tag LOCUS_26620 2954079 2952892 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226955.1 protein_id gnl|my_center|LOCUS_26620 2954851 2954312 gene locus_tag LOCUS_26630 2954851 2954312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 2955108 2954959 gene locus_tag LOCUS_26640 2955108 2954959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 2955964 2955260 gene locus_tag LOCUS_26650 2955964 2955260 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_26650 2956081 2956389 gene locus_tag LOCUS_26660 2956081 2956389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 2956644 2956402 gene locus_tag LOCUS_26670 2956644 2956402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 2956776 2957708 gene locus_tag LOCUS_26680 2956776 2957708 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_26680 2958789 2957845 gene locus_tag LOCUS_26690 2958789 2957845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 2959675 2958857 gene locus_tag LOCUS_26700 2959675 2958857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 2959778 2959596 gene locus_tag LOCUS_26710 2959778 2959596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 2959941 2960495 gene locus_tag LOCUS_26720 2959941 2960495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 2960584 2962488 gene locus_tag LOCUS_26730 2960584 2962488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2962478 2964217 gene locus_tag LOCUS_26740 2962478 2964217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 2964372 2965340 gene locus_tag LOCUS_26750 2964372 2965340 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_26750 2965354 2966292 gene locus_tag LOCUS_26760 2965354 2966292 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 protein_id gnl|my_center|LOCUS_26760 2966378 2967937 gene locus_tag LOCUS_26770 2966378 2967937 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_26770 2968823 2968029 gene locus_tag LOCUS_26780 gene pdaA 2968823 2968029 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875972.1 protein_id gnl|my_center|LOCUS_26780 2968986 2969576 gene locus_tag LOCUS_26790 2968986 2969576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 2969613 2969828 gene locus_tag LOCUS_26800 2969613 2969828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 2970902 2969898 gene locus_tag LOCUS_26810 2970902 2969898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 2972146 2971235 gene locus_tag LOCUS_26820 2972146 2971235 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446816.1 protein_id gnl|my_center|LOCUS_26820 2972209 2972445 gene locus_tag LOCUS_26830 2972209 2972445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 2972582 2973187 gene locus_tag LOCUS_26840 2972582 2973187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 2973776 2973258 gene locus_tag LOCUS_26850 2973776 2973258 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701718.1 protein_id gnl|my_center|LOCUS_26850 2974835 2973981 gene locus_tag LOCUS_26860 2974835 2973981 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528056.1 protein_id gnl|my_center|LOCUS_26860 2975225 2974863 gene locus_tag LOCUS_26870 2975225 2974863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2975912 2975577 gene locus_tag LOCUS_26880 2975912 2975577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 2976171 2976007 gene locus_tag LOCUS_26890 2976171 2976007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 2978409 2976508 gene locus_tag LOCUS_26900 2978409 2976508 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_26900 2978600 2979454 gene locus_tag LOCUS_26910 2978600 2979454 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966961.1 protein_id gnl|my_center|LOCUS_26910 2980005 2979562 gene locus_tag LOCUS_26920 2980005 2979562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 2980406 2980083 gene locus_tag LOCUS_26930 2980406 2980083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 2982428 2981127 gene locus_tag LOCUS_26940 2982428 2981127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 2982925 2982455 gene locus_tag LOCUS_26950 2982925 2982455 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224743.1 protein_id gnl|my_center|LOCUS_26950 2983765 2983106 gene locus_tag LOCUS_26960 2983765 2983106 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768018.1 protein_id gnl|my_center|LOCUS_26960 2983928 2984545 gene locus_tag LOCUS_26970 2983928 2984545 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476519.1 protein_id gnl|my_center|LOCUS_26970 2984959 2984546 gene locus_tag LOCUS_26980 2984959 2984546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 2985994 2985026 gene locus_tag LOCUS_26990 2985994 2985026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 2986820 2986179 gene locus_tag LOCUS_27000 2986820 2986179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 2987360 2987007 gene locus_tag LOCUS_27010 2987360 2987007 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356348.1 protein_id gnl|my_center|LOCUS_27010 2987504 2987857 gene locus_tag LOCUS_27020 2987504 2987857 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947400.1 protein_id gnl|my_center|LOCUS_27020 2989813 2987897 gene locus_tag LOCUS_27030 2989813 2987897 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860962.1 protein_id gnl|my_center|LOCUS_27030 2990435 2989875 gene locus_tag LOCUS_27040 2990435 2989875 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680597.1 protein_id gnl|my_center|LOCUS_27040 2991038 2990607 gene locus_tag LOCUS_27050 2991038 2990607 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114199.1 protein_id gnl|my_center|LOCUS_27050 2991660 2991148 gene locus_tag LOCUS_27060 2991660 2991148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 2991891 2993108 gene locus_tag LOCUS_27070 gene yxjM 2991891 2993108 CDS product two-component system sensor histidine kinase YxjM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244524.1 protein_id gnl|my_center|LOCUS_27070 2993056 2993763 gene locus_tag LOCUS_27080 gene yxjL 2993056 2993763 CDS product two-component system response regulator YxJL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243101.1 protein_id gnl|my_center|LOCUS_27080 2994225 2993893 gene locus_tag LOCUS_27090 2994225 2993893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 2995281 2994277 gene locus_tag LOCUS_27100 2995281 2994277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 2996469 2995798 gene locus_tag LOCUS_27110 2996469 2995798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 2996761 2997834 gene locus_tag LOCUS_27120 2996761 2997834 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 protein_id gnl|my_center|LOCUS_27120 2998441 2997956 gene locus_tag LOCUS_27130 2998441 2997956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 2998678 2999055 gene locus_tag LOCUS_27140 2998678 2999055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 2999981 2999121 gene locus_tag LOCUS_27150 2999981 2999121 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_27150 3000168 3001082 gene locus_tag LOCUS_27160 3000168 3001082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 3001146 3004451 gene locus_tag LOCUS_27170 3001146 3004451 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011074.1 protein_id gnl|my_center|LOCUS_27170 3005315 3004734 gene locus_tag LOCUS_27180 3005315 3004734 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328266.1 protein_id gnl|my_center|LOCUS_27180 3006513 3005428 gene locus_tag LOCUS_27190 3006513 3005428 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267915.1 protein_id gnl|my_center|LOCUS_27190 3007928 3007086 gene locus_tag LOCUS_27200 gene yeaE 3007928 3007086 CDS product methylglyoxal reductase YeaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186361.1 protein_id gnl|my_center|LOCUS_27200 3008131 3007922 gene locus_tag LOCUS_27210 3008131 3007922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 3008475 3008032 gene locus_tag LOCUS_27220 3008475 3008032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 3011472 3009199 gene locus_tag LOCUS_27230 3011472 3009199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 3011594 3012379 gene locus_tag LOCUS_27240 3011594 3012379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 3012815 3013111 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgcttttcctccaatgtactgcactgggtgca 3013398 3014336 gene locus_tag LOCUS_27250 3013398 3014336 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221977.1 protein_id gnl|my_center|LOCUS_27250 3014333 3015124 gene locus_tag LOCUS_27260 gene lieB 3014333 3015124 CDS product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 protein_id gnl|my_center|LOCUS_27260 3016051 3015239 gene locus_tag LOCUS_27270 3016051 3015239 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029601.1 protein_id gnl|my_center|LOCUS_27270 3016767 3016174 gene locus_tag LOCUS_27280 3016767 3016174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 3017328 3016948 gene locus_tag LOCUS_27290 3017328 3016948 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036534.1 protein_id gnl|my_center|LOCUS_27290 3019126 3017387 gene locus_tag LOCUS_27300 3019126 3017387 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809608.1 protein_id gnl|my_center|LOCUS_27300 3019324 3019809 gene locus_tag LOCUS_27310 3019324 3019809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 3020600 3019902 gene locus_tag LOCUS_27320 3020600 3019902 CDS product (S)-benzoin forming benzil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271070.1 protein_id gnl|my_center|LOCUS_27320 3021959 3020784 gene locus_tag LOCUS_27330 3021959 3020784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 3022420 3022256 gene locus_tag LOCUS_27340 3022420 3022256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 3022356 3022649 gene locus_tag LOCUS_27350 3022356 3022649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 3023314 3022763 gene locus_tag LOCUS_27360 3023314 3022763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 3023487 3025853 gene locus_tag LOCUS_27370 3023487 3025853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 3025987 3026775 gene locus_tag LOCUS_27380 3025987 3026775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 3027486 3027271 gene locus_tag LOCUS_27390 3027486 3027271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 3027703 3027458 gene locus_tag LOCUS_27400 3027703 3027458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 3028786 3028001 gene locus_tag LOCUS_27410 3028786 3028001 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897816.1 protein_id gnl|my_center|LOCUS_27410 3029133 3028930 gene locus_tag LOCUS_27420 3029133 3028930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 3030129 3029251 gene locus_tag LOCUS_27430 gene gmuE 3030129 3029251 CDS product fructokinase GmuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234095.1 protein_id gnl|my_center|LOCUS_27430 3030995 3030147 gene locus_tag LOCUS_27440 3030995 3030147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 3032259 3030973 gene locus_tag LOCUS_27450 3032259 3030973 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233297.1 protein_id gnl|my_center|LOCUS_27450 3032739 3032918 gene locus_tag LOCUS_27460 3032739 3032918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 3034098 3033016 gene locus_tag LOCUS_27470 3034098 3033016 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_27470 3034917 3034603 gene locus_tag LOCUS_27480 3034917 3034603 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002008881.1 protein_id gnl|my_center|LOCUS_27480 3035400 3035038 gene locus_tag LOCUS_27490 3035400 3035038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 3037917 3035524 gene locus_tag LOCUS_27500 3037917 3035524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 3038630 3037950 gene locus_tag LOCUS_27510 3038630 3037950 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 protein_id gnl|my_center|LOCUS_27510 3040059 3038758 gene locus_tag LOCUS_27520 gene pbuO 3040059 3038758 CDS product hypoxanthine/guanine permease PbuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229234.1 protein_id gnl|my_center|LOCUS_27520 3040279 3042045 gene locus_tag LOCUS_27530 3040279 3042045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 3042042 3045302 gene locus_tag LOCUS_27540 3042042 3045302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 3045379 3045852 gene locus_tag LOCUS_27550 3045379 3045852 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759735.1 protein_id gnl|my_center|LOCUS_27550 3047169 3046396 gene locus_tag LOCUS_27560 3047169 3046396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 3047453 3048739 gene locus_tag LOCUS_27570 3047453 3048739 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930645.1 protein_id gnl|my_center|LOCUS_27570 3049047 3051191 gene locus_tag LOCUS_27580 3049047 3051191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 3051820 3051260 gene locus_tag LOCUS_27590 3051820 3051260 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020694.1 protein_id gnl|my_center|LOCUS_27590 3051980 3052660 gene locus_tag LOCUS_27600 3051980 3052660 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_27600 3052657 3053430 gene locus_tag LOCUS_27610 3052657 3053430 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982927.1 protein_id gnl|my_center|LOCUS_27610 3053590 3053402 gene locus_tag LOCUS_27620 3053590 3053402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 3053712 3053939 gene locus_tag LOCUS_27630 3053712 3053939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 3054618 3054118 gene locus_tag LOCUS_27640 3054618 3054118 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775411.1 protein_id gnl|my_center|LOCUS_27640 3055818 3054880 gene locus_tag LOCUS_27650 gene mmuM 3055818 3054880 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246467.1 protein_id gnl|my_center|LOCUS_27650 3056968 3055859 gene locus_tag LOCUS_27660 3056968 3055859 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036241.1 protein_id gnl|my_center|LOCUS_27660 3057733 3056996 gene locus_tag LOCUS_27670 3057733 3056996 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623610.1 protein_id gnl|my_center|LOCUS_27670 3058452 3057730 gene locus_tag LOCUS_27680 3058452 3057730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 3059337 3058474 gene locus_tag LOCUS_27690 gene tcyJ 3059337 3058474 CDS product sulfur-containing amino acid ABC transporter substrate-binding protein TcyJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399114.1 protein_id gnl|my_center|LOCUS_27690 3060228 3059659 gene locus_tag LOCUS_27700 3060228 3059659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 3061792 3060500 gene locus_tag LOCUS_27710 3061792 3060500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 3063352 3062288 gene locus_tag LOCUS_27720 gene malR 3063352 3062288 CDS product maltose operon transcriptional repressor MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219042.1 protein_id gnl|my_center|LOCUS_27720 3069389 3063474 gene locus_tag LOCUS_27730 3069389 3063474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 3070410 3069532 gene locus_tag LOCUS_27740 3070410 3069532 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_27740 3071382 3070420 gene locus_tag LOCUS_27750 gene rmgP 3071382 3070420 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_27750 3073128 3071458 gene locus_tag LOCUS_27760 3073128 3071458 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_27760 3074267 3073950 gene locus_tag LOCUS_27770 3074267 3073950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 3074571 3075116 gene locus_tag LOCUS_27780 3074571 3075116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 3075160 3076068 gene locus_tag LOCUS_27790 3075160 3076068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 3077917 3076469 gene locus_tag LOCUS_27800 3077917 3076469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 3078345 3078079 gene locus_tag LOCUS_27810 3078345 3078079 CDS product CD3324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229850.1 protein_id gnl|my_center|LOCUS_27810 3080088 3078634 gene locus_tag LOCUS_27820 3080088 3078634 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963676.1 protein_id gnl|my_center|LOCUS_27820 3080315 3080088 gene locus_tag LOCUS_27830 3080315 3080088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 3082376 3080685 gene locus_tag LOCUS_27840 3082376 3080685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 3083120 3082608 gene locus_tag LOCUS_27850 3083120 3082608 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244690.1 protein_id gnl|my_center|LOCUS_27850 3083911 3083165 gene locus_tag LOCUS_27860 gene pdaB 3083911 3083165 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945995.1 protein_id gnl|my_center|LOCUS_27860 3084664 3084044 gene locus_tag LOCUS_27870 3084664 3084044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27870 3086454 3084958 gene locus_tag LOCUS_27880 3086454 3084958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203329.1 protein_id gnl|my_center|LOCUS_27880 3086579 3087463 gene locus_tag LOCUS_27890 3086579 3087463 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966961.1 protein_id gnl|my_center|LOCUS_27890 3088711 3087587 gene locus_tag LOCUS_27900 3088711 3087587 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816491.1 protein_id gnl|my_center|LOCUS_27900 3089555 3088875 gene locus_tag LOCUS_27910 3089555 3088875 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966920.1 protein_id gnl|my_center|LOCUS_27910 3090536 3089727 gene locus_tag LOCUS_27920 3090536 3089727 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776877.1 protein_id gnl|my_center|LOCUS_27920 3090667 3091548 gene locus_tag LOCUS_27930 3090667 3091548 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729459.1 protein_id gnl|my_center|LOCUS_27930 3091640 3092056 gene locus_tag LOCUS_27940 3091640 3092056 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340503.1 protein_id gnl|my_center|LOCUS_27940 3092135 3092680 gene locus_tag LOCUS_27950 3092135 3092680 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438330.1 protein_id gnl|my_center|LOCUS_27950 3092667 3093449 gene locus_tag LOCUS_27960 3092667 3093449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 3095477 3093585 gene locus_tag LOCUS_27970 gene htpG 3095477 3093585 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 protein_id gnl|my_center|LOCUS_27970 3095740 3096357 gene locus_tag LOCUS_27980 gene udk 3095740 3096357 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225916.1 protein_id gnl|my_center|LOCUS_27980 3097181 3096642 gene locus_tag LOCUS_27990 3097181 3096642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 3097407 3098258 gene locus_tag LOCUS_28000 3097407 3098258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 3098191 3098466 gene locus_tag LOCUS_28010 3098191 3098466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 3099492 3099136 gene locus_tag LOCUS_28020 3099492 3099136 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084925.1 protein_id gnl|my_center|LOCUS_28020 3100757 3099648 gene locus_tag LOCUS_28030 3100757 3099648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 3102545 3100785 gene locus_tag LOCUS_28040 3102545 3100785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 3104455 3102587 gene locus_tag LOCUS_28050 3104455 3102587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 3105864 3104518 gene locus_tag LOCUS_28060 3105864 3104518 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022298.1 protein_id gnl|my_center|LOCUS_28060 3107358 3105916 gene locus_tag LOCUS_28070 3107358 3105916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 3107623 3107447 gene locus_tag LOCUS_28080 3107623 3107447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 3108398 3107664 gene locus_tag LOCUS_28090 3108398 3107664 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722832.1 protein_id gnl|my_center|LOCUS_28090 3109415 3108570 gene locus_tag LOCUS_28100 gene iolO 3109415 3108570 CDS product 5-keto-L-gluconate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083268.1 protein_id gnl|my_center|LOCUS_28100 3113095 3109460 gene locus_tag LOCUS_28110 3113095 3109460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 3114148 3113258 gene locus_tag LOCUS_28120 3114148 3113258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 3114287 3115900 gene locus_tag LOCUS_28130 3114287 3115900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 3116376 3117236 gene locus_tag LOCUS_28140 3116376 3117236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115327.1 protein_id gnl|my_center|LOCUS_28140 3118232 3117378 gene locus_tag LOCUS_28150 3118232 3117378 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892682.1 protein_id gnl|my_center|LOCUS_28150 3118501 3118310 gene locus_tag LOCUS_28160 3118501 3118310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 3118488 3118940 gene locus_tag LOCUS_28170 3118488 3118940 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130472.1 protein_id gnl|my_center|LOCUS_28170 3119038 3122793 gene locus_tag LOCUS_28180 3119038 3122793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 3124321 3123143 gene locus_tag LOCUS_28190 3124321 3123143 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232765.1 protein_id gnl|my_center|LOCUS_28190 3124815 3124381 gene locus_tag LOCUS_28200 3124815 3124381 CDS product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115309.1 protein_id gnl|my_center|LOCUS_28200 3126091 3125324 gene locus_tag LOCUS_28210 3126091 3125324 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021175.1 protein_id gnl|my_center|LOCUS_28210 3127544 3126240 gene locus_tag LOCUS_28220 3127544 3126240 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439084.1 protein_id gnl|my_center|LOCUS_28220 3129032 3127641 gene locus_tag LOCUS_28230 3129032 3127641 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989199.1 protein_id gnl|my_center|LOCUS_28230 3129363 3130280 gene locus_tag LOCUS_28240 3129363 3130280 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966649.1 protein_id gnl|my_center|LOCUS_28240 3130756 3130415 gene locus_tag LOCUS_28250 3130756 3130415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 3132345 3130942 gene locus_tag LOCUS_28260 3132345 3130942 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035938.1 protein_id gnl|my_center|LOCUS_28260 3132525 3133064 gene locus_tag LOCUS_28270 3132525 3133064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 3134597 3133281 gene locus_tag LOCUS_28280 gene yjoB 3134597 3133281 CDS product ATPase YjoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245490.1 protein_id gnl|my_center|LOCUS_28280 3136056 3134608 gene locus_tag LOCUS_28290 3136056 3134608 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_28290 3137922 3136480 gene locus_tag LOCUS_28300 3137922 3136480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 3140708 3138117 gene locus_tag LOCUS_28310 3140708 3138117 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030575.1 protein_id gnl|my_center|LOCUS_28310 3141986 3140709 gene locus_tag LOCUS_28320 3141986 3140709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 3143655 3142072 gene locus_tag LOCUS_28330 3143655 3142072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209759.1 protein_id gnl|my_center|LOCUS_28330 3144472 3143669 gene locus_tag LOCUS_28340 3144472 3143669 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816142.1 protein_id gnl|my_center|LOCUS_28340 3145042 3144969 gene locus_tag LOCUS_t00280 3145042 3144969 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3145442 3145369 gene locus_tag LOCUS_t00290 3145442 3145369 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3145842 3145769 gene locus_tag LOCUS_t00300 3145842 3145769 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3146112 3146040 gene locus_tag LOCUS_t00310 3146112 3146040 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3146930 3148255 gene locus_tag LOCUS_28350 3146930 3148255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 3148230 3149054 gene locus_tag LOCUS_28360 3148230 3149054 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966656.1 protein_id gnl|my_center|LOCUS_28360 3149313 3151151 gene locus_tag LOCUS_28370 3149313 3151151 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_28370 3151347 3151562 gene locus_tag LOCUS_28380 3151347 3151562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 3151594 3152046 gene locus_tag LOCUS_28390 3151594 3152046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 3152431 3152279 gene locus_tag LOCUS_28400 3152431 3152279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 3153623 3152490 gene locus_tag LOCUS_28410 3153623 3152490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 3158502 3153718 gene locus_tag LOCUS_28420 3158502 3153718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 3160451 3158739 gene locus_tag LOCUS_28430 3160451 3158739 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_28430 3161466 3160573 gene locus_tag LOCUS_28440 3161466 3160573 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_28440 3162454 3161483 gene locus_tag LOCUS_28450 3162454 3161483 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_28450 3163090 3163737 gene locus_tag LOCUS_28460 3163090 3163737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 3163718 3164284 gene locus_tag LOCUS_28470 3163718 3164284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 3166223 3164583 gene locus_tag LOCUS_28480 3166223 3164583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 3168717 3166417 gene locus_tag LOCUS_28490 3168717 3166417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 3171325 3168875 gene locus_tag LOCUS_28500 3171325 3168875 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108674.1 protein_id gnl|my_center|LOCUS_28500 3172424 3171327 gene locus_tag LOCUS_28510 3172424 3171327 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973578.1 protein_id gnl|my_center|LOCUS_28510 3173262 3172477 gene locus_tag LOCUS_28520 3173262 3172477 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_28520 3173457 3174341 gene locus_tag LOCUS_28530 3173457 3174341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 3175002 3176921 gene locus_tag LOCUS_28540 3175002 3176921 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681271.1 protein_id gnl|my_center|LOCUS_28540 3176914 3178707 gene locus_tag LOCUS_28550 3176914 3178707 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680887.1 protein_id gnl|my_center|LOCUS_28550 3178729 3179382 gene locus_tag LOCUS_28560 3178729 3179382 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535623.1 protein_id gnl|my_center|LOCUS_28560 3179998 3179810 gene locus_tag LOCUS_28570 3179998 3179810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 3180842 3180006 gene locus_tag LOCUS_28580 3180842 3180006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 3181629 3180871 gene locus_tag LOCUS_28590 3181629 3180871 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_28590 3182773 3181601 gene locus_tag LOCUS_28600 3182773 3181601 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080048.1 protein_id gnl|my_center|LOCUS_28600 3184601 3182775 gene locus_tag LOCUS_28610 3184601 3182775 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969594.1 protein_id gnl|my_center|LOCUS_28610 3185909 3184641 gene locus_tag LOCUS_28620 3185909 3184641 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243488.1 protein_id gnl|my_center|LOCUS_28620 3186346 3186164 gene locus_tag LOCUS_28630 3186346 3186164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 3186850 3187194 gene locus_tag LOCUS_28640 3186850 3187194 CDS product YrdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258995.1 protein_id gnl|my_center|LOCUS_28640 3188348 3187347 gene locus_tag LOCUS_28650 gene czcD 3188348 3187347 CDS product CDF family zinc transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229873.1 protein_id gnl|my_center|LOCUS_28650 3188753 3188364 gene locus_tag LOCUS_28660 3188753 3188364 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918377.1 protein_id gnl|my_center|LOCUS_28660 3192064 3189311 gene locus_tag LOCUS_28670 3192064 3189311 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369316.1 protein_id gnl|my_center|LOCUS_28670 3195293 3192138 gene locus_tag LOCUS_28680 3195293 3192138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 3196611 3195286 gene locus_tag LOCUS_28690 3196611 3195286 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989563.1 protein_id gnl|my_center|LOCUS_28690 3197564 3196650 gene locus_tag LOCUS_28700 3197564 3196650 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 protein_id gnl|my_center|LOCUS_28700 3198519 3197584 gene locus_tag LOCUS_28710 3198519 3197584 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_28710 3200140 3198650 gene locus_tag LOCUS_28720 3200140 3198650 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_28720 3201883 3200285 gene locus_tag LOCUS_28730 3201883 3200285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 3203708 3201876 gene locus_tag LOCUS_28740 3203708 3201876 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356857.1 protein_id gnl|my_center|LOCUS_28740 3205272 3203992 gene locus_tag LOCUS_28750 gene hflX 3205272 3203992 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393283.1 protein_id gnl|my_center|LOCUS_28750 3206491 3205877 gene locus_tag LOCUS_28760 3206491 3205877 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011993730.1 protein_id gnl|my_center|LOCUS_28760 3207600 3206488 gene locus_tag LOCUS_28770 3207600 3206488 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582736.1 protein_id gnl|my_center|LOCUS_28770 3208064 3207831 gene locus_tag LOCUS_28780 3208064 3207831 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286203.1 protein_id gnl|my_center|LOCUS_28780 3208453 3208199 gene locus_tag LOCUS_28790 3208453 3208199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 3208851 3208600 gene locus_tag LOCUS_28800 3208851 3208600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 3210941 3209175 gene locus_tag LOCUS_28810 3210941 3209175 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_28810 3212766 3210994 gene locus_tag LOCUS_28820 3212766 3210994 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_28820 3213694 3212792 gene locus_tag LOCUS_28830 3213694 3212792 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_28830 3214646 3213717 gene locus_tag LOCUS_28840 3214646 3213717 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_28840 3216533 3214749 gene locus_tag LOCUS_28850 3216533 3214749 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 protein_id gnl|my_center|LOCUS_28850 3217582 3216587 gene locus_tag LOCUS_28860 3217582 3216587 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 protein_id gnl|my_center|LOCUS_28860 3219003 3217594 gene locus_tag LOCUS_28870 3219003 3217594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 3220202 3219264 gene locus_tag LOCUS_28880 3220202 3219264 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970438.1 protein_id gnl|my_center|LOCUS_28880 3221622 3220618 gene locus_tag LOCUS_28890 3221622 3220618 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244029.1 protein_id gnl|my_center|LOCUS_28890 3222564 3221749 gene locus_tag LOCUS_28900 3222564 3221749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 3223613 3222561 gene locus_tag LOCUS_28910 3223613 3222561 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966712.1 protein_id gnl|my_center|LOCUS_28910 3224296 3223610 gene locus_tag LOCUS_28920 3224296 3223610 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243015.1 protein_id gnl|my_center|LOCUS_28920 3225784 3224435 gene locus_tag LOCUS_28930 3225784 3224435 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_28930 3226684 3225800 gene locus_tag LOCUS_28940 3226684 3225800 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_28940 3227616 3226705 gene locus_tag LOCUS_28950 3227616 3226705 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_28950 3229534 3227762 gene locus_tag LOCUS_28960 3229534 3227762 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_28960 3231332 3229656 gene locus_tag LOCUS_28970 3231332 3229656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 3233073 3231337 gene locus_tag LOCUS_28980 gene yesM 3233073 3231337 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_28980 3235041 3233314 gene locus_tag LOCUS_28990 3235041 3233314 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_28990 3236112 3235213 gene locus_tag LOCUS_29000 3236112 3235213 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_29000 3237040 3236129 gene locus_tag LOCUS_29010 3237040 3236129 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_29010 3239470 3237233 gene locus_tag LOCUS_29020 3239470 3237233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 3240933 3239539 gene locus_tag LOCUS_29030 3240933 3239539 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_29030 3243207 3241207 gene locus_tag LOCUS_29040 3243207 3241207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 3243406 3244035 gene locus_tag LOCUS_29050 3243406 3244035 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722624.1 protein_id gnl|my_center|LOCUS_29050 3244201 3244596 gene locus_tag LOCUS_29060 3244201 3244596 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227906.1 protein_id gnl|my_center|LOCUS_29060 3244709 3245794 gene locus_tag LOCUS_29070 3244709 3245794 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173644.1 protein_id gnl|my_center|LOCUS_29070 3245841 3246305 gene locus_tag LOCUS_29080 3245841 3246305 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033059696.1 protein_id gnl|my_center|LOCUS_29080 3246450 3246380 gene locus_tag LOCUS_t00320 3246450 3246380 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3246540 3246464 gene locus_tag LOCUS_t00330 3246540 3246464 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3246643 3246573 gene locus_tag LOCUS_t00340 3246643 3246573 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3246727 3246653 gene locus_tag LOCUS_t00350 3246727 3246653 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3246817 3246731 gene locus_tag LOCUS_t00360 3246817 3246731 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3246913 3246828 gene locus_tag LOCUS_t00370 3246913 3246828 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3247002 3246929 gene locus_tag LOCUS_t00380 3247002 3246929 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3247087 3247012 gene locus_tag LOCUS_t00390 3247087 3247012 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3247178 3247095 gene locus_tag LOCUS_t00400 3247178 3247095 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3247261 3247186 gene locus_tag LOCUS_t00410 3247261 3247186 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3247359 3247284 gene locus_tag LOCUS_t00420 3247359 3247284 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3247450 3247374 gene locus_tag LOCUS_t00430 3247450 3247374 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3247563 3247487 gene locus_tag LOCUS_t00440 3247563 3247487 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3247665 3247590 gene locus_tag LOCUS_t00450 3247665 3247590 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3247816 3247742 gene locus_tag LOCUS_t00460 3247816 3247742 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3247930 3247840 gene locus_tag LOCUS_t00470 3247930 3247840 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3248011 3247936 gene locus_tag LOCUS_t00480 3248011 3247936 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3248104 3248029 gene locus_tag LOCUS_t00490 3248104 3248029 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3248194 3248118 gene locus_tag LOCUS_t00500 3248194 3248118 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 3251234 3248313 gene locus_tag LOCUS_r00100 3251234 3248313 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3251742 3251630 gene locus_tag LOCUS_r00110 3251742 3251630 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3253453 3251900 gene locus_tag LOCUS_r00120 3253453 3251900 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3255063 3253903 gene locus_tag LOCUS_29090 3255063 3253903 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109296.1 protein_id gnl|my_center|LOCUS_29090 3256032 3255316 gene locus_tag LOCUS_29100 3256032 3255316 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164691160.1 protein_id gnl|my_center|LOCUS_29100 3257060 3256032 gene locus_tag LOCUS_29110 3257060 3256032 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227484.1 protein_id gnl|my_center|LOCUS_29110 3257808 3257053 gene locus_tag LOCUS_29120 3257808 3257053 CDS product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181910.1 protein_id gnl|my_center|LOCUS_29120 3258914 3257811 gene locus_tag LOCUS_29130 3258914 3257811 CDS product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510099.1 protein_id gnl|my_center|LOCUS_29130 3259998 3258892 gene locus_tag LOCUS_29140 3259998 3258892 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139971.1 protein_id gnl|my_center|LOCUS_29140 3260217 3260038 gene locus_tag LOCUS_29150 3260217 3260038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 3260625 3260374 gene locus_tag LOCUS_29160 3260625 3260374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 3262186 3261107 gene locus_tag LOCUS_29170 3262186 3261107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 3262560 3262321 gene locus_tag LOCUS_29180 3262560 3262321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012598856.1 protein_id gnl|my_center|LOCUS_29180 3264340 3262601 gene locus_tag LOCUS_29190 3264340 3262601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 3264761 3265642 gene locus_tag LOCUS_29200 3264761 3265642 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359341.1 protein_id gnl|my_center|LOCUS_29200 3267496 3265802 gene locus_tag LOCUS_29210 3267496 3265802 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012193.1 protein_id gnl|my_center|LOCUS_29210 3267802 3267545 gene locus_tag LOCUS_29220 3267802 3267545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 3271139 3268110 gene locus_tag LOCUS_29230 3271139 3268110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 3272486 3271209 gene locus_tag LOCUS_29240 3272486 3271209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 3273426 3272572 gene locus_tag LOCUS_29250 3273426 3272572 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_29250 3274325 3273432 gene locus_tag LOCUS_29260 3274325 3273432 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114399.1 protein_id gnl|my_center|LOCUS_29260 3274718 3274566 gene locus_tag LOCUS_29270 3274718 3274566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 3274931 3275947 gene locus_tag LOCUS_29280 3274931 3275947 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721423.1 protein_id gnl|my_center|LOCUS_29280 3276898 3276596 gene locus_tag LOCUS_29290 3276898 3276596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 3277519 3276932 gene locus_tag LOCUS_29300 3277519 3276932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 3278789 3277512 gene locus_tag LOCUS_29310 3278789 3277512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 3279963 3278812 gene locus_tag LOCUS_29320 3279963 3278812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 3283437 3280336 gene locus_tag LOCUS_29330 3283437 3280336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 3283883 3284446 gene locus_tag LOCUS_29340 3283883 3284446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 3284476 3284868 gene locus_tag LOCUS_29350 3284476 3284868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 3284873 3286294 gene locus_tag LOCUS_29360 3284873 3286294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 3286291 3286680 gene locus_tag LOCUS_29370 3286291 3286680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 3287512 3287148 gene locus_tag LOCUS_tm00010 3287512 3287148 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3288219 3287740 gene locus_tag LOCUS_29380 gene smpB 3288219 3287740 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_29380 3291553 3288377 gene locus_tag LOCUS_29390 3291553 3288377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 3292008 3291772 gene locus_tag LOCUS_29400 gene secG 3292008 3291772 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220028.1 protein_id gnl|my_center|LOCUS_29400 3293059 3292124 gene locus_tag LOCUS_29410 3293059 3292124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 3294721 3293303 gene locus_tag LOCUS_29420 3294721 3293303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 3297407 3295005 gene locus_tag LOCUS_29430 3297407 3295005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 3298318 3297554 gene locus_tag LOCUS_29440 3298318 3297554 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_29440 3299861 3298569 gene locus_tag LOCUS_29450 gene eno 3299861 3298569 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 protein_id gnl|my_center|LOCUS_29450 3301497 3299965 gene locus_tag LOCUS_29460 gene gpmI 3301497 3299965 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228330.1 protein_id gnl|my_center|LOCUS_29460 3302256 3301498 gene locus_tag LOCUS_29470 gene tpiA 3302256 3301498 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861867.1 protein_id gnl|my_center|LOCUS_29470 3303483 3302302 gene locus_tag LOCUS_29480 3303483 3302302 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036339.1 protein_id gnl|my_center|LOCUS_29480 3304956 3303952 gene locus_tag LOCUS_29490 gene gap 3304956 3303952 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161236.1 protein_id gnl|my_center|LOCUS_29490 3306121 3305084 gene locus_tag LOCUS_29500 gene cggR 3306121 3305084 CDS product gapA transcriptional regulator CggR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258187.1 protein_id gnl|my_center|LOCUS_29500 3306366 3306440 gene locus_tag LOCUS_t00510 3306366 3306440 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3306755 3307345 gene locus_tag LOCUS_29510 gene clpP 3306755 3307345 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228214.1 protein_id gnl|my_center|LOCUS_29510 3307602 3307919 gene locus_tag LOCUS_29520 3307602 3307919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 3308854 3308081 gene locus_tag LOCUS_29530 3308854 3308081 CDS product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173525.1 protein_id gnl|my_center|LOCUS_29530 3309302 3309033 gene locus_tag LOCUS_29540 3309302 3309033 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_29540 3310332 3309403 gene locus_tag LOCUS_29550 gene whiA 3310332 3309403 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243775.1 protein_id gnl|my_center|LOCUS_29550 3311325 3310339 gene locus_tag LOCUS_29560 gene mgfK 3311325 3310339 CDS product gluconeogenesis morphogenetic factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244450.1 protein_id gnl|my_center|LOCUS_29560 3312221 3311334 gene locus_tag LOCUS_29570 gene rapZ 3312221 3311334 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243903.1 protein_id gnl|my_center|LOCUS_29570 3313367 3312417 gene locus_tag LOCUS_29580 gene glcK 3313367 3312417 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 protein_id gnl|my_center|LOCUS_29580 3314530 3313583 gene locus_tag LOCUS_29590 gene trxB 3314530 3313583 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_29590 3316305 3314563 gene locus_tag LOCUS_29600 3316305 3314563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 3316758 3316474 gene locus_tag LOCUS_29610 3316758 3316474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 3317880 3316927 gene locus_tag LOCUS_29620 3317880 3316927 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107420.1 protein_id gnl|my_center|LOCUS_29620 3318896 3318207 gene locus_tag LOCUS_29630 gene hisIE 3318896 3318207 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 protein_id gnl|my_center|LOCUS_29630 3319651 3318893 gene locus_tag LOCUS_29640 gene hisF 3319651 3318893 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_29640 3320360 3319737 gene locus_tag LOCUS_29650 gene hisH 3320360 3319737 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244267.1 protein_id gnl|my_center|LOCUS_29650 3320961 3320362 gene locus_tag LOCUS_29660 gene hisB 3320961 3320362 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243389.1 protein_id gnl|my_center|LOCUS_29660 3322385 3321102 gene locus_tag LOCUS_29670 gene hisD 3322385 3321102 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243286.1 protein_id gnl|my_center|LOCUS_29670 3323231 3322560 gene locus_tag LOCUS_29680 gene hisG 3323231 3322560 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968235.1 protein_id gnl|my_center|LOCUS_29680 3324477 3323239 gene locus_tag LOCUS_29690 3324477 3323239 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244441.1 protein_id gnl|my_center|LOCUS_29690 3325868 3324714 gene locus_tag LOCUS_29700 3325868 3324714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 3326356 3325865 gene locus_tag LOCUS_29710 3326356 3325865 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255064.1 protein_id gnl|my_center|LOCUS_29710 3327018 3326362 gene locus_tag LOCUS_29720 gene ppaX 3327018 3326362 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242685.1 protein_id gnl|my_center|LOCUS_29720 3328074 3327037 gene locus_tag LOCUS_29730 gene lgt 3328074 3327037 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722614.1 protein_id gnl|my_center|LOCUS_29730 3329078 3328140 gene locus_tag LOCUS_29740 gene hprK 3329078 3328140 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127250.1 protein_id gnl|my_center|LOCUS_29740 3330407 3329286 gene locus_tag LOCUS_29750 gene ugpC 3330407 3329286 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_29750 3331649 3330498 gene locus_tag LOCUS_29760 3331649 3330498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 3332660 3331719 gene locus_tag LOCUS_29770 3332660 3331719 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272199.1 protein_id gnl|my_center|LOCUS_29770 3332882 3332807 gene locus_tag LOCUS_t00520 3332882 3332807 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3332978 3332895 gene locus_tag LOCUS_t00530 3332978 3332895 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3333089 3333014 gene locus_tag LOCUS_t00540 3333089 3333014 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3333181 3333105 gene locus_tag LOCUS_t00550 3333181 3333105 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3333270 3333195 gene locus_tag LOCUS_t00560 3333270 3333195 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3333355 3333279 gene locus_tag LOCUS_t00570 3333355 3333279 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3336475 3333554 gene locus_tag LOCUS_r00130 3336475 3333554 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3336767 3336655 gene locus_tag LOCUS_r00140 3336767 3336655 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3338470 3336925 gene locus_tag LOCUS_r00150 3338470 3336925 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3339057 3338794 gene locus_tag LOCUS_29780 3339057 3338794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 3339326 3339054 gene locus_tag LOCUS_29790 3339326 3339054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 3340107 3339508 gene locus_tag LOCUS_29800 gene recR 3340107 3339508 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559169.1 protein_id gnl|my_center|LOCUS_29800 3340451 3340137 gene locus_tag LOCUS_29810 3340451 3340137 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001996460.1 protein_id gnl|my_center|LOCUS_29810 3342287 3340500 gene locus_tag LOCUS_29820 gene dnaX 3342287 3340500 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732084.1 protein_id gnl|my_center|LOCUS_29820 3343237 3342851 gene locus_tag LOCUS_29830 3343237 3342851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 3343518 3343321 gene locus_tag LOCUS_29840 gene rpmE 3343518 3343321 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_29840 3344907 3343648 gene locus_tag LOCUS_29850 3344907 3343648 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941550.1 protein_id gnl|my_center|LOCUS_29850 3346306 3344948 gene locus_tag LOCUS_29860 gene rho 3346306 3344948 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053899.1 protein_id gnl|my_center|LOCUS_29860 3347667 3346420 gene locus_tag LOCUS_29870 gene murA 3347667 3346420 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413260.1 protein_id gnl|my_center|LOCUS_29870 3348543 3348145 gene locus_tag LOCUS_29880 gene spo0F 3348543 3348145 CDS product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398594.1 protein_id gnl|my_center|LOCUS_29880 3350275 3348671 gene locus_tag LOCUS_29890 gene pyrG 3350275 3348671 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227612.1 protein_id gnl|my_center|LOCUS_29890 3351159 3350590 gene locus_tag LOCUS_29900 3351159 3350590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 3351612 3352748 gene locus_tag LOCUS_29910 3351612 3352748 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393523.1 protein_id gnl|my_center|LOCUS_29910 3354470 3352791 gene locus_tag LOCUS_29920 gene argS 3354470 3352791 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_29920 3354977 3354528 gene locus_tag LOCUS_29930 3354977 3354528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 3355963 3355460 gene locus_tag LOCUS_29940 3355963 3355460 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730265.1 protein_id gnl|my_center|LOCUS_29940 3356372 3356121 gene locus_tag LOCUS_29950 3356372 3356121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 3358247 3356664 gene locus_tag LOCUS_29960 3358247 3356664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 3359130 3358261 gene locus_tag LOCUS_29970 3359130 3358261 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 protein_id gnl|my_center|LOCUS_29970 3360010 3359135 gene locus_tag LOCUS_29980 3360010 3359135 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803821.1 protein_id gnl|my_center|LOCUS_29980 3361656 3360169 gene locus_tag LOCUS_29990 3361656 3360169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 3362831 3361797 gene locus_tag LOCUS_30000 3362831 3361797 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119158.1 protein_id gnl|my_center|LOCUS_30000 3364119 3363250 gene locus_tag LOCUS_30010 gene speB 3364119 3363250 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209831.1 protein_id gnl|my_center|LOCUS_30010 3364971 3364144 gene locus_tag LOCUS_30020 gene speE 3364971 3364144 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424696.1 protein_id gnl|my_center|LOCUS_30020 3365184 3367289 gene locus_tag LOCUS_30030 3365184 3367289 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372988.1 protein_id gnl|my_center|LOCUS_30030 3367808 3368665 gene locus_tag LOCUS_30040 3367808 3368665 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131855.1 protein_id gnl|my_center|LOCUS_30040 3369006 3369854 gene locus_tag LOCUS_30050 3369006 3369854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 3371983 3370211 gene locus_tag LOCUS_30060 3371983 3370211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142714.1 protein_id gnl|my_center|LOCUS_30060 3373740 3371980 gene locus_tag LOCUS_30070 3373740 3371980 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929086.1 protein_id gnl|my_center|LOCUS_30070 3373937 3374872 gene locus_tag LOCUS_30080 3373937 3374872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 3376404 3374869 gene locus_tag LOCUS_30090 3376404 3374869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 3377735 3376527 gene locus_tag LOCUS_30100 3377735 3376527 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124880.1 protein_id gnl|my_center|LOCUS_30100 3378014 3377808 gene locus_tag LOCUS_30110 3378014 3377808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 3377925 3378602 gene locus_tag LOCUS_30120 3377925 3378602 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811530.1 protein_id gnl|my_center|LOCUS_30120 3378827 3380443 gene locus_tag LOCUS_30130 3378827 3380443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 3380539 3381144 gene locus_tag LOCUS_30140 3380539 3381144 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141158.1 protein_id gnl|my_center|LOCUS_30140 3381134 3382066 gene locus_tag LOCUS_30150 3381134 3382066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 3382524 3382156 gene locus_tag LOCUS_30160 3382524 3382156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 3383241 3382714 gene locus_tag LOCUS_30170 3383241 3382714 CDS product YwhD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244446.1 protein_id gnl|my_center|LOCUS_30170 3383506 3385506 gene locus_tag LOCUS_30180 3383506 3385506 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123042767.1 protein_id gnl|my_center|LOCUS_30180 3385539 3386360 gene locus_tag LOCUS_30190 3385539 3386360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 3386932 3387429 gene locus_tag LOCUS_30200 3386932 3387429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 3388035 3387616 gene locus_tag LOCUS_30210 3388035 3387616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 3388252 3393210 gene locus_tag LOCUS_30220 3388252 3393210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 3393701 3394978 gene locus_tag LOCUS_30230 3393701 3394978 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772618.1 protein_id gnl|my_center|LOCUS_30230 3394993 3395964 gene locus_tag LOCUS_30240 gene cah 3394993 3395964 CDS product cephalosporin C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246400.1 protein_id gnl|my_center|LOCUS_30240 3396979 3396140 gene locus_tag LOCUS_30250 3396979 3396140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 3397122 3398309 gene locus_tag LOCUS_30260 3397122 3398309 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030728.1 protein_id gnl|my_center|LOCUS_30260 3398532 3398696 gene locus_tag LOCUS_30270 3398532 3398696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 3400455 3399103 gene locus_tag LOCUS_30280 3400455 3399103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 3400929 3400567 gene locus_tag LOCUS_30290 3400929 3400567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 3402145 3401141 gene locus_tag LOCUS_30300 3402145 3401141 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037063.1 protein_id gnl|my_center|LOCUS_30300 3402087 3402341 gene locus_tag LOCUS_30310 3402087 3402341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 3402356 3403111 gene locus_tag LOCUS_30320 3402356 3403111 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_30320 3403869 3403207 gene locus_tag LOCUS_30330 3403869 3403207 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355190.1 protein_id gnl|my_center|LOCUS_30330 3404393 3403893 gene locus_tag LOCUS_30340 3404393 3403893 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316661.1 protein_id gnl|my_center|LOCUS_30340 3404581 3405456 gene locus_tag LOCUS_30350 3404581 3405456 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071679.1 protein_id gnl|my_center|LOCUS_30350 3405597 3406307 gene locus_tag LOCUS_30360 3405597 3406307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 3406664 3406407 gene locus_tag LOCUS_30370 3406664 3406407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 3407535 3407143 gene locus_tag LOCUS_30380 3407535 3407143 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258465.1 protein_id gnl|my_center|LOCUS_30380 3408421 3407561 gene locus_tag LOCUS_30390 3408421 3407561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 3409084 3408653 gene locus_tag LOCUS_30400 3409084 3408653 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429665.1 protein_id gnl|my_center|LOCUS_30400 3409272 3410486 gene locus_tag LOCUS_30410 3409272 3410486 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967206.1 protein_id gnl|my_center|LOCUS_30410 3411078 3410626 gene locus_tag LOCUS_30420 3411078 3410626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 3411211 3412035 gene locus_tag LOCUS_30430 3411211 3412035 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204082927.1 protein_id gnl|my_center|LOCUS_30430 3412804 3412154 gene locus_tag LOCUS_30440 3412804 3412154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 3413523 3412843 gene locus_tag LOCUS_30450 3413523 3412843 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229666.1 protein_id gnl|my_center|LOCUS_30450 3414080 3413802 gene locus_tag LOCUS_30460 3414080 3413802 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089416.1 protein_id gnl|my_center|LOCUS_30460 3414414 3414854 gene locus_tag LOCUS_30470 3414414 3414854 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723583.1 protein_id gnl|my_center|LOCUS_30470 3414858 3416609 gene locus_tag LOCUS_30480 3414858 3416609 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005135.1 protein_id gnl|my_center|LOCUS_30480 3416652 3417215 gene locus_tag LOCUS_30490 3416652 3417215 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233428.1 protein_id gnl|my_center|LOCUS_30490 3417944 3417396 gene locus_tag LOCUS_30500 3417944 3417396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 3418287 3417949 gene locus_tag LOCUS_30510 3418287 3417949 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827865.1 protein_id gnl|my_center|LOCUS_30510 3419649 3418594 gene locus_tag LOCUS_30520 gene aroC 3419649 3418594 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_30520 3419715 3420650 gene locus_tag LOCUS_30530 3419715 3420650 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948557.1 protein_id gnl|my_center|LOCUS_30530 3421249 3420668 gene locus_tag LOCUS_30540 3421249 3420668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 3421497 3421940 gene locus_tag LOCUS_30550 3421497 3421940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 3422360 3422082 gene locus_tag LOCUS_30560 3422360 3422082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 3423284 3422382 gene locus_tag LOCUS_30570 3423284 3422382 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963352.1 protein_id gnl|my_center|LOCUS_30570 3423402 3424289 gene locus_tag LOCUS_30580 gene dapA 3423402 3424289 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141020.1 protein_id gnl|my_center|LOCUS_30580 3424449 3425921 gene locus_tag LOCUS_30590 3424449 3425921 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948440.1 protein_id gnl|my_center|LOCUS_30590 3426282 3427502 gene locus_tag LOCUS_30600 3426282 3427502 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966748.1 protein_id gnl|my_center|LOCUS_30600 3428977 3427766 gene locus_tag LOCUS_30610 3428977 3427766 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742100.1 protein_id gnl|my_center|LOCUS_30610 3429962 3428964 gene locus_tag LOCUS_30620 3429962 3428964 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389971.1 protein_id gnl|my_center|LOCUS_30620 3430741 3430112 gene locus_tag LOCUS_30630 3430741 3430112 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033261752.1 protein_id gnl|my_center|LOCUS_30630 3432362 3430776 gene locus_tag LOCUS_30640 gene mdtP 3432362 3430776 CDS product multidrug efflux MFS transporter MdtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228559.1 protein_id gnl|my_center|LOCUS_30640 3432575 3433390 gene locus_tag LOCUS_30650 3432575 3433390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 3433475 3434857 gene locus_tag LOCUS_30660 3433475 3434857 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046233294.1 protein_id gnl|my_center|LOCUS_30660 3435399 3434992 gene locus_tag LOCUS_30670 3435399 3434992 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968054.1 protein_id gnl|my_center|LOCUS_30670 3435624 3436613 gene locus_tag LOCUS_30680 3435624 3436613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 3438989 3436701 gene locus_tag LOCUS_30690 3438989 3436701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 3440369 3439083 gene locus_tag LOCUS_30700 3440369 3439083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 3440910 3440362 gene locus_tag LOCUS_30710 3440910 3440362 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355429.1 protein_id gnl|my_center|LOCUS_30710 3442887 3441049 gene locus_tag LOCUS_30720 3442887 3441049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 3443062 3443508 gene locus_tag LOCUS_30730 3443062 3443508 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229930.1 protein_id gnl|my_center|LOCUS_30730 3443680 3444639 gene locus_tag LOCUS_30740 3443680 3444639 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_30740 3444753 3445604 gene locus_tag LOCUS_30750 3444753 3445604 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530858.1 protein_id gnl|my_center|LOCUS_30750 3445656 3446627 gene locus_tag LOCUS_30760 3445656 3446627 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_30760 3446809 3447516 gene locus_tag LOCUS_30770 3446809 3447516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 3448760 3447546 gene locus_tag LOCUS_30780 3448760 3447546 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128216.1 protein_id gnl|my_center|LOCUS_30780 3448853 3449110 gene locus_tag LOCUS_30790 3448853 3449110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 3451386 3449107 gene locus_tag LOCUS_30800 3451386 3449107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 3452011 3451631 gene locus_tag LOCUS_30810 3452011 3451631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 3455106 3452206 gene locus_tag LOCUS_30820 3455106 3452206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 3455982 3455326 gene locus_tag LOCUS_30830 3455982 3455326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 3457646 3456006 gene locus_tag LOCUS_30840 3457646 3456006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 3458002 3457643 gene locus_tag LOCUS_30850 3458002 3457643 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814133.1 protein_id gnl|my_center|LOCUS_30850 3458225 3458548 gene locus_tag LOCUS_30860 3458225 3458548 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125388.1 protein_id gnl|my_center|LOCUS_30860 3459566 3458730 gene locus_tag LOCUS_30870 3459566 3458730 CDS product RMD1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943194.1 protein_id gnl|my_center|LOCUS_30870 3459753 3461096 gene locus_tag LOCUS_30880 3459753 3461096 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_30880 3461904 3461203 gene locus_tag LOCUS_30890 3461904 3461203 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338482.1 protein_id gnl|my_center|LOCUS_30890 3462088 3463080 gene locus_tag LOCUS_30900 3462088 3463080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 3464116 3463130 gene locus_tag LOCUS_30910 3464116 3463130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 3464946 3464140 gene locus_tag LOCUS_30920 gene rsbQ 3464946 3464140 CDS product sigma factor SigB/phosphatase RsbP regulator RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228292.1 protein_id gnl|my_center|LOCUS_30920 3466432 3465530 gene locus_tag LOCUS_30930 3466432 3465530 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747210.1 protein_id gnl|my_center|LOCUS_30930 3466609 3467277 gene locus_tag LOCUS_30940 3466609 3467277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 3468412 3467411 gene locus_tag LOCUS_30950 3468412 3467411 CDS product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732576.1 protein_id gnl|my_center|LOCUS_30950 3469608 3468646 gene locus_tag LOCUS_30960 3469608 3468646 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289148.1 protein_id gnl|my_center|LOCUS_30960 3470012 3471559 gene locus_tag LOCUS_30970 3470012 3471559 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078186907.1 protein_id gnl|my_center|LOCUS_30970 3473275 3471704 gene locus_tag LOCUS_30980 gene abc-f 3473275 3471704 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602057.1 protein_id gnl|my_center|LOCUS_30980 3473454 3474842 gene locus_tag LOCUS_30990 3473454 3474842 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582688.1 protein_id gnl|my_center|LOCUS_30990 3475002 3474796 gene locus_tag LOCUS_31000 3475002 3474796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 3475099 3475518 gene locus_tag LOCUS_31010 3475099 3475518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 3475558 3475851 gene locus_tag LOCUS_31020 3475558 3475851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 3476224 3475955 gene locus_tag LOCUS_31030 3476224 3475955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 3476449 3477630 gene locus_tag LOCUS_31040 3476449 3477630 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868969.1 protein_id gnl|my_center|LOCUS_31040 3477839 3478603 gene locus_tag LOCUS_31050 3477839 3478603 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983505.1 protein_id gnl|my_center|LOCUS_31050 3478617 3479393 gene locus_tag LOCUS_31060 3478617 3479393 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784150.1 protein_id gnl|my_center|LOCUS_31060 3479459 3480619 gene locus_tag LOCUS_31070 3479459 3480619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 3481700 3480930 gene locus_tag LOCUS_31080 3481700 3480930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 3481915 3482901 gene locus_tag LOCUS_31090 3481915 3482901 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775988.1 protein_id gnl|my_center|LOCUS_31090 3483097 3484473 gene locus_tag LOCUS_31100 gene gdhA 3483097 3484473 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721354.1 protein_id gnl|my_center|LOCUS_31100 3484693 3485112 gene locus_tag LOCUS_31110 3484693 3485112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 3485252 3485455 gene locus_tag LOCUS_31120 3485252 3485455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 3486356 3485550 gene locus_tag LOCUS_31130 3486356 3485550 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660564.1 protein_id gnl|my_center|LOCUS_31130 3487764 3486451 gene locus_tag LOCUS_31140 3487764 3486451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 3488311 3488024 gene locus_tag LOCUS_31150 3488311 3488024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 3489150 3488395 gene locus_tag LOCUS_31160 3489150 3488395 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545555.1 protein_id gnl|my_center|LOCUS_31160 3491019 3489541 gene locus_tag LOCUS_31170 3491019 3489541 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966741.1 protein_id gnl|my_center|LOCUS_31170 3496080 3491281 gene locus_tag LOCUS_31180 3496080 3491281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 3497262 3496426 gene locus_tag LOCUS_31190 3497262 3496426 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637552.1 protein_id gnl|my_center|LOCUS_31190 3498736 3497435 gene locus_tag LOCUS_31200 gene glcP 3498736 3497435 CDS product glucose/mannose transporter GlcP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245772.1 protein_id gnl|my_center|LOCUS_31200 3498966 3499475 gene locus_tag LOCUS_31210 3498966 3499475 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861860.1 protein_id gnl|my_center|LOCUS_31210 3499586 3499789 gene locus_tag LOCUS_31220 3499586 3499789 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289418.1 protein_id gnl|my_center|LOCUS_31220 3500312 3499998 gene locus_tag LOCUS_31230 3500312 3499998 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979543.1 protein_id gnl|my_center|LOCUS_31230 3500632 3500333 gene locus_tag LOCUS_31240 3500632 3500333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 3501067 3501867 gene locus_tag LOCUS_31250 gene motA 3501067 3501867 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458996.1 protein_id gnl|my_center|LOCUS_31250 3501851 3502696 gene locus_tag LOCUS_31260 gene motB 3501851 3502696 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232473.1 protein_id gnl|my_center|LOCUS_31260 3503520 3502819 gene locus_tag LOCUS_31270 3503520 3502819 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_31270 3505071 3503569 gene locus_tag LOCUS_31280 3505071 3503569 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245326.1 protein_id gnl|my_center|LOCUS_31280 3506276 3505614 gene locus_tag LOCUS_31290 3506276 3505614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31290 3507074 3506367 gene locus_tag LOCUS_31300 3507074 3506367 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064094285.1 protein_id gnl|my_center|LOCUS_31300 3509375 3507126 gene locus_tag LOCUS_31310 3509375 3507126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 3509739 3510218 gene locus_tag LOCUS_31320 gene tadA 3509739 3510218 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439010.1 protein_id gnl|my_center|LOCUS_31320 3510336 3510181 gene locus_tag LOCUS_31330 3510336 3510181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 3510662 3510474 gene locus_tag LOCUS_31340 3510662 3510474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 3510723 3510799 gene locus_tag LOCUS_t00580 3510723 3510799 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3512641 3511163 gene locus_tag LOCUS_31350 3512641 3511163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 3513721 3512699 gene locus_tag LOCUS_31360 3513721 3512699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 3514013 3513861 gene locus_tag LOCUS_31370 3514013 3513861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 3514218 3514042 gene locus_tag LOCUS_31380 3514218 3514042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 3514602 3514255 gene locus_tag LOCUS_31390 3514602 3514255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 3514821 3514733 gene locus_tag LOCUS_t00590 3514821 3514733 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3516215 3514935 gene locus_tag LOCUS_31400 gene serS 3516215 3514935 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884187.1 protein_id gnl|my_center|LOCUS_31400 3516978 3516388 gene locus_tag LOCUS_31410 gene pdxT 3516978 3516388 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238799.1 protein_id gnl|my_center|LOCUS_31410 3517884 3517003 gene locus_tag LOCUS_31420 gene pdxS 3517884 3517003 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247145.1 protein_id gnl|my_center|LOCUS_31420 3519373 3518084 gene locus_tag LOCUS_31430 gene dacA 3519373 3518084 CDS product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011053075.1 protein_id gnl|my_center|LOCUS_31430 3521089 3519632 gene locus_tag LOCUS_31440 gene guaB 3521089 3519632 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264088.1 protein_id gnl|my_center|LOCUS_31440 3522298 3521234 gene locus_tag LOCUS_31450 3522298 3521234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 3522798 3522686 gene locus_tag LOCUS_r00160 3522798 3522686 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3525835 3522914 gene locus_tag LOCUS_r00170 3525835 3522914 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3526073 3525998 gene locus_tag LOCUS_t00600 3526073 3525998 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3526160 3526084 gene locus_tag LOCUS_t00610 3526160 3526084 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 3527872 3526327 gene locus_tag LOCUS_r00180 3527872 3526327 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3529659 3528154 gene locus_tag LOCUS_31460 gene lysS 3529659 3528154 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 protein_id gnl|my_center|LOCUS_31460 3530302 3529826 gene locus_tag LOCUS_31470 gene greA 3530302 3529826 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809765.1 protein_id gnl|my_center|LOCUS_31470 3531591 3530554 gene locus_tag LOCUS_31480 gene dusB 3531591 3530554 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912251.1 protein_id gnl|my_center|LOCUS_31480 3531859 3531653 gene locus_tag LOCUS_31490 3531859 3531653 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387031.1 protein_id gnl|my_center|LOCUS_31490 3532383 3531811 gene locus_tag LOCUS_31500 gene folK 3532383 3531811 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059445.1 protein_id gnl|my_center|LOCUS_31500 3532753 3532355 gene locus_tag LOCUS_31510 gene folB 3532753 3532355 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242949.1 protein_id gnl|my_center|LOCUS_31510 3533663 3532770 gene locus_tag LOCUS_31520 gene folP 3533663 3532770 