COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..2308709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1314 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858822.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene dnaA CDS 1467..2537 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858808.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene dnaN CDS 2556..4877 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858833.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene gyrB CDS 4944..5327 product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002834281.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene queF CDS 5338..5952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 6168..6575 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023470.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(6815..7081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(7078..7884) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903995.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(7939..8793) product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(8794..9486) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857391.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene modB CDS complement(9479..9871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(9885..10631) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798928.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene modA CDS complement(10641..11423) product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933208.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 11556..12803 product DUF4010 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784141.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(12993..13520) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141342.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 13624..13968 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420359.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(13976..14803) product LysR family transcriptional regulator YofA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231468.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene yofA CDS 14897..16078 product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047739778.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(16075..17157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(17167..18561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(18563..19474) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707309.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene cysD CDS complement(19557..20258) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(20267..20497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(20532..21464) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene cysK CDS complement(21628..22041) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419409.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(22051..23319) product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853122.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 23528..23845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 23855..25081 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966853.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 25249..27147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(27144..28505) product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768689.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(28498..31626) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209267.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(31630..32754) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545408.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 32909..33262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(33328..35184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(35280..36431) product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706371.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(36538..36975) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846461.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene dps CDS complement(37057..37707) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889796.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 38025..39677 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 39752..41143 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 41221..41868 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262567.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene ung CDS complement(41855..42217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 42304..42960 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357915.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 43012..43365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 43441..43869 product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947613.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 43862..44503 product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161586.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 44513..45250 product YaaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853346.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 45261..46226 product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073715.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(46313..47302) product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729002.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(47349..48440) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072975.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(48440..48922) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851998.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(48922..49530) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851820.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene pyrE CDS complement(49533..50090) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938332.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene frr CDS complement(50101..51042) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(51053..51406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 51503..52195 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376795.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(52147..52551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(52593..53288) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851668.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 rRNA 53764..55278 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 55385..55461 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 55487..55562 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 rRNA 55916..58822 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 59030..59141 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS 59719..60564 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965501.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(60639..62684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 62827..64677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(64793..65866) product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080642.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(65859..66932) product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817136.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene aepY CDS complement(66932..68221) product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202933.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene aepX CDS complement(68246..69148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(69145..70314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(70298..71041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(71034..72029) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383748.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(72030..72764) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(72796..74097) product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767814.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene aepX CDS complement(74101..74991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(74988..76331) product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259605.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(76331..77029) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339011.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(77029..77319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(77323..77868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(77840..78871) product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987011.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene pseI CDS complement(78868..79776) product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002830499.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene pseG CDS complement(79779..80495) product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene pseF CDS complement(80488..81618) product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene pseC CDS complement(81615..82607) product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858028.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene pseB CDS 82713..82922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 83009..84058 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851424.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene recA CDS 84206..85483 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955673.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene eno CDS 85516..85725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002839177.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 85722..86423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(86444..87292) product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851400.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(87282..87794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(87795..90116) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene topA CDS complement(90249..91457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(91562..92356) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858257.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(92353..93231) product menaquinone biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626212.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(93337..93549) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780697.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene rpsU CDS 93664..94134 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131513.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene moaC CDS 94131..94394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(94389..94874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(94874..96373) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904307.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene nuoN CDS complement(96366..97895) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159928.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(97905..99758) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200192.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene nuoL CDS complement(99760..100059) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579761.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene nuoK CDS complement(100056..100637) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464208.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(100646..101239) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851456.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene nuoI CDS complement(101249..102238) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277308.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene nuoH CDS complement(102240..104567) product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891945.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(104568..105344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(105331..105603) product NADH-ubiquinone oxidoreductase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819168.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(105600..106826) product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864417.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene nuoD CDS complement(106826..107617) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864416.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(107614..108123) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(108105..108494) product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851275.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(108505..110238) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858720.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 110347..110955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 110956..111597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 111640..113265 product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925752.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene dauA CDS complement(113314..113565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 113671..113952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(113944..115143) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894372.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(115207..115746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 115849..117006 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815449.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 117003..120167 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815450.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 120160..121545 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037811.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(121560..122402) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873890.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene nfo CDS 122585..123784 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887595.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(123854..124129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 124316..125392 product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858664.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 125389..126432 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142178.