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025985130.1 protein_id gnl|my_center|LOCUS_31520 3534532 3533660 gene locus_tag LOCUS_31530 gene pabC 3534532 3533660 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909893.1 protein_id gnl|my_center|LOCUS_31530 3535110 3534529 gene locus_tag LOCUS_31540 gene pabA 3535110 3534529 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602293.1 protein_id gnl|my_center|LOCUS_31540 3536726 3535170 gene locus_tag LOCUS_31550 gene trpE 3536726 3535170 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_31550 3537856 3536918 gene locus_tag LOCUS_31560 gene cysK 3537856 3536918 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244491.1 protein_id gnl|my_center|LOCUS_31560 3538937 3537972 gene locus_tag LOCUS_31570 3538937 3537972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 3539906 3538998 gene locus_tag LOCUS_31580 gene hslO 3539906 3538998 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656366.1 protein_id gnl|my_center|LOCUS_31580 3540740 3539973 gene locus_tag LOCUS_31590 3540740 3539973 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_31590 3541633 3540737 gene locus_tag LOCUS_31600 gene nadC 3541633 3540737 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228350.1 protein_id gnl|my_center|LOCUS_31600 3543245 3541626 gene locus_tag LOCUS_31610 gene nadB 3543245 3541626 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119573.1 protein_id gnl|my_center|LOCUS_31610 3544224 3543286 gene locus_tag LOCUS_31620 gene nadA 3544224 3543286 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020997.1 protein_id gnl|my_center|LOCUS_31620 3546706 3544685 gene locus_tag LOCUS_31630 gene ftsH 3546706 3544685 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079674.1 protein_id gnl|my_center|LOCUS_31630 3547352 3546813 gene locus_tag LOCUS_31640 3547352 3546813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31640 3548857 3547421 gene locus_tag LOCUS_31650 gene tilS 3548857 3547421 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243704.1 protein_id gnl|my_center|LOCUS_31650 3549879 3548941 gene locus_tag LOCUS_31660 3549879 3548941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 3550588 3549863 gene locus_tag LOCUS_31670 3550588 3549863 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068698953.1 protein_id gnl|my_center|LOCUS_31670 3551423 3550869 gene locus_tag LOCUS_31680 3551423 3550869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 3553923 3551425 gene locus_tag LOCUS_31690 gene spoIIE 3553923 3551425 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123550.1 protein_id gnl|my_center|LOCUS_31690 3554959 3554387 gene locus_tag LOCUS_31700 3554959 3554387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 3555452 3555135 gene locus_tag LOCUS_31710 3555452 3555135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 3556125 3555478 gene locus_tag LOCUS_31720 3556125 3555478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 3556409 3556122 gene locus_tag LOCUS_31730 3556409 3556122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 3556835 3556554 gene locus_tag LOCUS_31740 3556835 3556554 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226716.1 protein_id gnl|my_center|LOCUS_31740 3557108 3556836 gene locus_tag LOCUS_31750 3557108 3556836 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905402.1 protein_id gnl|my_center|LOCUS_31750 3558766 3557288 gene locus_tag LOCUS_31760 gene mazG 3558766 3557288 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014237.1 protein_id gnl|my_center|LOCUS_31760 3561077 3558852 gene locus_tag LOCUS_31770 3561077 3558852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 3561931 3561389 gene locus_tag LOCUS_31780 gene spoVT 3561931 3561389 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_31780 3563152 3562307 gene locus_tag LOCUS_31790 3563152 3562307 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966753.1 protein_id gnl|my_center|LOCUS_31790 3564007 3563207 gene locus_tag LOCUS_31800 3564007 3563207 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531157.1 protein_id gnl|my_center|LOCUS_31800 3565083 3564013 gene locus_tag LOCUS_31810 3565083 3564013 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143100.1 protein_id gnl|my_center|LOCUS_31810 3566091 3565396 gene locus_tag LOCUS_31820 gene urtE 3566091 3565396 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_31820 3566857 3566069 gene locus_tag LOCUS_31830 gene urtD 3566857 3566069 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 protein_id gnl|my_center|LOCUS_31830 3567908 3566820 gene locus_tag LOCUS_31840 gene urtC 3567908 3566820 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056964.1 protein_id gnl|my_center|LOCUS_31840 3568893 3567988 gene locus_tag LOCUS_31850 3568893 3567988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 3570405 3569125 gene locus_tag LOCUS_31860 gene urtA 3570405 3569125 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_31860 3572396 3570762 gene locus_tag LOCUS_31870 3572396 3570762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 3573611 3572565 gene locus_tag LOCUS_31880 3573611 3572565 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665619.1 protein_id gnl|my_center|LOCUS_31880 3574837 3573716 gene locus_tag LOCUS_31890 gene prsA 3574837 3573716 CDS product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710058.1 protein_id gnl|my_center|LOCUS_31890 3578351 3574824 gene locus_tag LOCUS_31900 gene mfd 3578351 3574824 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_31900 3578693 3578463 gene locus_tag LOCUS_31910 3578693 3578463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 3579466 3578906 gene locus_tag LOCUS_31920 gene pth 3579466 3578906 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_31920 3579652 3579852 gene locus_tag LOCUS_31930 3579652 3579852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 3580589 3579939 gene locus_tag LOCUS_31940 3580589 3579939 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_31940 3582255 3580855 gene locus_tag LOCUS_31950 gene glmU 3582255 3580855 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226732.1 protein_id gnl|my_center|LOCUS_31950 3582662 3582378 gene locus_tag LOCUS_31960 gene spoVG 3582662 3582378 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454041.1 protein_id gnl|my_center|LOCUS_31960 3583187 3582801 gene locus_tag LOCUS_31970 3583187 3582801 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_31970 3584038 3583202 gene locus_tag LOCUS_31980 gene purR 3584038 3583202 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078543208.1 protein_id gnl|my_center|LOCUS_31980 3584977 3584123 gene locus_tag LOCUS_31990 gene ispE 3584977 3584123 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226742.1 protein_id gnl|my_center|LOCUS_31990 3585484 3585110 gene locus_tag LOCUS_32000 3585484 3585110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 3585938 3585666 gene locus_tag LOCUS_32010 3585938 3585666 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832193.1 protein_id gnl|my_center|LOCUS_32010 3586965 3586090 gene locus_tag LOCUS_32020 gene yabG 3586965 3586090 CDS product sporulation peptidase YabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083476656.1 protein_id gnl|my_center|LOCUS_32020 3588017 3587121 gene locus_tag LOCUS_32030 gene rsmA 3588017 3587121 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_32030 3588577 3588023 gene locus_tag LOCUS_32040 gene rnmV 3588577 3588023 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692835.1 protein_id gnl|my_center|LOCUS_32040 3589925 3588780 gene locus_tag LOCUS_32050 3589925 3588780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 3591322 3590555 gene locus_tag LOCUS_32060 3591322 3590555 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_32060 3592660 3591344 gene locus_tag LOCUS_32070 3592660 3591344 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243873.1 protein_id gnl|my_center|LOCUS_32070 3592933 3593187 gene locus_tag LOCUS_32080 3592933 3593187 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391595.1 protein_id gnl|my_center|LOCUS_32080 3594198 3593299 gene locus_tag LOCUS_32090 gene rsmI 3594198 3593299 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243457.1 protein_id gnl|my_center|LOCUS_32090 3594974 3594195 gene locus_tag LOCUS_32100 3594974 3594195 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244526.1 protein_id gnl|my_center|LOCUS_32100 3595474 3595082 gene locus_tag LOCUS_32110 gene yabA 3595474 3595082 CDS product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412056.1 protein_id gnl|my_center|LOCUS_32110 3596328 3595525 gene locus_tag LOCUS_32120 3596328 3595525 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272429.1 protein_id gnl|my_center|LOCUS_32120 3597307 3596333 gene locus_tag LOCUS_32130 gene holB 3597307 3596333 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169561.1 protein_id gnl|my_center|LOCUS_32130 3597846 3597403 gene locus_tag LOCUS_32140 3597846 3597403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 3598193 3597864 gene locus_tag LOCUS_32150 3598193 3597864 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832200.1 protein_id gnl|my_center|LOCUS_32150 3598909 3598283 gene locus_tag LOCUS_32160 gene tmk 3598909 3598283 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243137.1 protein_id gnl|my_center|LOCUS_32160 3600477 3598975 gene locus_tag LOCUS_32170 3600477 3598975 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075273.1 protein_id gnl|my_center|LOCUS_32170 3600832 3600644 gene locus_tag LOCUS_32180 3600832 3600644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 3601094 3601624 gene locus_tag LOCUS_32190 3601094 3601624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 3601853 3601741 gene locus_tag LOCUS_r00190 3601853 3601741 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3604893 3601971 gene locus_tag LOCUS_r00200 3604893 3601971 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3605130 3605055 gene locus_tag LOCUS_t00620 3605130 3605055 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3605217 3605141 gene locus_tag LOCUS_t00630 3605217 3605141 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 3606936 3605384 gene locus_tag LOCUS_r00210 3606936 3605384 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3608336 3607248 gene locus_tag LOCUS_32200 3608336 3607248 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 protein_id gnl|my_center|LOCUS_32200 3610874 3608379 gene locus_tag LOCUS_32210 gene gyrA 3610874 3608379 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_32210 3611210 3611046 gene locus_tag LOCUS_32220 3611210 3611046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 3611259 3612011 gene locus_tag LOCUS_32230 3611259 3612011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 3613986 3612076 gene locus_tag LOCUS_32240 gene gyrB 3613986 3612076 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_32240 3614381 3614133 gene locus_tag LOCUS_32250 3614381 3614133 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815134.1 protein_id gnl|my_center|LOCUS_32250 3615524 3614415 gene locus_tag LOCUS_32260 gene recF 3615524 3614415 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470745.1 protein_id gnl|my_center|LOCUS_32260 3615786 3615571 gene locus_tag LOCUS_32270 gene rlbA 3615786 3615571 CDS product ribosome maturation protein RlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226810.1 protein_id gnl|my_center|LOCUS_32270 3617010 3615868 gene locus_tag LOCUS_32280 gene dnaN 3617010 3615868 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242509.1 protein_id gnl|my_center|LOCUS_32280 3618614 3617262 gene locus_tag LOCUS_32290 gene dnaA 3618614 3617262 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428017.1 protein_id gnl|my_center|LOCUS_32290 3618978 3618760 gene locus_tag LOCUS_32300 3618978 3618760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 3619258 3619392 gene locus_tag LOCUS_32310 gene rpmH 3619258 3619392 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831901.1 protein_id gnl|my_center|LOCUS_32310 3619475 3619822 gene locus_tag LOCUS_32320 gene rnpA 3619475 3619822 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723727.1 protein_id gnl|my_center|LOCUS_32320 3619963 3620736 gene locus_tag LOCUS_32330 gene spoIIIJ 3619963 3620736 CDS product YidC family membrane integrase SpoIIIJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886648.1 protein_id gnl|my_center|LOCUS_32330 3620733 3621449 gene locus_tag LOCUS_32340 3620733 3621449 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111516.1 protein_id gnl|my_center|LOCUS_32340 3621534 3622916 gene locus_tag LOCUS_32350 gene mnmE 3621534 3622916 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393757.1 protein_id gnl|my_center|LOCUS_32350 3622948 3624837 gene locus_tag LOCUS_32360 gene mnmG 3622948 3624837 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000541039.1 protein_id gnl|my_center|LOCUS_32360 3624840 3625562 gene locus_tag LOCUS_32370 gene rsmG 3624840 3625562 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243029.1 protein_id gnl|my_center|LOCUS_32370 3625722 3626555 gene locus_tag LOCUS_32380 gene noc 3625722 3626555 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799016.1 protein_id gnl|my_center|LOCUS_32380 3626801 3627574 gene locus_tag LOCUS_32390 gene soj 3626801 3627574 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_32390 3627555 3628409 gene locus_tag LOCUS_32400 gene spo0J 3627555 3628409 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 protein_id gnl|my_center|LOCUS_32400 3628513 3629688 gene locus_tag LOCUS_32410 3628513 3629688 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942513.1 protein_id gnl|my_center|LOCUS_32410 3629719 3630213 gene locus_tag LOCUS_32420 3629719 3630213 CDS product DUF4446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966988.1 protein_id gnl|my_center|LOCUS_32420 3630778 3630185 gene locus_tag LOCUS_32430 3630778 3630185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 3630950 3631189 gene locus_tag LOCUS_32440 3630950 3631189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 3631234 3631473 gene locus_tag LOCUS_32450 3631234 3631473 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728659.1 protein_id gnl|my_center|LOCUS_32450 3631549 3631639 gene locus_tag LOCUS_t00640 3631549 3631639 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3632227 3633984 gene locus_tag LOCUS_32460 3632227 3633984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 3633981 3635750 gene locus_tag LOCUS_32470 3633981 3635750 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_32470 3635747 3636733 gene locus_tag LOCUS_32480 3635747 3636733 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082691.1 protein_id gnl|my_center|LOCUS_32480 3636863 3637924 gene locus_tag LOCUS_32490 gene mglB 3636863 3637924 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816741.1 protein_id gnl|my_center|LOCUS_32490 3638012 3639529 gene locus_tag LOCUS_32500 gene mglA 3638012 3639529 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255039.1 protein_id gnl|my_center|LOCUS_32500 3639543 3640556 gene locus_tag LOCUS_32510 gene mglC 3639543 3640556 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275112.1 protein_id gnl|my_center|LOCUS_32510 3641180 3641001 gene locus_tag LOCUS_32520 3641180 3641001 CDS product YjzC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531418.1 protein_id gnl|my_center|LOCUS_32520 3641420 3641704 gene locus_tag LOCUS_32530 gene rpsF 3641420 3641704 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233779.1 protein_id gnl|my_center|LOCUS_32530 3641753 3642316 gene locus_tag LOCUS_32540 gene ssb 3641753 3642316 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721668.1 protein_id gnl|my_center|LOCUS_32540 3642335 3642613 gene locus_tag LOCUS_32550 gene rpsR 3642335 3642613 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897044.1 protein_id gnl|my_center|LOCUS_32550 3643066 3642713 gene locus_tag LOCUS_32560 3643066 3642713 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870963.1 protein_id gnl|my_center|LOCUS_32560 3643251 3644342 gene locus_tag LOCUS_32570 gene lytR 3643251 3644342 CDS product transcription antiterminator LytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227949.1 protein_id gnl|my_center|LOCUS_32570 3644361 3644813 gene locus_tag LOCUS_32580 3644361 3644813 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966935.1 protein_id gnl|my_center|LOCUS_32580 3645097 3645999 gene locus_tag LOCUS_32590 3645097 3645999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 3646013 3647980 gene locus_tag LOCUS_32600 gene gdpP 3646013 3647980 CDS product cyclic-di-AMP phosphodiesterase GdpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242517.1 protein_id gnl|my_center|LOCUS_32600 3647977 3648420 gene locus_tag LOCUS_32610 gene rplI 3647977 3648420 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_32610 3648404 3649807 gene locus_tag LOCUS_32620 gene dnaB 3648404 3649807 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_32620 3650037 3651323 gene locus_tag LOCUS_32630 gene purA 3650037 3651323 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243325.1 protein_id gnl|my_center|LOCUS_32630 3651542 3652357 gene locus_tag LOCUS_32640 3651542 3652357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 3652662 3654014 gene locus_tag LOCUS_32650 3652662 3654014 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393899.1 protein_id gnl|my_center|LOCUS_32650 3654220 3654978 gene locus_tag LOCUS_32660 gene walR 3654220 3654978 CDS product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244363.1 protein_id gnl|my_center|LOCUS_32660 3654975 3656933 gene locus_tag LOCUS_32670 gene walK 3654975 3656933 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722908.1 protein_id gnl|my_center|LOCUS_32670 3656930 3658363 gene locus_tag LOCUS_32680 gene yycH 3656930 3658363 CDS product two-component system activity regulator YycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061593.1 protein_id gnl|my_center|LOCUS_32680 3658491 3659213 gene locus_tag LOCUS_32690 3658491 3659213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 3659283 3660089 gene locus_tag LOCUS_32700 3659283 3660089 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522833.1 protein_id gnl|my_center|LOCUS_32700 3660279 3660058 gene locus_tag LOCUS_32710 3660279 3660058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 3660488 3661921 gene locus_tag LOCUS_32720 3660488 3661921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 3662052 3662225 gene locus_tag LOCUS_32730 3662052 3662225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 3662229 3662708 gene locus_tag LOCUS_32740 gene rlmH 3662229 3662708 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989404.1 protein_id gnl|my_center|LOCUS_32740 3662871 3663176 gene locus_tag LOCUS_32750 3662871 3663176 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234907.1 protein_id gnl|my_center|LOCUS_32750 3663450 3664883 gene locus_tag LOCUS_32760 gene lmr(B) 3663450 3664883 CDS product lincomycin efflux MFS transporter Lmr(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886396.1 protein_id gnl|my_center|LOCUS_32760 3664979 3665986 gene locus_tag LOCUS_32770 3664979 3665986 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532392.1 protein_id gnl|my_center|LOCUS_32770 3666109 3667134 gene locus_tag LOCUS_32780 3666109 3667134 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084237.1 protein_id gnl|my_center|LOCUS_32780 3667248 3667703 gene locus_tag LOCUS_32790 3667248 3667703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 3668338 3667958 gene locus_tag LOCUS_32800 3668338 3667958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 3669235 3668531 gene locus_tag LOCUS_32810 3669235 3668531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 3669477 3669253 gene locus_tag LOCUS_32820 3669477 3669253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 3670258 3669806 gene locus_tag LOCUS_32830 3670258 3669806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 3670573 3671118 gene locus_tag LOCUS_32840 3670573 3671118 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864755.1 protein_id gnl|my_center|LOCUS_32840 3671216 3672157 gene locus_tag LOCUS_32850 3671216 3672157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 3672527 3672345 gene locus_tag LOCUS_32860 3672527 3672345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 3673314 3672754 gene locus_tag LOCUS_32870 3673314 3672754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 3673540 3674397 gene locus_tag LOCUS_32880 3673540 3674397 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225309.1 protein_id gnl|my_center|LOCUS_32880 3674876 3675379 gene locus_tag LOCUS_32890 3674876 3675379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 3676236 3677630 gene locus_tag LOCUS_32900 3676236 3677630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 3678093 3678650 gene locus_tag LOCUS_32910 3678093 3678650 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948470.1 protein_id gnl|my_center|LOCUS_32910 3678783 3679349 gene locus_tag LOCUS_32920 3678783 3679349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 3679475 3680596 gene locus_tag LOCUS_32930 3679475 3680596 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990019.1 protein_id gnl|my_center|LOCUS_32930 3680596 3681318 gene locus_tag LOCUS_32940 3680596 3681318 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723280.1 protein_id gnl|my_center|LOCUS_32940 3681347 3682753 gene locus_tag LOCUS_32950 3681347 3682753 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860348.1 protein_id gnl|my_center|LOCUS_32950 3683876 3682839 gene locus_tag LOCUS_32960 3683876 3682839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 3684605 3684129 gene locus_tag LOCUS_32970 3684605 3684129 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801042.1 protein_id gnl|my_center|LOCUS_32970 3685109 3684630 gene locus_tag LOCUS_32980 3685109 3684630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 3685254 3686192 gene locus_tag LOCUS_32990 3685254 3686192 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755047.1 protein_id gnl|my_center|LOCUS_32990 3686689 3686240 gene locus_tag LOCUS_33000 3686689 3686240 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600350.1 protein_id gnl|my_center|LOCUS_33000 3686795 3687742 gene locus_tag LOCUS_33010 3686795 3687742 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434114.1 protein_id gnl|my_center|LOCUS_33010 3688295 3687822 gene locus_tag LOCUS_33020 3688295 3687822 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226555.1 protein_id gnl|my_center|LOCUS_33020 3688388 3688801 gene locus_tag LOCUS_33030 3688388 3688801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 3689210 3691147 gene locus_tag LOCUS_33040 3689210 3691147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 3692019 3691324 gene locus_tag LOCUS_33050 3692019 3691324 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233023.1 protein_id gnl|my_center|LOCUS_33050 3692180 3693637 gene locus_tag LOCUS_33060 3692180 3693637 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130061.1 protein_id gnl|my_center|LOCUS_33060 3694685 3693660 gene locus_tag LOCUS_33070 3694685 3693660 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755047.1 protein_id gnl|my_center|LOCUS_33070 3694802 3695224 gene locus_tag LOCUS_33080 3694802 3695224 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146729243.1 protein_id gnl|my_center|LOCUS_33080 3695411 3695878 gene locus_tag LOCUS_33090 3695411 3695878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963451.1 protein_id gnl|my_center|LOCUS_33090 3695948 3696433 gene locus_tag LOCUS_33100 3695948 3696433 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801042.1 protein_id gnl|my_center|LOCUS_33100 3696840 3698069 gene locus_tag LOCUS_33110 3696840 3698069 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814899.1 protein_id gnl|my_center|LOCUS_33110 3698843 3698202 gene locus_tag LOCUS_33120 3698843 3698202 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689887.1 protein_id gnl|my_center|LOCUS_33120 3698987 3699355 gene locus_tag LOCUS_33130 3698987 3699355 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391916.1 protein_id gnl|my_center|LOCUS_33130 3700833 3699472 gene locus_tag LOCUS_33140 gene mepA 3700833 3699472 CDS product multidrug efflux MATE transporter MepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651051.1 protein_id gnl|my_center|LOCUS_33140 3700973 3701656 gene locus_tag LOCUS_33150 3700973 3701656 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130063.1 protein_id gnl|my_center|LOCUS_33150 3702340 3701762 gene locus_tag LOCUS_33160 3702340 3701762 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974638.1 protein_id gnl|my_center|LOCUS_33160 3702798 3702337 gene locus_tag LOCUS_33170 3702798 3702337 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096727.1 protein_id gnl|my_center|LOCUS_33170 3702934 3703302 gene locus_tag LOCUS_33180 3702934 3703302 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229458.1 protein_id gnl|my_center|LOCUS_33180 3704377 3703307 gene locus_tag LOCUS_33190 3704377 3703307 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228694.1 protein_id gnl|my_center|LOCUS_33190 3705390 3704629 gene locus_tag LOCUS_33200 3705390 3704629 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963857.1 protein_id gnl|my_center|LOCUS_33200 3706306 3705458 gene locus_tag LOCUS_33210 3706306 3705458 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275478.1 protein_id gnl|my_center|LOCUS_33210 3706489 3707040 gene locus_tag LOCUS_33220 3706489 3707040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 3707101 3707451 gene locus_tag LOCUS_33230 3707101 3707451 CDS product nucleotide excision repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048949.1 protein_id gnl|my_center|LOCUS_33230 3707703 3708407 gene locus_tag LOCUS_33240 3707703 3708407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 3708433 3709164 gene locus_tag LOCUS_33250 3708433 3709164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 3709175 3709531 gene locus_tag LOCUS_33260 3709175 3709531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 3709723 3710649 gene locus_tag LOCUS_33270 3709723 3710649 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469098.1 protein_id gnl|my_center|LOCUS_33270 3710720 3711148 gene locus_tag LOCUS_33280 3710720 3711148 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140612.1 protein_id gnl|my_center|LOCUS_33280 3711575 3712519 gene locus_tag LOCUS_33290 3711575 3712519 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775693.1 protein_id gnl|my_center|LOCUS_33290 3712535 3713464 gene locus_tag LOCUS_33300 3712535 3713464 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_33300 3713577 3715100 gene locus_tag LOCUS_33310 3713577 3715100 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_33310 3715263 3717023 gene locus_tag LOCUS_33320 3715263 3717023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 3716998 3717759 gene locus_tag LOCUS_33330 3716998 3717759 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016216.1 protein_id gnl|my_center|LOCUS_33330 3717809 3719281 gene locus_tag LOCUS_33340 3717809 3719281 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_33340 3719256 3719420 gene locus_tag LOCUS_33350 3719256 3719420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 3719510 3721465 gene locus_tag LOCUS_33360 3719510 3721465 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986616.1 protein_id gnl|my_center|LOCUS_33360 3722789 3721560 gene locus_tag LOCUS_33370 3722789 3721560 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186025.1 protein_id gnl|my_center|LOCUS_33370 3723239 3724435 gene locus_tag LOCUS_33380 3723239 3724435 CDS product ParM/StbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476644.1 protein_id gnl|my_center|LOCUS_33380 3724463 3724870 gene locus_tag LOCUS_33390 3724463 3724870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 3725330 3725923 gene locus_tag LOCUS_33400 3725330 3725923 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477833.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33400 3725937 3727736 gene locus_tag LOCUS_33410 3725937 3727736 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_33410 3729045 3727927 gene locus_tag LOCUS_33420 3729045 3727927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 3729466 3729035 gene locus_tag LOCUS_33430 3729466 3729035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 3731015 3729459 gene locus_tag LOCUS_33440 3731015 3729459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 3731146 3731781 gene locus_tag LOCUS_33450 gene casR 3731146 3731781 CDS product two-component system response regulator CasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694623.1 protein_id gnl|my_center|LOCUS_33450 3732422 3731847 gene locus_tag LOCUS_33460 gene lepB 3732422 3731847 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_33460 3733207 3732521 gene locus_tag LOCUS_33470 3733207 3732521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 3734085 3733300 gene locus_tag LOCUS_33480 3734085 3733300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 3734595 3734131 gene locus_tag LOCUS_33490 3734595 3734131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 3736053 3734875 gene locus_tag LOCUS_33500 3736053 3734875 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126014666.1 protein_id gnl|my_center|LOCUS_33500 3736222 3737331 gene locus_tag LOCUS_33510 3736222 3737331 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_33510 3737346 3738188 gene locus_tag LOCUS_33520 3737346 3738188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 3738211 3739233 gene locus_tag LOCUS_33530 3738211 3739233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 3739633 3740847 gene locus_tag LOCUS_33540 3739633 3740847 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 protein_id gnl|my_center|LOCUS_33540 3741608 3740901 gene locus_tag LOCUS_33550 3741608 3740901 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234156.1 protein_id gnl|my_center|LOCUS_33550 3741827 3742489 gene locus_tag LOCUS_33560 3741827 3742489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 3742570 3746532 gene locus_tag LOCUS_33570 3742570 3746532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 3746727 3747866 gene locus_tag LOCUS_33580 3746727 3747866 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272186.1 protein_id gnl|my_center|LOCUS_33580 3747881 3748846 gene locus_tag LOCUS_33590 3747881 3748846 CDS product NHLP bacteriocin system secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814912.1 protein_id gnl|my_center|LOCUS_33590 3748866 3751115 gene locus_tag LOCUS_33600 3748866 3751115 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_33600 3751155 3754079 gene locus_tag LOCUS_33610 3751155 3754079 CDS product NHLP bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_33610 3754165 3754536 gene locus_tag LOCUS_33620 3754165 3754536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 3754739 3755149 gene locus_tag LOCUS_33630 3754739 3755149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 3755177 3755590 gene locus_tag LOCUS_33640 3755177 3755590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 3755819 3757141 gene locus_tag LOCUS_33650 3755819 3757141 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532932.1 protein_id gnl|my_center|LOCUS_33650 3757157 3758089 gene locus_tag LOCUS_33660 3757157 3758089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 3758070 3760397 gene locus_tag LOCUS_33670 3758070 3760397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 3760394 3760717 gene locus_tag LOCUS_33680 3760394 3760717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 3760714 3761478 gene locus_tag LOCUS_33690 gene fabG 3760714 3761478 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392464.1 protein_id gnl|my_center|LOCUS_33690 3761475 3762227 gene locus_tag LOCUS_33700 3761475 3762227 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531692.1 protein_id gnl|my_center|LOCUS_33700 3762254 3762643 gene locus_tag LOCUS_33710 gene acpS 3762254 3762643 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583416.1 protein_id gnl|my_center|LOCUS_33710 3762640 3763581 gene locus_tag LOCUS_33720 3762640 3763581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 3763820 3764521 gene locus_tag LOCUS_33730 3763820 3764521 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965648.1 protein_id gnl|my_center|LOCUS_33730 3765338 3764535 gene locus_tag LOCUS_33740 3765338 3764535 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902733.1 protein_id gnl|my_center|LOCUS_33740 3766148 3765369 gene locus_tag LOCUS_33750 3766148 3765369 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861714.1 protein_id gnl|my_center|LOCUS_33750 3767179 3766229 gene locus_tag LOCUS_33760 3767179 3766229 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140222.1 protein_id gnl|my_center|LOCUS_33760 3768549 3767206 gene locus_tag LOCUS_33770 3768549 3767206 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898649.1 protein_id gnl|my_center|LOCUS_33770 3769404 3768586 gene locus_tag LOCUS_33780 3769404 3768586 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898651.1 protein_id gnl|my_center|LOCUS_33780 3770294 3769422 gene locus_tag LOCUS_33790 3770294 3769422 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416903.1 protein_id gnl|my_center|LOCUS_33790 3771372 3770287 gene locus_tag LOCUS_33800 3771372 3770287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436292.1 protein_id gnl|my_center|LOCUS_33800 3772274 3771666 gene locus_tag LOCUS_33810 3772274 3771666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 3772506 3773540 gene locus_tag LOCUS_33820 3772506 3773540 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_33820 3773681 3774967 gene locus_tag LOCUS_33830 3773681 3774967 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_33830 3775228 3775653 gene locus_tag LOCUS_33840 3775228 3775653 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359781.1 protein_id gnl|my_center|LOCUS_33840 3776678 3775803 gene locus_tag LOCUS_33850 3776678 3775803 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242958.1 protein_id gnl|my_center|LOCUS_33850 3777092 3776844 gene locus_tag LOCUS_33860 3777092 3776844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 3777055 3778023 gene locus_tag LOCUS_33870 3777055 3778023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 3778254 3778991 gene locus_tag LOCUS_33880 gene pyrH 3778254 3778991 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248055.1 protein_id gnl|my_center|LOCUS_33880 3779506 3781761 gene locus_tag LOCUS_33890 3779506 3781761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 3781786 3783408 gene locus_tag LOCUS_33900 3781786 3783408 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014246.1 protein_id gnl|my_center|LOCUS_33900 3783421 3783822 gene locus_tag LOCUS_33910 3783421 3783822 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191582.1 protein_id gnl|my_center|LOCUS_33910 3785051 3783990 gene locus_tag LOCUS_33920 3785051 3783990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 3785251 3786252 gene locus_tag LOCUS_33930 3785251 3786252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 3786686 3787657 gene locus_tag LOCUS_33940 3786686 3787657 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_33940 3787676 3788584 gene locus_tag LOCUS_33950 3787676 3788584 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_33950 3788634 3790250 gene locus_tag LOCUS_33960 3788634 3790250 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 protein_id gnl|my_center|LOCUS_33960 3792623 3790320 gene locus_tag LOCUS_33970 3792623 3790320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 3792732 3793757 gene locus_tag LOCUS_33980 3792732 3793757 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714630.1 protein_id gnl|my_center|LOCUS_33980 3793763 3796465 gene locus_tag LOCUS_33990 3793763 3796465 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_33990 3796489 3797523 gene locus_tag LOCUS_34000 3796489 3797523 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405515.1 protein_id gnl|my_center|LOCUS_34000 3797776 3798156 gene locus_tag LOCUS_34010 3797776 3798156 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964329.1 protein_id gnl|my_center|LOCUS_34010 3799177 3798335 gene locus_tag LOCUS_34020 3799177 3798335 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793532.1 protein_id gnl|my_center|LOCUS_34020 3800500 3799283 gene locus_tag LOCUS_34030 3800500 3799283 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229456.1 protein_id gnl|my_center|LOCUS_34030 3800649 3801065 gene locus_tag LOCUS_34040 3800649 3801065 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229458.1 protein_id gnl|my_center|LOCUS_34040 3801250 3801525 gene locus_tag LOCUS_34050 3801250 3801525 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456206.1 protein_id gnl|my_center|LOCUS_34050 3801597 3801908 gene locus_tag LOCUS_34060 3801597 3801908 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661811.1 protein_id gnl|my_center|LOCUS_34060 3801942 3802328 gene locus_tag LOCUS_34070 3801942 3802328 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092321.1 protein_id gnl|my_center|LOCUS_34070 3802552 3803361 gene locus_tag LOCUS_34080 3802552 3803361 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493645.1 protein_id gnl|my_center|LOCUS_34080 3803377 3805371 gene locus_tag LOCUS_34090 3803377 3805371 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391308.1 protein_id gnl|my_center|LOCUS_34090 3805611 3806048 gene locus_tag LOCUS_34100 3805611 3806048 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243655.1 protein_id gnl|my_center|LOCUS_34100 3806054 3807319 gene locus_tag LOCUS_34110 3806054 3807319 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233759.1 protein_id gnl|my_center|LOCUS_34110 3807484 3808158 gene locus_tag LOCUS_34120 3807484 3808158 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229666.1 protein_id gnl|my_center|LOCUS_34120 3808343 3809626 gene locus_tag LOCUS_34130 3808343 3809626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 3809702 3809998 gene locus_tag LOCUS_34140 3809702 3809998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 3810098 3810703 gene locus_tag LOCUS_34150 3810098 3810703 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222730.1 protein_id gnl|my_center|LOCUS_34150 3810811 3811275 gene locus_tag LOCUS_34160 3810811 3811275 CDS product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230675.1 protein_id gnl|my_center|LOCUS_34160 3811309 3811977 gene locus_tag LOCUS_34170 3811309 3811977 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965313.1 protein_id gnl|my_center|LOCUS_34170 3812150 3812839 gene locus_tag LOCUS_34180 3812150 3812839 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822492.1 protein_id gnl|my_center|LOCUS_34180 3812832 3813992 gene locus_tag LOCUS_34190 3812832 3813992 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369660.1 protein_id gnl|my_center|LOCUS_34190 3814114 3814710 gene locus_tag LOCUS_34200 3814114 3814710 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348886.1 protein_id gnl|my_center|LOCUS_34200 3814982 3815803 gene locus_tag LOCUS_34210 3814982 3815803 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963219.1 protein_id gnl|my_center|LOCUS_34210 3815930 3816787 gene locus_tag LOCUS_34220 3815930 3816787 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759382.1 protein_id gnl|my_center|LOCUS_34220 3816893 3817552 gene locus_tag LOCUS_34230 3816893 3817552 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245030.1 protein_id gnl|my_center|LOCUS_34230 3817667 3818350 gene locus_tag LOCUS_34240 3817667 3818350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047726.1 protein_id gnl|my_center|LOCUS_34240 3818549 3819781 gene locus_tag LOCUS_34250 3818549 3819781 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 protein_id gnl|my_center|LOCUS_34250 3820620 3819880 gene locus_tag LOCUS_34260 3820620 3819880 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460169.1 protein_id gnl|my_center|LOCUS_34260 3821884 3820874 gene locus_tag LOCUS_34270 3821884 3820874 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983751.1 protein_id gnl|my_center|LOCUS_34270 3822891 3821881 gene locus_tag LOCUS_34280 3822891 3821881 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823047.1 protein_id gnl|my_center|LOCUS_34280 3823912 3822896 gene locus_tag LOCUS_34290 3823912 3822896 CDS product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732576.1 protein_id gnl|my_center|LOCUS_34290 3824100 3825149 gene locus_tag LOCUS_34300 3824100 3825149 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078275.1 protein_id gnl|my_center|LOCUS_34300 3825564 3825244 gene locus_tag LOCUS_34310 gene rhaM 3825564 3825244 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243762.1 protein_id gnl|my_center|LOCUS_34310 3827082 3825580 gene locus_tag LOCUS_34320 3827082 3825580 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976070.1 protein_id gnl|my_center|LOCUS_34320 3827242 3828120 gene locus_tag LOCUS_34330 3827242 3828120 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355307.1 protein_id gnl|my_center|LOCUS_34330 3828978 3828286 gene locus_tag LOCUS_34340 3828978 3828286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 3829070 3829477 gene locus_tag LOCUS_34350 3829070 3829477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 3830476 3829715 gene locus_tag LOCUS_34360 3830476 3829715 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 protein_id gnl|my_center|LOCUS_34360 3831197 3830616 gene locus_tag LOCUS_34370 3831197 3830616 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243181.1 protein_id gnl|my_center|LOCUS_34370 3833021 3831453 gene locus_tag LOCUS_34380 gene katX 3833021 3831453 CDS product catalase KatX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243042.1 protein_id gnl|my_center|LOCUS_34380 3834203 3833502 gene locus_tag LOCUS_34390 gene thiE 3834203 3833502 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090962.1 protein_id gnl|my_center|LOCUS_34390 3835017 3834193 gene locus_tag LOCUS_34400 gene thiD 3835017 3834193 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035802.1 protein_id gnl|my_center|LOCUS_34400 3835857 3835057 gene locus_tag LOCUS_34410 gene thiM 3835857 3835057 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056115.1 protein_id gnl|my_center|LOCUS_34410 3836925 3835897 gene locus_tag LOCUS_34420 3836925 3835897 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670421.1 protein_id gnl|my_center|LOCUS_34420 3837710 3836922 gene locus_tag LOCUS_34430 3837710 3836922 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080857.1 protein_id gnl|my_center|LOCUS_34430 3838485 3837682 gene locus_tag LOCUS_34440 3838485 3837682 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256330.1 protein_id gnl|my_center|LOCUS_34440 3839855 3838857 gene locus_tag LOCUS_34450 3839855 3838857 CDS product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460934.1 protein_id gnl|my_center|LOCUS_34450 3840111 3841328 gene locus_tag LOCUS_34460 gene hmpA 3840111 3841328 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947707.1 protein_id gnl|my_center|LOCUS_34460 3841912 3841406 gene locus_tag LOCUS_34470 3841912 3841406 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600586.1 protein_id gnl|my_center|LOCUS_34470 3842108 3842989 gene locus_tag LOCUS_34480 3842108 3842989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 3842992 3843438 gene locus_tag LOCUS_34490 3842992 3843438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 3843735 3845459 gene locus_tag LOCUS_34500 3843735 3845459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 3846500 3845592 gene locus_tag LOCUS_34510 3846500 3845592 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447162.1 protein_id gnl|my_center|LOCUS_34510 3847938 3846628 gene locus_tag LOCUS_34520 3847938 3846628 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713010.1 protein_id gnl|my_center|LOCUS_34520 3848881 3848306 gene locus_tag LOCUS_34530 3848881 3848306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 3850187 3849045 gene locus_tag LOCUS_34540 gene dnaN 3850187 3849045 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242509.1 protein_id gnl|my_center|LOCUS_34540 3850449 3850192 gene locus_tag LOCUS_34550 3850449 3850192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 3850632 3851693 gene locus_tag LOCUS_34560 gene rlmN 3850632 3851693 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989487.1 protein_id gnl|my_center|LOCUS_34560 3852109 3852576 gene locus_tag LOCUS_34570 gene greA 3852109 3852576 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422204.1 protein_id gnl|my_center|LOCUS_34570 3853073 3854242 gene locus_tag LOCUS_34580 3853073 3854242 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287288.1 protein_id gnl|my_center|LOCUS_34580 3854385 3857399 gene locus_tag LOCUS_34590 3854385 3857399 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027462.1 protein_id gnl|my_center|LOCUS_34590 3857541 3859004 gene locus_tag LOCUS_34600 3857541 3859004 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039351.1 protein_id gnl|my_center|LOCUS_34600 3860132 3859188 gene locus_tag LOCUS_34610 3860132 3859188 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063174092.1 protein_id gnl|my_center|LOCUS_34610 3860220 3861083 gene locus_tag LOCUS_34620 3860220 3861083 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028225.1 protein_id gnl|my_center|LOCUS_34620 3862194 3861361 gene locus_tag LOCUS_34630 3862194 3861361 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974649.1 protein_id gnl|my_center|LOCUS_34630 3863014 3862199 gene locus_tag LOCUS_34640 3863014 3862199 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326870.1 protein_id gnl|my_center|LOCUS_34640 3863320 3864309 gene locus_tag LOCUS_34650 3863320 3864309 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645267.1 protein_id gnl|my_center|LOCUS_34650 3864335 3864661 gene locus_tag LOCUS_34660 3864335 3864661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 3864987 3865274 gene locus_tag LOCUS_34670 3864987 3865274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 3865517 3866350 gene locus_tag LOCUS_34680 3865517 3866350 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228670.1 protein_id gnl|my_center|LOCUS_34680 3866370 3867305 gene locus_tag LOCUS_34690 3866370 3867305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 3867422 3868552 gene locus_tag LOCUS_34700 3867422 3868552 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767191.1 protein_id gnl|my_center|LOCUS_34700 3869029 3868601 gene locus_tag LOCUS_34710 3869029 3868601 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600350.1 protein_id gnl|my_center|LOCUS_34710 3870464 3869223 gene locus_tag LOCUS_34720 3870464 3869223 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757481.1 protein_id gnl|my_center|LOCUS_34720 3872526 3871192 gene locus_tag LOCUS_34730 3872526 3871192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 3872866 3872681 gene locus_tag LOCUS_34740 3872866 3872681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 3873020 3873574 gene locus_tag LOCUS_34750 3873020 3873574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34750 3873590 3873913 gene locus_tag LOCUS_34760 3873590 3873913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34760 3876270 3873955 gene locus_tag LOCUS_34770 3876270 3873955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 3876506 3877528 gene locus_tag LOCUS_34780 gene add 3876506 3877528 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948672.1 protein_id gnl|my_center|LOCUS_34780 3877654 3878730 gene locus_tag LOCUS_34790 3877654 3878730 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158098.1 protein_id gnl|my_center|LOCUS_34790 3879032 3879232 gene locus_tag LOCUS_34800 gene cspB 3879032 3879232 CDS product cold-shock protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723180.1 protein_id gnl|my_center|LOCUS_34800 3879447 3880532 gene locus_tag LOCUS_34810 3879447 3880532 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837892.1 protein_id gnl|my_center|LOCUS_34810 3880693 3884448 gene locus_tag LOCUS_34820 3880693 3884448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 3884685 3887153 gene locus_tag LOCUS_34830 3884685 3887153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 3887678 3887202 gene locus_tag LOCUS_34840 3887678 3887202 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011091014.1 protein_id gnl|my_center|LOCUS_34840 3888015 3888527 gene locus_tag LOCUS_34850 3888015 3888527 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813074.1 protein_id gnl|my_center|LOCUS_34850 3888511 3890514 gene locus_tag LOCUS_34860 gene tet 3888511 3890514 CDS product tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964757.1 protein_id gnl|my_center|LOCUS_34860 3891514 3890672 gene locus_tag LOCUS_34870 3891514 3890672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 3892861 3891821 gene locus_tag LOCUS_34880 3892861 3891821 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227743.1 protein_id gnl|my_center|LOCUS_34880 3893028 3894173 gene locus_tag LOCUS_34890 gene nosA 3893028 3894173 CDS product nitric oxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243309.1 protein_id gnl|my_center|LOCUS_34890 3894170 3894424 gene locus_tag LOCUS_34900 3894170 3894424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 3895060 3894464 gene locus_tag LOCUS_34910 3895060 3894464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 3896290 3895088 gene locus_tag LOCUS_34920 3896290 3895088 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259359.1 protein_id gnl|my_center|LOCUS_34920 3896701 3896369 gene locus_tag LOCUS_34930 3896701 3896369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 3896935 3898902 gene locus_tag LOCUS_34940 3896935 3898902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 3898974 3899525 gene locus_tag LOCUS_34950 3898974 3899525 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103131.1 protein_id gnl|my_center|LOCUS_34950 3899597 3899998 gene locus_tag LOCUS_34960 3899597 3899998 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600350.1 protein_id gnl|my_center|LOCUS_34960 3901689 3900124 gene locus_tag LOCUS_34970 3901689 3900124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 3901826 3902158 gene locus_tag LOCUS_34980 3901826 3902158 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 protein_id gnl|my_center|LOCUS_34980 3902158 3903501 gene locus_tag LOCUS_34990 3902158 3903501 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183571152.1 protein_id gnl|my_center|LOCUS_34990 3903646 3904680 gene locus_tag LOCUS_35000 3903646 3904680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 3904680 3905453 gene locus_tag LOCUS_35010 3904680 3905453 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_35010 3905730 3906254 gene locus_tag LOCUS_35020 3905730 3906254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 3906442 3907263 gene locus_tag LOCUS_35030 3906442 3907263 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924976.1 protein_id gnl|my_center|LOCUS_35030 3907312 3907680 gene locus_tag LOCUS_35040 3907312 3907680 CDS product DUF4180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403459.1 protein_id gnl|my_center|LOCUS_35040 3907817 3908680 gene locus_tag LOCUS_35050 3907817 3908680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 3909434 3908793 gene locus_tag LOCUS_35060 3909434 3908793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 3909605 3910126 gene locus_tag LOCUS_35070 3909605 3910126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 3910260 3910997 gene locus_tag LOCUS_35080 3910260 3910997 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290748.1 protein_id gnl|my_center|LOCUS_35080 3911645 3911136 gene locus_tag LOCUS_35090 3911645 3911136 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949403.1 protein_id gnl|my_center|LOCUS_35090 3911981 3911757 gene locus_tag LOCUS_35100 3911981 3911757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 3912151 3912360 gene locus_tag LOCUS_35110 3912151 3912360 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_35110 3912365 3912838 gene locus_tag LOCUS_35120 3912365 3912838 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703940.1 protein_id gnl|my_center|LOCUS_35120 3912950 3913453 gene locus_tag LOCUS_35130 3912950 3913453 CDS product cytochrome c biogenesis protein CcdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028639.1 protein_id gnl|my_center|LOCUS_35130 3913548 3914006 gene locus_tag LOCUS_35140 3913548 3914006 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133916.1 protein_id gnl|my_center|LOCUS_35140 3914694 3914113 gene locus_tag LOCUS_35150 3914694 3914113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 3915232 3914699 gene locus_tag LOCUS_35160 3915232 3914699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 3915575 3915865 gene locus_tag LOCUS_35170 3915575 3915865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 3915920 3918352 gene locus_tag LOCUS_35180 3915920 3918352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 3918370 3920982 gene locus_tag LOCUS_35190 3918370 3920982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 3920939 3922831 gene locus_tag LOCUS_35200 3920939 3922831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 3922841 3925012 gene locus_tag LOCUS_35210 3922841 3925012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 3926409 3925078 gene locus_tag LOCUS_35220 3926409 3925078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 3927155 3926406 gene locus_tag LOCUS_35230 3927155 3926406 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393162.1 protein_id gnl|my_center|LOCUS_35230 3928387 3927152 gene locus_tag LOCUS_35240 3928387 3927152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 3929169 3928636 gene locus_tag LOCUS_35250 3929169 3928636 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_35250 3929792 3930757 gene locus_tag LOCUS_35260 3929792 3930757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 3930762 3931628 gene locus_tag LOCUS_35270 gene thiG 3930762 3931628 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886483.1 protein_id gnl|my_center|LOCUS_35270 3931625 3932824 gene locus_tag LOCUS_35280 gene thiO 3931625 3932824 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230302.1 protein_id gnl|my_center|LOCUS_35280 3935242 3933284 gene locus_tag LOCUS_35290 3935242 3933284 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732630.1 protein_id gnl|my_center|LOCUS_35290 3936969 3935239 gene locus_tag LOCUS_35300 3936969 3935239 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966556.1 protein_id gnl|my_center|LOCUS_35300 3937515 3936976 gene locus_tag LOCUS_35310 3937515 3936976 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966557.1 protein_id gnl|my_center|LOCUS_35310 3937863 3939521 gene locus_tag LOCUS_35320 3937863 3939521 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_35320 3940756 3939608 gene locus_tag LOCUS_35330 3940756 3939608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 3941542 3940931 gene locus_tag LOCUS_35340 3941542 3940931 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530303.1 protein_id gnl|my_center|LOCUS_35340 3942567 3941584 gene locus_tag LOCUS_35350 3942567 3941584 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392003.1 protein_id gnl|my_center|LOCUS_35350 3943438 3942848 gene locus_tag LOCUS_35360 3943438 3942848 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277026.1 protein_id gnl|my_center|LOCUS_35360 3943923 3943480 gene locus_tag LOCUS_35370 3943923 3943480 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512998.1 protein_id gnl|my_center|LOCUS_35370 3944107 3944433 gene locus_tag LOCUS_35380 3944107 3944433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 3944505 3945143 gene locus_tag LOCUS_35390 3944505 3945143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 3946592 3945351 gene locus_tag LOCUS_35400 3946592 3945351 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246358.1 protein_id gnl|my_center|LOCUS_35400 3947354 3946893 gene locus_tag LOCUS_35410 3947354 3946893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 3947821 3950256 gene locus_tag LOCUS_35420 gene nasD 3947821 3950256 CDS product NADPH-nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234637.1 protein_id gnl|my_center|LOCUS_35420 3950362 3950697 gene locus_tag LOCUS_35430 gene nirD 3950362 3950697 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246252.1 protein_id gnl|my_center|LOCUS_35430 3950773 3951600 gene locus_tag LOCUS_35440 3950773 3951600 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228112.1 protein_id gnl|my_center|LOCUS_35440 3951614 3952381 gene locus_tag LOCUS_35450 gene cobA 3951614 3952381 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521262.1 protein_id gnl|my_center|LOCUS_35450 3952644 3953774 gene locus_tag LOCUS_35460 3952644 3953774 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583058.1 protein_id gnl|my_center|LOCUS_35460 3953796 3954521 gene locus_tag LOCUS_35470 3953796 3954521 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932350.1 protein_id gnl|my_center|LOCUS_35470 3954534 3955463 gene locus_tag LOCUS_35480 3954534 3955463 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416574.1 protein_id gnl|my_center|LOCUS_35480 3955477 3956862 gene locus_tag LOCUS_35490 3955477 3956862 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978322.1 protein_id gnl|my_center|LOCUS_35490 3956930 3959053 gene locus_tag LOCUS_35500 3956930 3959053 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391620.1 protein_id gnl|my_center|LOCUS_35500 3959079 3959990 gene locus_tag LOCUS_35510 3959079 3959990 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382199.1 protein_id gnl|my_center|LOCUS_35510 3960006 3960878 gene locus_tag LOCUS_35520 3960006 3960878 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 protein_id gnl|my_center|LOCUS_35520 3960920 3962545 gene locus_tag LOCUS_35530 3960920 3962545 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357899.1 protein_id gnl|my_center|LOCUS_35530 3962729 3963427 gene locus_tag LOCUS_35540 3962729 3963427 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553324.1 protein_id gnl|my_center|LOCUS_35540 3963890 3964714 gene locus_tag LOCUS_35550 3963890 3964714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 3964879 3966318 gene locus_tag LOCUS_35560 gene nagZ 3964879 3966318 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_35560 3967592 3966561 gene locus_tag LOCUS_35570 gene malR 3967592 3966561 CDS product maltose operon transcriptional repressor MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219053.1 protein_id gnl|my_center|LOCUS_35570 3968084 3969409 gene locus_tag LOCUS_35580 3968084 3969409 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709916.1 protein_id gnl|my_center|LOCUS_35580 3969533 3970846 gene locus_tag LOCUS_35590 3969533 3970846 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035541.1 protein_id gnl|my_center|LOCUS_35590 3970843 3971682 gene locus_tag LOCUS_35600 3970843 3971682 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162661.1 protein_id gnl|my_center|LOCUS_35600 3971679 3973325 gene locus_tag LOCUS_35610 3971679 3973325 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584022.1 protein_id gnl|my_center|LOCUS_35610 3973494 3974264 gene locus_tag LOCUS_35620 3973494 3974264 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258858.1 protein_id gnl|my_center|LOCUS_35620 3976140 3974395 gene locus_tag LOCUS_35630 3976140 3974395 CDS product alpha-glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471779.1 protein_id gnl|my_center|LOCUS_35630 3976479 3977453 gene locus_tag LOCUS_35640 3976479 3977453 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_35640 3977533 3978411 gene locus_tag LOCUS_35650 3977533 3978411 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 protein_id gnl|my_center|LOCUS_35650 3978502 3980241 gene locus_tag LOCUS_35660 3978502 3980241 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357899.1 protein_id gnl|my_center|LOCUS_35660 3980378 3982297 gene locus_tag LOCUS_35670 3980378 3982297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 3982272 3983885 gene locus_tag LOCUS_35680 3982272 3983885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 3984054 3985841 gene locus_tag LOCUS_35690 3984054 3985841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 3985945 3986970 gene locus_tag LOCUS_35700 3985945 3986970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 3987578 3987249 gene locus_tag LOCUS_35710 3987578 3987249 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461986.1 protein_id gnl|my_center|LOCUS_35710 3988727 3987600 gene locus_tag LOCUS_35720 3988727 3987600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 3989392 3989976 gene locus_tag LOCUS_35730 gene sugR 3989392 3989976 CDS product efflux SMR transporter transcriptional repressor SugR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721417.1 protein_id gnl|my_center|LOCUS_35730 3989993 3990358 gene locus_tag LOCUS_35740 gene sugE 3989993 3990358 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705814.1 protein_id gnl|my_center|LOCUS_35740 3990386 3990709 gene locus_tag LOCUS_35750 gene sugE 3990386 3990709 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123025.1 protein_id gnl|my_center|LOCUS_35750 3990879 3991514 gene locus_tag LOCUS_35760 3990879 3991514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 3992265 3991636 gene locus_tag LOCUS_35770 3992265 3991636 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389675.1 protein_id gnl|my_center|LOCUS_35770 3993190 3992528 gene locus_tag LOCUS_35780 3993190 3992528 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_35780 3994409 3993210 gene locus_tag LOCUS_35790 3994409 3993210 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433551.1 protein_id gnl|my_center|LOCUS_35790 3996049 3994406 gene locus_tag LOCUS_35800 3996049 3994406 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385517.1 protein_id gnl|my_center|LOCUS_35800 3997296 3996091 gene locus_tag LOCUS_35810 3997296 3996091 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626531.1 protein_id gnl|my_center|LOCUS_35810 3997460 3998362 gene locus_tag LOCUS_35820 3997460 3998362 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050612.1 protein_id gnl|my_center|LOCUS_35820 3999138 3998461 gene locus_tag LOCUS_35830 3999138 3998461 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965838.1 protein_id gnl|my_center|LOCUS_35830 4000358 3999183 gene locus_tag LOCUS_35840 4000358 3999183 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531927.1 protein_id gnl|my_center|LOCUS_35840 4001214 4000387 gene locus_tag LOCUS_35850 4001214 4000387 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531924.1 protein_id gnl|my_center|LOCUS_35850 4002145 4001216 gene locus_tag LOCUS_35860 4002145 4001216 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329342.1 protein_id gnl|my_center|LOCUS_35860 4003546 4002230 gene locus_tag LOCUS_35870 4003546 4002230 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972818.1 protein_id gnl|my_center|LOCUS_35870 4003847 4004746 gene locus_tag LOCUS_35880 4003847 4004746 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897345.1 protein_id gnl|my_center|LOCUS_35880 4004842 4005267 gene locus_tag LOCUS_35890 gene saiR 4004842 4005267 CDS product Rrf2-family transcriptional regulator SaiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083465.1 protein_id gnl|my_center|LOCUS_35890 4005337 4005648 gene locus_tag LOCUS_35900 gene trxA 4005337 4005648 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851800.1 protein_id gnl|my_center|LOCUS_35900 4005870 4007117 gene locus_tag LOCUS_35910 4005870 4007117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 4007285 4008049 gene locus_tag LOCUS_35920 4007285 4008049 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813595.1 protein_id gnl|my_center|LOCUS_35920 4008333 4008187 gene locus_tag LOCUS_35930 4008333 4008187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 4008505 4009605 gene locus_tag LOCUS_35940 gene ychF 4008505 4009605 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242727.1 protein_id gnl|my_center|LOCUS_35940 4009840 4010913 gene locus_tag LOCUS_35950 gene prfA 4009840 4010913 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887065.1 protein_id gnl|my_center|LOCUS_35950 4011134 4012447 gene locus_tag LOCUS_35960 4011134 4012447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 4012681 4013454 gene locus_tag LOCUS_35970 gene spoIIR 4012681 4013454 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227654.1 protein_id gnl|my_center|LOCUS_35970 4015005 4013542 gene locus_tag LOCUS_35980 4015005 4013542 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890812.1 protein_id gnl|my_center|LOCUS_35980 4015394 4016407 gene locus_tag LOCUS_35990 4015394 4016407 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227659.1 protein_id gnl|my_center|LOCUS_35990 4016793 4017353 gene locus_tag LOCUS_36000 4016793 4017353 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227661.1 protein_id gnl|my_center|LOCUS_36000 4017391 4017972 gene locus_tag LOCUS_36010 4017391 4017972 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393870.1 protein_id gnl|my_center|LOCUS_36010 4018292 4018759 gene locus_tag LOCUS_36020 gene rpiB 4018292 4018759 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869549.1 protein_id gnl|my_center|LOCUS_36020 4018772 4019374 gene locus_tag LOCUS_36030 4018772 4019374 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227667.1 protein_id gnl|my_center|LOCUS_36030 4019475 4020722 gene locus_tag LOCUS_36040 gene glyA 4019475 4020722 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110494.1 protein_id gnl|my_center|LOCUS_36040 4021078 4021869 gene locus_tag LOCUS_36050 4021078 4021869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 4022088 4023146 gene locus_tag LOCUS_36060 4022088 4023146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 4023331 4023960 gene locus_tag LOCUS_36070 gene upp 4023331 4023960 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_36070 4023976 4025124 gene locus_tag LOCUS_36080 gene wecB 4023976 4025124 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140145.1 protein_id gnl|my_center|LOCUS_36080 4025314 4025565 gene locus_tag LOCUS_36090 4025314 4025565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 4025565 4025975 gene locus_tag LOCUS_36100 4025565 4025975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 4025976 4026749 gene locus_tag LOCUS_36110 gene atpB 4025976 4026749 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399871.1 protein_id gnl|my_center|LOCUS_36110 4026824 4027048 gene locus_tag LOCUS_36120 4026824 4027048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 4027152 4027634 gene locus_tag LOCUS_36130 gene atpF 4027152 4027634 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244051.1 protein_id gnl|my_center|LOCUS_36130 4027631 4028179 gene locus_tag LOCUS_36140 gene atpH 4027631 4028179 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064678.1 protein_id gnl|my_center|LOCUS_36140 4028196 4029710 gene locus_tag LOCUS_36150 gene atpA 4028196 4029710 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027518.1 protein_id gnl|my_center|LOCUS_36150 4029834 4030694 gene locus_tag LOCUS_36160 gene atpG 4029834 4030694 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244388.1 protein_id gnl|my_center|LOCUS_36160 4030831 4032249 gene locus_tag LOCUS_36170 gene atpD 4030831 4032249 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032600.1 protein_id gnl|my_center|LOCUS_36170 4032311 4032709 gene locus_tag LOCUS_36180 4032311 4032709 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 protein_id gnl|my_center|LOCUS_36180 4034426 4032882 gene locus_tag LOCUS_36190 4034426 4032882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 4036212 4034662 gene locus_tag LOCUS_36200 4036212 4034662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 4036629 4037678 gene locus_tag LOCUS_36210 4036629 4037678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 4037675 4039135 gene locus_tag LOCUS_36220 4037675 4039135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 4039132 4039962 gene locus_tag LOCUS_36230 4039132 4039962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 4040207 4041508 gene locus_tag LOCUS_36240 4040207 4041508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 4041543 4041767 gene locus_tag LOCUS_36250 4041543 4041767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 4041953 4042780 gene locus_tag LOCUS_36260 4041953 4042780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 4042840 4043871 gene locus_tag LOCUS_36270 4042840 4043871 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765220.1 protein_id gnl|my_center|LOCUS_36270 4044183 4044554 gene locus_tag LOCUS_36280 gene nuoA 4044183 4044554 CDS product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179273.1 protein_id gnl|my_center|LOCUS_36280 4044539 4045057 gene locus_tag LOCUS_36290 gene nuoB 4044539 4045057 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236331.1 protein_id gnl|my_center|LOCUS_36290 4045054 4046259 gene locus_tag LOCUS_36300 4045054 4046259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 4046266 4047366 gene locus_tag LOCUS_36310 gene nuoD 4046266 4047366 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_36310 4047366 4048376 gene locus_tag LOCUS_36320 gene nuoH 4047366 4048376 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573431.1 protein_id gnl|my_center|LOCUS_36320 4048519 4048974 gene locus_tag LOCUS_36330 gene nuoI 4048519 4048974 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677191.1 protein_id gnl|my_center|LOCUS_36330 4048978 4049496 gene locus_tag LOCUS_36340 4048978 4049496 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012801.1 protein_id gnl|my_center|LOCUS_36340 4049497 4049799 gene locus_tag LOCUS_36350 gene nuoK 4049497 4049799 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100078.1 protein_id gnl|my_center|LOCUS_36350 4049805 4051676 gene locus_tag LOCUS_36360 gene nuoL 4049805 4051676 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568230.1 protein_id gnl|my_center|LOCUS_36360 4051676 4053304 gene locus_tag LOCUS_36370 4051676 4053304 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998901.1 protein_id gnl|my_center|LOCUS_36370 4053310 4054872 gene locus_tag LOCUS_36380 gene nuoN 4053310 4054872 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078186264.1 protein_id gnl|my_center|LOCUS_36380 4055337 4055729 gene locus_tag LOCUS_36390 4055337 4055729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 4055794 4058436 gene locus_tag LOCUS_36400 4055794 4058436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 4058451 4058696 gene locus_tag LOCUS_36410 4058451 4058696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 4058911 4060323 gene locus_tag LOCUS_36420 gene murA 4058911 4060323 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411265.1 protein_id gnl|my_center|LOCUS_36420 4060508 4061701 gene locus_tag LOCUS_36430 4060508 4061701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 4061810 4062565 gene locus_tag LOCUS_36440 4061810 4062565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 4062752 4063039 gene locus_tag LOCUS_36450 gene spoIIID 4062752 4063039 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221804.1 protein_id gnl|my_center|LOCUS_36450 4063144 4064154 gene locus_tag LOCUS_36460 4063144 4064154 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457984.1 protein_id gnl|my_center|LOCUS_36460 4064341 4065207 gene locus_tag LOCUS_36470 gene flhO 4064341 4065207 CDS product flagellar hook-basal body complex protein FlhO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244097.1 protein_id gnl|my_center|LOCUS_36470 4065312 4066133 gene locus_tag LOCUS_36480 gene flgG 4065312 4066133 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880505.1 protein_id gnl|my_center|LOCUS_36480 4066145 4066495 gene locus_tag LOCUS_36490 4066145 4066495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 4068875 4066686 gene locus_tag LOCUS_36500 4068875 4066686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 4069302 4069883 gene locus_tag LOCUS_36510 gene pgsA 4069302 4069883 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966859.1 protein_id gnl|my_center|LOCUS_36510 4070042 4070473 gene locus_tag LOCUS_36520 gene fabZ 4070042 4070473 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 protein_id gnl|my_center|LOCUS_36520 4070728 4072431 gene locus_tag LOCUS_36530 4070728 4072431 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104191.1 protein_id gnl|my_center|LOCUS_36530 4072489 4074600 gene locus_tag LOCUS_36540 4072489 4074600 CDS product DUF5693 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391758.1 protein_id gnl|my_center|LOCUS_36540 4074549 4075748 gene locus_tag LOCUS_36550 gene csaB 4074549 4075748 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181502.1 protein_id gnl|my_center|LOCUS_36550 4075980 4077113 gene locus_tag LOCUS_36560 4075980 4077113 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378318.1 protein_id gnl|my_center|LOCUS_36560 4077287 4081348 gene locus_tag LOCUS_36570 4077287 4081348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 4081934 4084714 gene locus_tag LOCUS_36580 4081934 4084714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 4084891 4088211 gene locus_tag LOCUS_36590 4084891 4088211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 4088349 4088849 gene locus_tag LOCUS_36600 4088349 4088849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 4088942 4089211 gene locus_tag LOCUS_36610 4088942 4089211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 4089532 4090734 gene locus_tag LOCUS_36620 gene metK 4089532 4090734 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_36620 4090920 4095335 gene locus_tag LOCUS_36630 4090920 4095335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 4095503 4098205 gene locus_tag LOCUS_36640 4095503 4098205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 4098278 4099438 gene locus_tag LOCUS_36650 gene degS 4098278 4099438 CDS product two-component sensor histidine kinase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227983.1 protein_id gnl|my_center|LOCUS_36650 4099445 4100173 gene locus_tag LOCUS_36660 gene degU 4099445 4100173 CDS product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 protein_id gnl|my_center|LOCUS_36660 4100403 4101134 gene locus_tag LOCUS_36670 4100403 4101134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 4102767 4102162 gene locus_tag LOCUS_36680 4102767 4102162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 4102898 4102734 gene locus_tag LOCUS_36690 4102898 4102734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 4103583 4103041 gene locus_tag LOCUS_36700 4103583 4103041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 4103707 4103943 gene locus_tag LOCUS_36710 4103707 4103943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 4103951 4104787 gene locus_tag LOCUS_36720 4103951 4104787 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194119.1 protein_id gnl|my_center|LOCUS_36720 4105087 4105509 gene locus_tag LOCUS_36730 4105087 4105509 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227995.1 protein_id gnl|my_center|LOCUS_36730 4105666 4105944 gene locus_tag LOCUS_36740 gene flgM 4105666 4105944 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227997.1 protein_id gnl|my_center|LOCUS_36740 4105955 4106455 gene locus_tag LOCUS_36750 4105955 4106455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 4106470 4108005 gene locus_tag LOCUS_36760 gene flgK 4106470 4108005 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_36760 4108024 4108938 gene locus_tag LOCUS_36770 gene flgL 4108024 4108938 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_36770 4108953 4109522 gene locus_tag LOCUS_36780 4108953 4109522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 4109614 4110051 gene locus_tag LOCUS_36790 gene fliW 4109614 4110051 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228007.1 protein_id gnl|my_center|LOCUS_36790 4110069 4110311 gene locus_tag LOCUS_36800 4110069 4110311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 4110434 4111204 gene locus_tag LOCUS_36810 gene hag 4110434 4111204 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_36810 4111360 4111932 gene locus_tag LOCUS_36820 4111360 4111932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36820 4111947 4112720 gene locus_tag LOCUS_36830 4111947 4112720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36830 4113187 4113957 gene locus_tag LOCUS_36840 gene hag 4113187 4113957 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_36840 4114084 4114476 gene locus_tag LOCUS_36850 4114084 4114476 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965506.1 protein_id gnl|my_center|LOCUS_36850 4114489 4116060 gene locus_tag LOCUS_36860 4114489 4116060 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242960.1 protein_id gnl|my_center|LOCUS_36860 4116073 4116474 gene locus_tag LOCUS_36870 gene fliS 4116073 4116474 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 protein_id gnl|my_center|LOCUS_36870 4116467 4116796 gene locus_tag LOCUS_36880 4116467 4116796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 4116875 4119130 gene locus_tag LOCUS_36890 4116875 4119130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 4119108 4121333 gene locus_tag LOCUS_36900 4119108 4121333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 4121333 4122340 gene locus_tag LOCUS_36910 4121333 4122340 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600889.1 protein_id gnl|my_center|LOCUS_36910 4122372 4123556 gene locus_tag LOCUS_36920 4122372 4123556 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947844.1 protein_id gnl|my_center|LOCUS_36920 4123679 4124662 gene locus_tag LOCUS_36930 4123679 4124662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 4124659 4125327 gene locus_tag LOCUS_36940 4124659 4125327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 4125345 4126406 gene locus_tag LOCUS_36950 4125345 4126406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 4126428 4127426 gene locus_tag LOCUS_36960 gene neuB 4126428 4127426 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936321.1 protein_id gnl|my_center|LOCUS_36960 4127423 4128601 gene locus_tag LOCUS_36970 gene neuC 4127423 4128601 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823150.1 protein_id gnl|my_center|LOCUS_36970 4128588 4129640 gene locus_tag LOCUS_36980 4128588 4129640 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_36980 4129637 4130326 gene locus_tag LOCUS_36990 4129637 4130326 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403384.1 protein_id gnl|my_center|LOCUS_36990 4131064 4130606 gene locus_tag LOCUS_37000 4131064 4130606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 4132038 4132235 gene locus_tag LOCUS_37010 gene cspC 4132038 4132235 CDS product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001990088.1 protein_id gnl|my_center|LOCUS_37010 4132489 4133034 gene locus_tag LOCUS_37020 gene raiA 4132489 4133034 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671185.1 protein_id gnl|my_center|LOCUS_37020 4133207 4135714 gene locus_tag LOCUS_37030 gene secA 4133207 4135714 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228033.1 protein_id gnl|my_center|LOCUS_37030 4135872 4136885 gene locus_tag LOCUS_37040 gene prfB 4135872 4136885 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_37040 4137148 4138179 gene locus_tag LOCUS_37050 4137148 4138179 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722640.1 protein_id gnl|my_center|LOCUS_37050 4138300 4139364 gene locus_tag LOCUS_37060 gene argC 4138300 4139364 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245768.1 protein_id gnl|my_center|LOCUS_37060 4139447 4140688 gene locus_tag LOCUS_37070 gene argJ 4139447 4140688 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163580248.1 protein_id gnl|my_center|LOCUS_37070 4140705 4141526 gene locus_tag LOCUS_37080 gene argB 4140705 4141526 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 protein_id gnl|my_center|LOCUS_37080 4141560 4142774 gene locus_tag LOCUS_37090 4141560 4142774 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232985.1 protein_id gnl|my_center|LOCUS_37090 4142791 4143750 gene locus_tag LOCUS_37100 gene argF 4142791 4143750 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_37100 4144107 4145342 gene locus_tag LOCUS_37110 4144107 4145342 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_37110 4145427 4146842 gene locus_tag LOCUS_37120 gene argH 4145427 4146842 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041296.1 protein_id gnl|my_center|LOCUS_37120 4148561 4147077 gene locus_tag LOCUS_37130 4148561 4147077 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460967.1 protein_id gnl|my_center|LOCUS_37130 4148886 4149572 gene locus_tag LOCUS_37140 gene ftsE 4148886 4149572 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 protein_id gnl|my_center|LOCUS_37140 4149562 4150479 gene locus_tag LOCUS_37150 gene ftsX 4149562 4150479 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645021.1 protein_id gnl|my_center|LOCUS_37150 4150480 4151667 gene locus_tag LOCUS_37160 4150480 4151667 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_37160 4151812 4153281 gene locus_tag LOCUS_37170 gene ctpB 4151812 4153281 CDS product carboxy-terminal processing protease CtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228041.1 protein_id gnl|my_center|LOCUS_37170 4153391 4154689 gene locus_tag LOCUS_37180 gene minJ 4153391 4154689 CDS product cell division topological determinant MinJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242631.1 protein_id gnl|my_center|LOCUS_37180 4154744 4154920 gene locus_tag LOCUS_37190 4154744 4154920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 4155013 4157016 gene locus_tag LOCUS_37200 gene uvrB 4155013 4157016 CDS product excinuclease ABC subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441046.1 protein_id gnl|my_center|LOCUS_37200 4157040 4159925 gene locus_tag LOCUS_37210 gene uvrA 4157040 4159925 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 protein_id gnl|my_center|LOCUS_37210 4161710 4160100 gene locus_tag LOCUS_37220 4161710 4160100 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119621.1 protein_id gnl|my_center|LOCUS_37220 4162015 4162230 gene locus_tag LOCUS_37230 4162015 4162230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 4163363 4162395 gene locus_tag LOCUS_37240 4163363 4162395 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989909.1 protein_id gnl|my_center|LOCUS_37240 4163773 4166322 gene locus_tag LOCUS_37250 4163773 4166322 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 protein_id gnl|my_center|LOCUS_37250 4166537 4168384 gene locus_tag LOCUS_37260 4166537 4168384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 4168375 4170537 gene locus_tag LOCUS_37270 4168375 4170537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 4170553 4170921 gene locus_tag LOCUS_37280 4170553 4170921 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258220.1 protein_id gnl|my_center|LOCUS_37280 4170955 4171665 gene locus_tag LOCUS_37290 4170955 4171665 CDS product heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272088.1 protein_id gnl|my_center|LOCUS_37290 4171963 4174203 gene locus_tag LOCUS_37300 gene pcrA 4171963 4174203 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163769.1 protein_id gnl|my_center|LOCUS_37300 4174262 4176307 gene locus_tag LOCUS_37310 gene ligA 4174262 4176307 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965961.1 protein_id gnl|my_center|LOCUS_37310 4176671 4178216 gene locus_tag LOCUS_r00220 4176671 4178216 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4178306 4178381 gene locus_tag LOCUS_t00650 4178306 4178381 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4178548 4181469 gene locus_tag LOCUS_r00230 4178548 4181469 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4181584 4181696 gene locus_tag LOCUS_r00240 4181584 4181696 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4182124 4182585 gene locus_tag LOCUS_37320 gene ctsR 4182124 4182585 CDS product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244563.1 protein_id gnl|my_center|LOCUS_37320 4182621 4183160 gene locus_tag LOCUS_37330 gene mcsA 4182621 4183160 CDS product protein-arginine kinase activator protein McsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966297.1 protein_id gnl|my_center|LOCUS_37330 4183175 4184254 gene locus_tag LOCUS_37340 4183175 4184254 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 protein_id gnl|my_center|LOCUS_37340 4184257 4186716 gene locus_tag LOCUS_37350 gene clpC 4184257 4186716 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_37350 4186921 4188288 gene locus_tag LOCUS_37360 gene radA 4186921 4188288 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_37360 4188302 4189378 gene locus_tag LOCUS_37370 gene disA 4188302 4189378 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392163.1 protein_id gnl|my_center|LOCUS_37370 4189537 4190289 gene locus_tag LOCUS_37380 gene pssA 4189537 4190289 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285417.1 protein_id gnl|my_center|LOCUS_37380 4190770 4190375 gene locus_tag LOCUS_37390 4190770 4190375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966463.1 protein_id gnl|my_center|LOCUS_37390 4190959 4192059 gene locus_tag LOCUS_37400 4190959 4192059 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235014.1 protein_id gnl|my_center|LOCUS_37400 4192143 4192865 gene locus_tag LOCUS_37410 gene ispD 4192143 4192865 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_37410 4192862 4193347 gene locus_tag LOCUS_37420 gene ispF 4192862 4193347 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225745.1 protein_id gnl|my_center|LOCUS_37420 4193387 4194856 gene locus_tag LOCUS_37430 gene gltX 4193387 4194856 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399675.1 protein_id gnl|my_center|LOCUS_37430 4195350 4196036 gene locus_tag LOCUS_37440 gene cysE 4195350 4196036 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476494.1 protein_id gnl|my_center|LOCUS_37440 4196033 4197433 gene locus_tag LOCUS_37450 gene cysS 4196033 4197433 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152268.1 protein_id gnl|my_center|LOCUS_37450 4197418 4197900 gene locus_tag LOCUS_37460 4197418 4197900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 4197893 4198666 gene locus_tag LOCUS_37470 gene rlmB 4197893 4198666 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399684.1 protein_id gnl|my_center|LOCUS_37470 4198711 4199190 gene locus_tag LOCUS_37480 4198711 4199190 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724086.1 protein_id gnl|my_center|LOCUS_37480 4199450 4200127 gene locus_tag LOCUS_37490 gene sigH 4199450 4200127 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942746.1 protein_id gnl|my_center|LOCUS_37490 4200619 4200828 gene locus_tag LOCUS_37500 gene secE 4200619 4200828 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728078.1 protein_id gnl|my_center|LOCUS_37500 4200852 4201394 gene locus_tag LOCUS_37510 gene nusG 4200852 4201394 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225764.1 protein_id gnl|my_center|LOCUS_37510 4201449 4201874 gene locus_tag LOCUS_37520 gene rplK 4201449 4201874 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085872.1 protein_id gnl|my_center|LOCUS_37520 4202010 4202702 gene locus_tag LOCUS_37530 gene rplA 4202010 4202702 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002020168.1 protein_id gnl|my_center|LOCUS_37530 4202943 4203440 gene locus_tag LOCUS_37540 gene rplJ 4202943 4203440 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235042.1 protein_id gnl|my_center|LOCUS_37540 4203507 4203869 gene locus_tag LOCUS_37550 gene rplL 4203507 4203869 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459089.1 protein_id gnl|my_center|LOCUS_37550 4203962 4204564 gene locus_tag LOCUS_37560 4203962 4204564 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763267.1 protein_id gnl|my_center|LOCUS_37560 4204929 4208474 gene locus_tag LOCUS_37570 gene rpoB 4204929 4208474 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147554.1 protein_id gnl|my_center|LOCUS_37570 4208619 4212242 gene locus_tag LOCUS_37580 gene rpoC 4208619 4212242 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567936.1 protein_id gnl|my_center|LOCUS_37580 4212473 4212703 gene locus_tag LOCUS_37590 4212473 4212703 CDS product 50S ribosomal protein L7ae-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225778.1 protein_id gnl|my_center|LOCUS_37590 4212837 4213256 gene locus_tag LOCUS_37600 gene rpsL 4212837 4213256 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225781.1 protein_id gnl|my_center|LOCUS_37600 4213325 4213795 gene locus_tag LOCUS_37610 gene rpsG 4213325 4213795 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137491.1 protein_id gnl|my_center|LOCUS_37610 4213825 4215903 gene locus_tag LOCUS_37620 gene fusA 4213825 4215903 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090370.1 protein_id gnl|my_center|LOCUS_37620 4216018 4217208 gene locus_tag LOCUS_37630 gene tuf 4216018 4217208 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723640.1 protein_id gnl|my_center|LOCUS_37630 4217672 4217980 gene locus_tag LOCUS_37640 gene rpsJ 4217672 4217980 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_37640 4218021 4218641 gene locus_tag LOCUS_37650 gene rplC 4218021 4218641 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 protein_id gnl|my_center|LOCUS_37650 4218668 4219291 gene locus_tag LOCUS_37660 gene rplD 4218668 4219291 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_37660 4219291 4219581 gene locus_tag LOCUS_37670 gene rplW 4219291 4219581 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156467.1 protein_id gnl|my_center|LOCUS_37670 4219644 4220474 gene locus_tag LOCUS_37680 gene rplB 4219644 4220474 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511583.1 protein_id gnl|my_center|LOCUS_37680 4220543 4220824 gene locus_tag LOCUS_37690 gene rpsS 4220543 4220824 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156472.1 protein_id gnl|my_center|LOCUS_37690 4220868 4221203 gene locus_tag LOCUS_37700 gene rplV 4220868 4221203 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148024.1 protein_id gnl|my_center|LOCUS_37700 4221217 4221879 gene locus_tag LOCUS_37710 gene rpsC 4221217 4221879 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235068.1 protein_id gnl|my_center|LOCUS_37710 4221882 4222316 gene locus_tag LOCUS_37720 gene rplP 4221882 4222316 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 protein_id gnl|my_center|LOCUS_37720 4222306 4222506 gene locus_tag LOCUS_37730 gene rpmC 4222306 4222506 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855718.1 protein_id gnl|my_center|LOCUS_37730 4222555 4222818 gene locus_tag LOCUS_37740 gene rpsQ 4222555 4222818 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225804.1 protein_id gnl|my_center|LOCUS_37740 4222861 4223229 gene locus_tag LOCUS_37750 gene rplN 4222861 4223229 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459101.1 protein_id gnl|my_center|LOCUS_37750 4223275 4223628 gene locus_tag LOCUS_37760 gene rplX 4223275 4223628 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 protein_id gnl|my_center|LOCUS_37760 4223660 4224202 gene locus_tag LOCUS_37770 gene rplE 4223660 4224202 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288671.1 protein_id gnl|my_center|LOCUS_37770 4224225 4224410 gene locus_tag LOCUS_37780 gene rpsN 4224225 4224410 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156488.1 protein_id gnl|my_center|LOCUS_37780 4224441 4224839 gene locus_tag LOCUS_37790 gene rpsH 4224441 4224839 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245511.1 protein_id gnl|my_center|LOCUS_37790 4224870 4225412 gene locus_tag LOCUS_37800 gene rplF 4224870 4225412 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399690.1 protein_id gnl|my_center|LOCUS_37800 4225476 4225844 gene locus_tag LOCUS_37810 gene rplR 4225476 4225844 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 protein_id gnl|my_center|LOCUS_37810 4225876 4226373 gene locus_tag LOCUS_37820 gene rpsE 4225876 4226373 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_37820 4226387 4226572 gene locus_tag LOCUS_37830 gene rpmD 4226387 4226572 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156497.1 protein_id gnl|my_center|LOCUS_37830 4226677 4227117 gene locus_tag LOCUS_37840 gene rplO 4226677 4227117 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_37840 4227118 4228419 gene locus_tag LOCUS_37850 gene secY 4227118 4228419 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490114.1 protein_id gnl|my_center|LOCUS_37850 4228507 4229160 gene locus_tag LOCUS_37860 4228507 4229160 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399686.1 protein_id gnl|my_center|LOCUS_37860 4229157 4229918 gene locus_tag LOCUS_37870 gene map 4229157 4229918 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_37870 4229925 4230206 gene locus_tag LOCUS_37880 4229925 4230206 CDS product ribosome-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969230.1 protein_id gnl|my_center|LOCUS_37880 4230209 4230424 gene locus_tag LOCUS_37890 gene infA 4230209 4230424 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_37890 4230600 4230968 gene locus_tag LOCUS_37900 gene rpsM 4230600 4230968 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090788.1 protein_id gnl|my_center|LOCUS_37900 4230988 4231383 gene locus_tag LOCUS_37910 gene rpsK 4230988 4231383 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810114.1 protein_id gnl|my_center|LOCUS_37910 4231511 4232455 gene locus_tag LOCUS_37920 gene rpoA 4231511 4232455 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569643.1 protein_id gnl|my_center|LOCUS_37920 4232506 4232874 gene locus_tag LOCUS_37930 gene rplQ 4232506 4232874 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331490.1 protein_id gnl|my_center|LOCUS_37930 4232947 4233687 gene locus_tag LOCUS_37940 gene truA 4232947 4233687 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_37940 4233909 4234346 gene locus_tag LOCUS_37950 gene rplM 4233909 4234346 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260793.1 protein_id gnl|my_center|LOCUS_37950 4234366 4234758 gene locus_tag LOCUS_37960 gene rpsI 4234366 4234758 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_37960 4234906 4235598 gene locus_tag LOCUS_37970 4234906 4235598 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830661.1 protein_id gnl|my_center|LOCUS_37970 4235682 4236845 gene locus_tag LOCUS_37980 gene sat 4235682 4236845 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245745.1 protein_id gnl|my_center|LOCUS_37980 4237000 4237767 gene locus_tag LOCUS_37990 gene cwlD 4237000 4237767 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399672.1 protein_id gnl|my_center|LOCUS_37990 4237881 4238996 gene locus_tag LOCUS_38000 4237881 4238996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 4239771 4239163 gene locus_tag LOCUS_38010 gene gerD 4239771 4239163 CDS product spore germination protein GerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827519.1 protein_id gnl|my_center|LOCUS_38010 4239770 4239955 gene locus_tag LOCUS_38020 4239770 4239955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 4240103 4240735 gene locus_tag LOCUS_38030 gene kbaA 4240103 4240735 CDS product KinB signaling pathway activation protein KbaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088527.1 protein_id gnl|my_center|LOCUS_38030 4241571 4240768 gene locus_tag LOCUS_38040 gene pdaB 4241571 4240768 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235130.1 protein_id gnl|my_center|LOCUS_38040 4241681 4242295 gene locus_tag LOCUS_38050 4241681 4242295 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188542542.1 protein_id gnl|my_center|LOCUS_38050 4242497 4242718 gene locus_tag LOCUS_38060 4242497 4242718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 4242961 4244505 gene locus_tag LOCUS_r00250 4242961 4244505 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4244672 4244784 gene locus_tag LOCUS_r00260 4244672 4244784 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4244956 4247877 gene locus_tag LOCUS_r00270 4244956 4247877 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4247969 4248044 gene locus_tag LOCUS_t00660 4247969 4248044 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4248050 4248125 gene locus_tag LOCUS_t00670 4248050 4248125 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4248139 4248213 gene locus_tag LOCUS_t00680 4248139 4248213 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4248228 4248303 gene locus_tag LOCUS_t00690 4248228 4248303 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4248314 4248389 gene locus_tag LOCUS_t00700 4248314 4248389 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4248398 4248473 gene locus_tag LOCUS_t00710 4248398 4248473 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4248506 4248587 gene locus_tag LOCUS_t00720 4248506 4248587 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4248875 4249720 gene locus_tag LOCUS_38070 4248875 4249720 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732025.1 protein_id gnl|my_center|LOCUS_38070 4249876 4249950 gene locus_tag LOCUS_t00730 4249876 4249950 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4249957 4250033 gene locus_tag LOCUS_t00740 4249957 4250033 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4250061 4250137 gene locus_tag LOCUS_t00750 4250061 4250137 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4250146 4250219 gene locus_tag LOCUS_t00760 4250146 4250219 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4250543 4253353 gene locus_tag LOCUS_38080 gene ppc 4250543 4253353 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_38080 4253631 4254212 gene locus_tag LOCUS_38090 gene sigW 4253631 4254212 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_38090 4254342 4254971 gene locus_tag LOCUS_38100 gene rsiW 4254342 4254971 CDS product anti-sigma-W factor RsiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234951.1 protein_id gnl|my_center|LOCUS_38100 4255108 4255947 gene locus_tag LOCUS_38110 gene cdaA 4255108 4255947 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115700.1 protein_id gnl|my_center|LOCUS_38110 4255940 4257562 gene locus_tag LOCUS_38120 4255940 4257562 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359572.1 protein_id gnl|my_center|LOCUS_38120 4257583 4258929 gene locus_tag LOCUS_38130 gene glmM 4257583 4258929 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 protein_id gnl|my_center|LOCUS_38130 4259772 4261604 gene locus_tag LOCUS_38140 gene glmS 4259772 4261604 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808420.1 protein_id gnl|my_center|LOCUS_38140 4262724 4261819 gene locus_tag LOCUS_38150 4262724 4261819 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211478109.1 protein_id gnl|my_center|LOCUS_38150 4263530 4262721 gene locus_tag LOCUS_38160 4263530 4262721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 4264255 4263914 gene locus_tag LOCUS_38170 4264255 4263914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 4265085 4264294 gene locus_tag LOCUS_38180 4265085 4264294 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207439.1 protein_id gnl|my_center|LOCUS_38180 4265426 4265217 gene locus_tag LOCUS_38190 4265426 4265217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 4266652 4267527 gene locus_tag LOCUS_38200 4266652 4267527 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242958.1 protein_id gnl|my_center|LOCUS_38200 4267749 4268336 gene locus_tag LOCUS_38210 4267749 4268336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 4268436 4269200 gene locus_tag LOCUS_38220 4268436 4269200 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911797.1 protein_id gnl|my_center|LOCUS_38220 4270890 4269352 gene locus_tag LOCUS_38230 4270890 4269352 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202403.1 protein_id gnl|my_center|LOCUS_38230 4271119 4272138 gene locus_tag LOCUS_38240 4271119 4272138 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_38240 4272417 4273997 gene locus_tag LOCUS_38250 4272417 4273997 CDS product DUF3502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161603547.1 protein_id gnl|my_center|LOCUS_38250 4273994 4275715 gene locus_tag LOCUS_38260 4273994 4275715 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_38260 4275734 4277353 gene locus_tag LOCUS_38270 4275734 4277353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 4278622 4279971 gene locus_tag LOCUS_38280 4278622 4279971 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_38280 4280052 4280921 gene locus_tag LOCUS_38290 4280052 4280921 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939305.1 protein_id gnl|my_center|LOCUS_38290 4280933 4281772 gene locus_tag LOCUS_38300 4280933 4281772 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921761.1 protein_id gnl|my_center|LOCUS_38300 4281972 4282808 gene locus_tag LOCUS_38310 4281972 4282808 CDS product bromoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074324.1 protein_id gnl|my_center|LOCUS_38310 4284166 4282940 gene locus_tag LOCUS_38320 4284166 4282940 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190318.1 protein_id gnl|my_center|LOCUS_38320 4284298 4285179 gene locus_tag LOCUS_38330 4284298 4285179 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421907.1 protein_id gnl|my_center|LOCUS_38330 4285329 4285658 gene locus_tag LOCUS_38340 4285329 4285658 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813646.1 protein_id gnl|my_center|LOCUS_38340 4285674 4286543 gene locus_tag LOCUS_38350 4285674 4286543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 4286578 4287339 gene locus_tag LOCUS_38360 4286578 4287339 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017474.1 protein_id gnl|my_center|LOCUS_38360 4287341 4288111 gene locus_tag LOCUS_38370 gene lieB 4287341 4288111 CDS product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 protein_id gnl|my_center|LOCUS_38370 4288833 4290158 gene locus_tag LOCUS_38380 gene ltrA 4288833 4290158 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_38380 4290217 4290381 gene locus_tag LOCUS_38390 4290217 4290381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 4290378 4291115 gene locus_tag LOCUS_38400 4290378 4291115 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821952.1 protein_id gnl|my_center|LOCUS_38400 4291273 4292298 gene locus_tag LOCUS_38410 4291273 4292298 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_38410 4292534 4292295 gene locus_tag LOCUS_38420 4292534 4292295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 4292836 4293921 gene locus_tag LOCUS_38430 gene iolG 4292836 4293921 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_38430 4293918 4294931 gene locus_tag LOCUS_38440 gene iolG 4293918 4294931 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398990.1 protein_id gnl|my_center|LOCUS_38440 4294946 4295953 gene locus_tag LOCUS_38450 gene iolG 4294946 4295953 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398990.1 protein_id gnl|my_center|LOCUS_38450 4295989 4297065 gene locus_tag LOCUS_38460 4295989 4297065 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330812.1 protein_id gnl|my_center|LOCUS_38460 4297381 4297803 gene locus_tag LOCUS_38470 4297381 4297803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 4297800 4299728 gene locus_tag LOCUS_38480 4297800 4299728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 4300220 4303414 gene locus_tag LOCUS_38490 4300220 4303414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 4303440 4305383 gene locus_tag LOCUS_38500 4303440 4305383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 4305516 4306382 gene locus_tag LOCUS_38510 4305516 4306382 CDS product DUF1479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030607.1 protein_id gnl|my_center|LOCUS_38510 4306678 4307616 gene locus_tag LOCUS_38520 4306678 4307616 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_38520 4307659 4308537 gene locus_tag LOCUS_38530 4307659 4308537 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 protein_id gnl|my_center|LOCUS_38530 4308594 4310255 gene locus_tag LOCUS_38540 4308594 4310255 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002995654.1 protein_id gnl|my_center|LOCUS_38540 4310450 4312375 gene locus_tag LOCUS_38550 4310450 4312375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 4313088 4312471 gene locus_tag LOCUS_38560 4313088 4312471 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641140.1 protein_id gnl|my_center|LOCUS_38560 4313211 4313783 gene locus_tag LOCUS_38570 4313211 4313783 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088195.1 protein_id gnl|my_center|LOCUS_38570 4313783 4314997 gene locus_tag LOCUS_38580 4313783 4314997 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890714.1 protein_id gnl|my_center|LOCUS_38580 4315663 4315277 gene locus_tag LOCUS_38590 4315663 4315277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 4315873 4316889 gene locus_tag LOCUS_38600 4315873 4316889 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_38600 4317059 4317928 gene locus_tag LOCUS_38610 4317059 4317928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 4318233 4318051 gene locus_tag LOCUS_38620 gene tatAD 4318233 4318051 CDS product sec-independent protein translocase protein TatAD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223835.1 protein_id gnl|my_center|LOCUS_38620 4318887 4318330 gene locus_tag LOCUS_38630 4318887 4318330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 4320665 4319058 gene locus_tag LOCUS_38640 4320665 4319058 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918975.1 protein_id gnl|my_center|LOCUS_38640 4321026 4321247 gene locus_tag LOCUS_38650 4321026 4321247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 4321253 4322005 gene locus_tag LOCUS_38660 gene tatC 4321253 4322005 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886426.1 protein_id gnl|my_center|LOCUS_38660 4322140 4322328 gene locus_tag LOCUS_38670 4322140 4322328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 4324458 4322863 gene locus_tag LOCUS_38680 4324458 4322863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 4326202 4324463 gene locus_tag LOCUS_38690 4326202 4324463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 4326519 4327445 gene locus_tag LOCUS_38700 4326519 4327445 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_38700 4327466 4328377 gene locus_tag LOCUS_38710 4327466 4328377 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_38710 4328451 4330169 gene locus_tag LOCUS_38720 4328451 4330169 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_38720 4330260 4330991 gene locus_tag LOCUS_38730 4330260 4330991 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_38730 4331057 4332106 gene locus_tag LOCUS_38740 4331057 4332106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 4332383 4332697 gene locus_tag LOCUS_38750 4332383 4332697 CDS product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173644.1 protein_id gnl|my_center|LOCUS_38750 4333336 4332749 gene locus_tag LOCUS_38760 4333336 4332749 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258315.1 protein_id gnl|my_center|LOCUS_38760 4333508 4336612 gene locus_tag LOCUS_38770 4333508 4336612 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_38770 4336697 4339213 gene locus_tag LOCUS_38780 4336697 4339213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 4340196 4339294 gene locus_tag LOCUS_38790 4340196 4339294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 4340362 4341204 gene locus_tag LOCUS_38800 4340362 4341204 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_38800 4341209 4342228 gene locus_tag LOCUS_38810 4341209 4342228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 4342228 4342848 gene locus_tag LOCUS_38820 4342228 4342848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 4342990 4344654 gene locus_tag LOCUS_38830 4342990 4344654 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777117.1 protein_id gnl|my_center|LOCUS_38830 4344912 4345853 gene locus_tag LOCUS_38840 4344912 4345853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 4346021 4346287 gene locus_tag LOCUS_38850 4346021 4346287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 4346378 4346653 gene locus_tag LOCUS_38860 4346378 4346653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 4346755 4347354 gene locus_tag LOCUS_38870 4346755 4347354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181722.1 protein_id gnl|my_center|LOCUS_38870 4347449 4349341 gene locus_tag LOCUS_38880 4347449 4349341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 4349558 4350556 gene locus_tag LOCUS_38890 gene gap 4349558 4350556 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_38890 4350756 4351799 gene locus_tag LOCUS_38900 4350756 4351799 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031699.1 protein_id gnl|my_center|LOCUS_38900 4352371 4353192 gene locus_tag LOCUS_38910 4352371 4353192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 4353565 4354944 gene locus_tag LOCUS_38920 4353565 4354944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 4354937 4355140 gene locus_tag LOCUS_38930 4354937 4355140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 4355058 4356302 gene locus_tag LOCUS_38940 4355058 4356302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 4356424 4356975 gene locus_tag LOCUS_38950 4356424 4356975 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964857.1 protein_id gnl|my_center|LOCUS_38950 4357308 4358045 gene locus_tag LOCUS_38960 4357308 4358045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 4358042 4358854 gene locus_tag LOCUS_38970 4358042 4358854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 4359763 4358897 gene locus_tag LOCUS_38980 4359763 4358897 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264237.1 protein_id gnl|my_center|LOCUS_38980 4359903 4362635 gene locus_tag LOCUS_38990 4359903 4362635 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_38990 4362864 4365449 gene locus_tag LOCUS_39000 4362864 4365449 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228248.1 protein_id gnl|my_center|LOCUS_39000 4368711 4365751 gene locus_tag LOCUS_39010 4368711 4365751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 4369890 4369105 gene locus_tag LOCUS_39020 4369890 4369105 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 protein_id gnl|my_center|LOCUS_39020 4370059 4369844 gene locus_tag LOCUS_39030 4370059 4369844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 4370478 4371497 gene locus_tag LOCUS_39040 4370478 4371497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 4371797 4372387 gene locus_tag LOCUS_39050 4371797 4372387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 4372494 4373681 gene locus_tag LOCUS_39060 4372494 4373681 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100954.1 protein_id gnl|my_center|LOCUS_39060 4373915 4375267 gene locus_tag LOCUS_39070 4373915 4375267 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283476.1 protein_id gnl|my_center|LOCUS_39070 4375386 4376621 gene locus_tag LOCUS_39080 4375386 4376621 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226185.1 protein_id gnl|my_center|LOCUS_39080 4376739 4377293 gene locus_tag LOCUS_39090 4376739 4377293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 4378300 4377419 gene locus_tag LOCUS_39100 gene sdaAA 4378300 4377419 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_39100 4378993 4378316 gene locus_tag LOCUS_39110 gene sdaAB 4378993 4378316 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877446.1 protein_id gnl|my_center|LOCUS_39110 4379223 4380890 gene locus_tag LOCUS_39120 4379223 4380890 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094095353.1 protein_id gnl|my_center|LOCUS_39120 4380887 4382662 gene locus_tag LOCUS_39130 gene yesM 4380887 4382662 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_39130 4382759 4384231 gene locus_tag LOCUS_39140 4382759 4384231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 4384379 4385335 gene locus_tag LOCUS_39150 4384379 4385335 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_39150 4385332 4386162 gene locus_tag LOCUS_39160 4385332 4386162 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803781.1 protein_id gnl|my_center|LOCUS_39160 4386199 4388055 gene locus_tag LOCUS_39170 4386199 4388055 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530523.1 protein_id gnl|my_center|LOCUS_39170 4388437 4388922 gene locus_tag LOCUS_39180 4388437 4388922 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246188.1 protein_id gnl|my_center|LOCUS_39180 4389068 4390003 gene locus_tag LOCUS_39190 4389068 4390003 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_39190 4390095 4390526 gene locus_tag LOCUS_39200 4390095 4390526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 4390642 4391118 gene locus_tag LOCUS_39210 4390642 4391118 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948661.1 protein_id gnl|my_center|LOCUS_39210 4391604 4391167 gene locus_tag LOCUS_39220 4391604 4391167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 4392656 4391760 gene locus_tag LOCUS_39230 4392656 4391760 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966961.1 protein_id gnl|my_center|LOCUS_39230 4392954 4393907 gene locus_tag LOCUS_39240 4392954 4393907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 4395010 4394141 gene locus_tag LOCUS_39250 4395010 4394141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 4396054 4395128 gene locus_tag LOCUS_39260 4396054 4395128 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964760.1 protein_id gnl|my_center|LOCUS_39260 4396133 4396276 gene locus_tag LOCUS_39270 4396133 4396276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 4396239 4396976 gene locus_tag LOCUS_39280 4396239 4396976 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_39280 4396980 4398014 gene locus_tag LOCUS_39290 4396980 4398014 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_39290 4398194 4399525 gene locus_tag LOCUS_39300 4398194 4399525 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258986.1 protein_id gnl|my_center|LOCUS_39300 4400381 4400238 gene locus_tag LOCUS_39310 4400381 4400238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 4400516 4401133 gene locus_tag LOCUS_39320 4400516 4401133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 4401273 4401830 gene locus_tag LOCUS_39330 4401273 4401830 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639884.1 protein_id gnl|my_center|LOCUS_39330 4401811 4402374 gene locus_tag LOCUS_39340 4401811 4402374 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082498.1 protein_id gnl|my_center|LOCUS_39340 4402667 4403539 gene locus_tag LOCUS_39350 4402667 4403539 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_39350 4404749 4403724 gene locus_tag LOCUS_39360 4404749 4403724 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721423.1 protein_id gnl|my_center|LOCUS_39360 4405081 4406409 gene locus_tag LOCUS_39370 4405081 4406409 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732367.1 protein_id gnl|my_center|LOCUS_39370 4406425 4407300 gene locus_tag LOCUS_39380 4406425 4407300 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724790.1 protein_id gnl|my_center|LOCUS_39380 4407287 4408126 gene locus_tag LOCUS_39390 4407287 4408126 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721426.1 protein_id gnl|my_center|LOCUS_39390 4408152 4409099 gene locus_tag LOCUS_39400 4408152 4409099 CDS product DUF1861 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213840.1 protein_id gnl|my_center|LOCUS_39400 4409225 4410286 gene locus_tag LOCUS_39410 4409225 4410286 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989598.1 protein_id gnl|my_center|LOCUS_39410 4410642 4410289 gene locus_tag LOCUS_39420 4410642 4410289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 4410641 4411534 gene locus_tag LOCUS_39430 gene rmgP 4410641 4411534 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_39430 4411538 4412434 gene locus_tag LOCUS_39440 4411538 4412434 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830948.1 protein_id gnl|my_center|LOCUS_39440 4412530 4414239 gene locus_tag LOCUS_39450 4412530 4414239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 4414436 4416331 gene locus_tag LOCUS_39460 4414436 4416331 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_39460 4416333 4417925 gene locus_tag LOCUS_39470 4416333 4417925 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_39470 4419087 4418110 gene locus_tag LOCUS_39480 4419087 4418110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 4420197 4419298 gene locus_tag LOCUS_39490 4420197 4419298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 4421499 4420381 gene locus_tag LOCUS_39500 4421499 4420381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 4421973 4423286 gene locus_tag LOCUS_39510 4421973 4423286 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_39510 4423307 4424332 gene locus_tag LOCUS_39520 4423307 4424332 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_39520 4424447 4425940 gene locus_tag LOCUS_39530 4424447 4425940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 4426006 4426446 gene locus_tag LOCUS_39540 4426006 4426446 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053116.1 protein_id gnl|my_center|LOCUS_39540 4426788 4426570 gene locus_tag LOCUS_39550 4426788 4426570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 4427082 4427855 gene locus_tag LOCUS_39560 4427082 4427855 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003873.1 protein_id gnl|my_center|LOCUS_39560 4428064 4428213 gene locus_tag LOCUS_39570 4428064 4428213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 4428751 4428158 gene locus_tag LOCUS_39580 4428751 4428158 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037388.1 protein_id gnl|my_center|LOCUS_39580 4430021 4428846 gene locus_tag LOCUS_39590 4430021 4428846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 4430250 4430606 gene locus_tag LOCUS_39600 4430250 4430606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 4430540 4431262 gene locus_tag LOCUS_39610 4430540 4431262 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230359.1 protein_id gnl|my_center|LOCUS_39610 4431767 4431399 gene locus_tag LOCUS_39620 4431767 4431399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 4431894 4432247 gene locus_tag LOCUS_39630 4431894 4432247 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228912.1 protein_id gnl|my_center|LOCUS_39630 4432291 4433058 gene locus_tag LOCUS_39640 4432291 4433058 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982899.1 protein_id gnl|my_center|LOCUS_39640 4433372 4434145 gene locus_tag LOCUS_39650 4433372 4434145 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_39650 4434138 4434353 gene locus_tag LOCUS_39660 4434138 4434353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 4434428 4435279 gene locus_tag LOCUS_39670 4434428 4435279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 4435409 4436053 gene locus_tag LOCUS_39680 4435409 4436053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 4436900 4436199 gene locus_tag LOCUS_39690 4436900 4436199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 4437226 4436897 gene locus_tag LOCUS_39700 4437226 4436897 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356630.1 protein_id gnl|my_center|LOCUS_39700 4437393 4437893 gene locus_tag LOCUS_39710 4437393 4437893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 4439263 4438337 gene locus_tag LOCUS_39720 4439263 4438337 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970438.1 protein_id gnl|my_center|LOCUS_39720 4439483 4442236 gene locus_tag LOCUS_39730 4439483 4442236 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027553.1 protein_id gnl|my_center|LOCUS_39730 4442426 4442929 gene locus_tag LOCUS_39740 4442426 4442929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 4443126 4443374 gene locus_tag LOCUS_39750 4443126 4443374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 4443739 4445364 gene locus_tag LOCUS_39760 4443739 4445364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 4445357 4447150 gene locus_tag LOCUS_39770 gene yesM 4445357 4447150 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_39770 4447553 4449093 gene locus_tag LOCUS_r00280 4447553 4449093 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4449251 4449363 gene locus_tag LOCUS_r00290 4449251 4449363 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4449644 4452564 gene locus_tag LOCUS_r00300 4449644 4452564 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4452977 4453903 gene locus_tag LOCUS_39780 4452977 4453903 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_39780 4453933 4454817 gene locus_tag LOCUS_39790 4453933 4454817 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_39790 4454904 4456478 gene locus_tag LOCUS_39800 4454904 4456478 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002995654.1 protein_id gnl|my_center|LOCUS_39800 4456973 4458196 gene locus_tag LOCUS_39810 4456973 4458196 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770856.1 protein_id gnl|my_center|LOCUS_39810 4458254 4459099 gene locus_tag LOCUS_39820 4458254 4459099 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530858.1 protein_id gnl|my_center|LOCUS_39820 4460555 4459155 gene locus_tag LOCUS_39830 4460555 4459155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 4460771 4461301 gene locus_tag LOCUS_39840 4460771 4461301 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012056.1 protein_id gnl|my_center|LOCUS_39840 4461520 4462173 gene locus_tag LOCUS_39850 4461520 4462173 CDS product elongation factor G-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387072.1 protein_id gnl|my_center|LOCUS_39850 4462580 4466044 gene locus_tag LOCUS_39860 4462580 4466044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 4467238 4466147 gene locus_tag LOCUS_39870 4467238 4466147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 4467486 4467235 gene locus_tag LOCUS_39880 4467486 4467235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 4468648 4467488 gene locus_tag LOCUS_39890 4468648 4467488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 4470119 4468635 gene locus_tag LOCUS_39900 4470119 4468635 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233683.1 protein_id gnl|my_center|LOCUS_39900 4470571 4471215 gene locus_tag LOCUS_39910 4470571 4471215 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025687389.1 protein_id gnl|my_center|LOCUS_39910 4471728 4471420 gene locus_tag LOCUS_39920 4471728 4471420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 4473013 4471778 gene locus_tag LOCUS_39930 gene pepT 4473013 4471778 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244314.1 protein_id gnl|my_center|LOCUS_39930 4473278 4475008 gene locus_tag LOCUS_39940 4473278 4475008 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083000.1 protein_id gnl|my_center|LOCUS_39940 4475001 4476884 gene locus_tag LOCUS_39950 4475001 4476884 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083002.1 protein_id gnl|my_center|LOCUS_39950 4478513 4477101 gene locus_tag LOCUS_39960 4478513 4477101 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029787.1 protein_id gnl|my_center|LOCUS_39960 4478745 4478957 gene locus_tag LOCUS_39970 4478745 4478957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 4480597 4480028 gene locus_tag LOCUS_39980 4480597 4480028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 4480757 4482253 gene locus_tag LOCUS_39990 gene pepD 4480757 4482253 CDS product beta-Ala-His dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287514.1 protein_id gnl|my_center|LOCUS_39990 4482463 4484247 gene locus_tag LOCUS_40000 gene yesM 4482463 4484247 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_40000 4484368 4486122 gene locus_tag LOCUS_40010 4484368 4486122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 4486186 4487085 gene locus_tag LOCUS_40020 4486186 4487085 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_40020 4487128 4488012 gene locus_tag LOCUS_40030 4487128 4488012 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_40030 4488053 4489165 gene locus_tag LOCUS_40040 4488053 4489165 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_40040 4489234 4490907 gene locus_tag LOCUS_40050 4489234 4490907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 4490924 4492978 gene locus_tag LOCUS_40060 4490924 4492978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 4492975 4494141 gene locus_tag LOCUS_40070 4492975 4494141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 4495298 4494186 gene locus_tag LOCUS_40080 gene gerBC 4495298 4494186 CDS product spore germination protein GerBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242990.1 protein_id gnl|my_center|LOCUS_40080 4496680 4495295 gene locus_tag LOCUS_40090 4496680 4495295 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541476.1 protein_id gnl|my_center|LOCUS_40090 4497755 4496673 gene locus_tag LOCUS_40100 4497755 4496673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 4497927 4498112 gene locus_tag LOCUS_40110 4497927 4498112 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464456.1 protein_id gnl|my_center|LOCUS_40110 4498439 4500322 gene locus_tag LOCUS_40120 4498439 4500322 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109250.1 protein_id gnl|my_center|LOCUS_40120 4500319 4501401 gene locus_tag LOCUS_40130 4500319 4501401 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_40130 4501420 4502556 gene locus_tag LOCUS_40140 4501420 4502556 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287753.1 protein_id gnl|my_center|LOCUS_40140 4502777 4503424 gene locus_tag LOCUS_40150 4502777 4503424 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178514.1 protein_id gnl|my_center|LOCUS_40150 4505082 4503670 gene locus_tag LOCUS_40160 4505082 4503670 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110815093.1 protein_id gnl|my_center|LOCUS_40160 4507620 4506544 gene locus_tag LOCUS_40170 4507620 4506544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 4508713 4507625 gene locus_tag LOCUS_40180 4508713 4507625 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169830.1 protein_id gnl|my_center|LOCUS_40180 4508893 4509720 gene locus_tag LOCUS_40190 4508893 4509720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 4509992 4510576 gene locus_tag LOCUS_40200 gene pgsA 4509992 4510576 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052967.1 protein_id gnl|my_center|LOCUS_40200 4510687 4510514 gene locus_tag LOCUS_40210 4510687 4510514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 4511550 4510738 gene locus_tag LOCUS_40220 4511550 4510738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 4511745 4512668 gene locus_tag LOCUS_40230 4511745 4512668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 4513006 4512749 gene locus_tag LOCUS_40240 4513006 4512749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 4514115 4513192 gene locus_tag LOCUS_40250 4514115 4513192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 4514372 4514956 gene locus_tag LOCUS_40260 4514372 4514956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 4515064 4517526 gene locus_tag LOCUS_40270 4515064 4517526 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_40270 4517530 4518606 gene locus_tag LOCUS_40280 4517530 4518606 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257043.1 protein_id gnl|my_center|LOCUS_40280 4518786 4519508 gene locus_tag LOCUS_40290 4518786 4519508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 4521012 4519609 gene locus_tag LOCUS_40300 gene glyS 4521012 4519609 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287157.1 protein_id gnl|my_center|LOCUS_40300 4521454 4521981 gene locus_tag LOCUS_40310 4521454 4521981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 4522992 4522087 gene locus_tag LOCUS_40320 4522992 4522087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 4523199 4524239 gene locus_tag LOCUS_40330 4523199 4524239 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089093.1 protein_id gnl|my_center|LOCUS_40330 4524253 4525254 gene locus_tag LOCUS_40340 4524253 4525254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 4525298 4526167 gene locus_tag LOCUS_40350 4525298 4526167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 4527759 4526335 gene locus_tag LOCUS_40360 4527759 4526335 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387654.1 protein_id gnl|my_center|LOCUS_40360 4528139 4527777 gene locus_tag LOCUS_40370 4528139 4527777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 4528491 4528967 gene locus_tag LOCUS_40380 4528491 4528967 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665857.1 protein_id gnl|my_center|LOCUS_40380 4529981 4529040 gene locus_tag LOCUS_40390 4529981 4529040 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226263.1 protein_id gnl|my_center|LOCUS_40390 4530407 4529982 gene locus_tag LOCUS_40400 4530407 4529982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 4530858 4532401 gene locus_tag LOCUS_r00310 4530858 4532401 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4532559 4532671 gene locus_tag LOCUS_r00320 4532559 4532671 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4533067 4535987 gene locus_tag LOCUS_r00330 4533067 4535987 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4536105 4536181 gene locus_tag LOCUS_t00770 4536105 4536181 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 4536195 4536270 gene locus_tag LOCUS_t00780 4536195 4536270 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4536288 4536363 gene locus_tag LOCUS_t00790 4536288 4536363 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4536368 4536458 gene locus_tag LOCUS_t00800 4536368 4536458 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4536478 4536552 gene locus_tag LOCUS_t00810 4536478 4536552 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4536629 4536704 gene locus_tag LOCUS_t00820 4536629 4536704 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4536731 4536807 gene locus_tag LOCUS_t00830 4536731 4536807 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4536850 4536926 gene locus_tag LOCUS_t00840 4536850 4536926 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 4536972 4537047 gene locus_tag LOCUS_t00850 4536972 4537047 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4537059 4537132 gene locus_tag LOCUS_t00860 4537059 4537132 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4537145 4537231 gene locus_tag LOCUS_t00870 4537145 4537231 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4537235 4537309 gene locus_tag LOCUS_t00880 4537235 4537309 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4537316 4537392 gene locus_tag LOCUS_t00890 4537316 4537392 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4537421 4537497 gene locus_tag LOCUS_t00900 4537421 4537497 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4537510 4537580 gene locus_tag LOCUS_t00910 4537510 4537580 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4538276 4537773 gene locus_tag LOCUS_40410 4538276 4537773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 4539702 4538308 gene locus_tag LOCUS_40420 4539702 4538308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 4540062 4540607 gene locus_tag LOCUS_40430 4540062 4540607 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259181.1 protein_id gnl|my_center|LOCUS_40430 4540670 4541941 gene locus_tag LOCUS_40440 gene mdtG 4540670 4541941 CDS product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074163.1 protein_id gnl|my_center|LOCUS_40440 4542015 4543406 gene locus_tag LOCUS_40450 4542015 4543406 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267510.1 protein_id gnl|my_center|LOCUS_40450 4543461 4545155 gene locus_tag LOCUS_40460 4543461 4545155 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495702.1 protein_id gnl|my_center|LOCUS_40460 4545168 4546097 gene locus_tag LOCUS_40470 4545168 4546097 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928488.1 protein_id gnl|my_center|LOCUS_40470 4546113 4547006 gene locus_tag LOCUS_40480 4546113 4547006 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_40480 4547019 4549241 gene locus_tag LOCUS_40490 4547019 4549241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 4549325 4550659 gene locus_tag LOCUS_40500 4549325 4550659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 4550883 4551461 gene locus_tag LOCUS_40510 4550883 4551461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 4552421 4551594 gene locus_tag LOCUS_40520 4552421 4551594 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777099.1 protein_id gnl|my_center|LOCUS_40520 4552696 4552448 gene locus_tag LOCUS_40530 4552696 4552448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 4553832 4552834 gene locus_tag LOCUS_40540 4553832 4552834 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_40540 4554128 4555054 gene locus_tag LOCUS_40550 4554128 4555054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 4555097 4555312 gene locus_tag LOCUS_40560 4555097 4555312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 4556681 4555323 gene locus_tag LOCUS_40570 4556681 4555323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 4556964 4557833 gene locus_tag LOCUS_40580 gene catE 4556964 4557833 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233597.1 protein_id gnl|my_center|LOCUS_40580 4558044 4559792 gene locus_tag LOCUS_40590 4558044 4559792 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966041.1 protein_id gnl|my_center|LOCUS_40590 4559785 4561644 gene locus_tag LOCUS_40600 4559785 4561644 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_40600 4561718 4562389 gene locus_tag LOCUS_40610 4561718 4562389 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362607.1 protein_id gnl|my_center|LOCUS_40610 4563777 4566956 gene locus_tag LOCUS_40620 4563777 4566956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 4567148 4570057 gene locus_tag LOCUS_40630 4567148 4570057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 4570242 4571366 gene locus_tag LOCUS_40640 4570242 4571366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 4571558 4573384 gene locus_tag LOCUS_40650 4571558 4573384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 4573377 4574999 gene locus_tag LOCUS_40660 4573377 4574999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 4575185 4576138 gene locus_tag LOCUS_40670 4575185 4576138 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_40670 4576160 4577119 gene locus_tag LOCUS_40680 4576160 4577119 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_40680 4577179 4578798 gene locus_tag LOCUS_40690 4577179 4578798 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_40690 4578880 4579797 gene locus_tag LOCUS_40700 4578880 4579797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 4579893 4582490 gene locus_tag LOCUS_40710 4579893 4582490 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194904324.1 protein_id gnl|my_center|LOCUS_40710 4582558 4583736 gene locus_tag LOCUS_40720 4582558 4583736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 4584900 4584055 gene locus_tag LOCUS_40730 4584900 4584055 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_40730 4585167 4585736 gene locus_tag LOCUS_40740 4585167 4585736 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503553.1 protein_id gnl|my_center|LOCUS_40740 4585862 4586902 gene locus_tag LOCUS_40750 4585862 4586902 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_40750 4586902 4587234 gene locus_tag LOCUS_40760 4586902 4587234 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660653.1 protein_id gnl|my_center|LOCUS_40760 4587303 4587815 gene locus_tag LOCUS_40770 4587303 4587815 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004328577.1 protein_id gnl|my_center|LOCUS_40770 4587812 4588288 gene locus_tag LOCUS_40780 gene coaD 4587812 4588288 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694492.1 protein_id gnl|my_center|LOCUS_40780 4588516 4589364 gene locus_tag LOCUS_40790 gene folD 4588516 4589364 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207454.1 protein_id gnl|my_center|LOCUS_40790 4589542 4591254 gene locus_tag LOCUS_40800 4589542 4591254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 4592456 4591743 gene locus_tag LOCUS_40810 4592456 4591743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 4593195 4592470 gene locus_tag LOCUS_40820 4593195 4592470 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583993.1 protein_id gnl|my_center|LOCUS_40820 4595043 4593325 gene locus_tag LOCUS_40830 4595043 4593325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 4596880 4595243 gene locus_tag LOCUS_40840 4596880 4595243 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807737.1 protein_id gnl|my_center|LOCUS_40840 4597590 4596877 gene locus_tag LOCUS_40850 4597590 4596877 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807742.1 protein_id gnl|my_center|LOCUS_40850 4597829 4600297 gene locus_tag LOCUS_40860 4597829 4600297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 4600318 4601331 gene locus_tag LOCUS_40870 4600318 4601331 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_40870 4601328 4601732 gene locus_tag LOCUS_40880 4601328 4601732 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231531.1 protein_id gnl|my_center|LOCUS_40880 4601729 4602649 gene locus_tag LOCUS_40890 gene galU 4601729 4602649 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245127.1 protein_id gnl|my_center|LOCUS_40890 4602765 4603547 gene locus_tag LOCUS_40900 4602765 4603547 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_40900 4604237 4604052 gene locus_tag LOCUS_40910 4604237 4604052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 4604808 4604248 gene locus_tag LOCUS_40920 4604808 4604248 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479979.1 protein_id gnl|my_center|LOCUS_40920 4605030 4605377 gene locus_tag LOCUS_40930 4605030 4605377 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369567.1 protein_id gnl|my_center|LOCUS_40930 4606276 4605464 gene locus_tag LOCUS_40940 4606276 4605464 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727914.1 protein_id gnl|my_center|LOCUS_40940 4606813 4608141 gene locus_tag LOCUS_40950 4606813 4608141 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886626.1 protein_id gnl|my_center|LOCUS_40950 4609714 4608854 gene locus_tag LOCUS_40960 4609714 4608854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 4609823 4610824 gene locus_tag LOCUS_40970 gene gap 4609823 4610824 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_40970 4611448 4611206 gene locus_tag LOCUS_40980 4611448 4611206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 4611769 4613256 gene locus_tag LOCUS_40990 gene glpK 4611769 4613256 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233384.1 protein_id gnl|my_center|LOCUS_40990 4613477 4615159 gene locus_tag LOCUS_41000 gene glpD 4613477 4615159 CDS product aerobic glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672833.1 protein_id gnl|my_center|LOCUS_41000 4615322 4616275 gene locus_tag LOCUS_41010 4615322 4616275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 4616501 4617073 gene locus_tag LOCUS_41020 4616501 4617073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 4617263 4618144 gene locus_tag LOCUS_41030 4617263 4618144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 4618191 4618637 gene locus_tag LOCUS_41040 4618191 4618637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 4619664 4618771 gene locus_tag LOCUS_41050 4619664 4618771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 4619933 4619604 gene locus_tag LOCUS_41060 4619933 4619604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 4620969 4620049 gene locus_tag LOCUS_41070 4620969 4620049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 4621262 4623565 gene locus_tag LOCUS_41080 4621262 4623565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 4624474 4625394 gene locus_tag LOCUS_41090 4624474 4625394 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_41090 4625419 4626300 gene locus_tag LOCUS_41100 4625419 4626300 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_41100 4626330 4627952 gene locus_tag LOCUS_41110 4626330 4627952 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_41110 4628119 4629885 gene locus_tag LOCUS_41120 4628119 4629885 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223431.1 protein_id gnl|my_center|LOCUS_41120 4629963 4632623 gene locus_tag LOCUS_41130 4629963 4632623 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031477.1 protein_id gnl|my_center|LOCUS_41130 4633323 4632775 gene locus_tag LOCUS_41140 gene chrA 4633323 4632775 CDS product chromate resistance efflux protein ChrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227840.1 protein_id gnl|my_center|LOCUS_41140 4634065 4633577 gene locus_tag LOCUS_41150 gene chrS 4634065 4633577 CDS product chromate efflux transcriptional regulator ChrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242900.1 protein_id gnl|my_center|LOCUS_41150 4634312 4634824 gene locus_tag LOCUS_41160 4634312 4634824 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030950.1 protein_id gnl|my_center|LOCUS_41160 4634821 4635393 gene locus_tag LOCUS_41170 4634821 4635393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 4635530 4636630 gene locus_tag LOCUS_41180 4635530 4636630 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014601365.1 protein_id gnl|my_center|LOCUS_41180 4636627 4637466 gene locus_tag LOCUS_41190 4636627 4637466 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721372.1 protein_id gnl|my_center|LOCUS_41190 4637473 4638303 gene locus_tag LOCUS_41200 4637473 4638303 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721373.1 protein_id gnl|my_center|LOCUS_41200 4638300 4639373 gene locus_tag LOCUS_41210 4638300 4639373 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721374.1 protein_id gnl|my_center|LOCUS_41210 4639398 4640342 gene locus_tag LOCUS_41220 4639398 4640342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 4643599 4641557 gene locus_tag LOCUS_41230 4643599 4641557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 4643784 4644653 gene locus_tag LOCUS_41240 4643784 4644653 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966961.1 protein_id gnl|my_center|LOCUS_41240 4645626 4644847 gene locus_tag LOCUS_41250 4645626 4644847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 4645927 4647414 gene locus_tag LOCUS_41260 gene abfB 4645927 4647414 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_41260 4647421 4647699 gene locus_tag LOCUS_41270 4647421 4647699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 4647907 4648755 gene locus_tag LOCUS_41280 4647907 4648755 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014654706.1 protein_id gnl|my_center|LOCUS_41280 4649627 4648752 gene locus_tag LOCUS_41290 4649627 4648752 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027325.1 protein_id gnl|my_center|LOCUS_41290 4649819 4650433 gene locus_tag LOCUS_41300 4649819 4650433 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987352.1 protein_id gnl|my_center|LOCUS_41300 4650538 4651755 gene locus_tag LOCUS_41310 4650538 4651755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 4651966 4652550 gene locus_tag LOCUS_41320 4651966 4652550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 4652894 4653820 gene locus_tag LOCUS_41330 4652894 4653820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 4654239 4653907 gene locus_tag LOCUS_41340 4654239 4653907 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816343.1 protein_id gnl|my_center|LOCUS_41340 4654408 4655346 gene locus_tag LOCUS_41350 4654408 4655346 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584156.1 protein_id gnl|my_center|LOCUS_41350 4657020 4655494 gene locus_tag LOCUS_41360 4657020 4655494 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_41360 4658012 4657107 gene locus_tag LOCUS_41370 gene ligD 4658012 4657107 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393573.1 protein_id gnl|my_center|LOCUS_41370 4659196 4658009 gene locus_tag LOCUS_41380 4659196 4658009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41380 4660132 4659197 gene locus_tag LOCUS_41390 4660132 4659197 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886496.1 protein_id gnl|my_center|LOCUS_41390 4660291 4660476 gene locus_tag LOCUS_41400 4660291 4660476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 4660478 4660666 gene locus_tag LOCUS_41410 4660478 4660666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 4660870 4661025 gene locus_tag LOCUS_41420 4660870 4661025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 4661702 4662568 gene locus_tag LOCUS_41430 4661702 4662568 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964635.1 protein_id gnl|my_center|LOCUS_41430 4662714 4663883 gene locus_tag LOCUS_41440 4662714 4663883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 4663897 4664379 gene locus_tag LOCUS_41450 gene tsaE 4663897 4664379 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_41450 4664383 4665408 gene locus_tag LOCUS_41460 4664383 4665408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 4665395 4665901 gene locus_tag LOCUS_41470 gene rimI 4665395 4665901 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367197.1 protein_id gnl|my_center|LOCUS_41470 4665882 4666931 gene locus_tag LOCUS_41480 gene tsaD 4665882 4666931 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414585.1 protein_id gnl|my_center|LOCUS_41480 4667203 4668321 gene locus_tag LOCUS_41490 gene dgoD 4667203 4668321 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_41490 4668349 4669131 gene locus_tag LOCUS_41500 4668349 4669131 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_41500 4669172 4669954 gene locus_tag LOCUS_41510 4669172 4669954 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970029.1 protein_id gnl|my_center|LOCUS_41510 4670073 4670267 gene locus_tag LOCUS_41520 4670073 4670267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 4670449 4671273 gene locus_tag LOCUS_41530 4670449 4671273 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654538.1 protein_id gnl|my_center|LOCUS_41530 4672122 4673801 gene locus_tag LOCUS_41540 4672122 4673801 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_41540 4673842 4674297 gene locus_tag LOCUS_41550 4673842 4674297 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136699628.1 protein_id gnl|my_center|LOCUS_41550 4675673 4674798 gene locus_tag LOCUS_41560 4675673 4674798 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234236.1 protein_id gnl|my_center|LOCUS_41560 4676542 4676985 gene locus_tag LOCUS_41570 4676542 4676985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 4677023 4677439 gene locus_tag LOCUS_41580 4677023 4677439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 4679817 4677877 gene locus_tag LOCUS_41590 4679817 4677877 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244150.1 protein_id gnl|my_center|LOCUS_41590 4680022 4680666 gene locus_tag LOCUS_41600 4680022 4680666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 4680647 4681123 gene locus_tag LOCUS_41610 gene moaC 4680647 4681123 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094151.1 protein_id gnl|my_center|LOCUS_41610 4681177 4681671 gene locus_tag LOCUS_41620 4681177 4681671 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_41620 4681668 4682699 gene locus_tag LOCUS_41630 4681668 4682699 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938852.1 protein_id gnl|my_center|LOCUS_41630 4682807 4683037 gene locus_tag LOCUS_41640 gene tatAD 4682807 4683037 CDS product sec-independent protein translocase protein TatAD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223835.1 protein_id gnl|my_center|LOCUS_41640 4683214 4683951 gene locus_tag LOCUS_41650 gene tatC 4683214 4683951 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886426.1 protein_id gnl|my_center|LOCUS_41650 4685134 4684097 gene locus_tag LOCUS_41660 4685134 4684097 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010276.1 protein_id gnl|my_center|LOCUS_41660 4685335 4686342 gene locus_tag LOCUS_41670 4685335 4686342 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242478.1 protein_id gnl|my_center|LOCUS_41670 4686344 4687387 gene locus_tag LOCUS_41680 4686344 4687387 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760047.1 protein_id gnl|my_center|LOCUS_41680 4687402 4688196 gene locus_tag LOCUS_41690 4687402 4688196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886609.1 protein_id gnl|my_center|LOCUS_41690 4689708 4689989 gene locus_tag LOCUS_41700 gene groES 4689708 4689989 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003155970.1 protein_id gnl|my_center|LOCUS_41700 4690065 4691702 gene locus_tag LOCUS_41710 gene groEL 4690065 4691702 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029999.1 protein_id gnl|my_center|LOCUS_41710 4692038 4692379 gene locus_tag LOCUS_41720 gene arsR 4692038 4692379 CDS product arsenical resistance operon transcriptional regulator ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026021.1 protein_id gnl|my_center|LOCUS_41720 4692428 4692904 gene locus_tag LOCUS_41730 4692428 4692904 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271013.1 protein_id gnl|my_center|LOCUS_41730 4692960 4694402 gene locus_tag LOCUS_41740 4692960 4694402 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243030.1 protein_id gnl|my_center|LOCUS_41740 4694405 4694824 gene locus_tag LOCUS_41750 4694405 4694824 CDS product thioredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398596.1 protein_id gnl|my_center|LOCUS_41750 4695079 4695462 gene locus_tag LOCUS_41760 4695079 4695462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 4695612 4696328 gene locus_tag LOCUS_41770 4695612 4696328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 4696398 4696751 gene locus_tag LOCUS_41780 4696398 4696751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 4696963 4697250 gene locus_tag LOCUS_41790 4696963 4697250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 4697310 4698899 gene locus_tag LOCUS_41800 4697310 4698899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 4699312 4699839 gene locus_tag LOCUS_41810 4699312 4699839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 4699998 4700906 gene locus_tag LOCUS_41820 gene ligD 4699998 4700906 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879221.1 protein_id gnl|my_center|LOCUS_41820 4701131 4702246 gene locus_tag LOCUS_41830 4701131 4702246 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_41830 4702799 4703551 gene locus_tag LOCUS_41840 4702799 4703551 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_41840 4703548 4704624 gene locus_tag LOCUS_41850 4703548 4704624 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986537.1 protein_id gnl|my_center|LOCUS_41850 4704729 4705562 gene locus_tag LOCUS_41860 4704729 4705562 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_41860 4705709 4706230 gene locus_tag LOCUS_41870 4705709 4706230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 4706253 4707119 gene locus_tag LOCUS_41880 4706253 4707119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 4707125 4707700 gene locus_tag LOCUS_41890 4707125 4707700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 4707669 4708430 gene locus_tag LOCUS_41900 4707669 4708430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 4708514 4709536 gene locus_tag LOCUS_41910 4708514 4709536 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_41910 4709538 4709897 gene locus_tag LOCUS_41920 4709538 4709897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 4709918 4710745 gene locus_tag LOCUS_41930 4709918 4710745 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884111.1 protein_id gnl|my_center|LOCUS_41930 4711757 4710954 gene locus_tag LOCUS_41940 4711757 4710954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 4712015 4713490 gene locus_tag LOCUS_41950 4712015 4713490 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_41950 4713912 4713631 gene locus_tag LOCUS_41960 4713912 4713631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 4714115 4713819 gene locus_tag LOCUS_41970 4714115 4713819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 4714254 4714862 gene locus_tag LOCUS_41980 4714254 4714862 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615637.1 protein_id gnl|my_center|LOCUS_41980 4714900 4715307 gene locus_tag LOCUS_41990 4714900 4715307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 4715336 4716196 gene locus_tag LOCUS_42000 4715336 4716196 CDS product DUF1479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030607.1 protein_id gnl|my_center|LOCUS_42000 4716381 4717775 gene locus_tag LOCUS_42010 gene murF 4716381 4717775 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610677.1 protein_id gnl|my_center|LOCUS_42010 4718029 4717847 gene locus_tag LOCUS_42020 4718029 4717847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 4719010 4718153 gene locus_tag LOCUS_42030 4719010 4718153 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476555.1 protein_id gnl|my_center|LOCUS_42030 4719202 4720611 gene locus_tag LOCUS_42040 gene uxaC 4719202 4720611 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245001.1 protein_id gnl|my_center|LOCUS_42040 4720831 4721115 gene locus_tag LOCUS_42050 4720831 4721115 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070523.1 protein_id gnl|my_center|LOCUS_42050 4721099 4721743 gene locus_tag LOCUS_42060 4721099 4721743 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716356.1 protein_id gnl|my_center|LOCUS_42060 4722973 4721810 gene locus_tag LOCUS_42070 4722973 4721810 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582945.1 protein_id gnl|my_center|LOCUS_42070 4724334 4723168 gene locus_tag LOCUS_42080 4724334 4723168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 4724478 4725572 gene locus_tag LOCUS_42090 4724478 4725572 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044933.1 protein_id gnl|my_center|LOCUS_42090 4725664 4726164 gene locus_tag LOCUS_42100 4725664 4726164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 4726617 4726336 gene locus_tag LOCUS_42110 4726617 4726336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 4727044 4726856 gene locus_tag LOCUS_42120 4727044 4726856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 4728475 4727360 gene locus_tag LOCUS_42130 gene murG 4728475 4727360 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724766.1 protein_id gnl|my_center|LOCUS_42130 4728547 4729065 gene locus_tag LOCUS_42140 4728547 4729065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 4730251 4729265 gene locus_tag LOCUS_42150 gene trpS 4730251 4729265 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110984.1 protein_id gnl|my_center|LOCUS_42150 4730765 4732585 gene locus_tag LOCUS_42160 4730765 4732585 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_42160 4732579 4734138 gene locus_tag LOCUS_42170 4732579 4734138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 4734388 4735740 gene locus_tag LOCUS_42180 4734388 4735740 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_42180 4735943 4736833 gene locus_tag LOCUS_42190 4735943 4736833 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_42190 4736837 4737673 gene locus_tag LOCUS_42200 4736837 4737673 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_42200 4739292 4737736 gene locus_tag LOCUS_42210 gene mdtP 4739292 4737736 CDS product multidrug efflux MFS transporter MdtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228559.1 protein_id gnl|my_center|LOCUS_42210 4740409 4739495 gene locus_tag LOCUS_42220 4740409 4739495 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004530.1 protein_id gnl|my_center|LOCUS_42220 4740693 4741961 gene locus_tag LOCUS_42230 4740693 4741961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 4741966 4742997 gene locus_tag LOCUS_42240 4741966 4742997 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204710.1 protein_id gnl|my_center|LOCUS_42240 4742994 4743827 gene locus_tag LOCUS_42250 4742994 4743827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626546.1 protein_id gnl|my_center|LOCUS_42250 4743857 4744267 gene locus_tag LOCUS_42260 4743857 4744267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 4744954 4744463 gene locus_tag LOCUS_42270 4744954 4744463 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168663.1 protein_id gnl|my_center|LOCUS_42270 4745654 4744977 gene locus_tag LOCUS_42280 4745654 4744977 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_42280 4745834 4746961 gene locus_tag LOCUS_42290 4745834 4746961 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836210.1 protein_id gnl|my_center|LOCUS_42290 4747077 4747835 gene locus_tag LOCUS_42300 4747077 4747835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 4747853 4749160 gene locus_tag LOCUS_42310 4747853 4749160 CDS product flagellar protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259035.1 protein_id gnl|my_center|LOCUS_42310 4749334 4750299 gene locus_tag LOCUS_42320 4749334 4750299 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_42320 4750346 4751248 gene locus_tag LOCUS_42330 4750346 4751248 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_42330 4751321 4752991 gene locus_tag LOCUS_42340 4751321 4752991 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357899.1 protein_id gnl|my_center|LOCUS_42340 4753082 4754650 gene locus_tag LOCUS_42350 4753082 4754650 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922520.1 protein_id gnl|my_center|LOCUS_42350 4754674 4756437 gene locus_tag LOCUS_42360 4754674 4756437 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_42360 4756589 4759120 gene locus_tag LOCUS_42370 4756589 4759120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 4759385 4760677 gene locus_tag LOCUS_42380 4759385 4760677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 4760788 4760988 gene locus_tag LOCUS_42390 4760788 4760988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 4760951 4762147 gene locus_tag LOCUS_42400 gene alr 4760951 4762147 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181633.1 protein_id gnl|my_center|LOCUS_42400 4762669 4762950 gene locus_tag LOCUS_42410 4762669 4762950 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393653.1 protein_id gnl|my_center|LOCUS_42410 4762953 4763303 gene locus_tag LOCUS_42420 gene ndoA 4762953 4763303 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 protein_id gnl|my_center|LOCUS_42420 4763578 4764549 gene locus_tag LOCUS_42430 4763578 4764549 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382199.1 protein_id gnl|my_center|LOCUS_42430 4764571 4765458 gene locus_tag LOCUS_42440 4764571 4765458 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 protein_id gnl|my_center|LOCUS_42440 4765527 4767284 gene locus_tag LOCUS_42450 4765527 4767284 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357899.1 protein_id gnl|my_center|LOCUS_42450 4767534 4769459 gene locus_tag LOCUS_42460 4767534 4769459 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011285644.1 protein_id gnl|my_center|LOCUS_42460 4769461 4771089 gene locus_tag LOCUS_42470 4769461 4771089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 4771305 4771994 gene locus_tag LOCUS_42480 4771305 4771994 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400890.1 protein_id gnl|my_center|LOCUS_42480 4772020 4772694 gene locus_tag LOCUS_42490 4772020 4772694 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890721.1 protein_id gnl|my_center|LOCUS_42490 4772872 4773597 gene locus_tag LOCUS_42500 4772872 4773597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 4773594 4774457 gene locus_tag LOCUS_42510 4773594 4774457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 4774454 4775932 gene locus_tag LOCUS_42520 4774454 4775932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 4775929 4776864 gene locus_tag LOCUS_42530 4775929 4776864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 4776884 4777774 gene locus_tag LOCUS_42540 4776884 4777774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 4777790 4777945 gene locus_tag LOCUS_42550 4777790 4777945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 4777979 4778125 gene locus_tag LOCUS_42560 4777979 4778125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 4778122 4778547 gene locus_tag LOCUS_42570 4778122 4778547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 4778707 4779189 gene locus_tag LOCUS_42580 4778707 4779189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 4779371 4780651 gene locus_tag LOCUS_42590 4779371 4780651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 4782030 4780714 gene locus_tag LOCUS_42600 gene uraA 4782030 4780714 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815817.1 protein_id gnl|my_center|LOCUS_42600 4782228 4783469 gene locus_tag LOCUS_42610 4782228 4783469 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941766.1 protein_id gnl|my_center|LOCUS_42610 4783798 4784844 gene locus_tag LOCUS_42620 gene uxuA 4783798 4784844 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426045.1 protein_id gnl|my_center|LOCUS_42620 4784856 4785731 gene locus_tag LOCUS_42630 4784856 4785731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 4785728 4786873 gene locus_tag LOCUS_42640 4785728 4786873 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_42640 4786873 4787958 gene locus_tag LOCUS_42650 4786873 4787958 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 protein_id gnl|my_center|LOCUS_42650 4788043 4788924 gene locus_tag LOCUS_42660 4788043 4788924 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357554.1 protein_id gnl|my_center|LOCUS_42660 4788954 4789727 gene locus_tag LOCUS_42670 4788954 4789727 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_42670 4790324 4789863 gene locus_tag LOCUS_42680 4790324 4789863 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288269.1 protein_id gnl|my_center|LOCUS_42680 4790547 4791104 gene locus_tag LOCUS_42690 gene sigY 4790547 4791104 CDS product RNA polymerase sigma factor SigY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243678.1 protein_id gnl|my_center|LOCUS_42690 4791085 4791426 gene locus_tag LOCUS_42700 4791085 4791426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 4791423 4791647 gene locus_tag LOCUS_42710 4791423 4791647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 4791660 4791863 gene locus_tag LOCUS_42720 4791660 4791863 CDS product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227293.1 protein_id gnl|my_center|LOCUS_42720 4791860 4792855 gene locus_tag LOCUS_42730 4791860 4792855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244494.1 protein_id gnl|my_center|LOCUS_42730 4792870 4793625 gene locus_tag LOCUS_42740 4792870 4793625 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243335.1 protein_id gnl|my_center|LOCUS_42740 4793720 4794100 gene locus_tag LOCUS_42750 4793720 4794100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 4795074 4794217 gene locus_tag LOCUS_42760 4795074 4794217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 4795369 4795181 gene locus_tag LOCUS_42770 4795369 4795181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 4795478 4795765 gene locus_tag LOCUS_42780 gene gatC 4795478 4795765 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_42780 4795801 4797258 gene locus_tag LOCUS_42790 gene gatA 4795801 4797258 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051433.1 protein_id gnl|my_center|LOCUS_42790 4797289 4798731 gene locus_tag LOCUS_42800 gene gatB 4797289 4798731 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219444.1 protein_id gnl|my_center|LOCUS_42800 4798842 4800809 gene locus_tag LOCUS_42810 4798842 4800809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 4800891 4801328 gene locus_tag LOCUS_42820 gene perR 4800891 4801328 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223285.1 protein_id gnl|my_center|LOCUS_42820 4801608 4803254 gene locus_tag LOCUS_42830 4801608 4803254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 4803711 4803337 gene locus_tag LOCUS_42840 4803711 4803337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 4803921 4804787 gene locus_tag LOCUS_42850 4803921 4804787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 4805142 4806687 gene locus_tag LOCUS_r00340 4805142 4806687 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4806846 4806958 gene locus_tag LOCUS_r00350 4806846 4806958 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4806990 4807066 gene locus_tag LOCUS_t00920 4806990 4807066 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 4807077 4807152 gene locus_tag LOCUS_t00930 4807077 4807152 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4807313 4810233 gene locus_tag LOCUS_r00360 4807313 4810233 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4810327 4810402 gene locus_tag LOCUS_t00940 4810327 4810402 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4810408 4810498 gene locus_tag LOCUS_t00950 4810408 4810498 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4810504 4810578 gene locus_tag LOCUS_t00960 4810504 4810578 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4810658 4810733 gene locus_tag LOCUS_t00970 4810658 4810733 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4810761 4810837 gene locus_tag LOCUS_t00980 4810761 4810837 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4810872 4810948 gene locus_tag LOCUS_t00990 4810872 4810948 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 4810963 4811038 gene locus_tag LOCUS_t01000 4810963 4811038 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4811064 4811139 gene locus_tag LOCUS_t01010 4811064 4811139 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4811147 4811230 gene locus_tag LOCUS_t01020 4811147 4811230 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4811240 4811313 gene locus_tag LOCUS_t01030 4811240 4811313 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4811334 4811409 gene locus_tag LOCUS_t01040 4811334 4811409 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4811438 4811513 gene locus_tag LOCUS_t01050 4811438 4811513 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4811519 4811593 gene locus_tag LOCUS_t01060 4811519 4811593 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4811604 4811677 gene locus_tag LOCUS_t01070 4811604 4811677 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4811693 4811769 gene locus_tag LOCUS_t01080 4811693 4811769 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4811779 4811860 gene locus_tag LOCUS_t01090 4811779 4811860 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4811996 4812160 gene locus_tag LOCUS_42860 4811996 4812160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 4812489 4812776 gene locus_tag LOCUS_42870 4812489 4812776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 4812872 4813570 gene locus_tag LOCUS_42880 4812872 4813570 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811261.1 protein_id gnl|my_center|LOCUS_42880 4813567 4814067 gene locus_tag LOCUS_42890 4813567 4814067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 4814070 4814759 gene locus_tag LOCUS_42900 4814070 4814759 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811261.1 protein_id gnl|my_center|LOCUS_42900 4814863 4815945 gene locus_tag LOCUS_42910 4814863 4815945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 4815965 4816642 gene locus_tag LOCUS_42920 4815965 4816642 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598707.1 protein_id gnl|my_center|LOCUS_42920 4817514 4816969 gene locus_tag LOCUS_42930 4817514 4816969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 4817633 4819360 gene locus_tag LOCUS_42940 4817633 4819360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 4820707 4819382 gene locus_tag LOCUS_42950 4820707 4819382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 4821336 4820938 gene locus_tag LOCUS_42960 4821336 4820938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 4821538 4822392 gene locus_tag LOCUS_42970 4821538 4822392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 4822519 4824075 gene locus_tag LOCUS_42980 gene zwf 4822519 4824075 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393785.1 protein_id gnl|my_center|LOCUS_42980 4824091 4824291 gene locus_tag LOCUS_42990 4824091 4824291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 4824430 4826016 gene locus_tag LOCUS_43000 4824430 4826016 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_43000 4826566 4826153 gene locus_tag LOCUS_43010 4826566 4826153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 4826918 4826577 gene locus_tag LOCUS_43020 4826918 4826577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 4827069 4828187 gene locus_tag LOCUS_43030 4827069 4828187 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_43030 4828234 4829400 gene locus_tag LOCUS_43040 4828234 4829400 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_43040 4829442 4830065 gene locus_tag LOCUS_43050 4829442 4830065 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530499.1 protein_id gnl|my_center|LOCUS_43050 4830153 4831247 gene locus_tag LOCUS_43060 4830153 4831247 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_43060 4831474 4832574 gene locus_tag LOCUS_43070 4831474 4832574 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_43070 4833163 4832927 gene locus_tag LOCUS_43080 gene sspI 4833163 4832927 CDS product small acid-soluble spore protein SspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229525.1 protein_id gnl|my_center|LOCUS_43080 4833310 4833984 gene locus_tag LOCUS_43090 4833310 4833984 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_43090 4834014 4834802 gene locus_tag LOCUS_43100 4834014 4834802 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158483.1 protein_id gnl|my_center|LOCUS_43100 4836456 4835296 gene locus_tag LOCUS_43110 4836456 4835296 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272496.1 protein_id gnl|my_center|LOCUS_43110 4836674 4837300 gene locus_tag LOCUS_43120 4836674 4837300 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_43120 4837321 4837860 gene locus_tag LOCUS_43130 4837321 4837860 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_43130 4838129 4837926 gene locus_tag LOCUS_43140 4838129 4837926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 4838253 4838525 gene locus_tag LOCUS_43150 4838253 4838525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 4840390 4838618 gene locus_tag LOCUS_43160 4840390 4838618 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038020.1 protein_id gnl|my_center|LOCUS_43160 4840548 4842356 gene locus_tag LOCUS_43170 4840548 4842356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 4842490 4843851 gene locus_tag LOCUS_43180 4842490 4843851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 4843997 4850761 gene locus_tag LOCUS_43190 4843997 4850761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 4851019 4851897 gene locus_tag LOCUS_43200 4851019 4851897 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_43200 4851901 4852749 gene locus_tag LOCUS_43210 4851901 4852749 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_43210 4852780 4854462 gene locus_tag LOCUS_43220 4852780 4854462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 4855346 4854540 gene locus_tag LOCUS_43230 4855346 4854540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 4856380 4855472 gene locus_tag LOCUS_43240 4856380 4855472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 4856475 4857140 gene locus_tag LOCUS_43250 4856475 4857140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 4858174 4857131 gene locus_tag LOCUS_43260 4858174 4857131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 4859244 4858339 gene locus_tag LOCUS_43270 4859244 4858339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 4859501 4860895 gene locus_tag LOCUS_43280 4859501 4860895 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055010987.1 protein_id gnl|my_center|LOCUS_43280 4861288 4868514 gene locus_tag LOCUS_43290 4861288 4868514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 4868606 4869640 gene locus_tag LOCUS_43300 4868606 4869640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 4870045 4870971 gene locus_tag LOCUS_43310 4870045 4870971 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_43310 4871004 4871162 gene locus_tag LOCUS_43320 4871004 4871162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 4871353 4873503 gene locus_tag LOCUS_43330 4871353 4873503 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108997.1 protein_id gnl|my_center|LOCUS_43330 4873662 4875008 gene locus_tag LOCUS_43340 4873662 4875008 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161410139.1 protein_id gnl|my_center|LOCUS_43340 4875243 4879565 gene locus_tag LOCUS_43350 4875243 4879565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 4879788 4880669 gene locus_tag LOCUS_43360 4879788 4880669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 4882519 4881374 gene locus_tag LOCUS_43370 4882519 4881374 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964649.1 protein_id gnl|my_center|LOCUS_43370 4883176 4884804 gene locus_tag LOCUS_43380 4883176 4884804 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_43380 4884886 4885863 gene locus_tag LOCUS_43390 4884886 4885863 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_43390 4885857 4886822 gene locus_tag LOCUS_43400 4885857 4886822 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_43400 4886859 4887704 gene locus_tag LOCUS_43410 4886859 4887704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 4887769 4888992 gene locus_tag LOCUS_43420 4887769 4888992 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770856.1 protein_id gnl|my_center|LOCUS_43420 4889133 4889675 gene locus_tag LOCUS_43430 4889133 4889675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 4889725 4890417 gene locus_tag LOCUS_43440 4889725 4890417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 4890625 4892802 gene locus_tag LOCUS_43450 gene katG 4890625 4892802 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391529.1 protein_id gnl|my_center|LOCUS_43450 4893040 4893888 gene locus_tag LOCUS_43460 4893040 4893888 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_43460 4893866 4894600 gene locus_tag LOCUS_43470 gene fabG 4893866 4894600 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_43470 4894625 4895536 gene locus_tag LOCUS_43480 4894625 4895536 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 protein_id gnl|my_center|LOCUS_43480 4895634 4896353 gene locus_tag LOCUS_43490 4895634 4896353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 4896690 4897082 gene locus_tag LOCUS_43500 4896690 4897082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 4897114 4897293 gene locus_tag LOCUS_43510 4897114 4897293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 4898883 4897495 gene locus_tag LOCUS_43520 gene thrC 4898883 4897495 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_43520 4899053 4900033 gene locus_tag LOCUS_43530 4899053 4900033 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704826.1 protein_id gnl|my_center|LOCUS_43530 4899346 4899433 gene locus_tag LOCUS_t01100 4899346 4899433 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 4900242 4901759 gene locus_tag LOCUS_43540 4900242 4901759 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233683.1 protein_id gnl|my_center|LOCUS_43540 4901756 4902844 gene locus_tag LOCUS_43550 4901756 4902844 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392970.1 protein_id gnl|my_center|LOCUS_43550 4902841 4904058 gene locus_tag LOCUS_43560 4902841 4904058 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890704.1 protein_id gnl|my_center|LOCUS_43560 4904297 4905412 gene locus_tag LOCUS_43570 4904297 4905412 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392970.1 protein_id gnl|my_center|LOCUS_43570 4905506 4907857 gene locus_tag LOCUS_43580 4905506 4907857 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_43580 4907932 4908795 gene locus_tag LOCUS_43590 4907932 4908795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 4909887 4908859 gene locus_tag LOCUS_43600 gene lytH 4909887 4908859 CDS product L-Ala--D-Glu endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243462.1 protein_id gnl|my_center|LOCUS_43600 4910092 4910982 gene locus_tag LOCUS_43610 gene lipA 4910092 4910982 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166375.1 protein_id gnl|my_center|LOCUS_43610 4911073 4911993 gene locus_tag LOCUS_43620 4911073 4911993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 4913809 4912070 gene locus_tag LOCUS_43630 4913809 4912070 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161599.1 protein_id gnl|my_center|LOCUS_43630 4914609 4913812 gene locus_tag LOCUS_43640 4914609 4913812 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232918.1 protein_id gnl|my_center|LOCUS_43640 4915824 4914745 gene locus_tag LOCUS_43650 gene spoVV 4915824 4914745 CDS product dipicolinic acid transporter SpoVV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245492.1 protein_id gnl|my_center|LOCUS_43650 4916336 4916713 gene locus_tag LOCUS_43660 4916336 4916713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043386.1 protein_id gnl|my_center|LOCUS_43660 4916739 4917431 gene locus_tag LOCUS_43670 4916739 4917431 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393240.1 protein_id gnl|my_center|LOCUS_43670 4917779 4917543 gene locus_tag LOCUS_43680 4917779 4917543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 4917958 4917776 gene locus_tag LOCUS_43690 4917958 4917776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 4918164 4920002 gene locus_tag LOCUS_43700 4918164 4920002 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990142.1 protein_id gnl|my_center|LOCUS_43700 4920167 4920646 gene locus_tag LOCUS_43710 gene ndk 4920167 4920646 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056122.1 protein_id gnl|my_center|LOCUS_43710 4921388 4920750 gene locus_tag LOCUS_43720 4921388 4920750 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231196.1 protein_id gnl|my_center|LOCUS_43720 4921666 4922787 gene locus_tag LOCUS_43730 4921666 4922787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 4922799 4924037 gene locus_tag LOCUS_43740 4922799 4924037 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294683.1 protein_id gnl|my_center|LOCUS_43740 4924034 4924888 gene locus_tag LOCUS_43750 4924034 4924888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 4924902 4925756 gene locus_tag LOCUS_43760 4924902 4925756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 4925795 4925986 gene locus_tag LOCUS_43770 4925795 4925986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 4925976 4926758 gene locus_tag LOCUS_43780 4925976 4926758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 4926755 4928989 gene locus_tag LOCUS_43790 4926755 4928989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 4928940 4930130 gene locus_tag LOCUS_43800 4928940 4930130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 4930123 4930641 gene locus_tag LOCUS_43810 4930123 4930641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 4930663 4932375 gene locus_tag LOCUS_43820 4930663 4932375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 4932811 4932963 gene locus_tag LOCUS_43830 4932811 4932963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 4933093 4933527 gene locus_tag LOCUS_43840 4933093 4933527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 4933956 4934213 gene locus_tag LOCUS_43850 4933956 4934213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 4934402 4934740 gene locus_tag LOCUS_43860 4934402 4934740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 4934746 4934973 gene locus_tag LOCUS_43870 4934746 4934973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 4935291 4936295 gene locus_tag LOCUS_43880 4935291 4936295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 4936600 4937067 gene locus_tag LOCUS_43890 4936600 4937067 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016200.1 protein_id gnl|my_center|LOCUS_43890 4937304 4937705 gene locus_tag LOCUS_43900 4937304 4937705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 4937924 4938358 gene locus_tag LOCUS_43910 4937924 4938358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 4938532 4938945 gene locus_tag LOCUS_43920 4938532 4938945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 4939177 4939581 gene locus_tag LOCUS_43930 4939177 4939581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 4939822 4940589 gene locus_tag LOCUS_43940 4939822 4940589 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262191.1 protein_id gnl|my_center|LOCUS_43940 4940736 4940990 gene locus_tag LOCUS_43950 4940736 4940990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 4941107 4941925 gene locus_tag LOCUS_43960 4941107 4941925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 4941988 4942212 gene locus_tag LOCUS_43970 4941988 4942212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 4942332 4942616 gene locus_tag LOCUS_43980 4942332 4942616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 4942660 4942968 gene locus_tag LOCUS_43990 4942660 4942968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 4943054 4943311 gene locus_tag LOCUS_44000 4943054 4943311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 4943480 4943959 gene locus_tag LOCUS_44010 4943480 4943959 CDS product DUF1643 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588536.1 protein_id gnl|my_center|LOCUS_44010 4944059 4944634 gene locus_tag LOCUS_44020 4944059 4944634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 4944637 4945119 gene locus_tag LOCUS_44030 4944637 4945119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 4945131 4945502 gene locus_tag LOCUS_44040 gene fra 4945131 4945502 CDS product iron chaperone frataxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244145.1 protein_id gnl|my_center|LOCUS_44040 4946494 4945595 gene locus_tag LOCUS_44050 4946494 4945595 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019638483.1 protein_id gnl|my_center|LOCUS_44050 4947005 4946574 gene locus_tag LOCUS_44060 gene yneK 4947005 4946574 CDS product DynA interaction protein YneK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231580.1 protein_id gnl|my_center|LOCUS_44060 4947220 4948347 gene locus_tag LOCUS_44070 4947220 4948347 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912466.1 protein_id gnl|my_center|LOCUS_44070 4948407 4949306 gene locus_tag LOCUS_44080 gene purU 4948407 4949306 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245802.1 protein_id gnl|my_center|LOCUS_44080 4949645 4951660 gene locus_tag LOCUS_44090 gene tkt 4949645 4951660 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019766.1 protein_id gnl|my_center|LOCUS_44090 4951774 4952091 gene locus_tag LOCUS_44100 4951774 4952091 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077234.1 protein_id gnl|my_center|LOCUS_44100 4953547 4952231 gene locus_tag LOCUS_44110 4953547 4952231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 4953750 4955099 gene locus_tag LOCUS_44120 4953750 4955099 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435635.1 protein_id gnl|my_center|LOCUS_44120 4955109 4955741 gene locus_tag LOCUS_44130 4955109 4955741 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_44130 4956023 4956838 gene locus_tag LOCUS_44140 gene cysT 4956023 4956838 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_44140 4956835 4957632 gene locus_tag LOCUS_44150 gene cysW 4956835 4957632 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056131.1 protein_id gnl|my_center|LOCUS_44150 4957636 4958700 gene locus_tag LOCUS_44160 4957636 4958700 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729898.1 protein_id gnl|my_center|LOCUS_44160 4958792 4959874 gene locus_tag LOCUS_44170 4958792 4959874 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_44170 4961189 4960026 gene locus_tag LOCUS_44180 4961189 4960026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 4961453 4962520 gene locus_tag LOCUS_44190 4961453 4962520 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461666.1 protein_id gnl|my_center|LOCUS_44190 4963457 4962654 gene locus_tag LOCUS_44200 4963457 4962654 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462186.1 protein_id gnl|my_center|LOCUS_44200 4964395 4963532 gene locus_tag LOCUS_44210 gene mmsR 4964395 4963532 CDS product MmsAB operon transcriptional regulator MmsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122160.1 protein_id gnl|my_center|LOCUS_44210 4964587 4965525 gene locus_tag LOCUS_44220 4964587 4965525 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732378.1 protein_id gnl|my_center|LOCUS_44220 4965759 4967192 gene locus_tag LOCUS_44230 gene ctpA 4965759 4967192 CDS product carboxy-terminal processing protease CtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231186.1 protein_id gnl|my_center|LOCUS_44230 4967374 4968876 gene locus_tag LOCUS_44240 4967374 4968876 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802512.1 protein_id gnl|my_center|LOCUS_44240 4969028 4969564 gene locus_tag LOCUS_44250 4969028 4969564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 4970237 4969626 gene locus_tag LOCUS_44260 4970237 4969626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 4971132 4971833 gene locus_tag LOCUS_44270 4971132 4971833 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226877.1 protein_id gnl|my_center|LOCUS_44270 4972993 4971938 gene locus_tag LOCUS_44280 4972993 4971938 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_44280 4974069 4973236 gene locus_tag LOCUS_44290 4974069 4973236 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204774.1 protein_id gnl|my_center|LOCUS_44290 4974243 4975124 gene locus_tag LOCUS_44300 4974243 4975124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 4975245 4976795 gene locus_tag LOCUS_44310 4975245 4976795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 4976981 4978795 gene locus_tag LOCUS_44320 4976981 4978795 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 protein_id gnl|my_center|LOCUS_44320 4978901 4979860 gene locus_tag LOCUS_44330 gene mgrA 4978901 4979860 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_44330 4980723 4980079 gene locus_tag LOCUS_44340 4980723 4980079 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028021.1 protein_id gnl|my_center|LOCUS_44340 4980872 4981600 gene locus_tag LOCUS_44350 4980872 4981600 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687920.1 protein_id gnl|my_center|LOCUS_44350 4982117 4981746 gene locus_tag LOCUS_44360 4982117 4981746 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393711.1 protein_id gnl|my_center|LOCUS_44360 4982497 4982114 gene locus_tag LOCUS_44370 4982497 4982114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 4983257 4982553 gene locus_tag LOCUS_44380 4983257 4982553 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_44380 4983377 4984666 gene locus_tag LOCUS_44390 4983377 4984666 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042981175.1 protein_id gnl|my_center|LOCUS_44390 4984795 4985877 gene locus_tag LOCUS_44400 4984795 4985877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887741.1 protein_id gnl|my_center|LOCUS_44400 4985885 4986775 gene locus_tag LOCUS_44410 4985885 4986775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142031.1 protein_id gnl|my_center|LOCUS_44410 4987920 4986955 gene locus_tag LOCUS_44420 gene manA 4987920 4986955 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379715.1 protein_id gnl|my_center|LOCUS_44420 4988381 4987986 gene locus_tag LOCUS_44430 gene glxA 4988381 4987986 CDS product glyoxalase GlxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243380.1 protein_id gnl|my_center|LOCUS_44430 4989213 4988476 gene locus_tag LOCUS_44440 4989213 4988476 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404273.1 protein_id gnl|my_center|LOCUS_44440 4990183 4989215 gene locus_tag LOCUS_44450 4990183 4989215 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830802.1 protein_id gnl|my_center|LOCUS_44450 4990509 4990694 gene locus_tag LOCUS_44460 4990509 4990694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 4990874 4991659 gene locus_tag LOCUS_44470 gene trmB 4990874 4991659 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893561.1 protein_id gnl|my_center|LOCUS_44470 4992135 4991578 gene locus_tag LOCUS_44480 4992135 4991578 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944684.1 protein_id gnl|my_center|LOCUS_44480 4992374 4993546 gene locus_tag LOCUS_44490 4992374 4993546 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261636.1 protein_id gnl|my_center|LOCUS_44490 4993848 4995086 gene locus_tag LOCUS_44500 4993848 4995086 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808136.1 protein_id gnl|my_center|LOCUS_44500 4995499 4996092 gene locus_tag LOCUS_44510 gene infC 4995499 4996092 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958948.1 protein_id gnl|my_center|LOCUS_44510 4996116 4996319 gene locus_tag LOCUS_44520 gene rpmI 4996116 4996319 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222418.1 protein_id gnl|my_center|LOCUS_44520 4996358 4996717 gene locus_tag LOCUS_44530 gene rplT 4996358 4996717 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263326.1 protein_id gnl|my_center|LOCUS_44530 4996874 4997962 gene locus_tag LOCUS_44540 gene pepQ 4996874 4997962 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994047.1 protein_id gnl|my_center|LOCUS_44540 4998331 4998723 gene locus_tag LOCUS_44550 4998331 4998723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 4999282 4998836 gene locus_tag LOCUS_44560 4999282 4998836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 4999835 5001580 gene locus_tag LOCUS_44570 gene ilvB 4999835 5001580 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398643.1 protein_id gnl|my_center|LOCUS_44570 5001577 5002062 gene locus_tag LOCUS_44580 gene ilvN 5001577 5002062 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879215.1 protein_id gnl|my_center|LOCUS_44580 5002290 5003282 gene locus_tag LOCUS_44590 gene ilvC 5002290 5003282 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861143.1 protein_id gnl|my_center|LOCUS_44590 5003454 5004821 gene locus_tag LOCUS_44600 5003454 5004821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 5004850 5005509 gene locus_tag LOCUS_44610 5004850 5005509 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_44610 5005642 5007285 gene locus_tag LOCUS_44620 5005642 5007285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 5007455 5008534 gene locus_tag LOCUS_44630 gene leuB 5007455 5008534 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_44630 5008671 5009219 gene locus_tag LOCUS_44640 gene ahpA 5008671 5009219 CDS product biofilm-specific peroxidase AhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245371.1 protein_id gnl|my_center|LOCUS_44640 5009422 5009847 gene locus_tag LOCUS_44650 5009422 5009847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 5009968 5010789 gene locus_tag LOCUS_44660 gene sigI 5009968 5010789 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245855.1 protein_id gnl|my_center|LOCUS_44660 5010786 5012540 gene locus_tag LOCUS_44670 5010786 5012540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 5012785 5013183 gene locus_tag LOCUS_44680 5012785 5013183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 5013187 5014560 gene locus_tag LOCUS_44690 5013187 5014560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 5014702 5016303 gene locus_tag LOCUS_44700 5014702 5016303 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_44700 5016348 5017649 gene locus_tag LOCUS_44710 5016348 5017649 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257067.1 protein_id gnl|my_center|LOCUS_44710 5017838 5019388 gene locus_tag LOCUS_44720 gene gntK 5017838 5019388 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254941.1 protein_id gnl|my_center|LOCUS_44720 5019831 5019424 gene locus_tag LOCUS_44730 5019831 5019424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529060.1 protein_id gnl|my_center|LOCUS_44730 5020186 5021430 gene locus_tag LOCUS_44740 5020186 5021430 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006095218.1 protein_id gnl|my_center|LOCUS_44740 5022595 5021522 gene locus_tag LOCUS_44750 5022595 5021522 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031503.1 protein_id gnl|my_center|LOCUS_44750 5022766 5023539 gene locus_tag LOCUS_44760 5022766 5023539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 5024150 5023701 gene locus_tag LOCUS_44770 5024150 5023701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 5025064 5024321 gene locus_tag LOCUS_44780 5025064 5024321 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_44780 5025241 5026005 gene locus_tag LOCUS_44790 gene fabG 5025241 5026005 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167269.1 protein_id gnl|my_center|LOCUS_44790 5026090 5027223 gene locus_tag LOCUS_44800 gene dgoD 5026090 5027223 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_44800 5027478 5029508 gene locus_tag LOCUS_44810 5027478 5029508 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080133.1 protein_id gnl|my_center|LOCUS_44810 5029712 5030674 gene locus_tag LOCUS_44820 5029712 5030674 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_44820 5030707 5031597 gene locus_tag LOCUS_44830 5030707 5031597 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_44830 5031689 5033479 gene locus_tag LOCUS_44840 5031689 5033479 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_44840 5033604 5035406 gene locus_tag LOCUS_44850 5033604 5035406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 5035399 5036997 gene locus_tag LOCUS_44860 5035399 5036997 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_44860 5037151 5037636 gene locus_tag LOCUS_44870 5037151 5037636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 5038115 5037711 gene locus_tag LOCUS_44880 5038115 5037711 CDS product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095862.1 protein_id gnl|my_center|LOCUS_44880 5039164 5038112 gene locus_tag LOCUS_44890 5039164 5038112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 5039452 5040837 gene locus_tag LOCUS_44900 gene fumC 5039452 5040837 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456604.1 protein_id gnl|my_center|LOCUS_44900 5040948 5041913 gene locus_tag LOCUS_44910 5040948 5041913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 5042851 5042063 gene locus_tag LOCUS_44920 5042851 5042063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 5043120 5043722 gene locus_tag LOCUS_44930 5043120 5043722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 5043898 5044365 gene locus_tag LOCUS_44940 5043898 5044365 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036432311.1 protein_id gnl|my_center|LOCUS_44940 5044370 5044921 gene locus_tag LOCUS_44950 5044370 5044921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 5047851 5044969 gene locus_tag LOCUS_44960 5047851 5044969 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185141306.1 protein_id gnl|my_center|LOCUS_44960 5048126 5048707 gene locus_tag LOCUS_44970 5048126 5048707 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943169.1 protein_id gnl|my_center|LOCUS_44970 5049187 5048885 gene locus_tag LOCUS_44980 5049187 5048885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 5049345 5050772 gene locus_tag LOCUS_44990 5049345 5050772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 5050917 5051675 gene locus_tag LOCUS_45000 gene pxpB 5050917 5051675 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249288.1 protein_id gnl|my_center|LOCUS_45000 5051677 5052294 gene locus_tag LOCUS_45010 5051677 5052294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45010 5052363 5052704 gene locus_tag LOCUS_45020 5052363 5052704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45020 5052714 5053535 gene locus_tag LOCUS_45030 gene pxpA 5052714 5053535 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207350.1 protein_id gnl|my_center|LOCUS_45030 5053587 5055716 gene locus_tag LOCUS_45040 5053587 5055716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 5055767 5056186 gene locus_tag LOCUS_45050 5055767 5056186 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227646.1 protein_id gnl|my_center|LOCUS_45050 5056938 5056195 gene locus_tag LOCUS_45060 5056938 5056195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 5058420 5057383 gene locus_tag LOCUS_45070 5058420 5057383 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987087.1 protein_id gnl|my_center|LOCUS_45070 5060912 5058687 gene locus_tag LOCUS_45080 5060912 5058687 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047928.1 protein_id gnl|my_center|LOCUS_45080 5061359 5063011 gene locus_tag LOCUS_45090 5061359 5063011 CDS product copper resistance CopC/CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989886.1 protein_id gnl|my_center|LOCUS_45090 5063065 5063904 gene locus_tag LOCUS_45100 5063065 5063904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 5063909 5064628 gene locus_tag LOCUS_45110 5063909 5064628 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_45110 5064795 5065436 gene locus_tag LOCUS_45120 5064795 5065436 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974977.1 protein_id gnl|my_center|LOCUS_45120 5065828 5066859 gene locus_tag LOCUS_45130 gene pheS 5065828 5066859 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 protein_id gnl|my_center|LOCUS_45130 5066876 5069320 gene locus_tag LOCUS_45140 gene pheT 5066876 5069320 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498183.1 protein_id gnl|my_center|LOCUS_45140 5069586 5073896 gene locus_tag LOCUS_45150 5069586 5073896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 5074877 5074191 gene locus_tag LOCUS_45160 5074877 5074191 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331316.1 protein_id gnl|my_center|LOCUS_45160 5075712 5075317 gene locus_tag LOCUS_45170 5075712 5075317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 5076166 5075804 gene locus_tag LOCUS_45180 5076166 5075804 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392117.1 protein_id gnl|my_center|LOCUS_45180 5076393 5078756 gene locus_tag LOCUS_45190 5076393 5078756 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_45190 5078775 5079194 gene locus_tag LOCUS_45200 5078775 5079194 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237674.1 protein_id gnl|my_center|LOCUS_45200 5079330 5079878 gene locus_tag LOCUS_45210 5079330 5079878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 5079987 5081321 gene locus_tag LOCUS_45220 5079987 5081321 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871370.1 protein_id gnl|my_center|LOCUS_45220 5081344 5082261 gene locus_tag LOCUS_45230 gene cysK 5081344 5082261 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762273.1 protein_id gnl|my_center|LOCUS_45230 5083439 5082366 gene locus_tag LOCUS_45240 gene cotH 5083439 5082366 CDS product spore coat protein CotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227854.1 protein_id gnl|my_center|LOCUS_45240 5083825 5083526 gene locus_tag LOCUS_45250 5083825 5083526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 5084235 5085023 gene locus_tag LOCUS_45260 5084235 5085023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 5085428 5086093 gene locus_tag LOCUS_45270 5085428 5086093 CDS product DUF2642 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242695.1 protein_id gnl|my_center|LOCUS_45270 5086203 5086430 gene locus_tag LOCUS_45280 5086203 5086430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 5086467 5086940 gene locus_tag LOCUS_45290 5086467 5086940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 5087099 5087590 gene locus_tag LOCUS_45300 5087099 5087590 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_45300 5087606 5088820 gene locus_tag LOCUS_45310 5087606 5088820 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_45310 5088942 5089160 gene locus_tag LOCUS_45320 5088942 5089160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 5089373 5089948 gene locus_tag LOCUS_45330 5089373 5089948 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228501.1 protein_id gnl|my_center|LOCUS_45330 5089945 5090922 gene locus_tag LOCUS_45340 5089945 5090922 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861083.1 protein_id gnl|my_center|LOCUS_45340 5090926 5091339 gene locus_tag LOCUS_45350 5090926 5091339 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222779.1 protein_id gnl|my_center|LOCUS_45350 5091362 5092567 gene locus_tag LOCUS_45360 5091362 5092567 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272338.1 protein_id gnl|my_center|LOCUS_45360 5093711 5092725 gene locus_tag LOCUS_45370 5093711 5092725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 5094619 5093759 gene locus_tag LOCUS_45380 5094619 5093759 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757073.1 protein_id gnl|my_center|LOCUS_45380 5096205 5094733 gene locus_tag LOCUS_45390 5096205 5094733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 5096436 5096633 gene locus_tag LOCUS_45400 5096436 5096633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 5096840 5098171 gene locus_tag LOCUS_45410 5096840 5098171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45410 5098204 5098557 gene locus_tag LOCUS_45420 5098204 5098557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45420 5098521 5098718 gene locus_tag LOCUS_45430 5098521 5098718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 5098678 5099658 gene locus_tag LOCUS_45440 5098678 5099658 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209809385.1 protein_id gnl|my_center|LOCUS_45440 5099743 5100753 gene locus_tag LOCUS_45450 5099743 5100753 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_45450 5100754 5101734 gene locus_tag LOCUS_45460 5100754 5101734 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_45460 5101731 5102849 gene locus_tag LOCUS_45470 5101731 5102849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 5102901 5104232 gene locus_tag LOCUS_45480 5102901 5104232 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_45480 5104612 5104247 gene locus_tag LOCUS_45490 5104612 5104247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 5104587 5105852 gene locus_tag LOCUS_45500 5104587 5105852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 5106269 5106009 gene locus_tag LOCUS_45510 5106269 5106009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 5106620 5106324 gene locus_tag LOCUS_45520 5106620 5106324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 5106864 5107886 gene locus_tag LOCUS_45530 5106864 5107886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 5108873 5107881 gene locus_tag LOCUS_45540 5108873 5107881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 5109064 5109525 gene locus_tag LOCUS_45550 5109064 5109525 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082082.1 protein_id gnl|my_center|LOCUS_45550 5109737 5110510 gene locus_tag LOCUS_45560 5109737 5110510 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 protein_id gnl|my_center|LOCUS_45560 5110545 5112047 gene locus_tag LOCUS_45570 5110545 5112047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 5112483 5113739 gene locus_tag LOCUS_45580 5112483 5113739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 5113953 5114723 gene locus_tag LOCUS_45590 gene ecsA 5113953 5114723 CDS product ABC transporter ATP-binding protein EcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292612.1 protein_id gnl|my_center|LOCUS_45590 5114707 5115951 gene locus_tag LOCUS_45600 gene ecsB 5114707 5115951 CDS product ABC transporter permease EcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245169.1 protein_id gnl|my_center|LOCUS_45600 5116687 5116166 gene locus_tag LOCUS_45610 5116687 5116166 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030124.1 protein_id gnl|my_center|LOCUS_45610 5117009 5117890 gene locus_tag LOCUS_45620 5117009 5117890 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461665.1 protein_id gnl|my_center|LOCUS_45620 5118221 5119099 gene locus_tag LOCUS_45630 5118221 5119099 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722588.1 protein_id gnl|my_center|LOCUS_45630 5119121 5119909 gene locus_tag LOCUS_45640 gene tcyL 5119121 5119909 CDS product sulfur-containing amino acid ABC transporter permease TcyL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399112.1 protein_id gnl|my_center|LOCUS_45640 5119910 5120620 gene locus_tag LOCUS_45650 5119910 5120620 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722586.1 protein_id gnl|my_center|LOCUS_45650 5120617 5121369 gene locus_tag LOCUS_45660 5120617 5121369 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722585.1 protein_id gnl|my_center|LOCUS_45660 5121401 5122429 gene locus_tag LOCUS_45670 5121401 5122429 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594067.1 protein_id gnl|my_center|LOCUS_45670 5122529 5123719 gene locus_tag LOCUS_45680 5122529 5123719 CDS product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157892.1 protein_id gnl|my_center|LOCUS_45680 5123899 5124384 gene locus_tag LOCUS_45690 5123899 5124384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 5124436 5125767 gene locus_tag LOCUS_45700 5124436 5125767 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096495.1 protein_id gnl|my_center|LOCUS_45700 5126061 5127266 gene locus_tag LOCUS_45710 5126061 5127266 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392524.1 protein_id gnl|my_center|LOCUS_45710 5128719 5127412 gene locus_tag LOCUS_45720 5128719 5127412 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_45720 5128969 5129757 gene locus_tag LOCUS_45730 5128969 5129757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 5130456 5129818 gene locus_tag LOCUS_45740 5130456 5129818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 5130588 5132084 gene locus_tag LOCUS_45750 5130588 5132084 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106262.1 protein_id gnl|my_center|LOCUS_45750 5132688 5132119 gene locus_tag LOCUS_45760 5132688 5132119 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789900.1 protein_id gnl|my_center|LOCUS_45760 5132993 5133745 gene locus_tag LOCUS_45770 5132993 5133745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 5133915 5135264 gene locus_tag LOCUS_45780 5133915 5135264 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_45780 5136131 5135343 gene locus_tag LOCUS_45790 5136131 5135343 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255010.1 protein_id gnl|my_center|LOCUS_45790 5136275 5136571 gene locus_tag LOCUS_45800 5136275 5136571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 5136680 5137831 gene locus_tag LOCUS_45810 5136680 5137831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 5138173 5139096 gene locus_tag LOCUS_45820 5138173 5139096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 5139735 5144528 gene locus_tag LOCUS_45830 5139735 5144528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 5144546 5144728 gene locus_tag LOCUS_45840 5144546 5144728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 5145209 5147002 gene locus_tag LOCUS_45850 gene ltrA 5145209 5147002 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002335621.1 protein_id gnl|my_center|LOCUS_45850 5147055 5148470 gene locus_tag LOCUS_45860 5147055 5148470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 5148646 5154957 gene locus_tag LOCUS_45870 5148646 5154957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 5155096 5156340 gene locus_tag LOCUS_45880 5155096 5156340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 5157018 5156545 gene locus_tag LOCUS_45890 5157018 5156545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 5157527 5158426 gene locus_tag LOCUS_45900 5157527 5158426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 5158560 5159588 gene locus_tag LOCUS_45910 5158560 5159588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 5159585 5160334 gene locus_tag LOCUS_45920 5159585 5160334 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965644.1 protein_id gnl|my_center|LOCUS_45920 5160362 5161084 gene locus_tag LOCUS_45930 5160362 5161084 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676164.1 protein_id gnl|my_center|LOCUS_45930 5161444 5162289 gene locus_tag LOCUS_45940 5161444 5162289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 5162332 5163666 gene locus_tag LOCUS_45950 5162332 5163666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 5163859 5164146 gene locus_tag LOCUS_45960 5163859 5164146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 5164172 5164510 gene locus_tag LOCUS_45970 5164172 5164510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 5164510 5164854 gene locus_tag LOCUS_45980 5164510 5164854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 5164826 5165098 gene locus_tag LOCUS_45990 5164826 5165098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 5166375 5165368 gene locus_tag LOCUS_46000 5166375 5165368 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401659.1 protein_id gnl|my_center|LOCUS_46000 5167119 5166595 gene locus_tag LOCUS_46010 5167119 5166595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 5167973 5167761 gene locus_tag LOCUS_46020 5167973 5167761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 5168229 5169320 gene locus_tag LOCUS_46030 5168229 5169320 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512068.1 protein_id gnl|my_center|LOCUS_46030 5169314 5170498 gene locus_tag LOCUS_46040 5169314 5170498 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678143.1 protein_id gnl|my_center|LOCUS_46040 5170685 5172217 gene locus_tag LOCUS_46050 5170685 5172217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 5172268 5173365 gene locus_tag LOCUS_46060 gene wecB 5172268 5173365 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390550.1 protein_id gnl|my_center|LOCUS_46060 5173355 5174338 gene locus_tag LOCUS_46070 5173355 5174338 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932614.1 protein_id gnl|my_center|LOCUS_46070 5174335 5175168 gene locus_tag LOCUS_46080 5174335 5175168 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992747.1 protein_id gnl|my_center|LOCUS_46080 5175165 5176187 gene locus_tag LOCUS_46090 5175165 5176187 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739077.1 protein_id gnl|my_center|LOCUS_46090 5176222 5177004 gene locus_tag LOCUS_46100 5176222 5177004 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943077.1 protein_id gnl|my_center|LOCUS_46100 5177500 5177123 gene locus_tag LOCUS_46110 5177500 5177123 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383105.1 protein_id gnl|my_center|LOCUS_46110 5178058 5179509 gene locus_tag LOCUS_46120 5178058 5179509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 5179956 5179543 gene locus_tag LOCUS_46130 5179956 5179543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 5180119 5180679 gene locus_tag LOCUS_46140 5180119 5180679 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068762.1 protein_id gnl|my_center|LOCUS_46140 5180701 5181234 gene locus_tag LOCUS_46150 5180701 5181234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 5181231 5181815 gene locus_tag LOCUS_46160 5181231 5181815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 5181834 5182292 gene locus_tag LOCUS_46170 5181834 5182292 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400458.1 protein_id gnl|my_center|LOCUS_46170 5182345 5183274 gene locus_tag LOCUS_46180 gene cysK 5182345 5183274 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_46180 5184674 5185465 gene locus_tag LOCUS_46190 5184674 5185465 CDS product lipid II flippase Amj family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018770.1 protein_id gnl|my_center|LOCUS_46190 5186430 5185714 gene locus_tag LOCUS_46200 5186430 5185714 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943077.1 protein_id gnl|my_center|LOCUS_46200 5187615 5186533 gene locus_tag LOCUS_46210 5187615 5186533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 5187846 5188976 gene locus_tag LOCUS_46220 gene egsA 5187846 5188976 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229504.1 protein_id gnl|my_center|LOCUS_46220 5189906 5189118 gene locus_tag LOCUS_46230 5189906 5189118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 5191024 5190113 gene locus_tag LOCUS_46240 5191024 5190113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 5192163 5191171 gene locus_tag LOCUS_46250 gene fabHB 5192163 5191171 CDS product beta-ketoacyl-ACP synthase III FabHB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233200.1 protein_id gnl|my_center|LOCUS_46250 5199125 5192532 gene locus_tag LOCUS_46260 5199125 5192532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 5199402 5200295 gene locus_tag LOCUS_46270 5199402 5200295 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261938.1 protein_id gnl|my_center|LOCUS_46270 5202019 5200400 gene locus_tag LOCUS_46280 5202019 5200400 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_46280 5203826 5201997 gene locus_tag LOCUS_46290 5203826 5201997 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_46290 5203906 5205327 gene locus_tag LOCUS_46300 5203906 5205327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 5205439 5207028 gene locus_tag LOCUS_46310 5205439 5207028 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_46310 5207121 5208041 gene locus_tag LOCUS_46320 5207121 5208041 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_46320 5208054 5208998 gene locus_tag LOCUS_46330 5208054 5208998 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_46330 5209108 5210115 gene locus_tag LOCUS_46340 5209108 5210115 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031699.1 protein_id gnl|my_center|LOCUS_46340 5210165 5210884 gene locus_tag LOCUS_46350 5210165 5210884 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236030.1 protein_id gnl|my_center|LOCUS_46350 5210932 5211984 gene locus_tag LOCUS_46360 5210932 5211984 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_46360 5212008 5213201 gene locus_tag LOCUS_46370 gene nagA 5212008 5213201 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582637.1 protein_id gnl|my_center|LOCUS_46370 5213222 5214085 gene locus_tag LOCUS_46380 5213222 5214085 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375206.1 protein_id gnl|my_center|LOCUS_46380 5214124 5215092 gene locus_tag LOCUS_46390 gene glcK 5214124 5215092 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_46390 5216055 5215207 gene locus_tag LOCUS_46400 5216055 5215207 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_46400 5216215 5217087 gene locus_tag LOCUS_46410 5216215 5217087 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924049.1 protein_id gnl|my_center|LOCUS_46410 5217196 5218707 gene locus_tag LOCUS_46420 5217196 5218707 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_46420 5220840 5219032 gene locus_tag LOCUS_46430 5220840 5219032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 5221100 5222011 gene locus_tag LOCUS_46440 5221100 5222011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 5222285 5224030 gene locus_tag LOCUS_46450 5222285 5224030 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730661.1 protein_id gnl|my_center|LOCUS_46450 5224099 5225052 gene locus_tag LOCUS_46460 5224099 5225052 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860738.1 protein_id gnl|my_center|LOCUS_46460 5225066 5226004 gene locus_tag LOCUS_46470 5225066 5226004 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451064.1 protein_id gnl|my_center|LOCUS_46470 5226005 5227000 gene locus_tag LOCUS_46480 5226005 5227000 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030789.1 protein_id gnl|my_center|LOCUS_46480 5226993 5227967 gene locus_tag LOCUS_46490 5226993 5227967 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294513.1 protein_id gnl|my_center|LOCUS_46490 5227976 5228449 gene locus_tag LOCUS_46500 5227976 5228449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 5229365 5228667 gene locus_tag LOCUS_46510 5229365 5228667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 5229681 5231387 gene locus_tag LOCUS_46520 5229681 5231387 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972713.1 protein_id gnl|my_center|LOCUS_46520 5231404 5232390 gene locus_tag LOCUS_46530 5231404 5232390 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230099.1 protein_id gnl|my_center|LOCUS_46530 5232406 5233269 gene locus_tag LOCUS_46540 5232406 5233269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 5233280 5234278 gene locus_tag LOCUS_46550 5233280 5234278 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706885.1 protein_id gnl|my_center|LOCUS_46550 5234247 5235077 gene locus_tag LOCUS_46560 5234247 5235077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 5235074 5236405 gene locus_tag LOCUS_46570 5235074 5236405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 5236506 5238266 gene locus_tag LOCUS_46580 5236506 5238266 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202887107.1 protein_id gnl|my_center|LOCUS_46580 5238520 5240091 gene locus_tag LOCUS_46590 5238520 5240091 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_46590 5240088 5241788 gene locus_tag LOCUS_46600 5240088 5241788 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831078.1 protein_id gnl|my_center|LOCUS_46600 5241958 5242938 gene locus_tag LOCUS_46610 5241958 5242938 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_46610 5242970 5243866 gene locus_tag LOCUS_46620 5242970 5243866 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_46620 5243922 5245586 gene locus_tag LOCUS_46630 5243922 5245586 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_46630 5245681 5248137 gene locus_tag LOCUS_46640 5245681 5248137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 5248134 5251724 gene locus_tag LOCUS_46650 5248134 5251724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 5251773 5252645 gene locus_tag LOCUS_46660 5251773 5252645 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777129.1 protein_id gnl|my_center|LOCUS_46660 5252682 5254142 gene locus_tag LOCUS_46670 5252682 5254142 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_46670 5254546 5254980 gene locus_tag LOCUS_46680 5254546 5254980 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461111.1 protein_id gnl|my_center|LOCUS_46680 5255079 5256419 gene locus_tag LOCUS_46690 gene mdrM 5255079 5256419 CDS product multidrug efflux MFS transporter MdrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926611.1 protein_id gnl|my_center|LOCUS_46690 5256600 5257433 gene locus_tag LOCUS_46700 gene kduI 5256600 5257433 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423611.1 protein_id gnl|my_center|LOCUS_46700 5257472 5258254 gene locus_tag LOCUS_46710 5257472 5258254 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286332.1 protein_id gnl|my_center|LOCUS_46710 5258244 5258993 gene locus_tag LOCUS_46720 gene kduD 5258244 5258993 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_46720 5259080 5259742 gene locus_tag LOCUS_46730 5259080 5259742 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966256.1 protein_id gnl|my_center|LOCUS_46730 5259803 5260597 gene locus_tag LOCUS_46740 5259803 5260597 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359839.1 protein_id gnl|my_center|LOCUS_46740 5262709 5260832 gene locus_tag LOCUS_46750 5262709 5260832 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583012.1 protein_id gnl|my_center|LOCUS_46750 5264444 5262693 gene locus_tag LOCUS_46760 5264444 5262693 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_46760 5264686 5266449 gene locus_tag LOCUS_46770 gene yesM 5264686 5266449 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_46770 5266446 5267249 gene locus_tag LOCUS_46780 5266446 5267249 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815859.1 protein_id gnl|my_center|LOCUS_46780 5267364 5268734 gene locus_tag LOCUS_46790 5267364 5268734 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969647.1 protein_id gnl|my_center|LOCUS_46790 5268837 5269718 gene locus_tag LOCUS_46800 5268837 5269718 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226352.1 protein_id gnl|my_center|LOCUS_46800 5269734 5270624 gene locus_tag LOCUS_46810 5269734 5270624 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228625.1 protein_id gnl|my_center|LOCUS_46810 5270675 5271673 gene locus_tag LOCUS_46820 5270675 5271673 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_46820 5271776 5272315 gene locus_tag LOCUS_46830 5271776 5272315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 5272494 5274473 gene locus_tag LOCUS_46840 5272494 5274473 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094944.1 protein_id gnl|my_center|LOCUS_46840 5276157 5275555 gene locus_tag LOCUS_46850 5276157 5275555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 5276581 5278128 gene locus_tag LOCUS_46860 5276581 5278128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 5278570 5281011 gene locus_tag LOCUS_46870 5278570 5281011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 5281183 5282370 gene locus_tag LOCUS_46880 5281183 5282370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 5282394 5282681 gene locus_tag LOCUS_46890 5282394 5282681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 5282885 5283106 gene locus_tag LOCUS_46900 5282885 5283106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 5283305 5283514 gene locus_tag LOCUS_46910 5283305 5283514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 5283511 5283807 gene locus_tag LOCUS_46920 5283511 5283807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 5283804 5284007 gene locus_tag LOCUS_46930 5283804 5284007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 5284001 5285962 gene locus_tag LOCUS_46940 5284001 5285962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827609.1 protein_id gnl|my_center|LOCUS_46940 5286412 5287440 gene locus_tag LOCUS_46950 5286412 5287440 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003019.1 protein_id gnl|my_center|LOCUS_46950 5288502 5287660 gene locus_tag LOCUS_46960 5288502 5287660 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775269.1 protein_id gnl|my_center|LOCUS_46960 5288647 5289711 gene locus_tag LOCUS_46970 5288647 5289711 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096411.1 protein_id gnl|my_center|LOCUS_46970 5289711 5290472 gene locus_tag LOCUS_46980 5289711 5290472 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121747.1 protein_id gnl|my_center|LOCUS_46980 5290742 5292418 gene locus_tag LOCUS_46990 5290742 5292418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 5293452 5292541 gene locus_tag LOCUS_47000 5293452 5292541 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263539.1 protein_id gnl|my_center|LOCUS_47000 5293562 5294476 gene locus_tag LOCUS_47010 5293562 5294476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 5294464 5294697 gene locus_tag LOCUS_47020 5294464 5294697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 5294706 5294927 gene locus_tag LOCUS_47030 gene gerE 5294706 5294927 CDS product spore germination transcription factor GerE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003184172.1 protein_id gnl|my_center|LOCUS_47030 5295558 5295088 gene locus_tag LOCUS_47040 5295558 5295088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 5295815 5295555 gene locus_tag LOCUS_47050 5295815 5295555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 5297214 5296606 gene locus_tag LOCUS_47060 5297214 5296606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 5297452 5298921 gene locus_tag LOCUS_47070 5297452 5298921 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966741.1 protein_id gnl|my_center|LOCUS_47070 5299894 5298995 gene locus_tag LOCUS_47080 gene glsA 5299894 5298995 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149861.1 protein_id gnl|my_center|LOCUS_47080 5300097 5300771 gene locus_tag LOCUS_47090 5300097 5300771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 5300961 5302709 gene locus_tag LOCUS_47100 5300961 5302709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 5302854 5304425 gene locus_tag LOCUS_47110 5302854 5304425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939120.1 protein_id gnl|my_center|LOCUS_47110 5304422 5307427 gene locus_tag LOCUS_47120 5304422 5307427 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610086.1 protein_id gnl|my_center|LOCUS_47120 5307561 5307857 gene locus_tag LOCUS_47130 5307561 5307857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 5307965 5308942 gene locus_tag LOCUS_47140 5307965 5308942 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398762.1 protein_id gnl|my_center|LOCUS_47140 5309171 5310532 gene locus_tag LOCUS_47150 5309171 5310532 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969647.1 protein_id gnl|my_center|LOCUS_47150 5310623 5311504 gene locus_tag LOCUS_47160 5310623 5311504 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256269.1 protein_id gnl|my_center|LOCUS_47160 5311504 5312394 gene locus_tag LOCUS_47170 5311504 5312394 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226209.1 protein_id gnl|my_center|LOCUS_47170 5312483 5314285 gene locus_tag LOCUS_47180 5312483 5314285 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_47180 5314291 5315982 gene locus_tag LOCUS_47190 5314291 5315982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 5316043 5317644 gene locus_tag LOCUS_47200 gene nagZ 5316043 5317644 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963506.1 protein_id gnl|my_center|LOCUS_47200 5318111 5319656 gene locus_tag LOCUS_r00370 5318111 5319656 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5319815 5319927 gene locus_tag LOCUS_r00380 5319815 5319927 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5320281 5323202 gene locus_tag LOCUS_r00390 5320281 5323202 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5323308 5323383 gene locus_tag LOCUS_t01110 5323308 5323383 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5323402 5323476 gene locus_tag LOCUS_t01120 5323402 5323476 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5323662 5324564 gene locus_tag LOCUS_47210 5323662 5324564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 5324596 5325231 gene locus_tag LOCUS_47220 5324596 5325231 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_47220 5325228 5326214 gene locus_tag LOCUS_47230 5325228 5326214 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_47230 5326214 5328700 gene locus_tag LOCUS_47240 5326214 5328700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 5331878 5328921 gene locus_tag LOCUS_47250 5331878 5328921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 5332205 5333434 gene locus_tag LOCUS_47260 5332205 5333434 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230095.1 protein_id gnl|my_center|LOCUS_47260 5333533 5334579 gene locus_tag LOCUS_47270 gene bcd 5333533 5334579 CDS product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230309.1 protein_id gnl|my_center|LOCUS_47270 5334917 5334723 gene locus_tag LOCUS_47280 5334917 5334723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 5335032 5336885 gene locus_tag LOCUS_47290 5335032 5336885 CDS product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245281.1 protein_id gnl|my_center|LOCUS_47290 5337788 5337048 gene locus_tag LOCUS_47300 5337788 5337048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 5337944 5338483 gene locus_tag LOCUS_47310 gene bstA 5337944 5338483 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999077.1 protein_id gnl|my_center|LOCUS_47310 5338970 5338512 gene locus_tag LOCUS_47320 5338970 5338512 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_47320 5339563 5338967 gene locus_tag LOCUS_47330 5339563 5338967 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540175.1 protein_id gnl|my_center|LOCUS_47330 5340026 5339868 gene locus_tag LOCUS_47340 5340026 5339868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 5340213 5340061 gene locus_tag LOCUS_47350 5340213 5340061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 5340259 5341209 gene locus_tag LOCUS_47360 5340259 5341209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 5341288 5342658 gene locus_tag LOCUS_47370 5341288 5342658 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116795.1 protein_id gnl|my_center|LOCUS_47370 5342655 5343386 gene locus_tag LOCUS_47380 5342655 5343386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 5343951 5343355 gene locus_tag LOCUS_47390 gene yfbR 5343951 5343355 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706162.1 protein_id gnl|my_center|LOCUS_47390 5344113 5345657 gene locus_tag LOCUS_47400 gene fumA 5344113 5345657 CDS product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413503.1 protein_id gnl|my_center|LOCUS_47400 5345904 5346866 gene locus_tag LOCUS_47410 5345904 5346866 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886390.1 protein_id gnl|my_center|LOCUS_47410 5346919 5348730 gene locus_tag LOCUS_47420 5346919 5348730 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_47420 5348847 5349566 gene locus_tag LOCUS_47430 5348847 5349566 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640997.1 protein_id gnl|my_center|LOCUS_47430 5349713 5350477 gene locus_tag LOCUS_47440 5349713 5350477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 5351392 5350523 gene locus_tag LOCUS_47450 5351392 5350523 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924049.1 protein_id gnl|my_center|LOCUS_47450 5351608 5352687 gene locus_tag LOCUS_47460 5351608 5352687 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_47460 5353195 5352806 gene locus_tag LOCUS_47470 5353195 5352806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 5353578 5355044 gene locus_tag LOCUS_47480 5353578 5355044 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218124.1 protein_id gnl|my_center|LOCUS_47480 5355170 5356546 gene locus_tag LOCUS_47490 5355170 5356546 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886456.1 protein_id gnl|my_center|LOCUS_47490 5356647 5357933 gene locus_tag LOCUS_47500 5356647 5357933 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461637.1 protein_id gnl|my_center|LOCUS_47500 5357923 5359305 gene locus_tag LOCUS_47510 gene gltA 5357923 5359305 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082125.1 protein_id gnl|my_center|LOCUS_47510 5359370 5360671 gene locus_tag LOCUS_47520 gene preA 5359370 5360671 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_47520 5360675 5362102 gene locus_tag LOCUS_47530 gene hydA 5360675 5362102 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_47530 5362102 5362338 gene locus_tag LOCUS_47540 5362102 5362338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 5362617 5364356 gene locus_tag LOCUS_47550 gene abc-f 5362617 5364356 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195117.1 protein_id gnl|my_center|LOCUS_47550 5364693 5366129 gene locus_tag LOCUS_47560 5364693 5366129 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993830.1 protein_id gnl|my_center|LOCUS_47560 5366308 5366766 gene locus_tag LOCUS_47570 5366308 5366766 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896616.1 protein_id gnl|my_center|LOCUS_47570 5366779 5368071 gene locus_tag LOCUS_47580 5366779 5368071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 5368426 5368109 gene locus_tag LOCUS_47590 5368426 5368109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 5368803 5369267 gene locus_tag LOCUS_47600 5368803 5369267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963451.1 protein_id gnl|my_center|LOCUS_47600 5369293 5369466 gene locus_tag LOCUS_47610 5369293 5369466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 5369987 5369553 gene locus_tag LOCUS_47620 5369987 5369553 CDS product SET domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573649.1 protein_id gnl|my_center|LOCUS_47620 5370766 5370047 gene locus_tag LOCUS_47630 5370766 5370047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 5371008 5370787 gene locus_tag LOCUS_47640 5371008 5370787 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_47640 5371465 5371010 gene locus_tag LOCUS_47650 5371465 5371010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 5371702 5372337 gene locus_tag LOCUS_47660 5371702 5372337 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183863.1 protein_id gnl|my_center|LOCUS_47660 5373889 5372525 gene locus_tag LOCUS_47670 5373889 5372525 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204707.1 protein_id gnl|my_center|LOCUS_47670 5374118 5376154 gene locus_tag LOCUS_47680 5374118 5376154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895537.1 protein_id gnl|my_center|LOCUS_47680 5376494 5376342 gene locus_tag LOCUS_47690 5376494 5376342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 5377764 5376739 gene locus_tag LOCUS_47700 5377764 5376739 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485881.1 protein_id gnl|my_center|LOCUS_47700 5379116 5377761 gene locus_tag LOCUS_47710 5379116 5377761 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381849.1 protein_id gnl|my_center|LOCUS_47710 5379306 5379172 gene locus_tag LOCUS_47720 5379306 5379172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 5379919 5379728 gene locus_tag LOCUS_47730 5379919 5379728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 5380648 5382462 gene locus_tag LOCUS_47740 5380648 5382462 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_47740 5382459 5383994 gene locus_tag LOCUS_47750 5382459 5383994 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_47750 5384170 5385417 gene locus_tag LOCUS_47760 5384170 5385417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 5385508 5386455 gene locus_tag LOCUS_47770 5385508 5386455 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229019.1 protein_id gnl|my_center|LOCUS_47770 5386460 5387284 gene locus_tag LOCUS_47780 5386460 5387284 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_47780 5387352 5389439 gene locus_tag LOCUS_47790 5387352 5389439 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057096.1 protein_id gnl|my_center|LOCUS_47790 5389453 5390157 gene locus_tag LOCUS_47800 5389453 5390157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47800 5390154 5391071 gene locus_tag LOCUS_47810 5390154 5391071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47810 5391438 5391758 gene locus_tag LOCUS_47820 5391438 5391758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 5392096 5394441 gene locus_tag LOCUS_47830 5392096 5394441 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968004.1 protein_id gnl|my_center|LOCUS_47830 5394683 5396377 gene locus_tag LOCUS_47840 5394683 5396377 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 protein_id gnl|my_center|LOCUS_47840 5396457 5397386 gene locus_tag LOCUS_47850 5396457 5397386 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_47850 5397400 5398290 gene locus_tag LOCUS_47860 5397400 5398290 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_47860 5398609 5398833 gene locus_tag LOCUS_47870 5398609 5398833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 5398718 5399080 gene locus_tag LOCUS_47880 5398718 5399080 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227446.1 protein_id gnl|my_center|LOCUS_47880 5399111 5399767 gene locus_tag LOCUS_47890 5399111 5399767 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085391.1 protein_id gnl|my_center|LOCUS_47890 5402391 5400016 gene locus_tag LOCUS_47900 5402391 5400016 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738124.1 protein_id gnl|my_center|LOCUS_47900 5402595 5403239 gene locus_tag LOCUS_47910 5402595 5403239 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865972.1 protein_id gnl|my_center|LOCUS_47910 5403236 5404636 gene locus_tag LOCUS_47920 5403236 5404636 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037272.1 protein_id gnl|my_center|LOCUS_47920 5404816 5405940 gene locus_tag LOCUS_47930 5404816 5405940 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027022.1 protein_id gnl|my_center|LOCUS_47930 5405943 5407160 gene locus_tag LOCUS_47940 5405943 5407160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 5407396 5408307 gene locus_tag LOCUS_47950 5407396 5408307 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_47950 5408321 5409193 gene locus_tag LOCUS_47960 5408321 5409193 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286008.1 protein_id gnl|my_center|LOCUS_47960 5409315 5410883 gene locus_tag LOCUS_47970 5409315 5410883 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_47970 5410959 5412203 gene locus_tag LOCUS_47980 5410959 5412203 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_47980 5412231 5413868 gene locus_tag LOCUS_47990 5412231 5413868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 5413883 5415745 gene locus_tag LOCUS_48000 5413883 5415745 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_48000 5417548 5415848 gene locus_tag LOCUS_48010 5417548 5415848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 5420873 5417646 gene locus_tag LOCUS_48020 5420873 5417646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 5421054 5422097 gene locus_tag LOCUS_48030 5421054 5422097 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803824.1 protein_id gnl|my_center|LOCUS_48030 5423443 5422376 gene locus_tag LOCUS_48040 5423443 5422376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 5424284 5423436 gene locus_tag LOCUS_48050 5424284 5423436 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436406.1 protein_id gnl|my_center|LOCUS_48050 5425417 5424236 gene locus_tag LOCUS_48060 gene alr 5425417 5424236 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390615.1 protein_id gnl|my_center|LOCUS_48060 5426499 5425423 gene locus_tag LOCUS_48070 5426499 5425423 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161413.1 protein_id gnl|my_center|LOCUS_48070 5426693 5427394 gene locus_tag LOCUS_48080 5426693 5427394 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948339.1 protein_id gnl|my_center|LOCUS_48080 5427384 5428502 gene locus_tag LOCUS_48090 5427384 5428502 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243299.1 protein_id gnl|my_center|LOCUS_48090 5429193 5428588 gene locus_tag LOCUS_48100 5429193 5428588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 5429382 5430518 gene locus_tag LOCUS_48110 5429382 5430518 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728962.1 protein_id gnl|my_center|LOCUS_48110 5430614 5431360 gene locus_tag LOCUS_48120 5430614 5431360 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966717.1 protein_id gnl|my_center|LOCUS_48120 5431365 5432774 gene locus_tag LOCUS_48130 5431365 5432774 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224359.1 protein_id gnl|my_center|LOCUS_48130 5432807 5433469 gene locus_tag LOCUS_48140 5432807 5433469 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185732.1 protein_id gnl|my_center|LOCUS_48140 5433533 5434132 gene locus_tag LOCUS_48150 5433533 5434132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 5435502 5434429 gene locus_tag LOCUS_48160 5435502 5434429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 5436565 5435486 gene locus_tag LOCUS_48170 5436565 5435486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 5437802 5436558 gene locus_tag LOCUS_48180 5437802 5436558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 5438138 5439706 gene locus_tag LOCUS_48190 5438138 5439706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 5439712 5441508 gene locus_tag LOCUS_48200 5439712 5441508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 5441511 5443049 gene locus_tag LOCUS_48210 5441511 5443049 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304851.1 protein_id gnl|my_center|LOCUS_48210 5443188 5444930 gene locus_tag LOCUS_48220 5443188 5444930 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_48220 5445021 5445989 gene locus_tag LOCUS_48230 5445021 5445989 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_48230 5446003 5446902 gene locus_tag LOCUS_48240 5446003 5446902 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_48240 5447017 5447787 gene locus_tag LOCUS_48250 5447017 5447787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 5447840 5449270 gene locus_tag LOCUS_48260 gene xynD 5447840 5449270 CDS product alpha-L-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245027.1 protein_id gnl|my_center|LOCUS_48260 5449367 5450875 gene locus_tag LOCUS_48270 5449367 5450875 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890798.1 protein_id gnl|my_center|LOCUS_48270 5450916 5451923 gene locus_tag LOCUS_48280 5450916 5451923 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583995.1 protein_id gnl|my_center|LOCUS_48280 5456089 5452085 gene locus_tag LOCUS_48290 5456089 5452085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 5456407 5457801 gene locus_tag LOCUS_48300 5456407 5457801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 5457905 5459785 gene locus_tag LOCUS_48310 5457905 5459785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 5459975 5460178 gene locus_tag LOCUS_48320 5459975 5460178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 5462561 5460396 gene locus_tag LOCUS_48330 5462561 5460396 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243548.1 protein_id gnl|my_center|LOCUS_48330 5463225 5462725 gene locus_tag LOCUS_48340 5463225 5462725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 5463659 5463246 gene locus_tag LOCUS_48350 5463659 5463246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 5464258 5463656 gene locus_tag LOCUS_48360 gene rpoE 5464258 5463656 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420724.1 protein_id gnl|my_center|LOCUS_48360 5464734 5464982 gene locus_tag LOCUS_48370 5464734 5464982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 5465185 5466228 gene locus_tag LOCUS_48380 gene cyoA 5465185 5466228 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266850.1 protein_id gnl|my_center|LOCUS_48380 5466243 5468213 gene locus_tag LOCUS_48390 gene qoxB 5466243 5468213 CDS product cytochrome aa3 quinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227407.1 protein_id gnl|my_center|LOCUS_48390 5468213 5468827 gene locus_tag LOCUS_48400 gene cyoC 5468213 5468827 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809221.1 protein_id gnl|my_center|LOCUS_48400 5468829 5469167 gene locus_tag LOCUS_48410 5468829 5469167 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208652.1 protein_id gnl|my_center|LOCUS_48410 5469665 5470726 gene locus_tag LOCUS_48420 5469665 5470726 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014237.1 protein_id gnl|my_center|LOCUS_48420 5470743 5471798 gene locus_tag LOCUS_48430 5470743 5471798 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013700.1 protein_id gnl|my_center|LOCUS_48430 5471856 5472902 gene locus_tag LOCUS_48440 gene fepG 5471856 5472902 CDS product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817186.1 protein_id gnl|my_center|LOCUS_48440 5472983 5473822 gene locus_tag LOCUS_48450 5472983 5473822 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974572.1 protein_id gnl|my_center|LOCUS_48450 5474205 5476007 gene locus_tag LOCUS_48460 5474205 5476007 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_48460 5476112 5477083 gene locus_tag LOCUS_48470 gene appB 5476112 5477083 CDS product oligopeptide ABC transporter permease AppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245828.1 protein_id gnl|my_center|LOCUS_48470 5477080 5478039 gene locus_tag LOCUS_48480 gene appC 5477080 5478039 CDS product oligopeptide ABC transporter permease AppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232961.1 protein_id gnl|my_center|LOCUS_48480 5478006 5479004 gene locus_tag LOCUS_48490 5478006 5479004 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_48490 5479001 5479978 gene locus_tag LOCUS_48500 5479001 5479978 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_48500 5479991 5480188 gene locus_tag LOCUS_48510 5479991 5480188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 5480440 5480697 gene locus_tag LOCUS_48520 5480440 5480697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 5480849 5481475 gene locus_tag LOCUS_48530 5480849 5481475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 5481538 5482215 gene locus_tag LOCUS_48540 5481538 5482215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 5482538 5482323 gene locus_tag LOCUS_48550 5482538 5482323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 5482584 5483651 gene locus_tag LOCUS_48560 5482584 5483651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 5483711 5484364 gene locus_tag LOCUS_48570 5483711 5484364 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003739396.1 protein_id gnl|my_center|LOCUS_48570 5484378 5485343 gene locus_tag LOCUS_48580 5484378 5485343 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245533.1 protein_id gnl|my_center|LOCUS_48580 5485333 5485779 gene locus_tag LOCUS_48590 5485333 5485779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 5485763 5487214 gene locus_tag LOCUS_48600 5485763 5487214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 5487446 5488279 gene locus_tag LOCUS_48610 gene uppP 5487446 5488279 CDS product bacitracin resistance undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796238.1 protein_id gnl|my_center|LOCUS_48610 5488310 5488921 gene locus_tag LOCUS_48620 5488310 5488921 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722009.1 protein_id gnl|my_center|LOCUS_48620 5489000 5489272 gene locus_tag LOCUS_48630 5489000 5489272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 5489269 5489718 gene locus_tag LOCUS_48640 5489269 5489718 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244337.1 protein_id gnl|my_center|LOCUS_48640 5489761 5490558 gene locus_tag LOCUS_48650 5489761 5490558 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528749.1 protein_id gnl|my_center|LOCUS_48650 5490571 5491515 gene locus_tag LOCUS_48660 gene sapM 5490571 5491515 CDS product phosphatidylinositol-3-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417249.1 protein_id gnl|my_center|LOCUS_48660 5491552 5492304 gene locus_tag LOCUS_48670 5491552 5492304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 5492560 5495013 gene locus_tag LOCUS_48680 gene helD 5492560 5495013 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035473.1 protein_id gnl|my_center|LOCUS_48680 5495670 5495128 gene locus_tag LOCUS_48690 5495670 5495128 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101468.1 protein_id gnl|my_center|LOCUS_48690 5495951 5497435 gene locus_tag LOCUS_48700 5495951 5497435 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233429.1 protein_id gnl|my_center|LOCUS_48700 5497695 5497507 gene locus_tag LOCUS_48710 5497695 5497507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 5497965 5497705 gene locus_tag LOCUS_48720 5497965 5497705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48720 5498125 5498700 gene locus_tag LOCUS_48730 5498125 5498700 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807841.1 protein_id gnl|my_center|LOCUS_48730 5498927 5500075 gene locus_tag LOCUS_48740 5498927 5500075 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_48740 5500106 5500756 gene locus_tag LOCUS_48750 5500106 5500756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 5501714 5500812 gene locus_tag LOCUS_48760 5501714 5500812 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264237.1 protein_id gnl|my_center|LOCUS_48760 5501865 5503001 gene locus_tag LOCUS_48770 5501865 5503001 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968003.1 protein_id gnl|my_center|LOCUS_48770 5503342 5504298 gene locus_tag LOCUS_48780 5503342 5504298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 5504516 5506837 gene locus_tag LOCUS_48790 5504516 5506837 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990068.1 protein_id gnl|my_center|LOCUS_48790 5507014 5509029 gene locus_tag LOCUS_48800 5507014 5509029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 5509441 5509941 gene locus_tag LOCUS_48810 5509441 5509941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 5510128 5511711 gene locus_tag LOCUS_48820 5510128 5511711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 5511919 5512596 gene locus_tag LOCUS_48830 5511919 5512596 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393497.1 protein_id gnl|my_center|LOCUS_48830 5512586 5514121 gene locus_tag LOCUS_48840 gene xylB 5512586 5514121 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_48840 5514168 5515991 gene locus_tag LOCUS_48850 5514168 5515991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 5515988 5516791 gene locus_tag LOCUS_48860 5515988 5516791 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582797.1 protein_id gnl|my_center|LOCUS_48860 5516788 5517426 gene locus_tag LOCUS_48870 gene gmhA 5516788 5517426 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_48870 5517423 5518394 gene locus_tag LOCUS_48880 5517423 5518394 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_48880 5518776 5520131 gene locus_tag LOCUS_48890 5518776 5520131 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286788.1 protein_id gnl|my_center|LOCUS_48890 5520245 5521186 gene locus_tag LOCUS_48900 5520245 5521186 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_48900 5521183 5522061 gene locus_tag LOCUS_48910 5521183 5522061 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_48910 5522111 5523934 gene locus_tag LOCUS_48920 5522111 5523934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 5524099 5525019 gene locus_tag LOCUS_48930 5524099 5525019 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131855.1 protein_id gnl|my_center|LOCUS_48930 5525098 5527536 gene locus_tag LOCUS_48940 5525098 5527536 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928424.1 protein_id gnl|my_center|LOCUS_48940 5527612 5528274 gene locus_tag LOCUS_48950 5527612 5528274 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390891.1 protein_id gnl|my_center|LOCUS_48950 5528262 5529587 gene locus_tag LOCUS_48960 5528262 5529587 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266421.1 protein_id gnl|my_center|LOCUS_48960 5529656 5530438 gene locus_tag LOCUS_48970 5529656 5530438 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582797.1 protein_id gnl|my_center|LOCUS_48970 5530544 5534032 gene locus_tag LOCUS_48980 5530544 5534032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 5534243 5535691 gene locus_tag LOCUS_48990 gene gerKA 5534243 5535691 CDS product spore germination protein GerKA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208313.1 protein_id gnl|my_center|LOCUS_48990 5535688 5536788 gene locus_tag LOCUS_49000 5535688 5536788 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231622.1 protein_id gnl|my_center|LOCUS_49000 5536785 5537894 gene locus_tag LOCUS_49010 gene gerKC 5536785 5537894 CDS product spore germination protein GerKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000474043.1 protein_id gnl|my_center|LOCUS_49010 5538150 5538494 gene locus_tag LOCUS_49020 5538150 5538494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 5538636 5539205 gene locus_tag LOCUS_49030 5538636 5539205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49030 5539711 5539938 gene locus_tag LOCUS_49040 5539711 5539938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 5540321 5540608 gene locus_tag LOCUS_49050 5540321 5540608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 5540754 5541164 gene locus_tag LOCUS_49060 5540754 5541164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 5541182 5541337 gene locus_tag LOCUS_49070 5541182 5541337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 5541315 5541698 gene locus_tag LOCUS_49080 5541315 5541698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 5541793 5542374 gene locus_tag LOCUS_49090 5541793 5542374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 5542542 5542952 gene locus_tag LOCUS_49100 5542542 5542952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 5542993 5543385 gene locus_tag LOCUS_49110 5542993 5543385 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_49110 5543375 5543554 gene locus_tag LOCUS_49120 5543375 5543554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 5543602 5543844 gene locus_tag LOCUS_49130 5543602 5543844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 5543847 5544479 gene locus_tag LOCUS_49140 5543847 5544479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 5544868 5544638 gene locus_tag LOCUS_49150 5544868 5544638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 5545026 5545610 gene locus_tag LOCUS_49160 5545026 5545610 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885396.1 protein_id gnl|my_center|LOCUS_49160 5545628 5546269 gene locus_tag LOCUS_49170 5545628 5546269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 5546339 5546818 gene locus_tag LOCUS_49180 5546339 5546818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 5547074 5548225 gene locus_tag LOCUS_49190 5547074 5548225 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967203.1 protein_id gnl|my_center|LOCUS_49190 5548344 5550149 gene locus_tag LOCUS_49200 5548344 5550149 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902683.1 protein_id gnl|my_center|LOCUS_49200 5550165 5551763 gene locus_tag LOCUS_49210 5550165 5551763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49210 5551834 5552412 gene locus_tag LOCUS_49220 5551834 5552412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 5552645 5553481 gene locus_tag LOCUS_49230 5552645 5553481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 5553501 5554478 gene locus_tag LOCUS_49240 5553501 5554478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 5554485 5555330 gene locus_tag LOCUS_49250 5554485 5555330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 5555345 5556364 gene locus_tag LOCUS_49260 5555345 5556364 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_49260 5556361 5557335 gene locus_tag LOCUS_49270 5556361 5557335 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_49270 5557361 5558644 gene locus_tag LOCUS_49280 5557361 5558644 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929854.1 protein_id gnl|my_center|LOCUS_49280 5558769 5559719 gene locus_tag LOCUS_49290 5558769 5559719 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_49290 5559734 5560570 gene locus_tag LOCUS_49300 5559734 5560570 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804269.1 protein_id gnl|my_center|LOCUS_49300 5560725 5562089 gene locus_tag LOCUS_49310 5560725 5562089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 5562190 5563392 gene locus_tag LOCUS_49320 5562190 5563392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 5563440 5563934 gene locus_tag LOCUS_49330 5563440 5563934 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886643.1 protein_id gnl|my_center|LOCUS_49330 5564098 5564631 gene locus_tag LOCUS_49340 5564098 5564631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 5565491 5564994 gene locus_tag LOCUS_49350 5565491 5564994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 5565836 5567446 gene locus_tag LOCUS_49360 5565836 5567446 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992452.1 protein_id gnl|my_center|LOCUS_49360 5568601 5567618 gene locus_tag LOCUS_49370 gene degA 5568601 5567618 CDS product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 protein_id gnl|my_center|LOCUS_49370 5569095 5569562 gene locus_tag LOCUS_49380 gene rpiB 5569095 5569562 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525805.1 protein_id gnl|my_center|LOCUS_49380 5569647 5570306 gene locus_tag LOCUS_49390 5569647 5570306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 5571458 5570517 gene locus_tag LOCUS_49400 5571458 5570517 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_49400 5571729 5572793 gene locus_tag LOCUS_49410 5571729 5572793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 5572925 5574028 gene locus_tag LOCUS_49420 5572925 5574028 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028107.1 protein_id gnl|my_center|LOCUS_49420 5574243 5575154 gene locus_tag LOCUS_49430 5574243 5575154 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966735.1 protein_id gnl|my_center|LOCUS_49430 5575444 5576370 gene locus_tag LOCUS_49440 5575444 5576370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 5576367 5579285 gene locus_tag LOCUS_49450 gene uvrA 5576367 5579285 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061214.1 protein_id gnl|my_center|LOCUS_49450 5579526 5580146 gene locus_tag LOCUS_49460 5579526 5580146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 5580552 5583563 gene locus_tag LOCUS_49470 5580552 5583563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 5584921 5583758 gene locus_tag LOCUS_49480 gene trpB 5584921 5583758 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937396.1 protein_id gnl|my_center|LOCUS_49480 5585153 5586349 gene locus_tag LOCUS_49490 5585153 5586349 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530504.1 protein_id gnl|my_center|LOCUS_49490 5586530 5587093 gene locus_tag LOCUS_49500 5586530 5587093 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880222.1 protein_id gnl|my_center|LOCUS_49500 5587265 5588071 gene locus_tag LOCUS_49510 5587265 5588071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 5588435 5588211 gene locus_tag LOCUS_49520 5588435 5588211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 5588610 5589014 gene locus_tag LOCUS_49530 5588610 5589014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 5589019 5589468 gene locus_tag LOCUS_49540 5589019 5589468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 5589953 5589465 gene locus_tag LOCUS_49550 5589953 5589465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 5590869 5590147 gene locus_tag LOCUS_49560 5590869 5590147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 5591151 5591696 gene locus_tag LOCUS_49570 5591151 5591696 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438330.1 protein_id gnl|my_center|LOCUS_49570 5591683 5592321 gene locus_tag LOCUS_49580 5591683 5592321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 5593059 5592424 gene locus_tag LOCUS_49590 5593059 5592424 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243016.1 protein_id gnl|my_center|LOCUS_49590 5593879 5593025 gene locus_tag LOCUS_49600 5593879 5593025 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969400.1 protein_id gnl|my_center|LOCUS_49600 5594145 5595011 gene locus_tag LOCUS_49610 5594145 5595011 CDS product phosphogluconate dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027214.1 protein_id gnl|my_center|LOCUS_49610 5595019 5596077 gene locus_tag LOCUS_49620 5595019 5596077 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398939.1 protein_id gnl|my_center|LOCUS_49620 5596677 5597933 gene locus_tag LOCUS_49630 5596677 5597933 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_49630 5598007 5599272 gene locus_tag LOCUS_49640 5598007 5599272 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_49640 5599915 5600889 gene locus_tag LOCUS_49650 gene galM 5599915 5600889 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399304.1 protein_id gnl|my_center|LOCUS_49650 5601305 5602330 gene locus_tag LOCUS_49660 5601305 5602330 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973952.1 protein_id gnl|my_center|LOCUS_49660 5602413 5603504 gene locus_tag LOCUS_49670 5602413 5603504 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061916.1 protein_id gnl|my_center|LOCUS_49670 5603504 5603821 gene locus_tag LOCUS_49680 5603504 5603821 CDS product MocE family 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975439.1 protein_id gnl|my_center|LOCUS_49680 5604093 5605724 gene locus_tag LOCUS_49690 5604093 5605724 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582720.1 protein_id gnl|my_center|LOCUS_49690 5605821 5611397 gene locus_tag LOCUS_49700 5605821 5611397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 5611475 5613253 gene locus_tag LOCUS_49710 5611475 5613253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49710 5613375 5615249 gene locus_tag LOCUS_49720 5613375 5615249 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_49720 5615221 5615622 gene locus_tag LOCUS_49730 5615221 5615622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49730 5615642 5617015 gene locus_tag LOCUS_49740 5615642 5617015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 5617195 5618505 gene locus_tag LOCUS_49750 5617195 5618505 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_49750 5618835 5623463 gene locus_tag LOCUS_49760 5618835 5623463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 5623660 5625996 gene locus_tag LOCUS_49770 5623660 5625996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 5626126 5626293 gene locus_tag LOCUS_49780 5626126 5626293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 5626268 5627188 gene locus_tag LOCUS_49790 5626268 5627188 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 protein_id gnl|my_center|LOCUS_49790 5627274 5628383 gene locus_tag LOCUS_49800 5627274 5628383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 5628480 5628773 gene locus_tag LOCUS_49810 5628480 5628773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 5628779 5629543 gene locus_tag LOCUS_49820 gene fabG 5628779 5629543 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_49820 5630082 5631536 gene locus_tag LOCUS_49830 5630082 5631536 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583933.1 protein_id gnl|my_center|LOCUS_49830 5631625 5634573 gene locus_tag LOCUS_49840 5631625 5634573 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_49840 5634570 5635502 gene locus_tag LOCUS_49850 5634570 5635502 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_49850 5635509 5636381 gene locus_tag LOCUS_49860 5635509 5636381 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_49860 5636399 5638465 gene locus_tag LOCUS_49870 5636399 5638465 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583939.1 protein_id gnl|my_center|LOCUS_49870 5638503 5641115 gene locus_tag LOCUS_49880 5638503 5641115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 5641117 5642013 gene locus_tag LOCUS_49890 5641117 5642013 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_49890 5642029 5642979 gene locus_tag LOCUS_49900 5642029 5642979 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_49900 5643064 5644224 gene locus_tag LOCUS_49910 5643064 5644224 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302559.1 protein_id gnl|my_center|LOCUS_49910 5644955 5644293 gene locus_tag LOCUS_49920 5644955 5644293 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271956.1 protein_id gnl|my_center|LOCUS_49920 5645088 5645771 gene locus_tag LOCUS_49930 gene hitR 5645088 5645771 CDS product envelope stress response regulator transcription factor HitR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612413.1 protein_id gnl|my_center|LOCUS_49930 5645764 5647155 gene locus_tag LOCUS_49940 5645764 5647155 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839519.1 protein_id gnl|my_center|LOCUS_49940 5647236 5650334 gene locus_tag LOCUS_49950 5647236 5650334 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033514.1 protein_id gnl|my_center|LOCUS_49950 5650440 5651177 gene locus_tag LOCUS_49960 5650440 5651177 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971351.1 protein_id gnl|my_center|LOCUS_49960 5652575 5651343 gene locus_tag LOCUS_49970 5652575 5651343 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137547.1 protein_id gnl|my_center|LOCUS_49970 5652844 5654370 gene locus_tag LOCUS_49980 gene gerKA 5652844 5654370 CDS product spore germination protein GerKA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246515.1 protein_id gnl|my_center|LOCUS_49980 5654424 5655629 gene locus_tag LOCUS_49990 5654424 5655629 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461855.1 protein_id gnl|my_center|LOCUS_49990 5655631 5655858 gene locus_tag LOCUS_50000 5655631 5655858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 5655884 5657023 gene locus_tag LOCUS_50010 5655884 5657023 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392970.1 protein_id gnl|my_center|LOCUS_50010 5658489 5657626 gene locus_tag LOCUS_50020 5658489 5657626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 5658647 5659474 gene locus_tag LOCUS_50030 5658647 5659474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 5660924 5659686 gene locus_tag LOCUS_50040 5660924 5659686 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817233.1 protein_id gnl|my_center|LOCUS_50040 5661114 5661692 gene locus_tag LOCUS_50050 5661114 5661692 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974671.1 protein_id gnl|my_center|LOCUS_50050 5663129 5661828 gene locus_tag LOCUS_50060 5663129 5661828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 5663434 5665056 gene locus_tag LOCUS_50070 5663434 5665056 CDS product DUF4038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922209.1 protein_id gnl|my_center|LOCUS_50070 5665509 5665135 gene locus_tag LOCUS_50080 5665509 5665135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 5667990 5665537 gene locus_tag LOCUS_50090 5667990 5665537 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144184.1 protein_id gnl|my_center|LOCUS_50090 5668247 5669278 gene locus_tag LOCUS_50100 5668247 5669278 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_50100 5669442 5671814 gene locus_tag LOCUS_50110 5669442 5671814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 5671841 5672800 gene locus_tag LOCUS_50120 5671841 5672800 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289657.1 protein_id gnl|my_center|LOCUS_50120 5672831 5673703 gene locus_tag LOCUS_50130 5672831 5673703 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_50130 5673848 5675374 gene locus_tag LOCUS_50140 5673848 5675374 CDS product DUF3502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161603547.1 protein_id gnl|my_center|LOCUS_50140 5675551 5677737 gene locus_tag LOCUS_50150 5675551 5677737 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929205.1 protein_id gnl|my_center|LOCUS_50150 5677734 5679542 gene locus_tag LOCUS_50160 5677734 5679542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 5679611 5679952 gene locus_tag LOCUS_50170 5679611 5679952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 5680020 5681048 gene locus_tag LOCUS_50180 5680020 5681048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50180 5681283 5681501 gene locus_tag LOCUS_50190 5681283 5681501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 5681553 5682044 gene locus_tag LOCUS_50200 5681553 5682044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 5682074 5683042 gene locus_tag LOCUS_50210 5682074 5683042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 5683180 5683449 gene locus_tag LOCUS_50220 5683180 5683449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 5683705 5684097 gene locus_tag LOCUS_50230 5683705 5684097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 5684128 5684664 gene locus_tag LOCUS_50240 gene tmrB 5684128 5684664 CDS product tunicamycin resistance ATP-binding TmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246258.1 protein_id gnl|my_center|LOCUS_50240 5684713 5685219 gene locus_tag LOCUS_50250 5684713 5685219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 5685395 5686345 gene locus_tag LOCUS_50260 5685395 5686345 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573809.1 protein_id gnl|my_center|LOCUS_50260 5686342 5687187 gene locus_tag LOCUS_50270 5686342 5687187 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963750.1 protein_id gnl|my_center|LOCUS_50270 5687324 5688775 gene locus_tag LOCUS_50280 5687324 5688775 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963751.1 protein_id gnl|my_center|LOCUS_50280 5689233 5690102 gene locus_tag LOCUS_50290 5689233 5690102 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615409.1 protein_id gnl|my_center|LOCUS_50290 5690613 5690822 gene locus_tag LOCUS_50300 5690613 5690822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 5690859 5691395 gene locus_tag LOCUS_50310 5690859 5691395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 5691489 5691653 gene locus_tag LOCUS_50320 5691489 5691653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 5692362 5692619 gene locus_tag LOCUS_50330 5692362 5692619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 5692750 5693232 gene locus_tag LOCUS_50340 5692750 5693232 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989708.1 protein_id gnl|my_center|LOCUS_50340 5693669 5693241 gene locus_tag LOCUS_50350 5693669 5693241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 5693853 5694863 gene locus_tag LOCUS_50360 5693853 5694863 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089280.1 protein_id gnl|my_center|LOCUS_50360 5694887 5695312 gene locus_tag LOCUS_50370 5694887 5695312 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886646.1 protein_id gnl|my_center|LOCUS_50370 5695395 5696234 gene locus_tag LOCUS_50380 5695395 5696234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 5696466 5697101 gene locus_tag LOCUS_50390 5696466 5697101 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964173.1 protein_id gnl|my_center|LOCUS_50390 5697353 5698141 gene locus_tag LOCUS_50400 5697353 5698141 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948538.1 protein_id gnl|my_center|LOCUS_50400 5698827 5698192 gene locus_tag LOCUS_50410 5698827 5698192 CDS product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948988.1 protein_id gnl|my_center|LOCUS_50410 5699773 5698982 gene locus_tag LOCUS_50420 5699773 5698982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 5700617 5699805 gene locus_tag LOCUS_50430 5700617 5699805 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775994.1 protein_id gnl|my_center|LOCUS_50430 5701266 5702447 gene locus_tag LOCUS_50440 5701266 5702447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 5703463 5702876 gene locus_tag LOCUS_50450 5703463 5702876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 5703832 5704290 gene locus_tag LOCUS_50460 5703832 5704290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 5704756 5705697 gene locus_tag LOCUS_50470 5704756 5705697 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813143.1 protein_id gnl|my_center|LOCUS_50470 5707988 5705718 gene locus_tag LOCUS_50480 gene metE 5707988 5705718 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864555.1 protein_id gnl|my_center|LOCUS_50480 5708171 5708797 gene locus_tag LOCUS_50490 5708171 5708797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 5708983 5709249 gene locus_tag LOCUS_50500 5708983 5709249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50500 5709438 5709833 gene locus_tag LOCUS_50510 5709438 5709833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 5710099 5710284 gene locus_tag LOCUS_50520 5710099 5710284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 5710508 5710648 gene locus_tag LOCUS_50530 5710508 5710648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50530 5710797 5711216 gene locus_tag LOCUS_50540 5710797 5711216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090913.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50540 5711391 5712272 gene locus_tag LOCUS_50550 5711391 5712272 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731865.1 protein_id gnl|my_center|LOCUS_50550 5712433 5713440 gene locus_tag LOCUS_50560 5712433 5713440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50560 5713473 5714162 gene locus_tag LOCUS_50570 5713473 5714162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 5714374 5714967 gene locus_tag LOCUS_50580 gene hisB 5714374 5714967 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209295.1 protein_id gnl|my_center|LOCUS_50580 5715052 5715516 gene locus_tag LOCUS_50590 5715052 5715516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 5715703 5716230 gene locus_tag LOCUS_50600 5715703 5716230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 5716422 5717072 gene locus_tag LOCUS_50610 5716422 5717072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 5717129 5717407 gene locus_tag LOCUS_50620 5717129 5717407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 5717539 5717886 gene locus_tag LOCUS_50630 5717539 5717886 CDS product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965849.1 protein_id gnl|my_center|LOCUS_50630 5717966 5718754 gene locus_tag LOCUS_50640 5717966 5718754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 5719444 5719695 gene locus_tag LOCUS_50650 5719444 5719695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50650 5719927 5720280 gene locus_tag LOCUS_50660 5719927 5720280 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528790.1 protein_id gnl|my_center|LOCUS_50660 5720887 5720528 gene locus_tag LOCUS_50670 5720887 5720528 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476381.1 protein_id gnl|my_center|LOCUS_50670 5721016 5721654 gene locus_tag LOCUS_50680 gene azoRB 5721016 5721654 CDS product FMN-dependent NADH-azoreductase AzoRB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243587.1 protein_id gnl|my_center|LOCUS_50680 5721764 5721943 gene locus_tag LOCUS_50690 5721764 5721943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 5722838 5722092 gene locus_tag LOCUS_50700 5722838 5722092 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705454.1 protein_id gnl|my_center|LOCUS_50700 5723152 5723946 gene locus_tag LOCUS_50710 5723152 5723946 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990045.1 protein_id gnl|my_center|LOCUS_50710 5723991 5724701 gene locus_tag LOCUS_50720 5723991 5724701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 5724848 5725795 gene locus_tag LOCUS_50730 5724848 5725795 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082266.1 protein_id gnl|my_center|LOCUS_50730 5725922 5726326 gene locus_tag LOCUS_50740 5725922 5726326 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974464.1 protein_id gnl|my_center|LOCUS_50740 5726734 5727165 gene locus_tag LOCUS_50750 5726734 5727165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 5727243 5727908 gene locus_tag LOCUS_50760 5727243 5727908 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461502.1 protein_id gnl|my_center|LOCUS_50760 5728020 5728697 gene locus_tag LOCUS_50770 5728020 5728697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50770 5728749 5729990 gene locus_tag LOCUS_50780 5728749 5729990 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224293.1 protein_id gnl|my_center|LOCUS_50780 5730149 5730589 gene locus_tag LOCUS_50790 5730149 5730589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 5730708 5730956 gene locus_tag LOCUS_50800 5730708 5730956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 5731031 5731453 gene locus_tag LOCUS_50810 5731031 5731453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 5732207 5731725 gene locus_tag LOCUS_50820 5732207 5731725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 5732375 5733400 gene locus_tag LOCUS_50830 5732375 5733400 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003019.1 protein_id gnl|my_center|LOCUS_50830 5733427 5734641 gene locus_tag LOCUS_50840 5733427 5734641 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777113.1 protein_id gnl|my_center|LOCUS_50840 5734688 5735080 gene locus_tag LOCUS_50850 5734688 5735080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 5735480 5735133 gene locus_tag LOCUS_50860 5735480 5735133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 5737031 5736054 gene locus_tag LOCUS_50870 5737031 5736054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 5737503 5738927 gene locus_tag LOCUS_50880 5737503 5738927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 5739208 5739684 gene locus_tag LOCUS_50890 5739208 5739684 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401930.1 protein_id gnl|my_center|LOCUS_50890 5739674 5740783 gene locus_tag LOCUS_50900 5739674 5740783 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886459.1 protein_id gnl|my_center|LOCUS_50900 5740804 5741337 gene locus_tag LOCUS_50910 5740804 5741337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 5741430 5742473 gene locus_tag LOCUS_50920 5741430 5742473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 5742633 5743544 gene locus_tag LOCUS_50930 5742633 5743544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 5743569 5744039 gene locus_tag LOCUS_50940 5743569 5744039 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615134.1 protein_id gnl|my_center|LOCUS_50940 5745472 5744204 gene locus_tag LOCUS_50950 5745472 5744204 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906398.1 protein_id gnl|my_center|LOCUS_50950 5745738 5746493 gene locus_tag LOCUS_50960 5745738 5746493 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245137.1 protein_id gnl|my_center|LOCUS_50960 5746477 5747538 gene locus_tag LOCUS_50970 5746477 5747538 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223438.1 protein_id gnl|my_center|LOCUS_50970 5747552 5747968 gene locus_tag LOCUS_50980 5747552 5747968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 5748108 5749787 gene locus_tag LOCUS_50990 5748108 5749787 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488138.1 protein_id gnl|my_center|LOCUS_50990 5749822 5750484 gene locus_tag LOCUS_51000 5749822 5750484 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695789.1 protein_id gnl|my_center|LOCUS_51000 5750738 5750556 gene locus_tag LOCUS_51010 5750738 5750556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 5750936 5751226 gene locus_tag LOCUS_51020 5750936 5751226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 5751417 5753486 gene locus_tag LOCUS_51030 5751417 5753486 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 protein_id gnl|my_center|LOCUS_51030 5753535 5753909 gene locus_tag LOCUS_51040 5753535 5753909 CDS product sensory rhodopsin transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582807.1 protein_id gnl|my_center|LOCUS_51040 5753923 5755212 gene locus_tag LOCUS_51050 gene rhaA 5753923 5755212 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387675.1 protein_id gnl|my_center|LOCUS_51050 5755345 5756817 gene locus_tag LOCUS_51060 5755345 5756817 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_51060 5756849 5757613 gene locus_tag LOCUS_51070 gene rhaR 5756849 5757613 CDS product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 protein_id gnl|my_center|LOCUS_51070 5758663 5757809 gene locus_tag LOCUS_51080 5758663 5757809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51080 5759954 5760694 gene locus_tag LOCUS_51090 5759954 5760694 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812756.1 protein_id gnl|my_center|LOCUS_51090 5760691 5762220 gene locus_tag LOCUS_51100 5760691 5762220 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460058.1 protein_id gnl|my_center|LOCUS_51100 5762213 5762944 gene locus_tag LOCUS_51110 5762213 5762944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 5762995 5763702 gene locus_tag LOCUS_51120 5762995 5763702 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594439.1 protein_id gnl|my_center|LOCUS_51120 5764553 5767315 gene locus_tag LOCUS_51130 5764553 5767315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51130 5767486 5768940 gene locus_tag LOCUS_51140 gene cls 5767486 5768940 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243311.1 protein_id gnl|my_center|LOCUS_51140 5768976 5769653 gene locus_tag LOCUS_51150 gene ywaC 5768976 5769653 CDS product GTP pyrophosphokinase YwaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244564.1 protein_id gnl|my_center|LOCUS_51150 5770627 5769776 gene locus_tag LOCUS_51160 5770627 5769776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51160 5770836 5772869 gene locus_tag LOCUS_51170 5770836 5772869 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582883.1 protein_id gnl|my_center|LOCUS_51170 5774193 5773306 gene locus_tag LOCUS_51180 5774193 5773306 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_51180 5774328 5776658 gene locus_tag LOCUS_51190 gene yicI 5774328 5776658 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582725.1 protein_id gnl|my_center|LOCUS_51190 5777696 5778676 gene locus_tag LOCUS_51200 5777696 5778676 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_51200 5778692 5779591 gene locus_tag LOCUS_51210 5778692 5779591 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_51210 5779745 5781478 gene locus_tag LOCUS_51220 5779745 5781478 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_51220 5781640 5783469 gene locus_tag LOCUS_51230 5781640 5783469 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_51230 5783444 5785192 gene locus_tag LOCUS_51240 5783444 5785192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51240 5785475 5785804 gene locus_tag LOCUS_51250 gene csaA 5785475 5785804 CDS product chaperone CsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399582.1 protein_id gnl|my_center|LOCUS_51250 5786786 5785983 gene locus_tag LOCUS_51260 5786786 5785983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 5787180 5787671 gene locus_tag LOCUS_51270 5787180 5787671 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110618.1 protein_id gnl|my_center|LOCUS_51270 5788888 5787782 gene locus_tag LOCUS_51280 5788888 5787782 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_51280 5792389 5789261 gene locus_tag LOCUS_51290 5792389 5789261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 5792355 5792639 gene locus_tag LOCUS_51300 5792355 5792639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 5794141 5792762 gene locus_tag LOCUS_51310 5794141 5792762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 5795045 5794164 gene locus_tag LOCUS_51320 5795045 5794164 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_51320 5795963 5795058 gene locus_tag LOCUS_51330 5795963 5795058 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161668.1 protein_id gnl|my_center|LOCUS_51330 5797297 5796002 gene locus_tag LOCUS_51340 5797297 5796002 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989563.1 protein_id gnl|my_center|LOCUS_51340 5797601 5798737 gene locus_tag LOCUS_51350 5797601 5798737 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302559.1 protein_id gnl|my_center|LOCUS_51350 5799017 5802568 gene locus_tag LOCUS_51360 5799017 5802568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 5802730 5803794 gene locus_tag LOCUS_51370 5802730 5803794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 5803791 5804867 gene locus_tag LOCUS_51380 5803791 5804867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51380 5805404 5806489 gene locus_tag LOCUS_51390 gene asd 5805404 5806489 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_51390 5806719 5808287 gene locus_tag LOCUS_51400 5806719 5808287 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948835.1 protein_id gnl|my_center|LOCUS_51400 5808511 5808347 gene locus_tag LOCUS_51410 5808511 5808347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 5808766 5810052 gene locus_tag LOCUS_51420 gene tyrS 5808766 5810052 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512096.1 protein_id gnl|my_center|LOCUS_51420 5810867 5810154 gene locus_tag LOCUS_51430 5810867 5810154 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388698.1 protein_id gnl|my_center|LOCUS_51430 5811029 5811979 gene locus_tag LOCUS_51440 5811029 5811979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 5813391 5812060 gene locus_tag LOCUS_51450 5813391 5812060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 5813496 5813972 gene locus_tag LOCUS_51460 5813496 5813972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51460 5813983 5814153 gene locus_tag LOCUS_51470 5813983 5814153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 5815222 5814332 gene locus_tag LOCUS_51480 5815222 5814332 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102276.1 protein_id gnl|my_center|LOCUS_51480 5815331 5816113 gene locus_tag LOCUS_51490 gene nat 5815331 5816113 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419364.1 protein_id gnl|my_center|LOCUS_51490 5816825 5816220 gene locus_tag LOCUS_51500 5816825 5816220 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434857.1 protein_id gnl|my_center|LOCUS_51500 5816969 5817955 gene locus_tag LOCUS_51510 5816969 5817955 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_51510 5817973 5818905 gene locus_tag LOCUS_51520 5817973 5818905 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732378.1 protein_id gnl|my_center|LOCUS_51520 5818881 5819684 gene locus_tag LOCUS_51530 5818881 5819684 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966200.1 protein_id gnl|my_center|LOCUS_51530 5819973 5820965 gene locus_tag LOCUS_51540 5819973 5820965 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964016.1 protein_id gnl|my_center|LOCUS_51540 5821635 5821099 gene locus_tag LOCUS_51550 5821635 5821099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 5822642 5821761 gene locus_tag LOCUS_51560 5822642 5821761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 5822796 5823728 gene locus_tag LOCUS_51570 5822796 5823728 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973777.1 protein_id gnl|my_center|LOCUS_51570 5823782 5824795 gene locus_tag LOCUS_51580 5823782 5824795 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975879.1 protein_id gnl|my_center|LOCUS_51580 5825444 5826463 gene locus_tag LOCUS_51590 5825444 5826463 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_51590 5826476 5827393 gene locus_tag LOCUS_51600 gene rbsK 5826476 5827393 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246357.1 protein_id gnl|my_center|LOCUS_51600 5827543 5829054 gene locus_tag LOCUS_51610 gene rbsA 5827543 5829054 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262035.1 protein_id gnl|my_center|LOCUS_51610 5829051 5830013 gene locus_tag LOCUS_51620 5829051 5830013 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582805.1 protein_id gnl|my_center|LOCUS_51620 5830010 5830954 gene locus_tag LOCUS_51630 5830010 5830954 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074641.1 protein_id gnl|my_center|LOCUS_51630 5830960 5831997 gene locus_tag LOCUS_51640 5830960 5831997 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210043.1 protein_id gnl|my_center|LOCUS_51640 5832023 5832532 gene locus_tag LOCUS_51650 5832023 5832532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 5832572 5833882 gene locus_tag LOCUS_51660 5832572 5833882 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436698.1 protein_id gnl|my_center|LOCUS_51660 5833941 5834681 gene locus_tag LOCUS_51670 5833941 5834681 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697190.1 protein_id gnl|my_center|LOCUS_51670 5836812 5834806 gene locus_tag LOCUS_51680 5836812 5834806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 5838074 5836884 gene locus_tag LOCUS_51690 5838074 5836884 CDS product CBU_0270 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957471.1 protein_id gnl|my_center|LOCUS_51690 5838862 5838251 gene locus_tag LOCUS_51700 5838862 5838251 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949054.1 protein_id gnl|my_center|LOCUS_51700 5839493 5838882 gene locus_tag LOCUS_51710 5839493 5838882 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975477.1 protein_id gnl|my_center|LOCUS_51710 5840440 5839493 gene locus_tag LOCUS_51720 5840440 5839493 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234172.1 protein_id gnl|my_center|LOCUS_51720 5840954 5840568 gene locus_tag LOCUS_51730 5840954 5840568 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968618.1 protein_id gnl|my_center|LOCUS_51730 5841917 5841426 gene locus_tag LOCUS_51740 5841917 5841426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 5842936 5841914 gene locus_tag LOCUS_51750 5842936 5841914 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_51750 5844488 5843082 gene locus_tag LOCUS_51760 5844488 5843082 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_51760 5845223 5844537 gene locus_tag LOCUS_51770 5845223 5844537 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943647.1 protein_id gnl|my_center|LOCUS_51770 5847132 5845327 gene locus_tag LOCUS_51780 5847132 5845327 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715399.1 protein_id gnl|my_center|LOCUS_51780 5847821 5847147 gene locus_tag LOCUS_51790 5847821 5847147 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041856.1 protein_id gnl|my_center|LOCUS_51790 5847967 5848269 gene locus_tag LOCUS_51800 5847967 5848269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 5849425 5848427 gene locus_tag LOCUS_51810 5849425 5848427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51810 5850417 5849518 gene locus_tag LOCUS_51820 5850417 5849518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 5850751 5851560 gene locus_tag LOCUS_51830 5850751 5851560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 5851742 5852500 gene locus_tag LOCUS_51840 gene xynR 5851742 5852500 CDS product DNA-binding transcriptional repressor XynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095377.1 protein_id gnl|my_center|LOCUS_51840 5852519 5853292 gene locus_tag LOCUS_51850 5852519 5853292 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_51850 5853389 5854297 gene locus_tag LOCUS_51860 5853389 5854297 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922304.1 protein_id gnl|my_center|LOCUS_51860 5854294 5855145 gene locus_tag LOCUS_51870 5854294 5855145 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201854.1 protein_id gnl|my_center|LOCUS_51870 5855382 5856053 gene locus_tag LOCUS_51880 5855382 5856053 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223522.1 protein_id gnl|my_center|LOCUS_51880 5856037 5857569 gene locus_tag LOCUS_51890 5856037 5857569 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229620.1 protein_id gnl|my_center|LOCUS_51890 5859040 5858729 gene locus_tag LOCUS_51900 5859040 5858729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 5859306 5860709 gene locus_tag LOCUS_51910 5859306 5860709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 5860783 5861643 gene locus_tag LOCUS_51920 5860783 5861643 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643949.1 protein_id gnl|my_center|LOCUS_51920 5861762 5862727 gene locus_tag LOCUS_51930 gene pstC 5861762 5862727 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394571.1 protein_id gnl|my_center|LOCUS_51930 5862724 5863623 gene locus_tag LOCUS_51940 gene pstA 5862724 5863623 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994147.1 protein_id gnl|my_center|LOCUS_51940 5863765 5864958 gene locus_tag LOCUS_51950 5863765 5864958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 5865103 5865873 gene locus_tag LOCUS_51960 gene pstB 5865103 5865873 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536449.1 protein_id gnl|my_center|LOCUS_51960 5865908 5866570 gene locus_tag LOCUS_51970 gene phoU 5865908 5866570 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461595.1 protein_id gnl|my_center|LOCUS_51970 5867539 5866643 gene locus_tag LOCUS_51980 5867539 5866643 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050612.1 protein_id gnl|my_center|LOCUS_51980 5867728 5868672 gene locus_tag LOCUS_51990 5867728 5868672 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167205.1 protein_id gnl|my_center|LOCUS_51990 5868778 5869722 gene locus_tag LOCUS_52000 gene pstC 5868778 5869722 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398935.1 protein_id gnl|my_center|LOCUS_52000 5869719 5870606 gene locus_tag LOCUS_52010 gene pstA 5869719 5870606 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722630.1 protein_id gnl|my_center|LOCUS_52010 5870623 5871381 gene locus_tag LOCUS_52020 gene pstB 5870623 5871381 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_52020 5871402 5872061 gene locus_tag LOCUS_52030 gene phoU 5871402 5872061 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_52030 5872224 5873810 gene locus_tag LOCUS_52040 5872224 5873810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52040 5873807 5874979 gene locus_tag LOCUS_52050 5873807 5874979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 5875144 5877807 gene locus_tag LOCUS_52060 gene polA 5875144 5877807 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398870.1 protein_id gnl|my_center|LOCUS_52060 5877873 5878757 gene locus_tag LOCUS_52070 gene mutM 5877873 5878757 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114480.1 protein_id gnl|my_center|LOCUS_52070 5878855 5879562 gene locus_tag LOCUS_52080 gene ytaF 5878855 5879562 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229449.1 protein_id gnl|my_center|LOCUS_52080 5879680 5880276 gene locus_tag LOCUS_52090 gene coaE 5879680 5880276 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387006.1 protein_id gnl|my_center|LOCUS_52090 5880273 5880851 gene locus_tag LOCUS_52100 5880273 5880851 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393337.1 protein_id gnl|my_center|LOCUS_52100 5881136 5880921 gene locus_tag LOCUS_52110 gene sasP 5881136 5880921 CDS product small acid-soluble spore protein, SasP family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013338.1 protein_id gnl|my_center|LOCUS_52110 5881272 5881736 gene locus_tag LOCUS_52120 gene nrdR 5881272 5881736 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_52120 5881960 5882976 gene locus_tag LOCUS_52130 5881960 5882976 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 protein_id gnl|my_center|LOCUS_52130 5883187 5883262 gene locus_tag LOCUS_t01130 5883187 5883262 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5883374 5883601 gene locus_tag LOCUS_52140 5883374 5883601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 5883824 5885548 gene locus_tag LOCUS_52150 5883824 5885548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52150 5885545 5887125 gene locus_tag LOCUS_52160 5885545 5887125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 5887374 5888894 gene locus_tag LOCUS_52170 5887374 5888894 CDS product DUF3502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161603547.1 protein_id gnl|my_center|LOCUS_52170 5889020 5889862 gene locus_tag LOCUS_52180 5889020 5889862 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_52180 5889883 5890770 gene locus_tag LOCUS_52190 5889883 5890770 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_52190 5891087 5892262 gene locus_tag LOCUS_52200 5891087 5892262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52200 5892483 5898524 gene locus_tag LOCUS_52210 5892483 5898524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52210 5898636 5899136 gene locus_tag LOCUS_52220 5898636 5899136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52220 5899154 5900440 gene locus_tag LOCUS_52230 5899154 5900440 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356675.1 protein_id gnl|my_center|LOCUS_52230 5900630 5901709 gene locus_tag LOCUS_52240 5900630 5901709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52240 5901798 5902388 gene locus_tag LOCUS_52250 5901798 5902388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 5902657 5903094 gene locus_tag LOCUS_52260 5902657 5903094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 5903091 5903792 gene locus_tag LOCUS_52270 5903091 5903792 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446319.1 protein_id gnl|my_center|LOCUS_52270 5903875 5904141 gene locus_tag LOCUS_52280 5903875 5904141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 5904638 5907190 gene locus_tag LOCUS_52290 5904638 5907190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52290 5908874 5907525 gene locus_tag LOCUS_52300 5908874 5907525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 5909690 5909460 gene locus_tag LOCUS_52310 5909690 5909460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 5909683 5911113 gene locus_tag LOCUS_52320 5909683 5911113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 5911372 5912286 gene locus_tag LOCUS_52330 5911372 5912286 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529475.1 protein_id gnl|my_center|LOCUS_52330 5912388 5912837 gene locus_tag LOCUS_52340 5912388 5912837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 5912922 5913122 gene locus_tag LOCUS_52350 5912922 5913122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 5913140 5913733 gene locus_tag LOCUS_52360 5913140 5913733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 5913730 5914827 gene locus_tag LOCUS_52370 5913730 5914827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52370 5915819 5914965 gene locus_tag LOCUS_52380 5915819 5914965 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_52380 5916748 5915819 gene locus_tag LOCUS_52390 5916748 5915819 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257155.1 protein_id gnl|my_center|LOCUS_52390 5918122 5916800 gene locus_tag LOCUS_52400 5918122 5916800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52400 5918337 5919284 gene locus_tag LOCUS_52410 5918337 5919284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428935.1 protein_id gnl|my_center|LOCUS_52410 5920260 5919286 gene locus_tag LOCUS_52420 5920260 5919286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52420 5920663 5921559 gene locus_tag LOCUS_52430 5920663 5921559 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337842.1 protein_id gnl|my_center|LOCUS_52430 5921602 5922522 gene locus_tag LOCUS_52440 5921602 5922522 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_52440 5922556 5923476 gene locus_tag LOCUS_52450 5922556 5923476 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_52450 5923528 5925120 gene locus_tag LOCUS_52460 5923528 5925120 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002995654.1 protein_id gnl|my_center|LOCUS_52460 5927052 5925235 gene locus_tag LOCUS_52470 5927052 5925235 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_52470 5928629 5927049 gene locus_tag LOCUS_52480 5928629 5927049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 5928769 5929476 gene locus_tag LOCUS_52490 5928769 5929476 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346313.1 protein_id gnl|my_center|LOCUS_52490 5930164 5929646 gene locus_tag LOCUS_52500 5930164 5929646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 5930876 5930187 gene locus_tag LOCUS_52510 5930876 5930187 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195828.1 protein_id gnl|my_center|LOCUS_52510 5932378 5930873 gene locus_tag LOCUS_52520 5932378 5930873 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963640.1 protein_id gnl|my_center|LOCUS_52520 5932630 5933283 gene locus_tag LOCUS_52530 5932630 5933283 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233736.1 protein_id gnl|my_center|LOCUS_52530 5933561 5935624 gene locus_tag LOCUS_52540 5933561 5935624 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812357.1 protein_id gnl|my_center|LOCUS_52540 5935744 5935905 gene locus_tag LOCUS_52550 5935744 5935905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 5936340 5936089 gene locus_tag LOCUS_52560 5936340 5936089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 5936517 5937545 gene locus_tag LOCUS_52570 5936517 5937545 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 protein_id gnl|my_center|LOCUS_52570 5937542 5938357 gene locus_tag LOCUS_52580 5937542 5938357 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975109.1 protein_id gnl|my_center|LOCUS_52580 5941235 5938446 gene locus_tag LOCUS_52590 5941235 5938446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 5943086 5941272 gene locus_tag LOCUS_52600 5943086 5941272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 5943683 5944681 gene locus_tag LOCUS_52610 5943683 5944681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 5944884 5945342 gene locus_tag LOCUS_52620 5944884 5945342 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245144.1 protein_id gnl|my_center|LOCUS_52620 5947226 5945502 gene locus_tag LOCUS_52630 5947226 5945502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 5947465 5948196 gene locus_tag LOCUS_52640 5947465 5948196 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722576.1 protein_id gnl|my_center|LOCUS_52640 5948421 5950277 gene locus_tag LOCUS_52650 5948421 5950277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 5950378 5951541 gene locus_tag LOCUS_52660 5950378 5951541 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287753.1 protein_id gnl|my_center|LOCUS_52660 5951635 5952393 gene locus_tag LOCUS_52670 5951635 5952393 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_52670 5953464 5952592 gene locus_tag LOCUS_52680 5953464 5952592 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434154.1 protein_id gnl|my_center|LOCUS_52680 5953623 5955104 gene locus_tag LOCUS_52690 5953623 5955104 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245710.1 protein_id gnl|my_center|LOCUS_52690 5955172 5956185 gene locus_tag LOCUS_52700 5955172 5956185 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972587.1 protein_id gnl|my_center|LOCUS_52700 5956353 5956985 gene locus_tag LOCUS_52710 5956353 5956985 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287296.1 protein_id gnl|my_center|LOCUS_52710 5957107 5957529 gene locus_tag LOCUS_52720 5957107 5957529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 5958555 5957605 gene locus_tag LOCUS_52730 5958555 5957605 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233421.1 protein_id gnl|my_center|LOCUS_52730 5959468 5958548 gene locus_tag LOCUS_52740 5959468 5958548 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245448.1 protein_id gnl|my_center|LOCUS_52740 5961118 5960240 gene locus_tag LOCUS_52750 5961118 5960240 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948557.1 protein_id gnl|my_center|LOCUS_52750 5961245 5962771 gene locus_tag LOCUS_52760 gene zwf 5961245 5962771 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445335.1 protein_id gnl|my_center|LOCUS_52760 5962749 5964743 gene locus_tag LOCUS_52770 gene tkt 5962749 5964743 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193030.1 protein_id gnl|my_center|LOCUS_52770 5964780 5965445 gene locus_tag LOCUS_52780 gene fsa 5964780 5965445 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210267.1 protein_id gnl|my_center|LOCUS_52780 5965570 5966985 gene locus_tag LOCUS_52790 gene gndA 5965570 5966985 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_52790 5967201 5968664 gene locus_tag LOCUS_52800 5967201 5968664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52800 5968828 5969844 gene locus_tag LOCUS_52810 5968828 5969844 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_52810 5969847 5970914 gene locus_tag LOCUS_52820 5969847 5970914 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213126768.1 protein_id gnl|my_center|LOCUS_52820 5973206 5970957 gene locus_tag LOCUS_52830 5973206 5970957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 5973437 5974360 gene locus_tag LOCUS_52840 5973437 5974360 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 protein_id gnl|my_center|LOCUS_52840 5974377 5975246 gene locus_tag LOCUS_52850 5974377 5975246 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_52850 5975270 5976856 gene locus_tag LOCUS_52860 5975270 5976856 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972693.1 protein_id gnl|my_center|LOCUS_52860 5976882 5977889 gene locus_tag LOCUS_52870 5976882 5977889 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 protein_id gnl|my_center|LOCUS_52870 5977867 5978841 gene locus_tag LOCUS_52880 5977867 5978841 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963508.1 protein_id gnl|my_center|LOCUS_52880 5979096 5979572 gene locus_tag LOCUS_52890 5979096 5979572 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020070.1 protein_id gnl|my_center|LOCUS_52890 5979605 5981488 gene locus_tag LOCUS_52900 5979605 5981488 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392996.1 protein_id gnl|my_center|LOCUS_52900 5981832 5983787 gene locus_tag LOCUS_52910 gene abc-f 5981832 5983787 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150916.1 protein_id gnl|my_center|LOCUS_52910 5983839 5984828 gene locus_tag LOCUS_52920 5983839 5984828 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100885.1 protein_id gnl|my_center|LOCUS_52920 5985003 5985554 gene locus_tag LOCUS_52930 5985003 5985554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 5985799 5985975 gene locus_tag LOCUS_52940 5985799 5985975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 5987201 5986122 gene locus_tag LOCUS_52950 5987201 5986122 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782642.1 protein_id gnl|my_center|LOCUS_52950 5989067 5987439 gene locus_tag LOCUS_52960 5989067 5987439 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459501.1 protein_id gnl|my_center|LOCUS_52960 5989762 5989064 gene locus_tag LOCUS_52970 5989762 5989064 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965730.1 protein_id gnl|my_center|LOCUS_52970 5989909 5990781 gene locus_tag LOCUS_52980 5989909 5990781 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814244.1 protein_id gnl|my_center|LOCUS_52980 5990778 5991680 gene locus_tag LOCUS_52990 5990778 5991680 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814246.1 protein_id gnl|my_center|LOCUS_52990 5991727 5992836 gene locus_tag LOCUS_53000 5991727 5992836 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 protein_id gnl|my_center|LOCUS_53000 5992862 5994313 gene locus_tag LOCUS_53010 5992862 5994313 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814254.1 protein_id gnl|my_center|LOCUS_53010 5995317 5994418 gene locus_tag LOCUS_53020 5995317 5994418 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387131.1 protein_id gnl|my_center|LOCUS_53020 5995546 5996352 gene locus_tag LOCUS_53030 5995546 5996352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 5996387 5997850 gene locus_tag LOCUS_53040 5996387 5997850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 5998054 5998656 gene locus_tag LOCUS_53050 5998054 5998656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53050 5998687 5999172 gene locus_tag LOCUS_53060 5998687 5999172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 5999213 5999665 gene locus_tag LOCUS_53070 5999213 5999665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 5999736 6000302 gene locus_tag LOCUS_53080 5999736 6000302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53080 6000318 6000761 gene locus_tag LOCUS_53090 6000318 6000761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 6000745 6001314 gene locus_tag LOCUS_53100 6000745 6001314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53100 6001424 6002371 gene locus_tag LOCUS_53110 6001424 6002371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53110 6002416 6002838 gene locus_tag LOCUS_53120 6002416 6002838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 6002862 6003335 gene locus_tag LOCUS_53130 6002862 6003335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 6003429 6003791 gene locus_tag LOCUS_53140 6003429 6003791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53140 6004022 6004288 gene locus_tag LOCUS_53150 6004022 6004288 CDS product CD3324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229850.1 protein_id gnl|my_center|LOCUS_53150 6004447 6005529 gene locus_tag LOCUS_53160 6004447 6005529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 6005603 6006406 gene locus_tag LOCUS_53170 6005603 6006406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 6007402 6006512 gene locus_tag LOCUS_53180 6007402 6006512 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909376.1 protein_id gnl|my_center|LOCUS_53180 6007552 6008223 gene locus_tag LOCUS_53190 6007552 6008223 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705602.1 protein_id gnl|my_center|LOCUS_53190 6008408 6008890 gene locus_tag LOCUS_53200 6008408 6008890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 6008926 6009369 gene locus_tag LOCUS_53210 6008926 6009369 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226527.1 protein_id gnl|my_center|LOCUS_53210 6009484 6009909 gene locus_tag LOCUS_53220 6009484 6009909 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057349.1 protein_id gnl|my_center|LOCUS_53220 6010165 6011280 gene locus_tag LOCUS_53230 gene hisC 6010165 6011280 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_53230 6012487 6011759 gene locus_tag LOCUS_53240 6012487 6011759 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655263.1 protein_id gnl|my_center|LOCUS_53240 6012709 6012963 gene locus_tag LOCUS_53250 6012709 6012963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53250 6013469 6013056 gene locus_tag LOCUS_53260 6013469 6013056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 6014343 6013639 gene locus_tag LOCUS_53270 6014343 6013639 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_53270 6015320 6014514 gene locus_tag LOCUS_53280 6015320 6014514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53280 6015892 6015317 gene locus_tag LOCUS_53290 6015892 6015317 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141158.1 protein_id gnl|my_center|LOCUS_53290 6017121 6016066 gene locus_tag LOCUS_53300 6017121 6016066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 6018745 6017144 gene locus_tag LOCUS_53310 6018745 6017144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 6019507 6019076 gene locus_tag LOCUS_53320 6019507 6019076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 6019773 6020240 gene locus_tag LOCUS_53330 6019773 6020240 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461316.1 protein_id gnl|my_center|LOCUS_53330 6020274 6021521 gene locus_tag LOCUS_53340 6020274 6021521 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503266.1 protein_id gnl|my_center|LOCUS_53340 6022870 6021623 gene locus_tag LOCUS_53350 6022870 6021623 CDS product oxalate decarboxylase family bicupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747527.1 protein_id gnl|my_center|LOCUS_53350 6023599 6022874 gene locus_tag LOCUS_53360 6023599 6022874 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126313.1 protein_id gnl|my_center|LOCUS_53360 6023789 6025204 gene locus_tag LOCUS_53370 6023789 6025204 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709059.1 protein_id gnl|my_center|LOCUS_53370 6029053 6025307 gene locus_tag LOCUS_53380 6029053 6025307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 6030604 6029069 gene locus_tag LOCUS_53390 6030604 6029069 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459169.1 protein_id gnl|my_center|LOCUS_53390 6030880 6032061 gene locus_tag LOCUS_53400 6030880 6032061 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807837.1 protein_id gnl|my_center|LOCUS_53400 6032058 6032753 gene locus_tag LOCUS_53410 6032058 6032753 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814360.1 protein_id gnl|my_center|LOCUS_53410 6032773 6033372 gene locus_tag LOCUS_53420 6032773 6033372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 6033544 6034296 gene locus_tag LOCUS_53430 6033544 6034296 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722374.1 protein_id gnl|my_center|LOCUS_53430 6034293 6036356 gene locus_tag LOCUS_53440 6034293 6036356 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948990.1 protein_id gnl|my_center|LOCUS_53440 6037418 6036381 gene locus_tag LOCUS_53450 6037418 6036381 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989801.1 protein_id gnl|my_center|LOCUS_53450 6038086 6037415 gene locus_tag LOCUS_53460 6038086 6037415 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674592.1 protein_id gnl|my_center|LOCUS_53460 6039046 6038141 gene locus_tag LOCUS_53470 6039046 6038141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 6039157 6039561 gene locus_tag LOCUS_53480 6039157 6039561 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968136.1 protein_id gnl|my_center|LOCUS_53480 6040142 6039603 gene locus_tag LOCUS_53490 gene bstA 6040142 6039603 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999077.1 protein_id gnl|my_center|LOCUS_53490 6040330 6040665 gene locus_tag LOCUS_53500 6040330 6040665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53500 6042012 6040810 gene locus_tag LOCUS_53510 6042012 6040810 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014654825.1 protein_id gnl|my_center|LOCUS_53510 6042168 6042665 gene locus_tag LOCUS_53520 6042168 6042665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 6042926 6043291 gene locus_tag LOCUS_53530 6042926 6043291 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966283.1 protein_id gnl|my_center|LOCUS_53530 6043304 6043735 gene locus_tag LOCUS_53540 6043304 6043735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53540 6043742 6044086 gene locus_tag LOCUS_53550 6043742 6044086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53550 6044339 6044743 gene locus_tag LOCUS_53560 6044339 6044743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53560 6044843 6045952 gene locus_tag LOCUS_53570 6044843 6045952 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336221.1 protein_id gnl|my_center|LOCUS_53570 6045976 6046545 gene locus_tag LOCUS_53580 6045976 6046545 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227761.1 protein_id gnl|my_center|LOCUS_53580 6048442 6048233 gene locus_tag LOCUS_53590 6048442 6048233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53590 6048779 6048516 gene locus_tag LOCUS_53600 6048779 6048516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53600 6048891 6049454 gene locus_tag LOCUS_53610 6048891 6049454 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_53610 6049497 6049805 gene locus_tag LOCUS_53620 6049497 6049805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53620 6050577 6049924 gene locus_tag LOCUS_53630 6050577 6049924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53630 6050763 6051314 gene locus_tag LOCUS_53640 6050763 6051314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53640 6051358 6052299 gene locus_tag LOCUS_53650 6051358 6052299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53650 6052327 6053124 gene locus_tag LOCUS_53660 6052327 6053124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 6053995 6053090 gene locus_tag LOCUS_53670 6053995 6053090 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098205.1 protein_id gnl|my_center|LOCUS_53670 6054151 6054657 gene locus_tag LOCUS_53680 6054151 6054657 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180591.1 protein_id gnl|my_center|LOCUS_53680 6054798 6055736 gene locus_tag LOCUS_53690 6054798 6055736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53690 6056308 6055841 gene locus_tag LOCUS_53700 6056308 6055841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53700 6056872 6056363 gene locus_tag LOCUS_53710 gene hutZ 6056872 6056363 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372763.1 protein_id gnl|my_center|LOCUS_53710 6057035 6057607 gene locus_tag LOCUS_53720 6057035 6057607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 6057713 6058336 gene locus_tag LOCUS_53730 6057713 6058336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53730 6058402 6059640 gene locus_tag LOCUS_53740 6058402 6059640 CDS product DUF3533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475839.1 protein_id gnl|my_center|LOCUS_53740 6059685 6060101 gene locus_tag LOCUS_53750 6059685 6060101 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819713.1 protein_id gnl|my_center|LOCUS_53750 6060282 6060854 gene locus_tag LOCUS_53760 6060282 6060854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53760 6060869 6061642 gene locus_tag LOCUS_53770 6060869 6061642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53770 6062146 6062298 gene locus_tag LOCUS_53780 6062146 6062298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 6063311 6062256 gene locus_tag LOCUS_53790 6063311 6062256 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761587.1 protein_id gnl|my_center|LOCUS_53790 6064359 6063286 gene locus_tag LOCUS_53800 6064359 6063286 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258329.1 protein_id gnl|my_center|LOCUS_53800 6065528 6064362 gene locus_tag LOCUS_53810 6065528 6064362 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107521.1 protein_id gnl|my_center|LOCUS_53810 6065712 6066308 gene locus_tag LOCUS_53820 6065712 6066308 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141762.1 protein_id gnl|my_center|LOCUS_53820 6066305 6067132 gene locus_tag LOCUS_53830 6066305 6067132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53830 6067190 6067948 gene locus_tag LOCUS_53840 6067190 6067948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53840 6068173 6071283 gene locus_tag LOCUS_53850 6068173 6071283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53850 6072224 6071538 gene locus_tag LOCUS_53860 6072224 6071538 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233023.1 protein_id gnl|my_center|LOCUS_53860 6072535 6072326 gene locus_tag LOCUS_53870 6072535 6072326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 6072417 6073868 gene locus_tag LOCUS_53880 6072417 6073868 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890812.1 protein_id gnl|my_center|LOCUS_53880 6074726 6074019 gene locus_tag LOCUS_53890 gene araC 6074726 6074019 CDS product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368277.1 protein_id gnl|my_center|LOCUS_53890 6075000 6075809 gene locus_tag LOCUS_53900 6075000 6075809 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776877.1 protein_id gnl|my_center|LOCUS_53900 6076042 6076788 gene locus_tag LOCUS_53910 6076042 6076788 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_53910 6076825 6077679 gene locus_tag LOCUS_53920 6076825 6077679 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089438.1 protein_id gnl|my_center|LOCUS_53920 6078129 6079271 gene locus_tag LOCUS_53930 6078129 6079271 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793744.1 protein_id gnl|my_center|LOCUS_53930 6079366 6081678 gene locus_tag LOCUS_53940 6079366 6081678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 6081747 6082175 gene locus_tag LOCUS_53950 6081747 6082175 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 protein_id gnl|my_center|LOCUS_53950 6082301 6083449 gene locus_tag LOCUS_53960 6082301 6083449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53960 6083499 6084842 gene locus_tag LOCUS_53970 6083499 6084842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 6084866 6085975 gene locus_tag LOCUS_53980 6084866 6085975 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966575.1 protein_id gnl|my_center|LOCUS_53980 6086121 6088307 gene locus_tag LOCUS_53990 6086121 6088307 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_53990 6088430 6088819 gene locus_tag LOCUS_54000 6088430 6088819 CDS product holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721755.1 protein_id gnl|my_center|LOCUS_54000 6088968 6089471 gene locus_tag LOCUS_54010 6088968 6089471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54010 6089684 6090073 gene locus_tag LOCUS_54020 6089684 6090073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 6090464 6090216 gene locus_tag LOCUS_54030 6090464 6090216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54030 6090574 6090861 gene locus_tag LOCUS_54040 6090574 6090861 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943600.1 protein_id gnl|my_center|LOCUS_54040 6091013 6091438 gene locus_tag LOCUS_54050 6091013 6091438 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274012.1 protein_id gnl|my_center|LOCUS_54050 6091593 6092258 gene locus_tag LOCUS_54060 6091593 6092258 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503345.1 protein_id gnl|my_center|LOCUS_54060 6092415 6092894 gene locus_tag LOCUS_54070 6092415 6092894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 6093014 6093418 gene locus_tag LOCUS_54080 6093014 6093418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 6094427 6093525 gene locus_tag LOCUS_54090 6094427 6093525 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729459.1 protein_id gnl|my_center|LOCUS_54090 6094604 6095902 gene locus_tag LOCUS_54100 gene melA 6094604 6095902 CDS product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 protein_id gnl|my_center|LOCUS_54100 6096117 6096926 gene locus_tag LOCUS_54110 gene racE 6096117 6096926 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774005.1 protein_id gnl|my_center|LOCUS_54110 6097052 6098263 gene locus_tag LOCUS_54120 6097052 6098263 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948973.1 protein_id gnl|my_center|LOCUS_54120 6098400 6098639 gene locus_tag LOCUS_54130 6098400 6098639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 6098749 6099051 gene locus_tag LOCUS_54140 6098749 6099051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 6099078 6099302 gene locus_tag LOCUS_54150 6099078 6099302 CDS product DUF1450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222050.1 protein_id gnl|my_center|LOCUS_54150 6099404 6099733 gene locus_tag LOCUS_54160 6099404 6099733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 6099673 6100566 gene locus_tag LOCUS_54170 6099673 6100566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54170 6102658 6100664 gene locus_tag LOCUS_54180 6102658 6100664 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986153.1 protein_id gnl|my_center|LOCUS_54180 6103924 6102779 gene locus_tag LOCUS_54190 6103924 6102779 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944494.1 protein_id gnl|my_center|LOCUS_54190 6104054 6104695 gene locus_tag LOCUS_54200 6104054 6104695 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184583.1 protein_id gnl|my_center|LOCUS_54200 6104771 6104977 gene locus_tag LOCUS_54210 6104771 6104977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54210 6105014 6105589 gene locus_tag LOCUS_54220 6105014 6105589 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086782.1 protein_id gnl|my_center|LOCUS_54220 6105691 6106008 gene locus_tag LOCUS_54230 6105691 6106008 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528065.1 protein_id gnl|my_center|LOCUS_54230 6106036 6106575 gene locus_tag LOCUS_54240 6106036 6106575 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966655.1 protein_id gnl|my_center|LOCUS_54240 6106765 6107115 gene locus_tag LOCUS_54250 6106765 6107115 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528065.1 protein_id gnl|my_center|LOCUS_54250 6108689 6107472 gene locus_tag LOCUS_54260 6108689 6107472 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179295.1 protein_id gnl|my_center|LOCUS_54260 6108891 6109967 gene locus_tag LOCUS_54270 gene hemE 6108891 6109967 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252605.1 protein_id gnl|my_center|LOCUS_54270 6109960 6110901 gene locus_tag LOCUS_54280 gene hemH 6109960 6110901 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244736.1 protein_id gnl|my_center|LOCUS_54280 6110994 6112463 gene locus_tag LOCUS_54290 gene hemY 6110994 6112463 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245394.1 protein_id gnl|my_center|LOCUS_54290 6113069 6112530 gene locus_tag LOCUS_54300 6113069 6112530 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287163.1 protein_id gnl|my_center|LOCUS_54300 6113276 6114328 gene locus_tag LOCUS_54310 gene gerM 6113276 6114328 CDS product spore germination protein GerM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229578.1 protein_id gnl|my_center|LOCUS_54310 6114467 6115213 gene locus_tag LOCUS_54320 6114467 6115213 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246039.1 protein_id gnl|my_center|LOCUS_54320 6115210 6115848 gene locus_tag LOCUS_54330 6115210 6115848 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_54330 6117893 6116049 gene locus_tag LOCUS_54340 gene asnB 6117893 6116049 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392813.1 protein_id gnl|my_center|LOCUS_54340 6118083 6118448 gene locus_tag LOCUS_54350 6118083 6118448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 6118445 6118792 gene locus_tag LOCUS_54360 6118445 6118792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 6118968 6120299 gene locus_tag LOCUS_54370 6118968 6120299 CDS product 5'-deoxyadenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392738.1 protein_id gnl|my_center|LOCUS_54370 6121316 6120444 gene locus_tag LOCUS_54380 6121316 6120444 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140423.1 protein_id gnl|my_center|LOCUS_54380 6121851 6122516 gene locus_tag LOCUS_54390 6121851 6122516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 6122506 6123033 gene locus_tag LOCUS_54400 6122506 6123033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 6123030 6123152 gene locus_tag LOCUS_54410 6123030 6123152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 6123162 6123563 gene locus_tag LOCUS_54420 6123162 6123563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 6123803 6123727 gene locus_tag LOCUS_t01140 6123803 6123727 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6123949 6124980 gene locus_tag LOCUS_54430 6123949 6124980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 6125072 6126373 gene locus_tag LOCUS_54440 gene tig 6125072 6126373 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_54440 6126655 6127236 gene locus_tag LOCUS_54450 gene clpP 6126655 6127236 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_54450 6127280 6128536 gene locus_tag LOCUS_54460 gene clpX 6127280 6128536 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_54460 6128638 6129759 gene locus_tag LOCUS_54470 gene ispG 6128638 6129759 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194540.1 protein_id gnl|my_center|LOCUS_54470 6129954 6131660 gene locus_tag LOCUS_54480 gene lonB 6129954 6131660 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392067.1 protein_id gnl|my_center|LOCUS_54480 6131748 6134102 gene locus_tag LOCUS_54490 gene lon 6131748 6134102 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229618.1 protein_id gnl|my_center|LOCUS_54490 6134121 6134750 gene locus_tag LOCUS_54500 gene yihA 6134121 6134750 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732571.1 protein_id gnl|my_center|LOCUS_54500 6134918 6135508 gene locus_tag LOCUS_54510 6134918 6135508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 6135844 6136242 gene locus_tag LOCUS_54520 gene speH1 6135844 6136242 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456824.1 protein_id gnl|my_center|LOCUS_54520 6136423 6137808 gene locus_tag LOCUS_54530 gene hemA 6136423 6137808 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399038.1 protein_id gnl|my_center|LOCUS_54530 6137902 6138720 gene locus_tag LOCUS_54540 6137902 6138720 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222575.1 protein_id gnl|my_center|LOCUS_54540 6138754 6139440 gene locus_tag LOCUS_54550 6138754 6139440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54550 6139444 6140415 gene locus_tag LOCUS_54560 gene hemC 6139444 6140415 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226416.1 protein_id gnl|my_center|LOCUS_54560 6140412 6141995 gene locus_tag LOCUS_54570 gene cobA 6140412 6141995 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_54570 6141999 6142994 gene locus_tag LOCUS_54580 gene hemB 6141999 6142994 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732575.1 protein_id gnl|my_center|LOCUS_54580 6143061 6144362 gene locus_tag LOCUS_54590 gene hemL 6143061 6144362 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712943.1 protein_id gnl|my_center|LOCUS_54590 6144409 6145491 gene locus_tag LOCUS_54600 6144409 6145491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 6145685 6147115 gene locus_tag LOCUS_54610 6145685 6147115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 6147674 6150352 gene locus_tag LOCUS_54620 gene valS 6147674 6150352 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398606.1 protein_id gnl|my_center|LOCUS_54620 6149797 6149881 gene locus_tag LOCUS_t01150 6149797 6149881 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6150357 6151733 gene locus_tag LOCUS_54630 gene folC 6150357 6151733 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582053.1 protein_id gnl|my_center|LOCUS_54630 6151789 6153135 gene locus_tag LOCUS_54640 gene murC 6151789 6153135 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_54640 6153749 6153198 gene locus_tag LOCUS_54650 6153749 6153198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54650 6154593 6157031 gene locus_tag LOCUS_54660 6154593 6157031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54660 6157243 6157692 gene locus_tag LOCUS_54670 6157243 6157692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 6157709 6159271 gene locus_tag LOCUS_54680 6157709 6159271 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943573.1 protein_id gnl|my_center|LOCUS_54680 6159284 6159709 gene locus_tag LOCUS_54690 6159284 6159709 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 protein_id gnl|my_center|LOCUS_54690 6159709 6162270 gene locus_tag LOCUS_54700 6159709 6162270 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392263.1 protein_id gnl|my_center|LOCUS_54700 6162263 6164452 gene locus_tag LOCUS_54710 6162263 6164452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54710 6165104 6164601 gene locus_tag LOCUS_54720 6165104 6164601 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799620.1 protein_id gnl|my_center|LOCUS_54720 6165491 6165159 gene locus_tag LOCUS_54730 6165491 6165159 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804808.1 protein_id gnl|my_center|LOCUS_54730 6165640 6167085 gene locus_tag LOCUS_54740 6165640 6167085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 6167148 6167390 gene locus_tag LOCUS_54750 6167148 6167390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 6167428 6168057 gene locus_tag LOCUS_54760 6167428 6168057 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_54760 6168221 6168913 gene locus_tag LOCUS_54770 gene radC 6168221 6168913 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246034.1 protein_id gnl|my_center|LOCUS_54770 6168958 6169989 gene locus_tag LOCUS_54780 gene mreB 6168958 6169989 CDS product cell shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466737.1 protein_id gnl|my_center|LOCUS_54780 6170133 6170978 gene locus_tag LOCUS_54790 gene mreC 6170133 6170978 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135485.1 protein_id gnl|my_center|LOCUS_54790 6170975 6171499 gene locus_tag LOCUS_54800 6170975 6171499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54800 6171564 6172223 gene locus_tag LOCUS_54810 gene minC 6171564 6172223 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391521.1 protein_id gnl|my_center|LOCUS_54810 6172241 6173032 gene locus_tag LOCUS_54820 gene minD 6172241 6173032 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398624.1 protein_id gnl|my_center|LOCUS_54820 6173039 6174187 gene locus_tag LOCUS_54830 gene rodA 6173039 6174187 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723329.1 protein_id gnl|my_center|LOCUS_54830 6174347 6175135 gene locus_tag LOCUS_54840 6174347 6175135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 6175218 6176270 gene locus_tag LOCUS_54850 6175218 6176270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54850 6176263 6177150 gene locus_tag LOCUS_54860 gene spoIVFB 6176263 6177150 CDS product stage IV sporulation intramembrane metalloprotease SpoIVFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599075.1 protein_id gnl|my_center|LOCUS_54860 6177311 6178534 gene locus_tag LOCUS_54870 6177311 6178534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 6178752 6179063 gene locus_tag LOCUS_54880 gene rplU 6178752 6179063 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_54880 6179075 6179419 gene locus_tag LOCUS_54890 6179075 6179419 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973720.1 protein_id gnl|my_center|LOCUS_54890 6179434 6179739 gene locus_tag LOCUS_54900 gene rpmA 6179434 6179739 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944958.1 protein_id gnl|my_center|LOCUS_54900 6179927 6180658 gene locus_tag LOCUS_54910 6179927 6180658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54910 6180675 6182003 gene locus_tag LOCUS_54920 gene obgE 6180675 6182003 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000496111.1 protein_id gnl|my_center|LOCUS_54920 6182177 6182614 gene locus_tag LOCUS_54930 6182177 6182614 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_54930 6182638 6183924 gene locus_tag LOCUS_54940 6182638 6183924 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659109.1 protein_id gnl|my_center|LOCUS_54940 6184071 6185045 gene locus_tag LOCUS_54950 gene thrB 6184071 6185045 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889016.1 protein_id gnl|my_center|LOCUS_54950 6185042 6185917 gene locus_tag LOCUS_54960 gene pheA 6185042 6185917 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621730.1 protein_id gnl|my_center|LOCUS_54960 6186108 6187976 gene locus_tag LOCUS_54970 6186108 6187976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 6188183 6188800 gene locus_tag LOCUS_54980 6188183 6188800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 6189087 6189590 gene locus_tag LOCUS_54990 gene ruvC 6189087 6189590 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_54990 6189587 6190219 gene locus_tag LOCUS_55000 gene ruvA 6189587 6190219 CDS product Holliday junction DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464511.1 protein_id gnl|my_center|LOCUS_55000 6190309 6191364 gene locus_tag LOCUS_55010 gene ruvB 6190309 6191364 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344449.1 protein_id gnl|my_center|LOCUS_55010 6191364 6191810 gene locus_tag LOCUS_55020 6191364 6191810 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143244.1 protein_id gnl|my_center|LOCUS_55020 6191909 6194080 gene locus_tag LOCUS_55030 6191909 6194080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 6194089 6195135 gene locus_tag LOCUS_55040 gene queA 6194089 6195135 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354017.1 protein_id gnl|my_center|LOCUS_55040 6195162 6196295 gene locus_tag LOCUS_55050 gene tgt 6195162 6196295 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125365.1 protein_id gnl|my_center|LOCUS_55050 6196358 6196684 gene locus_tag LOCUS_55060 gene yajC 6196358 6196684 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723533.1 protein_id gnl|my_center|LOCUS_55060 6197711 6196848 gene locus_tag LOCUS_55070 6197711 6196848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55070 6198222 6197821 gene locus_tag LOCUS_55080 6198222 6197821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55080 6198485 6199231 gene locus_tag LOCUS_55090 6198485 6199231 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454832.1 protein_id gnl|my_center|LOCUS_55090 6200923 6199298 gene locus_tag LOCUS_55100 gene spoVB 6200923 6199298 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812078.1 protein_id gnl|my_center|LOCUS_55100 6201162 6201422 gene locus_tag LOCUS_55110 6201162 6201422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55110 6201511 6202779 gene locus_tag LOCUS_55120 6201511 6202779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55120 6202769 6203701 gene locus_tag LOCUS_55130 6202769 6203701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55130 6203875 6204786 gene locus_tag LOCUS_55140 6203875 6204786 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409743.1 protein_id gnl|my_center|LOCUS_55140 6204849 6207281 gene locus_tag LOCUS_55150 gene recJ 6204849 6207281 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246110.1 protein_id gnl|my_center|LOCUS_55150 6207278 6207790 gene locus_tag LOCUS_55160 6207278 6207790 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229745.1 protein_id gnl|my_center|LOCUS_55160 6208023 6210206 gene locus_tag LOCUS_55170 gene relA 6208023 6210206 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262810.1 protein_id gnl|my_center|LOCUS_55170 6210266 6210709 gene locus_tag LOCUS_55180 6210266 6210709 CDS product D-tyrosyl-tRNA(Tyr) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266954.1 protein_id gnl|my_center|LOCUS_55180 6210804 6210962 gene locus_tag LOCUS_55190 6210804 6210962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55190 6211730 6212980 gene locus_tag LOCUS_55200 gene hisS 6211730 6212980 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003161280.1 protein_id gnl|my_center|LOCUS_55200 6213021 6214841 gene locus_tag LOCUS_55210 gene aspS 6213021 6214841 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840895.1 protein_id gnl|my_center|LOCUS_55210 6215006 6215761 gene locus_tag LOCUS_55220 6215006 6215761 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967893.1 protein_id gnl|my_center|LOCUS_55220 6215758 6216423 gene locus_tag LOCUS_55230 6215758 6216423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55230 6216715 6218064 gene locus_tag LOCUS_55240 6216715 6218064 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721929.1 protein_id gnl|my_center|LOCUS_55240 6218244 6219818 gene locus_tag LOCUS_55250 6218244 6219818 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266704.1 protein_id gnl|my_center|LOCUS_55250 6219948 6221252 gene locus_tag LOCUS_55260 6219948 6221252 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_55260 6221541 6222863 gene locus_tag LOCUS_55270 6221541 6222863 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964731.1 protein_id gnl|my_center|LOCUS_55270 6224111 6223014 gene locus_tag LOCUS_55280 gene mnmA 6224111 6223014 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089522426.1 protein_id gnl|my_center|LOCUS_55280 6224355 6224774 gene locus_tag LOCUS_55290 gene cymR 6224355 6224774 CDS product cysteine metabolism transcriptional regulator CymR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225879.1 protein_id gnl|my_center|LOCUS_55290 6224788 6225942 gene locus_tag LOCUS_55300 gene nifS 6224788 6225942 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_55300 6225959 6226504 gene locus_tag LOCUS_55310 6225959 6226504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 6226508 6226702 gene locus_tag LOCUS_55320 6226508 6226702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225893.1 protein_id gnl|my_center|LOCUS_55320 6226909 6227979 gene locus_tag LOCUS_55330 6226909 6227979 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967889.1 protein_id gnl|my_center|LOCUS_55330 6228507 6231143 gene locus_tag LOCUS_55340 gene alaS 6228507 6231143 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246158.1 protein_id gnl|my_center|LOCUS_55340 6231172 6231453 gene locus_tag LOCUS_55350 6231172 6231453 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225903.1 protein_id gnl|my_center|LOCUS_55350 6231485 6231901 gene locus_tag LOCUS_55360 gene ruvX 6231485 6231901 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221197.1 protein_id gnl|my_center|LOCUS_55360 6231910 6232221 gene locus_tag LOCUS_55370 6231910 6232221 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017620.1 protein_id gnl|my_center|LOCUS_55370 6232248 6232547 gene locus_tag LOCUS_55380 6232248 6232547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 6232642 6233769 gene locus_tag LOCUS_55390 gene mltG 6232642 6233769 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_55390 6234034 6234978 gene locus_tag LOCUS_55400 6234034 6234978 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399094.1 protein_id gnl|my_center|LOCUS_55400 6235008 6236261 gene locus_tag LOCUS_55410 6235008 6236261 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229802.1 protein_id gnl|my_center|LOCUS_55410 6236316 6236510 gene locus_tag LOCUS_55420 6236316 6236510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 6236507 6238651 gene locus_tag LOCUS_55430 6236507 6238651 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964123.1 protein_id gnl|my_center|LOCUS_55430 6239573 6238893 gene locus_tag LOCUS_55440 6239573 6238893 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228889.1 protein_id gnl|my_center|LOCUS_55440 6240041 6239601 gene locus_tag LOCUS_55450 6240041 6239601 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285639.1 protein_id gnl|my_center|LOCUS_55450 6240445 6241815 gene locus_tag LOCUS_55460 6240445 6241815 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920960.1 protein_id gnl|my_center|LOCUS_55460 6241941 6243011 gene locus_tag LOCUS_55470 6241941 6243011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55470 6243033 6243767 gene locus_tag LOCUS_55480 6243033 6243767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55480 6244232 6243741 gene locus_tag LOCUS_55490 6244232 6243741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 6245640 6244327 gene locus_tag LOCUS_55500 6245640 6244327 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245414.1 protein_id gnl|my_center|LOCUS_55500 6245784 6246353 gene locus_tag LOCUS_55510 6245784 6246353 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733163.1 protein_id gnl|my_center|LOCUS_55510 6246583 6247560 gene locus_tag LOCUS_55520 6246583 6247560 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681592.1 protein_id gnl|my_center|LOCUS_55520 6247557 6248363 gene locus_tag LOCUS_55530 6247557 6248363 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956754.1 protein_id gnl|my_center|LOCUS_55530 6248365 6249156 gene locus_tag LOCUS_55540 6248365 6249156 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681582.1 protein_id gnl|my_center|LOCUS_55540 6250867 6249224 gene locus_tag LOCUS_55550 gene cimA 6250867 6249224 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_55550 6251030 6252316 gene locus_tag LOCUS_55560 6251030 6252316 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 protein_id gnl|my_center|LOCUS_55560 6252386 6252622 gene locus_tag LOCUS_55570 6252386 6252622 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151997.1 protein_id gnl|my_center|LOCUS_55570 6252791 6254692 gene locus_tag LOCUS_55580 6252791 6254692 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545101.1 protein_id gnl|my_center|LOCUS_55580 6254689 6256563 gene locus_tag LOCUS_55590 6254689 6256563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 6256582 6258189 gene locus_tag LOCUS_55600 6256582 6258189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55600 6258291 6259718 gene locus_tag LOCUS_55610 6258291 6259718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55610 6259922 6259782 gene locus_tag LOCUS_55620 6259922 6259782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 6260116 6261216 gene locus_tag LOCUS_55630 6260116 6261216 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887146.1 protein_id gnl|my_center|LOCUS_55630 6261232 6262035 gene locus_tag LOCUS_55640 6261232 6262035 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360523.1 protein_id gnl|my_center|LOCUS_55640 6262036 6262515 gene locus_tag LOCUS_55650 6262036 6262515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 6262726 6263487 gene locus_tag LOCUS_55660 6262726 6263487 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860778.1 protein_id gnl|my_center|LOCUS_55660 6263516 6264316 gene locus_tag LOCUS_55670 gene yidA 6263516 6264316 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989393.1 protein_id gnl|my_center|LOCUS_55670 6264836 6265441 gene locus_tag LOCUS_55680 6264836 6265441 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_55680 6265467 6266051 gene locus_tag LOCUS_55690 6265467 6266051 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163971.1 protein_id gnl|my_center|LOCUS_55690 6266143 6266658 gene locus_tag LOCUS_55700 6266143 6266658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55700 6266708 6267172 gene locus_tag LOCUS_55710 6266708 6267172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55710 6267277 6267777 gene locus_tag LOCUS_55720 6267277 6267777 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262268.1 protein_id gnl|my_center|LOCUS_55720 6267793 6268413 gene locus_tag LOCUS_55730 6267793 6268413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55730 6268604 6269026 gene locus_tag LOCUS_55740 6268604 6269026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55740 6269029 6269733 gene locus_tag LOCUS_55750 6269029 6269733 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875893.1 protein_id gnl|my_center|LOCUS_55750 6269739 6270494 gene locus_tag LOCUS_55760 6269739 6270494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55760 6270634 6271191 gene locus_tag LOCUS_55770 6270634 6271191 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 protein_id gnl|my_center|LOCUS_55770 6271303 6272520 gene locus_tag LOCUS_55780 gene fdhA 6271303 6272520 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226972.1 protein_id gnl|my_center|LOCUS_55780 6272704 6273156 gene locus_tag LOCUS_55790 6272704 6273156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 6273338 6274141 gene locus_tag LOCUS_55800 6273338 6274141 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095645285.1 protein_id gnl|my_center|LOCUS_55800 6274244 6274726 gene locus_tag LOCUS_55810 gene queD 6274244 6274726 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368414.1 protein_id gnl|my_center|LOCUS_55810 6274716 6275426 gene locus_tag LOCUS_55820 gene queE 6274716 6275426 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104809.1 protein_id gnl|my_center|LOCUS_55820 6275428 6276120 gene locus_tag LOCUS_55830 gene queC 6275428 6276120 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272362.1 protein_id gnl|my_center|LOCUS_55830 6277496 6276297 gene locus_tag LOCUS_55840 6277496 6276297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55840 6277756 6278703 gene locus_tag LOCUS_55850 6277756 6278703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55850 6278719 6279156 gene locus_tag LOCUS_55860 gene queD 6278719 6279156 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245665.1 protein_id gnl|my_center|LOCUS_55860 6279439 6280581 gene locus_tag LOCUS_55870 6279439 6280581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55870 6280594 6281940 gene locus_tag LOCUS_55880 6280594 6281940 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065381.1 protein_id gnl|my_center|LOCUS_55880 6281937 6285362 gene locus_tag LOCUS_55890 6281937 6285362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55890 6286562 6285522 gene locus_tag LOCUS_55900 6286562 6285522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244712.1 protein_id gnl|my_center|LOCUS_55900 6286675 6287961 gene locus_tag LOCUS_55910 6286675 6287961 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097417.1 protein_id gnl|my_center|LOCUS_55910 6288660 6287935 gene locus_tag LOCUS_55920 6288660 6287935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55920 6288845 6289417 gene locus_tag LOCUS_55930 6288845 6289417 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392241.1 protein_id gnl|my_center|LOCUS_55930 6289496 6289816 gene locus_tag LOCUS_55940 6289496 6289816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55940 6289903 6290112 gene locus_tag LOCUS_55950 6289903 6290112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55950 6290228 6290314 gene locus_tag LOCUS_t01160 6290228 6290314 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6290542 6290796 gene locus_tag LOCUS_55960 6290542 6290796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 6291272 6291454 gene locus_tag LOCUS_55970 6291272 6291454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55970 6291962 6292144 gene locus_tag LOCUS_55980 6291962 6292144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55980 6292155 6292433 gene locus_tag LOCUS_55990 6292155 6292433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55990 6292430 6292627 gene locus_tag LOCUS_56000 6292430 6292627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56000 6292828 6297882 gene locus_tag LOCUS_56010 6292828 6297882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 6297976 6298770 gene locus_tag LOCUS_56020 gene srtB 6297976 6298770 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095595.1 protein_id gnl|my_center|LOCUS_56020 6298881 6298967 gene locus_tag LOCUS_t01170 6298881 6298967 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6299134 6299220 gene locus_tag LOCUS_t01180 6299134 6299220 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6299403 6299819 gene locus_tag LOCUS_56030 gene exsC 6299403 6299819 CDS product exosporium protein ExsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148807.1 protein_id gnl|my_center|LOCUS_56030 6300003 6300848 gene locus_tag LOCUS_56040 6300003 6300848 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549805.1 protein_id gnl|my_center|LOCUS_56040 6301592 6300804 gene locus_tag LOCUS_56050 6301592 6300804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 6301740 6301973 gene locus_tag LOCUS_56060 6301740 6301973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56060 6302904 6301984 gene locus_tag LOCUS_56070 6302904 6301984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56070 6304050 6303097 gene locus_tag LOCUS_56080 6304050 6303097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56080 6305885 6304047 gene locus_tag LOCUS_56090 6305885 6304047 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100037.1 protein_id gnl|my_center|LOCUS_56090 6306159 6307043 gene locus_tag LOCUS_56100 6306159 6307043 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819165.1 protein_id gnl|my_center|LOCUS_56100 6307149 6308027 gene locus_tag LOCUS_56110 6307149 6308027 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965112.1 protein_id gnl|my_center|LOCUS_56110 6308051 6308575 gene locus_tag LOCUS_56120 6308051 6308575 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639884.1 protein_id gnl|my_center|LOCUS_56120 6308798 6310057 gene locus_tag LOCUS_56130 6308798 6310057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56130 6310204 6310971 gene locus_tag LOCUS_56140 6310204 6310971 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231298.1 protein_id gnl|my_center|LOCUS_56140 6311002 6311424 gene locus_tag LOCUS_56150 6311002 6311424 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040958745.1 protein_id gnl|my_center|LOCUS_56150 6312402 6311497 gene locus_tag LOCUS_56160 6312402 6311497 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948372.1 protein_id gnl|my_center|LOCUS_56160 6312515 6313795 gene locus_tag LOCUS_56170 6312515 6313795 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775353.1 protein_id gnl|my_center|LOCUS_56170 6313919 6314806 gene locus_tag LOCUS_56180 gene mneP 6313919 6314806 CDS product manganese transporter MneP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244477.1 protein_id gnl|my_center|LOCUS_56180 6315002 6316171 gene locus_tag LOCUS_56190 6315002 6316171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 6316353 6318119 gene locus_tag LOCUS_56200 6316353 6318119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56200 6319072 6318236 gene locus_tag LOCUS_56210 6319072 6318236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56210 6319295 6320689 gene locus_tag LOCUS_56220 6319295 6320689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56220 6320857 6321846 gene locus_tag LOCUS_56230 gene rbsR 6320857 6321846 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104051.1 protein_id gnl|my_center|LOCUS_56230 6322757 6321843 gene locus_tag LOCUS_56240 gene rbsK 6322757 6321843 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419503.1 protein_id gnl|my_center|LOCUS_56240 6323079 6323003 gene locus_tag LOCUS_t01190 6323079 6323003 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6323164 6323089 gene locus_tag LOCUS_t01200 6323164 6323089 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6323794 6323258 gene locus_tag LOCUS_56250 6323794 6323258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56250 6324237 6324908 gene locus_tag LOCUS_56260 6324237 6324908 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110287.1 protein_id gnl|my_center|LOCUS_56260 6325071 6325475 gene locus_tag LOCUS_56270 6325071 6325475 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220322.1 protein_id gnl|my_center|LOCUS_56270 6325531 6326037 gene locus_tag LOCUS_56280 6325531 6326037 CDS product DUF4178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051742.1 protein_id gnl|my_center|LOCUS_56280 6326054 6326791 gene locus_tag LOCUS_56290 6326054 6326791 CDS product DUF4247 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054401985.1 protein_id gnl|my_center|LOCUS_56290 6327001 6328215 gene locus_tag LOCUS_56300 gene lplT 6327001 6328215 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620430.1 protein_id gnl|my_center|LOCUS_56300 6328276 6329097 gene locus_tag LOCUS_56310 6328276 6329097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56310 6329084 6329674 gene locus_tag LOCUS_56320 6329084 6329674 CDS product DUF4269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495197.1 protein_id gnl|my_center|LOCUS_56320 6330285 6331064 gene locus_tag LOCUS_56330 6330285 6331064 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110492.1 protein_id gnl|my_center|LOCUS_56330 6331098 6331853 gene locus_tag LOCUS_56340 gene capA 6331098 6331853 CDS product capsular polysaccharide type 5/8 biosynthesis protein CapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446299.1 protein_id gnl|my_center|LOCUS_56340 6331840 6332544 gene locus_tag LOCUS_56350 6331840 6332544 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338483.1 protein_id gnl|my_center|LOCUS_56350 6332567 6334390 gene locus_tag LOCUS_56360 6332567 6334390 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272023.1 protein_id gnl|my_center|LOCUS_56360 6334639 6335994 gene locus_tag LOCUS_56370 6334639 6335994 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533497.1 protein_id gnl|my_center|LOCUS_56370 6336013 6337437 gene locus_tag LOCUS_56380 6336013 6337437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56380 6337434 6338570 gene locus_tag LOCUS_56390 6337434 6338570 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_56390 6338560 6340023 gene locus_tag LOCUS_56400 6338560 6340023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56400 6340038 6340643 gene locus_tag LOCUS_56410 6340038 6340643 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231291.1 protein_id gnl|my_center|LOCUS_56410 6340689 6341999 gene locus_tag LOCUS_56420 6340689 6341999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56420 6341996 6343024 gene locus_tag LOCUS_56430 6341996 6343024 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_56430 6343109 6344917 gene locus_tag LOCUS_56440 6343109 6344917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56440 6344914 6345696 gene locus_tag LOCUS_56450 6344914 6345696 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228268.1 protein_id gnl|my_center|LOCUS_56450 6345739 6346911 gene locus_tag LOCUS_56460 6345739 6346911 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968194.1 protein_id gnl|my_center|LOCUS_56460 6346898 6347800 gene locus_tag LOCUS_56470 gene galU 6346898 6347800 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_56470 6347801 6349144 gene locus_tag LOCUS_56480 gene tuaD 6347801 6349144 CDS product UDP-glucose 6-dehydrogenase TuaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242596.1 protein_id gnl|my_center|LOCUS_56480 6349508 6349783 gene locus_tag LOCUS_56490 6349508 6349783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56490 6349817 6350662 gene locus_tag LOCUS_56500 6349817 6350662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56500 6350793 6351707 gene locus_tag LOCUS_56510 6350793 6351707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56510 6352791 6352162 gene locus_tag LOCUS_56520 6352791 6352162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56520 6353951 6352935 gene locus_tag LOCUS_56530 6353951 6352935 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337441.1 protein_id gnl|my_center|LOCUS_56530 6354220 6356019 gene locus_tag LOCUS_56540 6354220 6356019 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285995.1 protein_id gnl|my_center|LOCUS_56540 6356305 6357117 gene locus_tag LOCUS_56550 6356305 6357117 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493653.1 protein_id gnl|my_center|LOCUS_56550 6357104 6358411 gene locus_tag LOCUS_56560 gene murA 6357104 6358411 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413268.1 protein_id gnl|my_center|LOCUS_56560 6359850 6358684 gene locus_tag LOCUS_56570 6359850 6358684 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179100.1 protein_id gnl|my_center|LOCUS_56570 6360058 6360528 gene locus_tag LOCUS_56580 6360058 6360528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 6360678 6362627 gene locus_tag LOCUS_56590 gene glgB 6360678 6362627 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100880.1 protein_id gnl|my_center|LOCUS_56590 6362680 6363846 gene locus_tag LOCUS_56600 6362680 6363846 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968049.1 protein_id gnl|my_center|LOCUS_56600 6363843 6364955 gene locus_tag LOCUS_56610 gene glgD 6363843 6364955 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 protein_id gnl|my_center|LOCUS_56610 6365055 6366518 gene locus_tag LOCUS_56620 gene glgA 6365055 6366518 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042515450.1 protein_id gnl|my_center|LOCUS_56620 6366500 6368491 gene locus_tag LOCUS_56630 6366500 6368491 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_56630 6369475 6368618 gene locus_tag LOCUS_56640 6369475 6368618 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925921.1 protein_id gnl|my_center|LOCUS_56640 6369600 6370622 gene locus_tag LOCUS_56650 6369600 6370622 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143100.1 protein_id gnl|my_center|LOCUS_56650 6370638 6371555 gene locus_tag LOCUS_56660 6370638 6371555 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990845.1 protein_id gnl|my_center|LOCUS_56660 6371580 6372932 gene locus_tag LOCUS_56670 6371580 6372932 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211158.1 protein_id gnl|my_center|LOCUS_56670 6372964 6373509 gene locus_tag LOCUS_56680 6372964 6373509 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095285.1 protein_id gnl|my_center|LOCUS_56680 6373528 6373857 gene locus_tag LOCUS_56690 6373528 6373857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56690 6373851 6374684 gene locus_tag LOCUS_56700 6373851 6374684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56700 6375182 6377110 gene locus_tag LOCUS_56710 gene thrS 6375182 6377110 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243399.1 protein_id gnl|my_center|LOCUS_56710 6377298 6377750 gene locus_tag LOCUS_56720 6377298 6377750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56720 6378139 6378008 gene locus_tag LOCUS_56730 6378139 6378008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56730 6378763 6378257 gene locus_tag LOCUS_56740 6378763 6378257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56740 6379052 6378756 gene locus_tag LOCUS_56750 6379052 6378756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56750 6379908 6379072 gene locus_tag LOCUS_56760 gene gerPC 6379908 6379072 CDS product spore germination protein GerPC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070760.1 protein_id gnl|my_center|LOCUS_56760 6380127 6379927 gene locus_tag LOCUS_56770 6380127 6379927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56770 6380363 6380127 gene locus_tag LOCUS_56780 6380363 6380127 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233096.1 protein_id gnl|my_center|LOCUS_56780 6380518 6380943 gene locus_tag LOCUS_56790 6380518 6380943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56790 6381065 6381265 gene locus_tag LOCUS_56800 6381065 6381265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56800 6381550 6382146 gene locus_tag LOCUS_56810 6381550 6382146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56810 6383166 6384578 gene locus_tag LOCUS_56820 gene gndA 6383166 6384578 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_56820 6384858 6384559 gene locus_tag LOCUS_56830 6384858 6384559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56830 6384998 6385519 gene locus_tag LOCUS_56840 6384998 6385519 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942669.1 protein_id gnl|my_center|LOCUS_56840 6385622 6386920 gene locus_tag LOCUS_56850 gene aroA 6385622 6386920 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479628.1 protein_id gnl|my_center|LOCUS_56850 6386984 6387418 gene locus_tag LOCUS_56860 6386984 6387418 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151390.1 protein_id gnl|my_center|LOCUS_56860 6387530 6388300 gene locus_tag LOCUS_56870 6387530 6388300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56870 6388454 6390337 gene locus_tag LOCUS_56880 gene ptsG 6388454 6390337 CDS product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246270.1 protein_id gnl|my_center|LOCUS_56880 6390334 6392094 gene locus_tag LOCUS_56890 gene ptsP 6390334 6392094 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048342.1 protein_id gnl|my_center|LOCUS_56890 6392748 6392224 gene locus_tag LOCUS_56900 6392748 6392224 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723656.1 protein_id gnl|my_center|LOCUS_56900 6392814 6393227 gene locus_tag LOCUS_56910 6392814 6393227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56910 6393414 6393794 gene locus_tag LOCUS_56920 6393414 6393794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56920 6393811 6394167 gene locus_tag LOCUS_56930 gene ytxJ 6393811 6394167 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404063.1 protein_id gnl|my_center|LOCUS_56930 6394240 6395244 gene locus_tag LOCUS_56940 gene ccpA 6394240 6395244 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103304.1 protein_id gnl|my_center|LOCUS_56940 6395244 6395948 gene locus_tag LOCUS_56950 6395244 6395948 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_56950 6397316 6396129 gene locus_tag LOCUS_56960 6397316 6396129 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398517.1 protein_id gnl|my_center|LOCUS_56960 6397991 6397359 gene locus_tag LOCUS_56970 gene acuA 6397991 6397359 CDS product acetoin utilization protein acetyltransferase AcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229296.1 protein_id gnl|my_center|LOCUS_56970 6398257 6399981 gene locus_tag LOCUS_56980 gene acsA 6398257 6399981 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399030.1 protein_id gnl|my_center|LOCUS_56980 6403220 6400077 gene locus_tag LOCUS_56990 6403220 6400077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56990 6403662 6403480 gene locus_tag LOCUS_57000 6403662 6403480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57000 6403794 6405050 gene locus_tag LOCUS_57010 gene tyrS 6403794 6405050 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_57010 6405265 6405792 gene locus_tag LOCUS_57020 6405265 6405792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460096.1 protein_id gnl|my_center|LOCUS_57020 6405821 6407335 gene locus_tag LOCUS_57030 6405821 6407335 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460095.1 protein_id gnl|my_center|LOCUS_57030 6407483 6408256 gene locus_tag LOCUS_57040 6407483 6408256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57040 6408391 6409227 gene locus_tag LOCUS_57050 6408391 6409227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57050 6410147 6409203 gene locus_tag LOCUS_57060 6410147 6409203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57060 6410197 6411300 gene locus_tag LOCUS_57070 6410197 6411300 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_57070 6411965 6411366 gene locus_tag LOCUS_57080 gene rpsD 6411965 6411366 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229304.1 protein_id gnl|my_center|LOCUS_57080 6412340 6414217 gene locus_tag LOCUS_57090 6412340 6414217 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229309.1 protein_id gnl|my_center|LOCUS_57090 6414438 6415154 gene locus_tag LOCUS_57100 6414438 6415154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57100 6415267 6416382 gene locus_tag LOCUS_57110 6415267 6416382 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_57110 6416458 6416697 gene locus_tag LOCUS_57120 6416458 6416697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57120 6416838 6417119 gene locus_tag LOCUS_57130 6416838 6417119 CDS product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245286.1 protein_id gnl|my_center|LOCUS_57130 6418294 6417233 gene locus_tag LOCUS_57140 gene cax 6418294 6417233 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482137.1 protein_id gnl|my_center|LOCUS_57140 6418451 6418834 gene locus_tag LOCUS_57150 6418451 6418834 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015712.1 protein_id gnl|my_center|LOCUS_57150 6420079 6418901 gene locus_tag LOCUS_57160 gene ftsW 6420079 6418901 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_57160 6420442 6420098 gene locus_tag LOCUS_57170 6420442 6420098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57170 6420634 6421863 gene locus_tag LOCUS_57180 gene sndC 6420634 6421863 CDS product N-acetyl amino acid acetylase SndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245681.1 protein_id gnl|my_center|LOCUS_57180 6421970 6422413 gene locus_tag LOCUS_57190 6421970 6422413 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199006.1 protein_id gnl|my_center|LOCUS_57190 6422655 6424379 gene locus_tag LOCUS_57200 6422655 6424379 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_57200 6424376 6426244 gene locus_tag LOCUS_57210 6424376 6426244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57210 6426345 6426872 gene locus_tag LOCUS_57220 6426345 6426872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57220 6426898 6427161 gene locus_tag LOCUS_57230 6426898 6427161 CDS product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002080814.1 protein_id gnl|my_center|LOCUS_57230 6427341 6427778 gene locus_tag LOCUS_57240 6427341 6427778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57240 6427904 6428815 gene locus_tag LOCUS_57250 6427904 6428815 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_57250 6428806 6429663 gene locus_tag LOCUS_57260 6428806 6429663 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_57260 6431674 6429818 gene locus_tag LOCUS_57270 gene efbA 6431674 6429818 CDS product fibronectin-binding protein EfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379361.1 protein_id gnl|my_center|LOCUS_57270 6431834 6434626 gene locus_tag LOCUS_57280 6431834 6434626 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104785.1 protein_id gnl|my_center|LOCUS_57280 6434821 6435834 gene locus_tag LOCUS_57290 6434821 6435834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57290 6435962 6436660 gene locus_tag LOCUS_57300 6435962 6436660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57300 6436672 6436971 gene locus_tag LOCUS_57310 6436672 6436971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57310 6437318 6438148 gene locus_tag LOCUS_57320 gene dapF 6437318 6438148 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_57320 6438173 6440038 gene locus_tag LOCUS_57330 6438173 6440038 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245847.1 protein_id gnl|my_center|LOCUS_57330 6440324 6440584 gene locus_tag LOCUS_57340 6440324 6440584 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_57340 6440599 6441216 gene locus_tag LOCUS_57350 gene gmk 6440599 6441216 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257738.1 protein_id gnl|my_center|LOCUS_57350 6441233 6441445 gene locus_tag LOCUS_57360 gene rpoZ 6441233 6441445 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221520.1 protein_id gnl|my_center|LOCUS_57360 6441585 6442805 gene locus_tag LOCUS_57370 gene coaBC 6441585 6442805 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911762.1 protein_id gnl|my_center|LOCUS_57370 6442802 6445330 gene locus_tag LOCUS_57380 gene priA 6442802 6445330 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_57380 6445372 6445857 gene locus_tag LOCUS_57390 gene def 6445372 6445857 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_57390 6445861 6446808 gene locus_tag LOCUS_57400 gene fmt 6445861 6446808 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 protein_id gnl|my_center|LOCUS_57400 6446805 6448508 gene locus_tag LOCUS_57410 gene rsmB 6446805 6448508 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249665.1 protein_id gnl|my_center|LOCUS_57410 6448652 6449698 gene locus_tag LOCUS_57420 gene rlmN 6448652 6449698 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450540.1 protein_id gnl|my_center|LOCUS_57420 6449711 6450460 gene locus_tag LOCUS_57430 6449711 6450460 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_57430 6450466 6452733 gene locus_tag LOCUS_57440 gene pknB 6450466 6452733 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733096.1 protein_id gnl|my_center|LOCUS_57440 6452702 6453652 gene locus_tag LOCUS_57450 gene rsgA 6452702 6453652 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232060.1 protein_id gnl|my_center|LOCUS_57450 6453654 6454298 gene locus_tag LOCUS_57460 gene rpe 6453654 6454298 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232058.1 protein_id gnl|my_center|LOCUS_57460 6454311 6454568 gene locus_tag LOCUS_57470 6454311 6454568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57470 6455269 6455081 gene locus_tag LOCUS_57480 gene rpmB 6455269 6455081 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221548.1 protein_id gnl|my_center|LOCUS_57480 6455490 6455849 gene locus_tag LOCUS_57490 6455490 6455849 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232054.1 protein_id gnl|my_center|LOCUS_57490 6455866 6457710 gene locus_tag LOCUS_57500 6455866 6457710 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101481.1 protein_id gnl|my_center|LOCUS_57500 6457721 6458575 gene locus_tag LOCUS_57510 6457721 6458575 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_57510 6458580 6460634 gene locus_tag LOCUS_57520 gene recG 6458580 6460634 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006884.1 protein_id gnl|my_center|LOCUS_57520 6460753 6461040 gene locus_tag LOCUS_57530 6460753 6461040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57530 6461794 6461111 gene locus_tag LOCUS_57540 6461794 6461111 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399300.1 protein_id gnl|my_center|LOCUS_57540 6461933 6463330 gene locus_tag LOCUS_57550 6461933 6463330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57550 6464103 6463459 gene locus_tag LOCUS_57560 6464103 6463459 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244782.1 protein_id gnl|my_center|LOCUS_57560 6464804 6464106 gene locus_tag LOCUS_57570 gene mtnX 6464804 6464106 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027474.1 protein_id gnl|my_center|LOCUS_57570 6466030 6464801 gene locus_tag LOCUS_57580 gene mtnW 6466030 6464801 CDS product 2,3-diketo-5-methylthiopentyl-1-phosphate enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245108.1 protein_id gnl|my_center|LOCUS_57580 6466908 6466027 gene locus_tag LOCUS_57590 gene proI 6466908 6466027 CDS product pyrroline-5-carboxylate reductase ProI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027273.1 protein_id gnl|my_center|LOCUS_57590 6468176 6466929 gene locus_tag LOCUS_57600 6468176 6466929 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_57600 6469393 6468278 gene locus_tag LOCUS_57610 gene proB 6469393 6468278 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744710.1 protein_id gnl|my_center|LOCUS_57610 6470995 6469805 gene locus_tag LOCUS_57620 6470995 6469805 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765511.1 protein_id gnl|my_center|LOCUS_57620 6471526 6471083 gene locus_tag LOCUS_57630 6471526 6471083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57630 6471682 6472479 gene locus_tag LOCUS_57640 6471682 6472479 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204714.1 protein_id gnl|my_center|LOCUS_57640 6473435 6472533 gene locus_tag LOCUS_57650 6473435 6472533 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246430.1 protein_id gnl|my_center|LOCUS_57650 6473610 6475031 gene locus_tag LOCUS_57660 gene leuC 6473610 6475031 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229604.1 protein_id gnl|my_center|LOCUS_57660 6475060 6475653 gene locus_tag LOCUS_57670 gene leuD 6475060 6475653 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357988.1 protein_id gnl|my_center|LOCUS_57670 6475834 6477381 gene locus_tag LOCUS_57680 6475834 6477381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57680 6477459 6478169 gene locus_tag LOCUS_57690 6477459 6478169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57690 6478186 6480897 gene locus_tag LOCUS_57700 6478186 6480897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57700 6481063 6481731 gene locus_tag LOCUS_57710 gene nth 6481063 6481731 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933025.1 protein_id gnl|my_center|LOCUS_57710 6481772 6482038 gene locus_tag LOCUS_57720 6481772 6482038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57720 6482147 6485851 gene locus_tag LOCUS_57730 6482147 6485851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57730 6486457 6488238 gene locus_tag LOCUS_57740 6486457 6488238 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967136.1 protein_id gnl|my_center|LOCUS_57740 6488235 6490067 gene locus_tag LOCUS_57750 6488235 6490067 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232362.1 protein_id gnl|my_center|LOCUS_57750 6490187 6491365 gene locus_tag LOCUS_57760 gene purT 6490187 6491365 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246432.1 protein_id gnl|my_center|LOCUS_57760 6492062 6491913 gene locus_tag LOCUS_57770 6492062 6491913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57770 6492061 6492888 gene locus_tag LOCUS_57780 6492061 6492888 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256952.1 protein_id gnl|my_center|LOCUS_57780 6492900 6493868 gene locus_tag LOCUS_57790 6492900 6493868 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207738.1 protein_id gnl|my_center|LOCUS_57790 6493861 6494847 gene locus_tag LOCUS_57800 6493861 6494847 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206500.1 protein_id gnl|my_center|LOCUS_57800 6495001 6496974 gene locus_tag LOCUS_57810 gene parE 6495001 6496974 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062193.1 protein_id gnl|my_center|LOCUS_57810 6496997 6499453 gene locus_tag LOCUS_57820 gene parC 6496997 6499453 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231550.1 protein_id gnl|my_center|LOCUS_57820 6499653 6499486 gene locus_tag LOCUS_57830 6499653 6499486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57830 6499948 6500361 gene locus_tag LOCUS_57840 6499948 6500361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57840 6501875 6500466 gene locus_tag LOCUS_57850 6501875 6500466 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808454.1 protein_id gnl|my_center|LOCUS_57850 6502630 6501875 gene locus_tag LOCUS_57860 6502630 6501875 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_57860 6503498 6502632 gene locus_tag LOCUS_57870 6503498 6502632 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_57870 6504216 6503485 gene locus_tag LOCUS_57880 6504216 6503485 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195828.1 protein_id gnl|my_center|LOCUS_57880 6504267 6506393 gene locus_tag LOCUS_57890 6504267 6506393 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002081021.1 protein_id gnl|my_center|LOCUS_57890 6506719 6506396 gene locus_tag LOCUS_57900 6506719 6506396 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232719.1 protein_id gnl|my_center|LOCUS_57900 6509178 6507280 gene locus_tag LOCUS_57910 gene sqhC 6509178 6507280 CDS product sporulenol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399534.1 protein_id gnl|my_center|LOCUS_57910 6509245 6509433 gene locus_tag LOCUS_57920 6509245 6509433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57920 6509530 6511245 gene locus_tag LOCUS_57930 6509530 6511245 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944619.1 protein_id gnl|my_center|LOCUS_57930 6511408 6512646 gene locus_tag LOCUS_57940 6511408 6512646 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007344.1 protein_id gnl|my_center|LOCUS_57940 6512871 6513515 gene locus_tag LOCUS_57950 gene pnuC 6512871 6513515 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088324.1 protein_id gnl|my_center|LOCUS_57950 6513512 6514540 gene locus_tag LOCUS_57960 6513512 6514540 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401213.1 protein_id gnl|my_center|LOCUS_57960 6516876 6514657 gene locus_tag LOCUS_57970 6516876 6514657 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243548.1 protein_id gnl|my_center|LOCUS_57970 6517516 6516974 gene locus_tag LOCUS_57980 6517516 6516974 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244053.1 protein_id gnl|my_center|LOCUS_57980 6518220 6517588 gene locus_tag LOCUS_57990 6518220 6517588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57990 6518640 6518233 gene locus_tag LOCUS_58000 6518640 6518233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58000 6518969 6518643 gene locus_tag LOCUS_58010 6518969 6518643 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289468.1 protein_id gnl|my_center|LOCUS_58010 6519416 6519237 gene locus_tag LOCUS_58020 6519416 6519237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58020 6519626 6520969 gene locus_tag LOCUS_58030 6519626 6520969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58030 6521173 6521652 gene locus_tag LOCUS_58040 6521173 6521652 CDS product DUF6530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943189.1 protein_id gnl|my_center|LOCUS_58040 6521687 6522079 gene locus_tag LOCUS_58050 6521687 6522079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130296.1 protein_id gnl|my_center|LOCUS_58050 6522107 6522715 gene locus_tag LOCUS_58060 6522107 6522715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58060 6523017 6524582 gene locus_tag LOCUS_58070 6523017 6524582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58070 6525191 6525961 gene locus_tag LOCUS_58080 6525191 6525961 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_58080 6526242 6526550 gene locus_tag LOCUS_58090 6526242 6526550 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460053.1 protein_id gnl|my_center|LOCUS_58090 6526564 6528237 gene locus_tag LOCUS_58100 6526564 6528237 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460052.1 protein_id gnl|my_center|LOCUS_58100 6528501 6529511 gene locus_tag LOCUS_58110 6528501 6529511 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_58110 6529516 6530331 gene locus_tag LOCUS_58120 6529516 6530331 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927109.1 protein_id gnl|my_center|LOCUS_58120 6530312 6531112 gene locus_tag LOCUS_58130 6530312 6531112 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393844.1 protein_id gnl|my_center|LOCUS_58130 6532080 6531283 gene locus_tag LOCUS_58140 6532080 6531283 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890768.1 protein_id gnl|my_center|LOCUS_58140 6532303 6533115 gene locus_tag LOCUS_58150 gene speD 6532303 6533115 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965890.1 protein_id gnl|my_center|LOCUS_58150 6533326 6534072 gene locus_tag LOCUS_58160 6533326 6534072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58160 6534531 6534184 gene locus_tag LOCUS_58170 gene ytxJ 6534531 6534184 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073516751.1 protein_id gnl|my_center|LOCUS_58170 6536578 6534650 gene locus_tag LOCUS_58180 6536578 6534650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58180 6536989 6536711 gene locus_tag LOCUS_58190 6536989 6536711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58190 6537426 6536992 gene locus_tag LOCUS_58200 6537426 6536992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58200 6537581 6538111 gene locus_tag LOCUS_58210 6537581 6538111 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230498.1 protein_id gnl|my_center|LOCUS_58210 6538855 6538295 gene locus_tag LOCUS_58220 6538855 6538295 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838169.1 protein_id gnl|my_center|LOCUS_58220 6539258 6538932 gene locus_tag LOCUS_58230 6539258 6538932 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723978.1 protein_id gnl|my_center|LOCUS_58230 6539385 6540902 gene locus_tag LOCUS_58240 gene ypwA 6539385 6540902 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215086.1 protein_id gnl|my_center|LOCUS_58240 6541828 6540971 gene locus_tag LOCUS_58250 6541828 6540971 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530905.1 protein_id gnl|my_center|LOCUS_58250 6541973 6543214 gene locus_tag LOCUS_58260 gene fabF 6541973 6543214 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_58260 6543338 6544330 gene locus_tag LOCUS_58270 6543338 6544330 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246146.1 protein_id gnl|my_center|LOCUS_58270 6544454 6545008 gene locus_tag LOCUS_58280 gene cotE 6544454 6545008 CDS product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231833.1 protein_id gnl|my_center|LOCUS_58280 6545145 6546602 gene locus_tag LOCUS_58290 6545145 6546602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58290 6546762 6549581 gene locus_tag LOCUS_58300 gene mutS 6546762 6549581 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209880066.1 protein_id gnl|my_center|LOCUS_58300 6549715 6551973 gene locus_tag LOCUS_58310 gene mutL 6549715 6551973 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378991.1 protein_id gnl|my_center|LOCUS_58310 6551970 6552740 gene locus_tag LOCUS_58320 6551970 6552740 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230795.1 protein_id gnl|my_center|LOCUS_58320 6552737 6553744 gene locus_tag LOCUS_58330 gene miaA 6552737 6553744 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 protein_id gnl|my_center|LOCUS_58330 6553741 6553980 gene locus_tag LOCUS_58340 gene hfq 6553741 6553980 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813896.1 protein_id gnl|my_center|LOCUS_58340 6554285 6557104 gene locus_tag LOCUS_58350 6554285 6557104 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233213.1 protein_id gnl|my_center|LOCUS_58350 6557164 6557895 gene locus_tag LOCUS_58360 6557164 6557895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58360 6558161 6558652 gene locus_tag LOCUS_58370 6558161 6558652 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824675.1 protein_id gnl|my_center|LOCUS_58370 6558649 6559338 gene locus_tag LOCUS_58380 6558649 6559338 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220030.1 protein_id gnl|my_center|LOCUS_58380 6559456 6560439 gene locus_tag LOCUS_58390 gene spoVK 6559456 6560439 CDS product stage V sporulation protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231746.1 protein_id gnl|my_center|LOCUS_58390 6560509 6561801 gene locus_tag LOCUS_58400 gene hflX 6560509 6561801 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245432.1 protein_id gnl|my_center|LOCUS_58400 6561835 6563118 gene locus_tag LOCUS_58410 6561835 6563118 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245218.1 protein_id gnl|my_center|LOCUS_58410 6563178 6563588 gene locus_tag LOCUS_58420 gene glnR 6563178 6563588 CDS product transcriptional repressor GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238341.1 protein_id gnl|my_center|LOCUS_58420 6563637 6564965 gene locus_tag LOCUS_58430 gene glnA 6563637 6564965 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135328.1 protein_id gnl|my_center|LOCUS_58430 6565114 6565290 gene locus_tag LOCUS_58440 6565114 6565290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58440 6565341 6566054 gene locus_tag LOCUS_58450 6565341 6566054 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728403.1 protein_id gnl|my_center|LOCUS_58450 6566026 6567060 gene locus_tag LOCUS_58460 6566026 6567060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58460 6567086 6569965 gene locus_tag LOCUS_58470 6567086 6569965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58470 6569969 6570874 gene locus_tag LOCUS_58480 6569969 6570874 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_58480 6570904 6571962 gene locus_tag LOCUS_58490 6570904 6571962 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897787.1 protein_id gnl|my_center|LOCUS_58490 6572627 6574060 gene locus_tag LOCUS_58500 6572627 6574060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58500 6574312 6577248 gene locus_tag LOCUS_58510 6574312 6577248 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_58510 6577261 6578232 gene locus_tag LOCUS_58520 6577261 6578232 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_58520 6578237 6579103 gene locus_tag LOCUS_58530 6578237 6579103 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_58530 6579117 6580586 gene locus_tag LOCUS_58540 6579117 6580586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58540 6580567 6581187 gene locus_tag LOCUS_58550 6580567 6581187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58550 6581202 6583775 gene locus_tag LOCUS_58560 6581202 6583775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58560 6583775 6584680 gene locus_tag LOCUS_58570 6583775 6584680 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_58570 6584702 6585700 gene locus_tag LOCUS_58580 6584702 6585700 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_58580 6585726 6587441 gene locus_tag LOCUS_58590 6585726 6587441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58590 6587468 6588499 gene locus_tag LOCUS_58600 6587468 6588499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58600 6588729 6589310 gene locus_tag LOCUS_58610 6588729 6589310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58610 6590015 6589395 gene locus_tag LOCUS_58620 gene lexA 6590015 6589395 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 protein_id gnl|my_center|LOCUS_58620 6590338 6590583 gene locus_tag LOCUS_58630 6590338 6590583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58630 6590769 6590975 gene locus_tag LOCUS_58640 6590769 6590975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58640 6591079 6592065 gene locus_tag LOCUS_58650 6591079 6592065 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727584.1 protein_id gnl|my_center|LOCUS_58650 6592126 6592644 gene locus_tag LOCUS_58660 6592126 6592644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58660 6592669 6593454 gene locus_tag LOCUS_58670 6592669 6593454 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398978.1 protein_id gnl|my_center|LOCUS_58670 6594349 6593789 gene locus_tag LOCUS_58680 6594349 6593789 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057305.1 protein_id gnl|my_center|LOCUS_58680 6594556 6597993 gene locus_tag LOCUS_58690 gene metH 6594556 6597993 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271582.1 protein_id gnl|my_center|LOCUS_58690 6598093 6599031 gene locus_tag LOCUS_58700 gene rnz 6598093 6599031 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989857.1 protein_id gnl|my_center|LOCUS_58700 6599117 6600091 gene locus_tag LOCUS_58710 6599117 6600091 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723878.1 protein_id gnl|my_center|LOCUS_58710 6600390 6600548 gene locus_tag LOCUS_58720 6600390 6600548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 6600807 6603056 gene locus_tag LOCUS_58730 gene mrfA 6600807 6603056 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_58730 6603147 6604745 gene locus_tag LOCUS_58740 6603147 6604745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58740 6604751 6605560 gene locus_tag LOCUS_58750 6604751 6605560 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276467.1 protein_id gnl|my_center|LOCUS_58750 6605695 6606537 gene locus_tag LOCUS_58760 gene mutM 6605695 6606537 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114480.1 protein_id gnl|my_center|LOCUS_58760 6606544 6607386 gene locus_tag LOCUS_58770 6606544 6607386 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_58770 6607383 6607688 gene locus_tag LOCUS_58780 6607383 6607688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103775.1 protein_id gnl|my_center|LOCUS_58780 6607709 6608488 gene locus_tag LOCUS_58790 6607709 6608488 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232156.1 protein_id gnl|my_center|LOCUS_58790 6608489 6609511 gene locus_tag LOCUS_58800 6608489 6609511 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134749050.1 protein_id gnl|my_center|LOCUS_58800 6609642 6611285 gene locus_tag LOCUS_58810 6609642 6611285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58810 6611485 6612183 gene locus_tag LOCUS_58820 gene ykoG 6611485 6612183 CDS product two-component system response regulator YkoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232551.1 protein_id gnl|my_center|LOCUS_58820 6612180 6613538 gene locus_tag LOCUS_58830 gene ykoH 6612180 6613538 CDS product two-component system sensor histidine kinase YkoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245526.1 protein_id gnl|my_center|LOCUS_58830 6613563 6614426 gene locus_tag LOCUS_58840 6613563 6614426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58840 6614454 6615125 gene locus_tag LOCUS_58850 6614454 6615125 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245627.1 protein_id gnl|my_center|LOCUS_58850 6615144 6615812 gene locus_tag LOCUS_58860 6615144 6615812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58860 6615859 6616632 gene locus_tag LOCUS_58870 6615859 6616632 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257270.1 protein_id gnl|my_center|LOCUS_58870 6617075 6619081 gene locus_tag LOCUS_58880 6617075 6619081 CDS product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095164.1 protein_id gnl|my_center|LOCUS_58880 6619199 6619897 gene locus_tag LOCUS_58890 6619199 6619897 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312272.1 protein_id gnl|my_center|LOCUS_58890 6619894 6620376 gene locus_tag LOCUS_58900 6619894 6620376 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250910.1 protein_id gnl|my_center|LOCUS_58900 6621254 6620514 gene locus_tag LOCUS_58910 6621254 6620514 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084007.1 protein_id gnl|my_center|LOCUS_58910 6621638 6622705 gene locus_tag LOCUS_58920 gene pdhA 6621638 6622705 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222294.1 protein_id gnl|my_center|LOCUS_58920 6622750 6623727 gene locus_tag LOCUS_58930 gene pdhB 6622750 6623727 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232313.1 protein_id gnl|my_center|LOCUS_58930 6623789 6625111 gene locus_tag LOCUS_58940 6623789 6625111 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989651.1 protein_id gnl|my_center|LOCUS_58940 6625116 6626531 gene locus_tag LOCUS_58950 gene lpdA 6625116 6626531 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 protein_id gnl|my_center|LOCUS_58950 6626667 6627155 gene locus_tag LOCUS_58960 6626667 6627155 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244690.1 protein_id gnl|my_center|LOCUS_58960 6627216 6628178 gene locus_tag LOCUS_58970 gene thyA 6627216 6628178 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679609.1 protein_id gnl|my_center|LOCUS_58970 6628210 6628719 gene locus_tag LOCUS_58980 gene folA 6628210 6628719 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_58980 6628914 6630401 gene locus_tag LOCUS_58990 gene gltD 6628914 6630401 CDS product glutamate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231462.1 protein_id gnl|my_center|LOCUS_58990 6630595 6630912 gene locus_tag LOCUS_59000 6630595 6630912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59000 6631015 6632133 gene locus_tag LOCUS_59010 6631015 6632133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59010 6632178 6634661 gene locus_tag LOCUS_59020 6632178 6634661 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786535.1 protein_id gnl|my_center|LOCUS_59020 6635469 6634729 gene locus_tag LOCUS_59030 6635469 6634729 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_59030 6635595 6635729 gene locus_tag LOCUS_59040 6635595 6635729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59040 6636067 6635846 gene locus_tag LOCUS_59050 6636067 6635846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59050 6636240 6636965 gene locus_tag LOCUS_59060 gene phnC 6636240 6636965 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078092.1 protein_id gnl|my_center|LOCUS_59060 6636962 6637474 gene locus_tag LOCUS_59070 6636962 6637474 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808849.1 protein_id gnl|my_center|LOCUS_59070 6637563 6638180 gene locus_tag LOCUS_59080 6637563 6638180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59080 6638201 6638779 gene locus_tag LOCUS_59090 6638201 6638779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59090 6638924 6640630 gene locus_tag LOCUS_59100 6638924 6640630 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031371.1 protein_id gnl|my_center|LOCUS_59100 6640960 6641631 gene locus_tag LOCUS_59110 6640960 6641631 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262987.1 protein_id gnl|my_center|LOCUS_59110 6641641 6642675 gene locus_tag LOCUS_59120 6641641 6642675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59120 6642822 6643742 gene locus_tag LOCUS_59130 gene chbG 6642822 6643742 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593465.1 protein_id gnl|my_center|LOCUS_59130 6643966 6644976 gene locus_tag LOCUS_59140 6643966 6644976 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762079.1 protein_id gnl|my_center|LOCUS_59140 6645168 6647474 gene locus_tag LOCUS_59150 6645168 6647474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59150 6647605 6647892 gene locus_tag LOCUS_59160 6647605 6647892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59160 6647923 6648459 gene locus_tag LOCUS_59170 6647923 6648459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59170 6649532 6648531 gene locus_tag LOCUS_59180 6649532 6648531 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399008.1 protein_id gnl|my_center|LOCUS_59180 6649861 6650394 gene locus_tag LOCUS_59190 6649861 6650394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59190 6650747 6652495 gene locus_tag LOCUS_59200 6650747 6652495 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967136.1 protein_id gnl|my_center|LOCUS_59200 6652573 6654381 gene locus_tag LOCUS_59210 6652573 6654381 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232362.1 protein_id gnl|my_center|LOCUS_59210 6654647 6654919 gene locus_tag LOCUS_59220 6654647 6654919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59220 6655223 6656515 gene locus_tag LOCUS_59230 gene serS 6655223 6656515 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887919.1 protein_id gnl|my_center|LOCUS_59230 6656600 6657565 gene locus_tag LOCUS_59240 6656600 6657565 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258828.1 protein_id gnl|my_center|LOCUS_59240 6657590 6658684 gene locus_tag LOCUS_59250 6657590 6658684 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583075.1 protein_id gnl|my_center|LOCUS_59250 6658681 6659979 gene locus_tag LOCUS_59260 6658681 6659979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59260 6660064 6660414 gene locus_tag LOCUS_59270 6660064 6660414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59270 6660665 6661303 gene locus_tag LOCUS_59280 gene pucB 6660665 6661303 CDS product xanthine dehydrogenase accessory protein PucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706287.1 protein_id gnl|my_center|LOCUS_59280 6661485 6661985 gene locus_tag LOCUS_59290 gene uraD 6661485 6661985 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640536.1 protein_id gnl|my_center|LOCUS_59290 6662172 6662381 gene locus_tag LOCUS_59300 6662172 6662381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59300 6662603 6663937 gene locus_tag LOCUS_59310 6662603 6663937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59310 6664844 6664071 gene locus_tag LOCUS_59320 6664844 6664071 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723335.1 protein_id gnl|my_center|LOCUS_59320 6664978 6665934 gene locus_tag LOCUS_59330 6664978 6665934 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810429.1 protein_id gnl|my_center|LOCUS_59330 6666013 6667815 gene locus_tag LOCUS_59340 6666013 6667815 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453879.1 protein_id gnl|my_center|LOCUS_59340 6668148 6667993 gene locus_tag LOCUS_59350 6668148 6667993 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046095.1 protein_id gnl|my_center|LOCUS_59350 6668309 6669571 gene locus_tag LOCUS_59360 6668309 6669571 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289547.1 protein_id gnl|my_center|LOCUS_59360 6670523 6670050 gene locus_tag LOCUS_59370 6670523 6670050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59370 6670781 6671329 gene locus_tag LOCUS_59380 6670781 6671329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59380 6671392 6671721 gene locus_tag LOCUS_59390 6671392 6671721 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_59390 6671856 6674081 gene locus_tag LOCUS_59400 6671856 6674081 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005309.1 protein_id gnl|my_center|LOCUS_59400 6674148 6674348 gene locus_tag LOCUS_59410 gene copZ 6674148 6674348 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832344.1 protein_id gnl|my_center|LOCUS_59410 6674463 6676412 gene locus_tag LOCUS_59420 6674463 6676412 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493712.1 protein_id gnl|my_center|LOCUS_59420 6676471 6677196 gene locus_tag LOCUS_59430 6676471 6677196 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841307.1 protein_id gnl|my_center|LOCUS_59430 6677193 6677675 gene locus_tag LOCUS_59440 6677193 6677675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59440 6677929 6680826 gene locus_tag LOCUS_59450 gene sucA 6677929 6680826 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399330.1 protein_id gnl|my_center|LOCUS_59450 6680872 6682149 gene locus_tag LOCUS_59460 gene odhB 6680872 6682149 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569898.1 protein_id gnl|my_center|LOCUS_59460 6682308 6683624 gene locus_tag LOCUS_59470 gene dgt 6682308 6683624 CDS product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185138301.1 protein_id gnl|my_center|LOCUS_59470 6683949 6684632 gene locus_tag LOCUS_59480 6683949 6684632 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041856.1 protein_id gnl|my_center|LOCUS_59480 6684629 6686440 gene locus_tag LOCUS_59490 6684629 6686440 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225342.1 protein_id gnl|my_center|LOCUS_59490 6686739 6687275 gene locus_tag LOCUS_59500 6686739 6687275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59500 6687300 6688169 gene locus_tag LOCUS_59510 6687300 6688169 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814244.1 protein_id gnl|my_center|LOCUS_59510 6688180 6689058 gene locus_tag LOCUS_59520 6688180 6689058 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814246.1 protein_id gnl|my_center|LOCUS_59520 6689086 6690183 gene locus_tag LOCUS_59530 6689086 6690183 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244902.1 protein_id gnl|my_center|LOCUS_59530 6690215 6691684 gene locus_tag LOCUS_59540 6690215 6691684 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814254.1 protein_id gnl|my_center|LOCUS_59540 6693107 6691770 gene locus_tag LOCUS_59550 6693107 6691770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59550 6694705 6694295 gene locus_tag LOCUS_59560 6694705 6694295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59560 6694752 6694919 gene locus_tag LOCUS_59570 6694752 6694919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59570 6694969 6695670 gene locus_tag LOCUS_59580 6694969 6695670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59580 6695683 6695910 gene locus_tag LOCUS_59590 6695683 6695910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59590 6696008 6696943 gene locus_tag LOCUS_59600 6696008 6696943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59600 6697044 6697538 gene locus_tag LOCUS_59610 gene bsaA 6697044 6697538 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219417.1 protein_id gnl|my_center|LOCUS_59610 6698965 6697622 gene locus_tag LOCUS_59620 6698965 6697622 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096830.1 protein_id gnl|my_center|LOCUS_59620 6699254 6699475 gene locus_tag LOCUS_59630 6699254 6699475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59630 6700475 6699576 gene locus_tag LOCUS_59640 6700475 6699576 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123503.1 protein_id gnl|my_center|LOCUS_59640 6700635 6701222 gene locus_tag LOCUS_59650 gene adaA 6700635 6701222 CDS product bifunctional transcriptional activator/DNA repair enzyme AdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234924.1 protein_id gnl|my_center|LOCUS_59650 6701224 6701733 gene locus_tag LOCUS_59660 gene adaB 6701224 6701733 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246311.1 protein_id gnl|my_center|LOCUS_59660 6701730 6703052 gene locus_tag LOCUS_59670 6701730 6703052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59670 6703054 6703701 gene locus_tag LOCUS_59680 6703054 6703701 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_59680 6703927 6705003 gene locus_tag LOCUS_59690 6703927 6705003 CDS product DoxX-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823951.1 protein_id gnl|my_center|LOCUS_59690 6705000 6705623 gene locus_tag LOCUS_59700 6705000 6705623 CDS product DUF4166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227829.1 protein_id gnl|my_center|LOCUS_59700 6705767 6706063 gene locus_tag LOCUS_59710 6705767 6706063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59710 6706171 6706497 gene locus_tag LOCUS_59720 6706171 6706497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59720 6706710 6707588 gene locus_tag LOCUS_59730 6706710 6707588 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713634.1 protein_id gnl|my_center|LOCUS_59730 6707612 6709543 gene locus_tag LOCUS_59740 gene ltaP 6707612 6709543 CDS product lipoteichoic acid primase LtaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931059.1 protein_id gnl|my_center|LOCUS_59740 6709860 6710582 gene locus_tag LOCUS_59750 6709860 6710582 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206332.1 protein_id gnl|my_center|LOCUS_59750 6710650 6711300 gene locus_tag LOCUS_59760 6710650 6711300 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_59760 6711353 6715069 gene locus_tag LOCUS_59770 gene uca 6711353 6715069 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140960.1 protein_id gnl|my_center|LOCUS_59770 6715066 6717093 gene locus_tag LOCUS_59780 gene atzF 6715066 6717093 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140963.1 protein_id gnl|my_center|LOCUS_59780 6717232 6717828 gene locus_tag LOCUS_59790 6717232 6717828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59790 6718582 6717962 gene locus_tag LOCUS_59800 6718582 6717962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59800 6718681 6719541 gene locus_tag LOCUS_59810 6718681 6719541 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393906.1 protein_id gnl|my_center|LOCUS_59810 6719538 6721427 gene locus_tag LOCUS_59820 6719538 6721427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59820 6721488 6722558 gene locus_tag LOCUS_59830 6721488 6722558 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775666.1 protein_id gnl|my_center|LOCUS_59830 6722630 6723271 gene locus_tag LOCUS_59840 6722630 6723271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59840 6724327 6723341 gene locus_tag LOCUS_59850 6724327 6723341 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808254.1 protein_id gnl|my_center|LOCUS_59850 6724521 6724667 gene locus_tag LOCUS_59860 6724521 6724667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59860 6724791 6725213 gene locus_tag LOCUS_59870 6724791 6725213 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437765.1 protein_id gnl|my_center|LOCUS_59870 6725215 6725568 gene locus_tag LOCUS_59880 6725215 6725568 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_59880 6725664 6726452 gene locus_tag LOCUS_59890 6725664 6726452 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066690.1 protein_id gnl|my_center|LOCUS_59890 6726533 6727264 gene locus_tag LOCUS_59900 6726533 6727264 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232774.1 protein_id gnl|my_center|LOCUS_59900 6727264 6728022 gene locus_tag LOCUS_59910 gene fetB 6727264 6728022 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232776.1 protein_id gnl|my_center|LOCUS_59910 6728082 6729002 gene locus_tag LOCUS_59920 6728082 6729002 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_59920 6729332 6730129 gene locus_tag LOCUS_59930 6729332 6730129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59930 6731984 6730212 gene locus_tag LOCUS_59940 6731984 6730212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59940 6732307 6732086 gene locus_tag LOCUS_59950 6732307 6732086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59950 6732192 6732569 gene locus_tag LOCUS_59960 6732192 6732569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59960 6732694 6733932 gene locus_tag LOCUS_59970 6732694 6733932 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272582.1 protein_id gnl|my_center|LOCUS_59970 6734044 6734331 gene locus_tag LOCUS_59980 6734044 6734331 CDS product HesB/YadR/YfhF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054445.1 protein_id gnl|my_center|LOCUS_59980 6734376 6734897 gene locus_tag LOCUS_59990 6734376 6734897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231066.1 protein_id gnl|my_center|LOCUS_59990 6735046 6735921 gene locus_tag LOCUS_60000 6735046 6735921 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643080.1 protein_id gnl|my_center|LOCUS_60000 6736155 6737066 gene locus_tag LOCUS_60010 gene rocF 6736155 6737066 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711563.1 protein_id gnl|my_center|LOCUS_60010 6737161 6738360 gene locus_tag LOCUS_60020 gene rocD 6737161 6738360 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242970.1 protein_id gnl|my_center|LOCUS_60020 6738393 6739406 gene locus_tag LOCUS_60030 gene rocF 6738393 6739406 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808692.1 protein_id gnl|my_center|LOCUS_60030 6739612 6740529 gene locus_tag LOCUS_60040 6739612 6740529 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_60040 6740574 6742148 gene locus_tag LOCUS_60050 gene pruA 6740574 6742148 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259550.1 protein_id gnl|my_center|LOCUS_60050 6742400 6743803 gene locus_tag LOCUS_60060 6742400 6743803 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975860.1 protein_id gnl|my_center|LOCUS_60060 6744074 6743928 gene locus_tag LOCUS_60070 6744074 6743928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60070 6744226 6744035 gene locus_tag LOCUS_60080 6744226 6744035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60080 6744359 6745423 gene locus_tag LOCUS_60090 6744359 6745423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60090 6745511 6746617 gene locus_tag LOCUS_60100 6745511 6746617 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_60100 6746756 6747559 gene locus_tag LOCUS_60110 6746756 6747559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60110 6747582 6749045 gene locus_tag LOCUS_60120 6747582 6749045 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001443162.1 protein_id gnl|my_center|LOCUS_60120 6749038 6750036 gene locus_tag LOCUS_60130 6749038 6750036 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_60130 6750070 6750630 gene locus_tag LOCUS_60140 gene cysC 6750070 6750630 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140515.1 protein_id gnl|my_center|LOCUS_60140 6750632 6752056 gene locus_tag LOCUS_60150 6750632 6752056 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332236.1 protein_id gnl|my_center|LOCUS_60150 6752115 6752999 gene locus_tag LOCUS_60160 6752115 6752999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60160 6753030 6754457 gene locus_tag LOCUS_60170 6753030 6754457 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766268.1 protein_id gnl|my_center|LOCUS_60170 6754730 6755755 gene locus_tag LOCUS_60180 6754730 6755755 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215631.1 protein_id gnl|my_center|LOCUS_60180 6755824 6756096 gene locus_tag LOCUS_60190 6755824 6756096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60190 6756232 6756666 gene locus_tag LOCUS_60200 6756232 6756666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60200 6757020 6756853 gene locus_tag LOCUS_60210 6757020 6756853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60210 6757206 6759026 gene locus_tag LOCUS_60220 gene vmlR 6757206 6759026 CDS product ABC-F type ribosomal protection protein VmlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234144.1 protein_id gnl|my_center|LOCUS_60220 6759077 6759574 gene locus_tag LOCUS_60230 6759077 6759574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60230 6759676 6760401 gene locus_tag LOCUS_60240 6759676 6760401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60240 6760504 6760902 gene locus_tag LOCUS_60250 6760504 6760902 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594462.1 protein_id gnl|my_center|LOCUS_60250 6761124 6761864 gene locus_tag LOCUS_60260 6761124 6761864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60260 6762786 6761950 gene locus_tag LOCUS_60270 6762786 6761950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60270 6762975 6763895 gene locus_tag LOCUS_60280 6762975 6763895 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886400.1 protein_id gnl|my_center|LOCUS_60280 6763892 6764905 gene locus_tag LOCUS_60290 6763892 6764905 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234649.1 protein_id gnl|my_center|LOCUS_60290 6766645 6764966 gene locus_tag LOCUS_60300 6766645 6764966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_60300 6773355 6766642 gene locus_tag LOCUS_60310 6773355 6766642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_60310 6774067 6773426 gene locus_tag LOCUS_60320 6774067 6773426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60320 6774731 6774207 gene locus_tag LOCUS_60330 6774731 6774207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60330 6775479 6775012 gene locus_tag LOCUS_60340 6775479 6775012 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897021.1 protein_id gnl|my_center|LOCUS_60340 6776210 6775653 gene locus_tag LOCUS_60350 6776210 6775653 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880650.1 protein_id gnl|my_center|LOCUS_60350 6776404 6777378 gene locus_tag LOCUS_60360 6776404 6777378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60360 6777601 6778032 gene locus_tag LOCUS_60370 6777601 6778032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60370 6778641 6778483 gene locus_tag LOCUS_60380 6778641 6778483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60380 6778776 6779477 gene locus_tag LOCUS_60390 6778776 6779477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60390 6779723 6780703 gene locus_tag LOCUS_60400 6779723 6780703 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947043.1 protein_id gnl|my_center|LOCUS_60400 6780824 6781369 gene locus_tag LOCUS_60410 6780824 6781369 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145144.1 protein_id gnl|my_center|LOCUS_60410 6781696 6781526 gene locus_tag LOCUS_60420 6781696 6781526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60420 6782066 6783484 gene locus_tag LOCUS_60430 6782066 6783484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60430 6783612 6784316 gene locus_tag LOCUS_60440 6783612 6784316 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583993.1 protein_id gnl|my_center|LOCUS_60440 6785092 6784412 gene locus_tag LOCUS_60450 6785092 6784412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60450 6786771 6785302 gene locus_tag LOCUS_60460 6786771 6785302 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966741.1 protein_id gnl|my_center|LOCUS_60460 6787561 6786929 gene locus_tag LOCUS_60470 6787561 6786929 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028098.1 protein_id gnl|my_center|LOCUS_60470 6787976 6787689 gene locus_tag LOCUS_60480 6787976 6787689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60480 6788192 6789283 gene locus_tag LOCUS_60490 6788192 6789283 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989410.1 protein_id gnl|my_center|LOCUS_60490 6789486 6790757 gene locus_tag LOCUS_60500 6789486 6790757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60500 6790772 6791920 gene locus_tag LOCUS_60510 6790772 6791920 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392037.1 protein_id gnl|my_center|LOCUS_60510 6792111 6793664 gene locus_tag LOCUS_60520 gene gerSA 6792111 6793664 CDS product spore germination protein GerSA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528995.1 protein_id gnl|my_center|LOCUS_60520 6793661 6794779 gene locus_tag LOCUS_60530 6793661 6794779 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166522.1 protein_id gnl|my_center|LOCUS_60530 6794776 6795912 gene locus_tag LOCUS_60540 gene gerAC 6794776 6795912 CDS product spore germination receptor protein GerAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968146.1 protein_id gnl|my_center|LOCUS_60540 6796013 6796816 gene locus_tag LOCUS_60550 6796013 6796816 CDS product DUF2935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440988.1 protein_id gnl|my_center|LOCUS_60550 6796981 6798537 gene locus_tag LOCUS_60560 6796981 6798537 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233752.1 protein_id gnl|my_center|LOCUS_60560 6799969 6798620 gene locus_tag LOCUS_60570 gene dnaA 6799969 6798620 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428017.1 protein_id gnl|my_center|LOCUS_60570 6801005 6800145 gene locus_tag LOCUS_60580 gene rhaR 6801005 6800145 CDS product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230731.1 protein_id gnl|my_center|LOCUS_60580 6801160 6803976 gene locus_tag LOCUS_60590 6801160 6803976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60590 6804063 6806474 gene locus_tag LOCUS_60600 6804063 6806474 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_60600 6808457 6806634 gene locus_tag LOCUS_60610 6808457 6806634 CDS product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470210.1 protein_id gnl|my_center|LOCUS_60610 6808602 6810149 gene locus_tag LOCUS_60620 6808602 6810149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60620 6810244 6810474 gene locus_tag LOCUS_60630 6810244 6810474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60630 6810523 6812259 gene locus_tag LOCUS_60640 6810523 6812259 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_60640 6812277 6812735 gene locus_tag LOCUS_60650 6812277 6812735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60650 6812975 6813334 gene locus_tag LOCUS_60660 6812975 6813334 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721986.1 protein_id gnl|my_center|LOCUS_60660 6813418 6814182 gene locus_tag LOCUS_60670 6813418 6814182 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_60670 6815019 6815369 gene locus_tag LOCUS_60680 6815019 6815369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60680 6815404 6816114 gene locus_tag LOCUS_60690 6815404 6816114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60690 6817746 6816637 gene locus_tag LOCUS_60700 gene xerS 6817746 6816637 CDS product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817882.1 protein_id gnl|my_center|LOCUS_60700 6818591 6817824 gene locus_tag LOCUS_60710 6818591 6817824 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_60710 6818859 6819224 gene locus_tag LOCUS_60720 6818859 6819224 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948844.1 protein_id gnl|my_center|LOCUS_60720 6819227 6820120 gene locus_tag LOCUS_60730 6819227 6820120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804332.1 protein_id gnl|my_center|LOCUS_60730 6820117 6820809 gene locus_tag LOCUS_60740 6820117 6820809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60740 6820936 6821595 gene locus_tag LOCUS_60750 gene sleB 6820936 6821595 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815363.1 protein_id gnl|my_center|LOCUS_60750 6821829 6823232 gene locus_tag LOCUS_60760 6821829 6823232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60760 6823378 6823923 gene locus_tag LOCUS_60770 6823378 6823923 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459074.1 protein_id gnl|my_center|LOCUS_60770 6824583 6824098 gene locus_tag LOCUS_60780 6824583 6824098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60780 6824830 6825816 gene locus_tag LOCUS_60790 gene msrB 6824830 6825816 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261262.1 protein_id gnl|my_center|LOCUS_60790 6825998 6827137 gene locus_tag LOCUS_60800 6825998 6827137 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815413.1 protein_id gnl|my_center|LOCUS_60800 6828393 6827314 gene locus_tag LOCUS_60810 6828393 6827314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229181.1 protein_id gnl|my_center|LOCUS_60810 6828541 6828999 gene locus_tag LOCUS_60820 6828541 6828999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60820 6829672 6829034 gene locus_tag LOCUS_60830 6829672 6829034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60830 6829801 6830070 gene locus_tag LOCUS_60840 6829801 6830070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60840 6830100 6830405 gene locus_tag LOCUS_60850 6830100 6830405 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966071.1 protein_id gnl|my_center|LOCUS_60850 6830435 6830755 gene locus_tag LOCUS_60860 6830435 6830755 CDS product DUF5519 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010325.1 protein_id gnl|my_center|LOCUS_60860 6831006 6832025 gene locus_tag LOCUS_60870 6831006 6832025 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228234.1 protein_id gnl|my_center|LOCUS_60870 6832342 6832109 gene locus_tag LOCUS_60880 6832342 6832109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60880 6832482 6834665 gene locus_tag LOCUS_60890 6832482 6834665 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245424.1 protein_id gnl|my_center|LOCUS_60890 6834887 6835327 gene locus_tag LOCUS_60900 6834887 6835327 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243655.1 protein_id gnl|my_center|LOCUS_60900 6835425 6836888 gene locus_tag LOCUS_60910 6835425 6836888 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392514.1 protein_id gnl|my_center|LOCUS_60910 6836923 6837849 gene locus_tag LOCUS_60920 6836923 6837849 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733747.1 protein_id gnl|my_center|LOCUS_60920 6838008 6838310 gene locus_tag LOCUS_60930 6838008 6838310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60930 6838534 6840150 gene locus_tag LOCUS_60940 6838534 6840150 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_60940 6840152 6841975 gene locus_tag LOCUS_60950 gene yesM 6840152 6841975 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_60950 6842050 6843759 gene locus_tag LOCUS_60960 6842050 6843759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60960 6844372 6845310 gene locus_tag LOCUS_60970 6844372 6845310 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_60970 6845340 6846218 gene locus_tag LOCUS_60980 6845340 6846218 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_60980 6846300 6848105 gene locus_tag LOCUS_60990 6846300 6848105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60990 6848339 6850594 gene locus_tag LOCUS_61000 6848339 6850594 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259698.1 protein_id gnl|my_center|LOCUS_61000 6850591 6851877 gene locus_tag LOCUS_61010 6850591 6851877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61010 6852262 6851984 gene locus_tag LOCUS_61020 6852262 6851984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61020 6852483 6852977 gene locus_tag LOCUS_61030 6852483 6852977 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872890.1 protein_id gnl|my_center|LOCUS_61030 6853496 6852978 gene locus_tag LOCUS_61040 6853496 6852978 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400636.1 protein_id gnl|my_center|LOCUS_61040 6853663 6854160 gene locus_tag LOCUS_61050 6853663 6854160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61050 6855070 6854297 gene locus_tag LOCUS_61060 6855070 6854297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61060 6855657 6855085 gene locus_tag LOCUS_61070 6855657 6855085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61070 6856167 6855826 gene locus_tag LOCUS_61080 6856167 6855826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61080 6856510 6857304 gene locus_tag LOCUS_61090 6856510 6857304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61090 6857825 6857589 gene locus_tag LOCUS_61100 6857825 6857589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61100 6858249 6859175 gene locus_tag LOCUS_61110 6858249 6859175 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774253.1 protein_id gnl|my_center|LOCUS_61110 6859209 6859439 gene locus_tag LOCUS_61120 6859209 6859439 CDS product cysteine-rich CWC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895521.1 protein_id gnl|my_center|LOCUS_61120 6859573 6861327 gene locus_tag LOCUS_61130 6859573 6861327 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_61130 6861324 6862709 gene locus_tag LOCUS_61140 6861324 6862709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61140 6862936 6864741 gene locus_tag LOCUS_61150 6862936 6864741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61150 6864812 6865723 gene locus_tag LOCUS_61160 gene rmgP 6864812 6865723 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_61160 6865745 6866632 gene locus_tag LOCUS_61170 6865745 6866632 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_61170 6866840 6867439 gene locus_tag LOCUS_61180 6866840 6867439 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581301.1 protein_id gnl|my_center|LOCUS_61180 6873739 6867590 gene locus_tag LOCUS_61190 6873739 6867590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61190 6875606 6873864 gene locus_tag LOCUS_61200 6875606 6873864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61200 6879065 6875763 gene locus_tag LOCUS_61210 6879065 6875763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61210 6882179 6879498 gene locus_tag LOCUS_61220 6882179 6879498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61220 6882409 6883299 gene locus_tag LOCUS_61230 6882409 6883299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61230 6883752 6883453 gene locus_tag LOCUS_61240 6883752 6883453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61240 6884426 6884040 gene locus_tag LOCUS_61250 6884426 6884040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61250 6884633 6884818 gene locus_tag LOCUS_61260 6884633 6884818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61260 6884944 6885528 gene locus_tag LOCUS_61270 6884944 6885528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61270 6887805 6885583 gene locus_tag LOCUS_61280 6887805 6885583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61280 6888181 6889317 gene locus_tag LOCUS_61290 6888181 6889317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61290 6889678 6889502 gene locus_tag LOCUS_61300 6889678 6889502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61300 6889634 6890257 gene locus_tag LOCUS_61310 6889634 6890257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61310 6890283 6891632 gene locus_tag LOCUS_61320 6890283 6891632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61320 6891749 6892297 gene locus_tag LOCUS_61330 6891749 6892297 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134951.1 protein_id gnl|my_center|LOCUS_61330 6892309 6892767 gene locus_tag LOCUS_61340 6892309 6892767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61340 6894133 6892772 gene locus_tag LOCUS_61350 6894133 6892772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545590.1 protein_id gnl|my_center|LOCUS_61350 6894352 6894972 gene locus_tag LOCUS_61360 6894352 6894972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61360 6895230 6896501 gene locus_tag LOCUS_61370 gene hisS 6895230 6896501 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425978.1 protein_id gnl|my_center|LOCUS_61370 6897183 6896596 gene locus_tag LOCUS_61380 6897183 6896596 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190407.1 protein_id gnl|my_center|LOCUS_61380 6897267 6898391 gene locus_tag LOCUS_61390 gene msrB 6897267 6898391 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261262.1 protein_id gnl|my_center|LOCUS_61390 6899172 6898426 gene locus_tag LOCUS_61400 6899172 6898426 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107575.1 protein_id gnl|my_center|LOCUS_61400 6899330 6900388 gene locus_tag LOCUS_61410 6899330 6900388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61410 6900462 6901220 gene locus_tag LOCUS_61420 6900462 6901220 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726700.1 protein_id gnl|my_center|LOCUS_61420 6901578 6902855 gene locus_tag LOCUS_61430 6901578 6902855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61430 6902806 6903843 gene locus_tag LOCUS_61440 6902806 6903843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61440 6903882 6904241 gene locus_tag LOCUS_61450 6903882 6904241 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645057.1 protein_id gnl|my_center|LOCUS_61450 6905066 6904344 gene locus_tag LOCUS_61460 6905066 6904344 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590206.1 protein_id gnl|my_center|LOCUS_61460 6906555 6905059 gene locus_tag LOCUS_61470 6906555 6905059 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649908.1 protein_id gnl|my_center|LOCUS_61470 6906747 6909347 gene locus_tag LOCUS_61480 6906747 6909347 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948680.1 protein_id gnl|my_center|LOCUS_61480 6909556 6910677 gene locus_tag LOCUS_61490 6909556 6910677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61490 6910735 6911313 gene locus_tag LOCUS_61500 6910735 6911313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61500 6911664 6912812 gene locus_tag LOCUS_61510 6911664 6912812 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393190.1 protein_id gnl|my_center|LOCUS_61510 6912816 6913478 gene locus_tag LOCUS_61520 gene opuCB 6912816 6913478 CDS product glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228349.1 protein_id gnl|my_center|LOCUS_61520 6913493 6914392 gene locus_tag LOCUS_61530 gene opuBC 6913493 6914392 CDS product choline ABC transporter substrate-binding lipoprotein OpuBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228372.1 protein_id gnl|my_center|LOCUS_61530 6914405 6915100 gene locus_tag LOCUS_61540 gene opuCD 6914405 6915100 CDS product glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244403.1 protein_id gnl|my_center|LOCUS_61540 6915299 6916012 gene locus_tag LOCUS_61550 gene deoD 6915299 6916012 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110707.1 protein_id gnl|my_center|LOCUS_61550 6916211 6916441 gene locus_tag LOCUS_61560 6916211 6916441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61560 6916861 6916613 gene locus_tag LOCUS_61570 6916861 6916613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61570 6917184 6916864 gene locus_tag LOCUS_61580 6917184 6916864 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979093.1 protein_id gnl|my_center|LOCUS_61580 6919515 6917323 gene locus_tag LOCUS_61590 6919515 6917323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61590 6920572 6919640 gene locus_tag LOCUS_61600 6920572 6919640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61600 6921550 6920621 gene locus_tag LOCUS_61610 6921550 6920621 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243358.1 protein_id gnl|my_center|LOCUS_61610 6921780 6921856 gene locus_tag LOCUS_t01210 6921780 6921856 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 6921929 6922885 gene locus_tag LOCUS_61620 gene gluQRS 6921929 6922885 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_61620 6922960 6923439 gene locus_tag LOCUS_61630 6922960 6923439 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494335.1 protein_id gnl|my_center|LOCUS_61630 6924334 6923504 gene locus_tag LOCUS_61640 6924334 6923504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61640 6924473 6925315 gene locus_tag LOCUS_61650 6924473 6925315 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803678.1 protein_id gnl|my_center|LOCUS_61650 6925779 6927221 gene locus_tag LOCUS_61660 6925779 6927221 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083410.1 protein_id gnl|my_center|LOCUS_61660 6927517 6927981 gene locus_tag LOCUS_61670 6927517 6927981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61670 6928045 6928503 gene locus_tag LOCUS_61680 6928045 6928503 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082141.1 protein_id gnl|my_center|LOCUS_61680 6928564 6929283 gene locus_tag LOCUS_61690 6928564 6929283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61690 6929437 6929652 gene locus_tag LOCUS_61700 6929437 6929652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61700 6929884 6931350 gene locus_tag LOCUS_61710 6929884 6931350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61710 6931350 6932318 gene locus_tag LOCUS_61720 6931350 6932318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61720 6935096 6932850 gene locus_tag LOCUS_61730 6935096 6932850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61730 6935322 6936941 gene locus_tag LOCUS_61740 6935322 6936941 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_61740 6937275 6938174 gene locus_tag LOCUS_61750 6937275 6938174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61750 6938171 6939397 gene locus_tag LOCUS_61760 6938171 6939397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61760 6939416 6939733 gene locus_tag LOCUS_61770 6939416 6939733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61770 6939730 6940566 gene locus_tag LOCUS_61780 6939730 6940566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61780 6940768 6944523 gene locus_tag LOCUS_61790 6940768 6944523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61790 6944559 6946577 gene locus_tag LOCUS_61800 6944559 6946577 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836949.1 protein_id gnl|my_center|LOCUS_61800 6946784 6948226 gene locus_tag LOCUS_61810 6946784 6948226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61810 6948319 6949758 gene locus_tag LOCUS_61820 6948319 6949758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61820 6950005 6951012 gene locus_tag LOCUS_61830 6950005 6951012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61830 6951227 6953332 gene locus_tag LOCUS_61840 6951227 6953332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61840 6953544 6954695 gene locus_tag LOCUS_61850 6953544 6954695 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257480.1 protein_id gnl|my_center|LOCUS_61850 6954713 6955882 gene locus_tag LOCUS_61860 6954713 6955882 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067534.1 protein_id gnl|my_center|LOCUS_61860 6955898 6956719 gene locus_tag LOCUS_61870 6955898 6956719 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228703.1 protein_id gnl|my_center|LOCUS_61870 6956753 6957550 gene locus_tag LOCUS_61880 6956753 6957550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61880 6957573 6958394 gene locus_tag LOCUS_61890 6957573 6958394 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976046.1 protein_id gnl|my_center|LOCUS_61890 6958391 6959473 gene locus_tag LOCUS_61900 6958391 6959473 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776742.1 protein_id gnl|my_center|LOCUS_61900 6960745 6959597 gene locus_tag LOCUS_61910 6960745 6959597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61910 6960747 6960929 gene locus_tag LOCUS_61920 6960747 6960929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61920 6961110 6962579 gene locus_tag LOCUS_61930 6961110 6962579 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425823.1 protein_id gnl|my_center|LOCUS_61930 6962677 6963486 gene locus_tag LOCUS_61940 6962677 6963486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61940 6963534 6964409 gene locus_tag LOCUS_61950 6963534 6964409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61950 6966165 6964630 gene locus_tag LOCUS_61960 6966165 6964630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61960 6966658 6967083 gene locus_tag LOCUS_61970 6966658 6967083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61970 6967339 6968958 gene locus_tag LOCUS_61980 6967339 6968958 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288004.1 protein_id gnl|my_center|LOCUS_61980 6968965 6970746 gene locus_tag LOCUS_61990 6968965 6970746 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_61990 6970743 6971729 gene locus_tag LOCUS_62000 6970743 6971729 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_62000 6972180 6973709 gene locus_tag LOCUS_62010 gene gguA 6972180 6973709 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_62010 6973712 6974725 gene locus_tag LOCUS_62020 6973712 6974725 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 protein_id gnl|my_center|LOCUS_62020 6974817 6975845 gene locus_tag LOCUS_62030 6974817 6975845 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_62030 6977149 6976229 gene locus_tag LOCUS_62040 6977149 6976229 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211478109.1 protein_id gnl|my_center|LOCUS_62040 6978033 6977146 gene locus_tag LOCUS_62050 6978033 6977146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62050 6979522 6978206 gene locus_tag LOCUS_62060 6979522 6978206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62060 6979935 6979735 gene locus_tag LOCUS_62070 6979935 6979735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62070 6980037 6980210 gene locus_tag LOCUS_62080 6980037 6980210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62080 6980278 6981186 gene locus_tag LOCUS_62090 6980278 6981186 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612250.1 protein_id gnl|my_center|LOCUS_62090 6981263 6981706 gene locus_tag LOCUS_62100 gene cwlJ 6981263 6981706 CDS product cell wall hydrolase CwlJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246500.1 protein_id gnl|my_center|LOCUS_62100 6981949 6982872 gene locus_tag LOCUS_62110 6981949 6982872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62110 6983033 6984541 gene locus_tag LOCUS_62120 6983033 6984541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62120 6984796 6985305 gene locus_tag LOCUS_62130 6984796 6985305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62130 6985308 6986879 gene locus_tag LOCUS_62140 gene mdtP 6985308 6986879 CDS product multidrug efflux MFS transporter MdtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228559.1 protein_id gnl|my_center|LOCUS_62140 6987090 6988067 gene locus_tag LOCUS_62150 6987090 6988067 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559357.1 protein_id gnl|my_center|LOCUS_62150 6988306 6988716 gene locus_tag LOCUS_62160 6988306 6988716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62160 6988858 6989841 gene locus_tag LOCUS_62170 6988858 6989841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775834.1 protein_id gnl|my_center|LOCUS_62170 6990191 6991105 gene locus_tag LOCUS_62180 6990191 6991105 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972041.1 protein_id gnl|my_center|LOCUS_62180 6991256 6991474 gene locus_tag LOCUS_62190 6991256 6991474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62190 6991949 6995332 gene locus_tag LOCUS_62200 6991949 6995332 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_62200 6995353 6995910 gene locus_tag LOCUS_62210 6995353 6995910 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_62210 6996145 6996762 gene locus_tag LOCUS_62220 6996145 6996762 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216917.1 protein_id gnl|my_center|LOCUS_62220 6997103 6998821 gene locus_tag LOCUS_62230 gene argS 6997103 6998821 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_62230 6998896 6999993 gene locus_tag LOCUS_62240 6998896 6999993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62240 7001560 7000007 gene locus_tag LOCUS_62250 gene spoVB 7001560 7000007 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198280.1 protein_id gnl|my_center|LOCUS_62250 7001759 7002757 gene locus_tag LOCUS_62260 7001759 7002757 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006494597.1 protein_id gnl|my_center|LOCUS_62260 7002957 7004291 gene locus_tag LOCUS_62270 7002957 7004291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62270 7004528 7005616 gene locus_tag LOCUS_62280 7004528 7005616 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_62280 7005691 7008174 gene locus_tag LOCUS_62290 7005691 7008174 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_62290 7008435 7010012 gene locus_tag LOCUS_62300 7008435 7010012 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527968.1 protein_id gnl|my_center|LOCUS_62300 7010881 7010180 gene locus_tag LOCUS_62310 7010881 7010180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62310 7011369 7012151 gene locus_tag LOCUS_62320 7011369 7012151 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088380.1 protein_id gnl|my_center|LOCUS_62320 7012239 7014248 gene locus_tag LOCUS_62330 gene yagF 7012239 7014248 CDS product xylonate dehydratase YagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095374.1 protein_id gnl|my_center|LOCUS_62330 7014285 7015118 gene locus_tag LOCUS_62340 7014285 7015118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62340 7015288 7016400 gene locus_tag LOCUS_62350 gene hppD 7015288 7016400 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810922.1 protein_id gnl|my_center|LOCUS_62350 7016438 7017712 gene locus_tag LOCUS_62360 7016438 7017712 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_62360 7017725 7019713 gene locus_tag LOCUS_62370 7017725 7019713 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806472.1 protein_id gnl|my_center|LOCUS_62370 7019765 7020727 gene locus_tag LOCUS_62380 7019765 7020727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840171.1 protein_id gnl|my_center|LOCUS_62380 7020732 7022009 gene locus_tag LOCUS_62390 gene fahA 7020732 7022009 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015939.1 protein_id gnl|my_center|LOCUS_62390 7022038 7023810 gene locus_tag LOCUS_62400 7022038 7023810 CDS product aromatic amino acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163226.1 protein_id gnl|my_center|LOCUS_62400 7024973 7024566 gene locus_tag LOCUS_62410 7024973 7024566 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296336.1 protein_id gnl|my_center|LOCUS_62410 7026119 7025268 gene locus_tag LOCUS_62420 7026119 7025268 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080532.1 protein_id gnl|my_center|LOCUS_62420 7026991 7026152 gene locus_tag LOCUS_62430 7026991 7026152 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192727398.1 protein_id gnl|my_center|LOCUS_62430 7028462 7027017 gene locus_tag LOCUS_62440 gene lmr(B) 7028462 7027017 CDS product lincomycin efflux MFS transporter Lmr(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886396.1 protein_id gnl|my_center|LOCUS_62440 7029062 7028541 gene locus_tag LOCUS_62450 7029062 7028541 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642965.1 protein_id gnl|my_center|LOCUS_62450 7030168 7029272 gene locus_tag LOCUS_62460 7030168 7029272 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104858.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62460 7030737 7030255 gene locus_tag LOCUS_62470 7030737 7030255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62470 7031830 7031162 gene locus_tag LOCUS_62480 7031830 7031162 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174466.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62480 7032397 7032029 gene locus_tag LOCUS_62490 7032397 7032029 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101943.1 protein_id gnl|my_center|LOCUS_62490 7033459 7032479 gene locus_tag LOCUS_62500 7033459 7032479 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930477.1 protein_id gnl|my_center|LOCUS_62500 7034383 7033541 gene locus_tag LOCUS_62510 7034383 7033541 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275478.1 protein_id gnl|my_center|LOCUS_62510 7035155 7034397 gene locus_tag LOCUS_62520 7035155 7034397 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816623.1 protein_id gnl|my_center|LOCUS_62520 7035653 7035177 gene locus_tag LOCUS_62530 7035653 7035177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62530 7035711 7036199 gene locus_tag LOCUS_62540 7035711 7036199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62540 7036534 7037082 gene locus_tag LOCUS_62550 7036534 7037082 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023672.1 protein_id gnl|my_center|LOCUS_62550 7037566 7037162 gene locus_tag LOCUS_62560 7037566 7037162 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 protein_id gnl|my_center|LOCUS_62560 7038602 7037718 gene locus_tag LOCUS_62570 7038602 7037718 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930477.1 protein_id gnl|my_center|LOCUS_62570 7039900 7038995 gene locus_tag LOCUS_62580 7039900 7038995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62580 7041390 7040386 gene locus_tag LOCUS_62590 7041390 7040386 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012218138.1 protein_id gnl|my_center|LOCUS_62590 7043335 7041404 gene locus_tag LOCUS_62600 7043335 7041404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62600 7043987 7043322 gene locus_tag LOCUS_62610 7043987 7043322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62610 7044456 7044121 gene locus_tag LOCUS_62620 7044456 7044121 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279278.1 protein_id gnl|my_center|LOCUS_62620 7044593 7045588 gene locus_tag LOCUS_62630 7044593 7045588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62630 7046770 7045622 gene locus_tag LOCUS_62640 7046770 7045622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62640 7047101 7046784 gene locus_tag LOCUS_62650 7047101 7046784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62650 7049155 7047371 gene locus_tag LOCUS_62660 7049155 7047371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62660 >Feature sequence2 101 805 gene locus_tag LOCUS_62670 101 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003613.1 protein_id gnl|my_center|LOCUS_62670 1445 1146 gene locus_tag LOCUS_62680 1445 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62680 2250 1423 gene locus_tag LOCUS_62690 2250 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62690 3215 2496 gene locus_tag LOCUS_62700 gene resD 3215 2496 CDS product DNA-binding response regulator ResD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426862.1 protein_id gnl|my_center|LOCUS_62700 4843 3458 gene locus_tag LOCUS_62710 4843 3458 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763119.1 protein_id gnl|my_center|LOCUS_62710 5293 4877 gene locus_tag LOCUS_62720 5293 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62720 5620 6264 gene locus_tag LOCUS_62730 5620 6264 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930124.1 protein_id gnl|my_center|LOCUS_62730 6353 6766 gene locus_tag LOCUS_62740 6353 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62740 7468 6791 gene locus_tag LOCUS_62750 7468 6791 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261909.1 protein_id gnl|my_center|LOCUS_62750 7636 7995 gene locus_tag LOCUS_62760 7636 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62760 8653 8009 gene locus_tag LOCUS_62770 8653 8009 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_62770 9188 8670 gene locus_tag LOCUS_62780 9188 8670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62780 9879 9169 gene locus_tag LOCUS_62790 9879 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62790 10684 9872 gene locus_tag LOCUS_62800 10684 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62800 11295 10681 gene locus_tag LOCUS_62810 11295 10681 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259401.1 protein_id gnl|my_center|LOCUS_62810 12659 11292 gene locus_tag LOCUS_62820 gene nosD 12659 11292 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070836.1 protein_id gnl|my_center|LOCUS_62820 13105 12656 gene locus_tag LOCUS_62830 13105 12656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62830 15273 13597 gene locus_tag LOCUS_62840 15273 13597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62840 15400 16620 gene locus_tag LOCUS_62850 15400 16620 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085938409.1 protein_id gnl|my_center|LOCUS_62850 17065 16709 gene locus_tag LOCUS_62860 17065 16709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62860 17612 17866 gene locus_tag LOCUS_62870 17612 17866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62870 18025 18900 gene locus_tag LOCUS_62880 18025 18900 CDS product DUF4238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888356.1 protein_id gnl|my_center|LOCUS_62880 19155 19514 gene locus_tag LOCUS_62890 19155 19514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62890 19515 19652 gene locus_tag LOCUS_62900 19515 19652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62900 19661 20443 gene locus_tag LOCUS_62910 gene xerD 19661 20443 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942464.1 protein_id gnl|my_center|LOCUS_62910 20557 20757 gene locus_tag LOCUS_62920 20557 20757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62920 21746 20958 gene locus_tag LOCUS_62930 21746 20958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62930 22170 22000 gene locus_tag LOCUS_62940 22170 22000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62940 22719 22207 gene locus_tag LOCUS_62950 22719 22207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62950 23970 22861 gene locus_tag LOCUS_62960 23970 22861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62960 26680 25268 gene locus_tag LOCUS_62970 26680 25268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62970 28526 26733 gene locus_tag LOCUS_62980 gene ltrA 28526 26733 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002335621.1 protein_id gnl|my_center|LOCUS_62980 29189 29007 gene locus_tag LOCUS_62990 29189 29007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62990 34096 29207 gene locus_tag LOCUS_63000 34096 29207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63000 35027 34104 gene locus_tag LOCUS_63010 35027 34104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63010 35910 35275 gene locus_tag LOCUS_63020 35910 35275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63020 36646 36023 gene locus_tag LOCUS_63030 36646 36023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63030 37104 36643 gene locus_tag LOCUS_63040 37104 36643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63040 37516 37328 gene locus_tag LOCUS_63050 37516 37328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63050 37689 37531 gene locus_tag LOCUS_63060 37689 37531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63060 38128 37703 gene locus_tag LOCUS_63070 38128 37703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63070 39518 38592 gene locus_tag LOCUS_63080 39518 38592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63080 40918 39518 gene locus_tag LOCUS_63090 40918 39518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63090 42174 40933 gene locus_tag LOCUS_63100 42174 40933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63100 43121 42171 gene locus_tag LOCUS_63110 43121 42171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63110 44738 43143 gene locus_tag LOCUS_63120 44738 43143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63120 45321 44779 gene locus_tag LOCUS_63130 45321 44779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63130 46256 45345 gene locus_tag LOCUS_63140 46256 45345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63140 47122 46274 gene locus_tag LOCUS_63150 47122 46274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63150 47604 47119 gene locus_tag LOCUS_63160 47604 47119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63160 48352 47777 gene locus_tag LOCUS_63170 48352 47777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63170 48758 48519 gene locus_tag LOCUS_63180 48758 48519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63180 49188 49844 gene locus_tag LOCUS_63190 49188 49844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63190 50705 51022 gene locus_tag LOCUS_63200 50705 51022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63200 51801 51109 gene locus_tag LOCUS_63210 51801 51109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63210 52289 51945 gene locus_tag LOCUS_63220 52289 51945 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017149794.1 protein_id gnl|my_center|LOCUS_63220 53932 52397 gene locus_tag LOCUS_63230 53932 52397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63230 55296 55964 gene locus_tag LOCUS_63240 55296 55964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63240 56972 56289 gene locus_tag LOCUS_63250 56972 56289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63250 58441 57884 gene locus_tag LOCUS_63260 58441 57884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63260 59787 58480 gene locus_tag LOCUS_63270 59787 58480 CDS product ParM/StbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476644.1 protein_id gnl|my_center|LOCUS_63270 60492 61331 gene locus_tag LOCUS_63280 60492 61331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63280 61336 61506 gene locus_tag LOCUS_63290 61336 61506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63290 61612 62004 gene locus_tag LOCUS_63300 61612 62004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63300 62020 63153 gene locus_tag LOCUS_63310 62020 63153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63310 63210 63512 gene locus_tag LOCUS_63320 63210 63512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63320 63516 63920 gene locus_tag LOCUS_63330 63516 63920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63330 63953 66607 gene locus_tag LOCUS_63340 63953 66607 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331165.1 protein_id gnl|my_center|LOCUS_63340 67502 67759 gene locus_tag LOCUS_63350 67502 67759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63350 67749 69257 gene locus_tag LOCUS_63360 67749 69257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63360 69269 71209 gene locus_tag LOCUS_63370 69269 71209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63370 71213 71635 gene locus_tag LOCUS_63380 71213 71635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63380 71809 73575 gene locus_tag LOCUS_63390 71809 73575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63390 73890 74285 gene locus_tag LOCUS_63400 73890 74285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63400 74322 74594 gene locus_tag LOCUS_63410 74322 74594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63410 74701 74898 gene locus_tag LOCUS_63420 74701 74898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63420 75137 75421 gene locus_tag LOCUS_63430 75137 75421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63430 75424 75768 gene locus_tag LOCUS_63440 75424 75768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63440 75772 76335 gene locus_tag LOCUS_63450 75772 76335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63450 76897 77571 gene locus_tag LOCUS_63460 gene radC 76897 77571 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013377.1 protein_id gnl|my_center|LOCUS_63460 77584 78075 gene locus_tag LOCUS_63470 77584 78075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63470 78090 79130 gene locus_tag LOCUS_63480 78090 79130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63480 79376 79867 gene locus_tag LOCUS_63490 79376 79867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63490 79864 80133 gene locus_tag LOCUS_63500 79864 80133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63500 80247 80699 gene locus_tag LOCUS_63510 80247 80699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63510 80623 80985 gene locus_tag LOCUS_63520 80623 80985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63520 81622 82842 gene locus_tag LOCUS_63530 81622 82842 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085938409.1 protein_id gnl|my_center|LOCUS_63530 83142 84065 gene locus_tag LOCUS_63540 83142 84065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63540 84409 85557 gene locus_tag LOCUS_63550 84409 85557 CDS product IS256-like element ISEfm2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081133701.1 protein_id gnl|my_center|LOCUS_63550 85953 87269 gene locus_tag LOCUS_63560 85953 87269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63560 87256 89307 gene locus_tag LOCUS_63570 87256 89307 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766176.1 protein_id gnl|my_center|LOCUS_63570 89291 91138 gene locus_tag LOCUS_63580 89291 91138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63580 91794 92840 gene locus_tag LOCUS_63590 91794 92840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63590 93582 93256 gene locus_tag LOCUS_63600 93582 93256 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461986.1 protein_id gnl|my_center|LOCUS_63600 93995 93600 gene locus_tag LOCUS_63610 gene soxR 93995 93600 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464169.1 protein_id gnl|my_center|LOCUS_63610 94233 93982 gene locus_tag LOCUS_63620 94233 93982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63620 94327 94680 gene locus_tag LOCUS_63630 94327 94680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63630 94677 95045 gene locus_tag LOCUS_63640 94677 95045 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146729243.1 protein_id gnl|my_center|LOCUS_63640 95594 95833 gene locus_tag LOCUS_63650 95594 95833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63650 95914 97212 gene locus_tag LOCUS_63660 95914 97212 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775027.1 protein_id gnl|my_center|LOCUS_63660 97328 97726 gene locus_tag LOCUS_63670 97328 97726 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964329.1 protein_id gnl|my_center|LOCUS_63670 97942 97760 gene locus_tag LOCUS_63680 97942 97760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63680 98291 98602 gene locus_tag LOCUS_63690 98291 98602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63690 99066 100280 gene locus_tag LOCUS_63700 99066 100280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63700 101864 100638 gene locus_tag LOCUS_63710 101864 100638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63710 102872 103159 gene locus_tag LOCUS_63720 102872 103159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63720 103134 104978 gene locus_tag LOCUS_63730 103134 104978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63730 105061 106800 gene locus_tag LOCUS_63740 105061 106800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63740 106823 106996 gene locus_tag LOCUS_63750 106823 106996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63750 107298 107849 gene locus_tag LOCUS_63760 107298 107849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63760 107821 108438 gene locus_tag LOCUS_63770 107821 108438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63770 109690 108782 gene locus_tag LOCUS_63780 109690 108782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63780 110633 110923 gene locus_tag LOCUS_63790 110633 110923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63790 110821 111699 gene locus_tag LOCUS_63800 110821 111699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63800 111717 112973 gene locus_tag LOCUS_63810 111717 112973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63810 113172 113477 gene locus_tag LOCUS_63820 113172 113477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63820 113795 113968 gene locus_tag LOCUS_63830 113795 113968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63830 114166 115962 gene locus_tag LOCUS_63840 114166 115962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63840 117058 118752 gene locus_tag LOCUS_63850 gene yesM 117058 118752 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_63850 118754 119797 gene locus_tag LOCUS_63860 118754 119797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63860 119914 121620 gene locus_tag LOCUS_63870 119914 121620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63870 121787 122656 gene locus_tag LOCUS_63880 121787 122656 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_63880 122674 123570 gene locus_tag LOCUS_63890 122674 123570 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_63890 123872 124816 gene locus_tag LOCUS_63900 123872 124816 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973778.1 protein_id gnl|my_center|LOCUS_63900 124806 125570 gene locus_tag LOCUS_63910 124806 125570 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_63910 125570 125734 gene locus_tag LOCUS_63920 125570 125734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63920 125882 126286 gene locus_tag LOCUS_63930 125882 126286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63930 126422 127018 gene locus_tag LOCUS_63940 126422 127018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63940 126979 127932 gene locus_tag LOCUS_63950 126979 127932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63950 128266 128799 gene locus_tag LOCUS_63960 128266 128799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63960 129715 131802 gene locus_tag LOCUS_63970 129715 131802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63970 132533 133255 gene locus_tag LOCUS_63980 132533 133255 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_63980 133414 135606 gene locus_tag LOCUS_63990 133414 135606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63990 135596 138640 gene locus_tag LOCUS_64000 135596 138640 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_64000 138645 139421 gene locus_tag LOCUS_64010 138645 139421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64010 139576 140547 gene locus_tag LOCUS_64020 139576 140547 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_64020 140561 141469 gene locus_tag LOCUS_64030 140561 141469 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130090.1 protein_id gnl|my_center|LOCUS_64030 141544 143133 gene locus_tag LOCUS_64040 141544 143133 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_64040 143223 145004 gene locus_tag LOCUS_64050 143223 145004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64050 144994 146712 gene locus_tag LOCUS_64060 144994 146712 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975928.1 protein_id gnl|my_center|LOCUS_64060 146828 148546 gene locus_tag LOCUS_64070 146828 148546 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_64070 148631 149536 gene locus_tag LOCUS_64080 148631 149536 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_64080 149551 150438 gene locus_tag LOCUS_64090 149551 150438 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_64090 150527 152284 gene locus_tag LOCUS_64100 150527 152284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64100 152259 153908 gene locus_tag LOCUS_64110 152259 153908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64110 153933 155288 gene locus_tag LOCUS_64120 153933 155288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64120 155858 155472 gene locus_tag LOCUS_64130 155858 155472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_64130 156196 155840 gene locus_tag LOCUS_64140 156196 155840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64140 157432 156425 gene locus_tag LOCUS_64150 gene gutB 157432 156425 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_64150 158158 157448 gene locus_tag LOCUS_64160 158158 157448 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_64160 158434 159780 gene locus_tag LOCUS_64170 158434 159780 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582573.1 protein_id gnl|my_center|LOCUS_64170 159824 160711 gene locus_tag LOCUS_64180 gene dapA 159824 160711 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_64180 160788 162125 gene locus_tag LOCUS_64190 160788 162125 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225468.1 protein_id gnl|my_center|LOCUS_64190 162177 163058 gene locus_tag LOCUS_64200 162177 163058 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027842956.1 protein_id gnl|my_center|LOCUS_64200 163070 163903 gene locus_tag LOCUS_64210 163070 163903 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525205.1 protein_id gnl|my_center|LOCUS_64210 163937 164713 gene locus_tag LOCUS_64220 163937 164713 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153442595.1 protein_id gnl|my_center|LOCUS_64220 164737 165366 gene locus_tag LOCUS_64230 164737 165366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64230 165491 166366 gene locus_tag LOCUS_64240 165491 166366 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164690802.1 protein_id gnl|my_center|LOCUS_64240 166391 167536 gene locus_tag LOCUS_64250 166391 167536 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027183.1 protein_id gnl|my_center|LOCUS_64250 167566 168141 gene locus_tag LOCUS_64260 167566 168141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64260 168339 169883 gene locus_tag LOCUS_64270 gene araD 168339 169883 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968358.1 protein_id gnl|my_center|LOCUS_64270 170084 170701 gene locus_tag LOCUS_64280 gene fabG 170084 170701 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989818.1 protein_id gnl|my_center|LOCUS_64280 170724 171890 gene locus_tag LOCUS_64290 170724 171890 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_64290 171987 172877 gene locus_tag LOCUS_64300 171987 172877 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396443.1 protein_id gnl|my_center|LOCUS_64300 172888 174033 gene locus_tag LOCUS_64310 172888 174033 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861810.1 protein_id gnl|my_center|LOCUS_64310 174249 175559 gene locus_tag LOCUS_64320 gene glcD 174249 175559 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890729.1 protein_id gnl|my_center|LOCUS_64320 175552 175875 gene locus_tag LOCUS_64330 175552 175875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64330 175832 176887 gene locus_tag LOCUS_64340 175832 176887 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209630.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64340 176932 177420 gene locus_tag LOCUS_64350 176932 177420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64350 177521 178168 gene locus_tag LOCUS_64360 177521 178168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64360 178179 178658 gene locus_tag LOCUS_64370 178179 178658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64370 179302 180495 gene locus_tag LOCUS_64380 179302 180495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64380 180564 180923 gene locus_tag LOCUS_64390 180564 180923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64390 180929 181321 gene locus_tag LOCUS_64400 180929 181321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64400 181606 181376 gene locus_tag LOCUS_64410 181606 181376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64410 181939 182985 gene locus_tag LOCUS_64420 181939 182985 CDS product DUF6094 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104230471.1 protein_id gnl|my_center|LOCUS_64420 183019 183657 gene locus_tag LOCUS_64430 183019 183657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64430 183659 186526 gene locus_tag LOCUS_64440 183659 186526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64440 186608 187630 gene locus_tag LOCUS_64450 186608 187630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64450 187627 187809 gene locus_tag LOCUS_64460 187627 187809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64460 188290 189051 gene locus_tag LOCUS_64470 188290 189051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64470 189106 189795 gene locus_tag LOCUS_64480 189106 189795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64480 189957 190298 gene locus_tag LOCUS_64490 189957 190298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64490 190345 190518 gene locus_tag LOCUS_64500 190345 190518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64500 191052 191513 gene locus_tag LOCUS_64510 191052 191513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64510 191531 191716 gene locus_tag LOCUS_64520 191531 191716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64520 192382 192615 gene locus_tag LOCUS_64530 192382 192615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64530 192567 193424 gene locus_tag LOCUS_64540 192567 193424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64540 193451 194131 gene locus_tag LOCUS_64550 193451 194131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64550 194718 194389 gene locus_tag LOCUS_64560 194718 194389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64560 194801 195058 gene locus_tag LOCUS_64570 194801 195058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64570 195100 195933 gene locus_tag LOCUS_64580 195100 195933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64580 196040 195843 gene locus_tag LOCUS_64590 196040 195843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64590 197234 196344 gene locus_tag LOCUS_64600 197234 196344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64600 197747 197595 gene locus_tag LOCUS_64610 197747 197595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64610 198218 198649 gene locus_tag LOCUS_64620 198218 198649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64620 198656 199054 gene locus_tag LOCUS_64630 198656 199054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64630 199069 199746 gene locus_tag LOCUS_64640 199069 199746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64640 200139 200636 gene locus_tag LOCUS_64650 200139 200636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64650 200651 200920 gene locus_tag LOCUS_64660 200651 200920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64660 200931 201254 gene locus_tag LOCUS_64670 200931 201254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64670 201453 203237 gene locus_tag LOCUS_64680 201453 203237 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693783.1 protein_id gnl|my_center|LOCUS_64680 203253 203966 gene locus_tag LOCUS_64690 203253 203966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64690 203991 204329 gene locus_tag LOCUS_64700 203991 204329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64700 204310 204471 gene locus_tag LOCUS_64710 204310 204471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64710 204729 205064 gene locus_tag LOCUS_64720 204729 205064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64720 205084 205827 gene locus_tag LOCUS_64730 205084 205827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64730 205824 206537 gene locus_tag LOCUS_64740 205824 206537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64740 206589 207971 gene locus_tag LOCUS_64750 206589 207971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64750 207964 208911 gene locus_tag LOCUS_64760 207964 208911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64760 209003 209452 gene locus_tag LOCUS_64770 209003 209452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64770 209524 210384 gene locus_tag LOCUS_64780 209524 210384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64780 210644 211063 gene locus_tag LOCUS_64790 210644 211063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64790 211066 211899 gene locus_tag LOCUS_64800 211066 211899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64800 211941 212330 gene locus_tag LOCUS_64810 211941 212330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64810 212432 212689 gene locus_tag LOCUS_64820 212432 212689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64820 213120 212788 gene locus_tag LOCUS_64830 213120 212788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64830 213617 213186 gene locus_tag LOCUS_64840 213617 213186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64840 213807 213607 gene locus_tag LOCUS_64850 213807 213607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64850 214029 213877 gene locus_tag LOCUS_64860 214029 213877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64860 215011 214169 gene locus_tag LOCUS_64870 215011 214169 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078543626.1 protein_id gnl|my_center|LOCUS_64870 215211 215459 gene locus_tag LOCUS_64880 215211 215459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64880 215456 215848 gene locus_tag LOCUS_64890 215456 215848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64890 216274 215969 gene locus_tag LOCUS_64900 216274 215969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64900 216670 217062 gene locus_tag LOCUS_64910 216670 217062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64910 217305 218831 gene locus_tag LOCUS_64920 217305 218831 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802296.1 protein_id gnl|my_center|LOCUS_64920 218824 219936 gene locus_tag LOCUS_64930 218824 219936 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049058.1 protein_id gnl|my_center|LOCUS_64930 220026 221057 gene locus_tag LOCUS_64940 220026 221057 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722252.1 protein_id gnl|my_center|LOCUS_64940 221940 221533 gene locus_tag LOCUS_64950 221940 221533 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296336.1 protein_id gnl|my_center|LOCUS_64950 223086 222235 gene locus_tag LOCUS_64960 223086 222235 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080532.1 protein_id gnl|my_center|LOCUS_64960 223958 223119 gene locus_tag LOCUS_64970 223958 223119 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192727398.1 protein_id gnl|my_center|LOCUS_64970 225429 223984 gene locus_tag LOCUS_64980 gene lmr(B) 225429 223984 CDS product lincomycin efflux MFS transporter Lmr(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886396.1 protein_id gnl|my_center|LOCUS_64980 226033 225446 gene locus_tag LOCUS_64990 226033 225446 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642965.1 protein_id gnl|my_center|LOCUS_64990 227141 226089 gene locus_tag LOCUS_65000 227141 226089 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104858.1 protein_id gnl|my_center|LOCUS_65000 227710 227228 gene locus_tag LOCUS_65010 227710 227228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65010 228809 227964 gene locus_tag LOCUS_65020 228809 227964 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080532.1 protein_id gnl|my_center|LOCUS_65020 229376 229008 gene locus_tag LOCUS_65030 229376 229008 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101943.1 protein_id gnl|my_center|LOCUS_65030 230438 229458 gene locus_tag LOCUS_65040 230438 229458 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930477.1 protein_id gnl|my_center|LOCUS_65040 231362 230520 gene locus_tag LOCUS_65050 231362 230520 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275478.1 protein_id gnl|my_center|LOCUS_65050 232134 231376 gene locus_tag LOCUS_65060 232134 231376 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816623.1 protein_id gnl|my_center|LOCUS_65060 232632 232156 gene locus_tag LOCUS_65070 232632 232156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65070 232690 233178 gene locus_tag LOCUS_65080 232690 233178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65080 233513 234061 gene locus_tag LOCUS_65090 233513 234061 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023672.1 protein_id gnl|my_center|LOCUS_65090 234546 234154 gene locus_tag LOCUS_65100 234546 234154 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 protein_id gnl|my_center|LOCUS_65100 235582 234590 gene locus_tag LOCUS_65110 235582 234590 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930477.1 protein_id gnl|my_center|LOCUS_65110 236890 235904 gene locus_tag LOCUS_65120 236890 235904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65120 238287 237376 gene locus_tag LOCUS_65130 238287 237376 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012218138.1 protein_id gnl|my_center|LOCUS_65130 239465 238848 gene locus_tag LOCUS_65140 239465 238848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65140 239889 239473 gene locus_tag LOCUS_65150 239889 239473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65150 240320 239940 gene locus_tag LOCUS_65160 240320 239940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65160 240699 240307 gene locus_tag LOCUS_65170 240699 240307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65170 241432 241184 gene locus_tag LOCUS_65180 241432 241184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65180 241569 241973 gene locus_tag LOCUS_65190 241569 241973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65190 244332 242596 gene locus_tag LOCUS_65200 244332 242596 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775114.1 protein_id gnl|my_center|LOCUS_65200 246131 244347 gene locus_tag LOCUS_65210 246131 244347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65210 >Feature sequence3 2092 23 gene locus_tag LOCUS_65220 2092 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65220 4673 2112 gene locus_tag LOCUS_65230 4673 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65230 6577 4991 gene locus_tag LOCUS_65240 6577 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65240 6807 6574 gene locus_tag LOCUS_65250 6807 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65250 9253 6800 gene locus_tag LOCUS_65260 9253 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65260 10653 9598 gene locus_tag LOCUS_65270 10653 9598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65270 13866 10750 gene locus_tag LOCUS_65280 13866 10750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65280 15617 13905 gene locus_tag LOCUS_65290 15617 13905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65290 16159 15572 gene locus_tag LOCUS_65300 16159 15572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65300 22737 16204 gene locus_tag LOCUS_65310 22737 16204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65310 23778 22792 gene locus_tag LOCUS_65320 23778 22792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65320 25267 23876 gene locus_tag LOCUS_65330 25267 23876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65330 26012 25374 gene locus_tag LOCUS_65340 26012 25374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65340 26575 26129 gene locus_tag LOCUS_65350 26575 26129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65350 26804 26589 gene locus_tag LOCUS_65360 26804 26589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65360 28089 26824 gene locus_tag LOCUS_65370 28089 26824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65370 30395 28101 gene locus_tag LOCUS_65380 30395 28101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65380 32400 30397 gene locus_tag LOCUS_65390 32400 30397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65390 33423 32428 gene locus_tag LOCUS_65400 33423 32428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65400 37075 33425 gene locus_tag LOCUS_65410 37075 33425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65410 38210 37089 gene locus_tag LOCUS_65420 38210 37089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65420 39375 38212 gene locus_tag LOCUS_65430 39375 38212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65430 39831 39391 gene locus_tag LOCUS_65440 39831 39391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65440 40732 39881 gene locus_tag LOCUS_65450 40732 39881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65450 41158 40748 gene locus_tag LOCUS_65460 41158 40748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65460 41501 41145 gene locus_tag LOCUS_65470 41501 41145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65470 41924 41508 gene locus_tag LOCUS_65480 41924 41508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65480 48173 41931 gene locus_tag LOCUS_65490 48173 41931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65490 55109 48186 gene locus_tag LOCUS_65500 55109 48186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65500 60955 55121 gene locus_tag LOCUS_65510 60955 55121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65510 61387 61217 gene locus_tag LOCUS_65520 61387 61217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65520 62205 61384 gene locus_tag LOCUS_65530 62205 61384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65530 62758 62264 gene locus_tag LOCUS_65540 62758 62264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65540 63569 62799 gene locus_tag LOCUS_65550 63569 62799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65550 64048 63575 gene locus_tag LOCUS_65560 64048 63575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65560 64872 64147 gene locus_tag LOCUS_65570 64872 64147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65570 67701 64939 gene locus_tag LOCUS_65580 67701 64939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65580 68330 67704 gene locus_tag LOCUS_65590 68330 67704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65590 69370 68327 gene locus_tag LOCUS_65600 69370 68327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65600 69830 69348 gene locus_tag LOCUS_65610 69830 69348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65610 70603 69830 gene locus_tag LOCUS_65620 70603 69830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65620 70878 70606 gene locus_tag LOCUS_65630 70878 70606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65630 71811 70933 gene locus_tag LOCUS_65640 71811 70933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65640 72122 71814 gene locus_tag LOCUS_65650 72122 71814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65650 72648 72136 gene locus_tag LOCUS_65660 72648 72136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65660 74389 72662 gene locus_tag LOCUS_65670 74389 72662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65670 76486 74411 gene locus_tag LOCUS_65680 76486 74411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65680 78571 76499 gene locus_tag LOCUS_65690 78571 76499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65690 79167 78595 gene locus_tag LOCUS_65700 79167 78595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65700 80315 79230 gene locus_tag LOCUS_65710 80315 79230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65710 81613 80345 gene locus_tag LOCUS_65720 81613 80345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65720 83097 81643 gene locus_tag LOCUS_65730 83097 81643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65730 85383 83104 gene locus_tag LOCUS_65740 85383 83104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65740 86738 85467 gene locus_tag LOCUS_65750 86738 85467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65750 88689 86911 gene locus_tag LOCUS_65760 88689 86911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65760 89089 88694 gene locus_tag LOCUS_65770 89089 88694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65770 89544 89095 gene locus_tag LOCUS_65780 89544 89095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65780 90024 89560 gene locus_tag LOCUS_65790 90024 89560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65790 90359 90027 gene locus_tag LOCUS_65800 90359 90027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65800 91101 90364 gene locus_tag LOCUS_65810 91101 90364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65810 91447 91289 gene locus_tag LOCUS_65820 91447 91289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65820 92664 91453 gene locus_tag LOCUS_65830 92664 91453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65830 92710 92895 gene locus_tag LOCUS_65840 92710 92895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65840 93426 93350 gene locus_tag LOCUS_t01220 93426 93350 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 93504 93431 gene locus_tag LOCUS_t01230 93504 93431 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 93584 93509 gene locus_tag LOCUS_t01240 93584 93509 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 93662 93589 gene locus_tag LOCUS_t01250 93662 93589 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 93743 93667 gene locus_tag LOCUS_t01260 93743 93667 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 94072 93914 gene locus_tag LOCUS_65850 94072 93914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65850 94757 94044 gene locus_tag LOCUS_65860 94757 94044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65860 95127 94687 gene locus_tag LOCUS_65870 95127 94687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65870 95398 95222 gene locus_tag LOCUS_65880 95398 95222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65880 95793 95353 gene locus_tag LOCUS_65890 95793 95353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65890 96058 95738 gene locus_tag LOCUS_65900 96058 95738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65900 96357 96091 gene locus_tag LOCUS_65910 96357 96091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65910 96529 96299 gene locus_tag LOCUS_65920 96529 96299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65920 96771 96532 gene locus_tag LOCUS_65930 96771 96532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65930 97062 96793 gene locus_tag LOCUS_65940 97062 96793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65940 97568 97146 gene locus_tag LOCUS_65950 97568 97146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65950 97815 98105 gene locus_tag LOCUS_65960 97815 98105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65960 98107 98259 gene locus_tag LOCUS_65970 98107 98259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65970 98389 98955 gene locus_tag LOCUS_65980 98389 98955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65980 99362 103045 gene locus_tag LOCUS_65990 99362 103045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65990 103621 104043 gene locus_tag LOCUS_66000 103621 104043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66000 104059 104238 gene locus_tag LOCUS_66010 104059 104238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66010 104500 104676 gene locus_tag LOCUS_66020 104500 104676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66020 104839 105126 gene locus_tag LOCUS_66030 104839 105126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66030 105110 105259 gene locus_tag LOCUS_66040 105110 105259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66040 105273 105440 gene locus_tag LOCUS_66050 105273 105440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66050 105443 105724 gene locus_tag LOCUS_66060 105443 105724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66060 105726 105944 gene locus_tag LOCUS_66070 105726 105944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66070 105960 106226 gene locus_tag LOCUS_66080 105960 106226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66080 106226 106489 gene locus_tag LOCUS_66090 106226 106489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66090 106494 106727 gene locus_tag LOCUS_66100 106494 106727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66100 106727 106948 gene locus_tag LOCUS_66110 106727 106948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66110 106951 107199 gene locus_tag LOCUS_66120 106951 107199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66120 107207 107488 gene locus_tag LOCUS_66130 107207 107488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66130 107488 107829 gene locus_tag LOCUS_66140 107488 107829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66140 107829 107981 gene locus_tag LOCUS_66150 107829 107981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66150 107959 108102 gene locus_tag LOCUS_66160 107959 108102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66160 108300 108587 gene locus_tag LOCUS_66170 108300 108587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66170 108587 108832 gene locus_tag LOCUS_66180 108587 108832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66180 108890 109153 gene locus_tag LOCUS_66190 108890 109153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66190 109156 109554 gene locus_tag LOCUS_66200 109156 109554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66200 109554 109844 gene locus_tag LOCUS_66210 109554 109844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66210 109854 110129 gene locus_tag LOCUS_66220 109854 110129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66220 110126 110383 gene locus_tag LOCUS_66230 110126 110383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66230 110456 110632 gene locus_tag LOCUS_66240 110456 110632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66240 110670 110843 gene locus_tag LOCUS_66250 110670 110843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66250 110908 111048 gene locus_tag LOCUS_66260 110908 111048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66260 111048 111410 gene locus_tag LOCUS_66270 111048 111410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66270 111473 111955 gene locus_tag LOCUS_66280 111473 111955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66280 112078 112302 gene locus_tag LOCUS_66290 112078 112302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66290 112337 112801 gene locus_tag LOCUS_66300 112337 112801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66300 112965 113387 gene locus_tag LOCUS_66310 112965 113387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66310 113415 113696 gene locus_tag LOCUS_66320 113415 113696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66320 113683 113877 gene locus_tag LOCUS_66330 113683 113877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66330 114612 114863 gene locus_tag LOCUS_66340 114612 114863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66340 114860 115216 gene locus_tag LOCUS_66350 114860 115216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66350 115210 115629 gene locus_tag LOCUS_66360 115210 115629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66360 115633 116097 gene locus_tag LOCUS_66370 gene rnhA 115633 116097 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933276.1 protein_id gnl|my_center|LOCUS_66370 116203 116520 gene locus_tag LOCUS_66380 116203 116520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66380 117323 116643 gene locus_tag LOCUS_66390 117323 116643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66390 117905 118276 gene locus_tag LOCUS_66400 117905 118276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66400 118313 119173 gene locus_tag LOCUS_66410 118313 119173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66410 119170 119655 gene locus_tag LOCUS_66420 119170 119655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66420 119708 120226 gene locus_tag LOCUS_66430 119708 120226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66430 120244 120489 gene locus_tag LOCUS_66440 120244 120489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66440 120545 120808 gene locus_tag LOCUS_66450 120545 120808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66450 120952 121824 gene locus_tag LOCUS_66460 120952 121824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66460 121975 123822 gene locus_tag LOCUS_66470 121975 123822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66470 123891 124757 gene locus_tag LOCUS_66480 123891 124757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66480 124858 125142 gene locus_tag LOCUS_66490 124858 125142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66490 125255 125491 gene locus_tag LOCUS_66500 125255 125491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66500 125533 126195 gene locus_tag LOCUS_66510 125533 126195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66510 126239 126514 gene locus_tag LOCUS_66520 126239 126514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66520 126511 126879 gene locus_tag LOCUS_66530 126511 126879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66530 126872 127051 gene locus_tag LOCUS_66540 126872 127051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66540 127185 127961 gene locus_tag LOCUS_66550 127185 127961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66550 128027 128389 gene locus_tag LOCUS_66560 128027 128389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66560 128401 129645 gene locus_tag LOCUS_66570 gene recA 128401 129645 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_66570 129658 130254 gene locus_tag LOCUS_66580 129658 130254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66580 130251 130463 gene locus_tag LOCUS_66590 130251 130463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66590 130704 131321 gene locus_tag LOCUS_66600 130704 131321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66600 131338 131697 gene locus_tag LOCUS_66610 131338 131697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66610 131654 132124 gene locus_tag LOCUS_66620 131654 132124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66620 132146 132679 gene locus_tag LOCUS_66630 132146 132679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66630 132705 133175 gene locus_tag LOCUS_66640 132705 133175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66640 133208 133939 gene locus_tag LOCUS_66650 133208 133939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66650 134402 134524 gene locus_tag LOCUS_66660 134402 134524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66660 134543 134905 gene locus_tag LOCUS_66670 134543 134905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66670 135119 135403 gene locus_tag LOCUS_66680 135119 135403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66680 135509 135973 gene locus_tag LOCUS_66690 135509 135973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66690 135966 136649 gene locus_tag LOCUS_66700 135966 136649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66700 137070 137276 gene locus_tag LOCUS_66710 137070 137276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66710 137369 138187 gene locus_tag LOCUS_66720 137369 138187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66720 138404 139312 gene locus_tag LOCUS_66730 138404 139312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66730 139378 141033 gene locus_tag LOCUS_66740 139378 141033 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143249.1 protein_id gnl|my_center|LOCUS_66740 141053 141433 gene locus_tag LOCUS_66750 141053 141433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66750 141629 142012 gene locus_tag LOCUS_66760 141629 142012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66760 142012 142302 gene locus_tag LOCUS_66770 142012 142302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66770 142485 142694 gene locus_tag LOCUS_66780 142485 142694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66780 142756 144342 gene locus_tag LOCUS_66790 142756 144342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66790 144345 144602 gene locus_tag LOCUS_66800 144345 144602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66800 144618 144803 gene locus_tag LOCUS_66810 144618 144803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66810 145002 145268 gene locus_tag LOCUS_66820 145002 145268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66820 145249 145890 gene locus_tag LOCUS_66830 145249 145890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66830 145890 146372 gene locus_tag LOCUS_66840 145890 146372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66840 146388 148364 gene locus_tag LOCUS_66850 gene pcrA 146388 148364 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163769.1 protein_id gnl|my_center|LOCUS_66850 148475 149485 gene locus_tag LOCUS_66860 148475 149485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66860 149541 149903 gene locus_tag LOCUS_66870 149541 149903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66870 149928 151301 gene locus_tag LOCUS_66880 149928 151301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66880 151312 151866 gene locus_tag LOCUS_66890 151312 151866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66890 151844 152521 gene locus_tag LOCUS_66900 151844 152521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66900 152606 153136 gene locus_tag LOCUS_66910 152606 153136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66910 153243 153998 gene locus_tag LOCUS_66920 153243 153998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66920 153998 155251 gene locus_tag LOCUS_66930 153998 155251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66930 155263 158565 gene locus_tag LOCUS_66940 155263 158565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66940 158565 158735 gene locus_tag LOCUS_66950 158565 158735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66950 158751 158924 gene locus_tag LOCUS_66960 158751 158924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66960 159006 160319 gene locus_tag LOCUS_66970 159006 160319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66970 160434 160721 gene locus_tag LOCUS_66980 160434 160721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66980 160741 160974 gene locus_tag LOCUS_66990 160741 160974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66990 160977 161276 gene locus_tag LOCUS_67000 160977 161276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67000 161723 161950 gene locus_tag LOCUS_67010 161723 161950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67010 162497 162679 gene locus_tag LOCUS_67020 162497 162679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67020 162765 163103 gene locus_tag LOCUS_67030 162765 163103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67030 163115 164395 gene locus_tag LOCUS_67040 163115 164395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67040 164395 164775 gene locus_tag LOCUS_67050 164395 164775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67050 164753 165226 gene locus_tag LOCUS_67060 164753 165226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67060 165198 165635 gene locus_tag LOCUS_67070 165198 165635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67070 165580 165969 gene locus_tag LOCUS_67080 165580 165969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67080 165959 166357 gene locus_tag LOCUS_67090 165959 166357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67090 166372 167196 gene locus_tag LOCUS_67100 166372 167196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67100 167186 167476 gene locus_tag LOCUS_67110 167186 167476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67110 167488 167733 gene locus_tag LOCUS_67120 167488 167733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67120 167745 168089 gene locus_tag LOCUS_67130 167745 168089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67130 168083 168322 gene locus_tag LOCUS_67140 168083 168322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67140 168319 168465 gene locus_tag LOCUS_67150 168319 168465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67150 168485 168766 gene locus_tag LOCUS_67160 168485 168766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67160 168766 168927 gene locus_tag LOCUS_67170 168766 168927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67170 169032 169304 gene locus_tag LOCUS_67180 169032 169304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67180 169728 170309 gene locus_tag LOCUS_67190 169728 170309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67190 170302 170901 gene locus_tag LOCUS_67200 170302 170901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67200 170907 171338 gene locus_tag LOCUS_67210 170907 171338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67210 171400 171813 gene locus_tag LOCUS_67220 171400 171813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67220 171824 172090 gene locus_tag LOCUS_67230 171824 172090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67230 172090 172371 gene locus_tag LOCUS_67240 172090 172371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67240 172387 172815 gene locus_tag LOCUS_67250 172387 172815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67250 172826 173311 gene locus_tag LOCUS_67260 172826 173311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67260 173651 173313 gene locus_tag LOCUS_67270 173651 173313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67270 173776 174138 gene locus_tag LOCUS_67280 173776 174138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67280 174144 174863 gene locus_tag LOCUS_67290 174144 174863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67290 174860 175123 gene locus_tag LOCUS_67300 174860 175123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67300 175143 176123 gene locus_tag LOCUS_67310 175143 176123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67310 176068 176379 gene locus_tag LOCUS_67320 176068 176379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67320 176315 177637 gene locus_tag LOCUS_67330 176315 177637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67330 177894 177634 gene locus_tag LOCUS_67340 177894 177634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67340 178138 177908 gene locus_tag LOCUS_67350 178138 177908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67350 179096 178146 gene locus_tag LOCUS_67360 179096 178146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67360 179507 179641 gene locus_tag LOCUS_67370 179507 179641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67370 179623 179820 gene locus_tag LOCUS_67380 179623 179820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67380 180273 179893 gene locus_tag LOCUS_67390 gene rtp 180273 179893 CDS product replication termination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220337.1 protein_id gnl|my_center|LOCUS_67390 180527 180838 gene locus_tag LOCUS_67400 180527 180838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67400 181431 180853 gene locus_tag LOCUS_67410 181431 180853 CDS product 5'-3'-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964531.1 protein_id gnl|my_center|LOCUS_67410 182136 181465 gene locus_tag LOCUS_67420 gene tmk 182136 181465 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583153.1 protein_id gnl|my_center|LOCUS_67420 182381 182133 gene locus_tag LOCUS_67430 182381 182133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67430 182569 182345 gene locus_tag LOCUS_67440 182569 182345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67440 182893 182576 gene locus_tag LOCUS_67450 182893 182576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67450 184127 182997 gene locus_tag LOCUS_67460 184127 182997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67460 184630 184202 gene locus_tag LOCUS_67470 184630 184202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67470 184983 184633 gene locus_tag LOCUS_67480 184983 184633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67480 185274 184990 gene locus_tag LOCUS_67490 185274 184990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67490 185711 185280 gene locus_tag LOCUS_67500 185711 185280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67500 189118 185711 gene locus_tag LOCUS_67510 189118 185711 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_67510 189520 189194 gene locus_tag LOCUS_67520 189520 189194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67520 190395 189511 gene locus_tag LOCUS_67530 190395 189511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67530 190707 190465 gene locus_tag LOCUS_67540 190707 190465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67540 191519 190695 gene locus_tag LOCUS_67550 191519 190695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67550 192084 191479 gene locus_tag LOCUS_67560 192084 191479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67560 192517 192095 gene locus_tag LOCUS_67570 192517 192095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67570 192626 192477 gene locus_tag LOCUS_67580 192626 192477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67580 193627 192725 gene locus_tag LOCUS_67590 193627 192725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67590 194103 193675 gene locus_tag LOCUS_67600 194103 193675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67600 194854 194120 gene locus_tag LOCUS_67610 194854 194120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67610 195293 194820 gene locus_tag LOCUS_67620 195293 194820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67620 195583 195284 gene locus_tag LOCUS_67630 195583 195284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67630 195864 195574 gene locus_tag LOCUS_67640 195864 195574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67640 196421 195852 gene locus_tag LOCUS_67650 196421 195852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67650 196630 196430 gene locus_tag LOCUS_67660 196630 196430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67660 197077 196646 gene locus_tag LOCUS_67670 197077 196646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180554.1 protein_id gnl|my_center|LOCUS_67670 198116 197088 gene locus_tag LOCUS_67680 gene nrdF 198116 197088 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203029.1 protein_id gnl|my_center|LOCUS_67680 200199 198106 gene locus_tag LOCUS_67690 gene nrdE 200199 198106 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215839.1 protein_id gnl|my_center|LOCUS_67690 200536 200171 gene locus_tag LOCUS_67700 gene nrdI 200536 200171 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959447.1 protein_id gnl|my_center|LOCUS_67700 200945 200673 gene locus_tag LOCUS_67710 200945 200673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67710 201441 200956 gene locus_tag LOCUS_67720 201441 200956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67720 201685 201446 gene locus_tag LOCUS_67730 201685 201446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67730 202302 201688 gene locus_tag LOCUS_67740 202302 201688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67740 202665 202315 gene locus_tag LOCUS_67750 202665 202315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67750 203651 202680 gene locus_tag LOCUS_67760 203651 202680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67760 204206 203655 gene locus_tag LOCUS_67770 204206 203655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67770 204551 204219 gene locus_tag LOCUS_67780 204551 204219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67780 205693 204611 gene locus_tag LOCUS_67790 205693 204611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67790 207019 205934 gene locus_tag LOCUS_67800 207019 205934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67800 207741 207016 gene locus_tag LOCUS_67810 207741 207016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67810 209003 207756 gene locus_tag LOCUS_67820 209003 207756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67820 209456 209184 gene locus_tag LOCUS_67830 209456 209184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67830 209976 209458 gene locus_tag LOCUS_67840 209976 209458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67840 211238 209994 gene locus_tag LOCUS_67850 211238 209994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67850 211788 211219 gene locus_tag LOCUS_67860 211788 211219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67860 213674 211794 gene locus_tag LOCUS_67870 213674 211794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67870 213864 213667 gene locus_tag LOCUS_67880 213864 213667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67880 214246 213884 gene locus_tag LOCUS_67890 214246 213884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67890 216763 214319 gene locus_tag LOCUS_67900 216763 214319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67900 218577 216760 gene locus_tag LOCUS_67910 218577 216760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67910 221023 218570 gene locus_tag LOCUS_67920 221023 218570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67920 222423 221368 gene locus_tag LOCUS_67930 222423 221368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67930 226689 222520 gene locus_tag LOCUS_67940 226689 222520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67940 227930 226641 gene locus_tag LOCUS_67950 227930 226641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67950