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene lpxB CDS 126487..126930 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857452.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene fabZ CDS 126942..127724 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095662.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene lpxA CDS 127735..128961 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891849.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene clpX CDS 128962..129990 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891850.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 129994..130764 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864583.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene mreC CDS complement(130765..131373) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852828.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 131892..133271 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071378.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene mgtE CDS 133485..135353 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864546.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene mnmG CDS 135387..137081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(137078..137764) product bis(5'-nucleosyl)-tetraphosphatase PrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244765.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene prpE CDS complement(137757..138674) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816114.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(138658..141219) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109412.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(141220..142407) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109411.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 142536..143468 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775527.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 143539..145650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 145620..147053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 147043..148458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(148597..149664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(149747..150604) product TniB family NTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102975.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(150607..152487) product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179844.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(152480..153142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(153377..154510) product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206575.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene trmA CDS 154598..156208 product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948968.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 156253..158187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 158208..159509 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852530.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene glmU CDS 159506..160723 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009984.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene coaBC CDS 160716..161402 product di-trans,poly-cis-decaprenylcistransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370674.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 161389..161898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 161895..162911 product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852624.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 162913..163635 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene truA CDS 163724..164515 product HrcA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891884.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 164525..165085 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780052.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene grpE CDS 165163..167046 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521014.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene dnaK CDS 167057..167359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 167356..168486 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(168505..168747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 168862..169668 product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226149.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 169699..171732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 171795..172019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 172070..172483 product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459284.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 172493..173425 product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459235.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene rimK CDS complement(173441..173797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 173928..174290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 174300..176075 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852245.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 176119..176865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(176893..178299) product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097758.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 178427..179053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 179165..179461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 179479..180087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(180092..181324) product ArsS family sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853241.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(181321..181983) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853196.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(182011..183432) product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853235.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene htrA CDS complement(183552..185240) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853088.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene ilvD tRNA 185427..185513 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA 185523..185611 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 185650..185725 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 185846..186190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(186223..187203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941917.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(187184..187855) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906118.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(187852..188808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 189280..189651 product molecular chaperone DnaK suppressor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851949.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene dksA CDS 189648..190646 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851259.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene truD CDS complement(190704..191687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(191696..192274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023053.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 192389..193687 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856815.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 193702..194655 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225440.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 194704..194949 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337254.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene purS CDS 194952..195623 product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858528.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene purQ CDS 195648..196718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 196705..197391 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858620.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 197381..197767 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023830.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene crcB CDS 197827..198048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 198068..198286 product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785095.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene tatA CDS 198297..199886 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891916.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene argS CDS complement(199910..200644) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269436.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(200682..201545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 201636..202634 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780453.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene gap CDS 202643..203845 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891932.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 203846..204559 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855528.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 204556..205380 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780456.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene fabI CDS 205607..206815 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858733.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene lysA CDS 206829..207908 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858741.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene pheA CDS 207925..209028 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858650.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene hisC CDS 209037..210839 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858717.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene dxs CDS 211027..212049 product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857587.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(212070..212621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 212690..213973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704211.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(213991..214722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(214737..215333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 215451..216005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 216015..216728 product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453781.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(216762..219446) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057938.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene alaS CDS 219634..219951 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851800.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene trxA CDS 220157..221086 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851648.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene trxB CDS 221091..221864 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851754.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene dapB CDS 221880..223226 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851896.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene purF CDS 223226..224191 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132720.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(224203..225099) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880380.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 225215..227269 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891908.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 227279..228148 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891909.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene truB CDS 228141..228896 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859130.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 228896..229369 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852861.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene smpB CDS 229533..230999 product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851405.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene ccoN CDS 231014..231679 product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851187.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene ccoO CDS 231689..231913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 231915..232808 product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851306.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 232808..233056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 233153..233782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 233784..234344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 234334..236685 product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891938.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 236749..237387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 237456..238553 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851475.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene prfB CDS complement(238675..239235) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855210.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene efp CDS complement(239245..240831) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852643.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene serA CDS complement(240846..242498) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852520.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(242566..243402) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852585.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(243412..244689) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852577.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene aroA CDS complement(244703..247009) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002915726.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene pheT CDS complement(247006..247998) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852567.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene pheS CDS 248227..248571 product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816465.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(248593..249528) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858530.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene accA CDS complement(249576..250835) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858574.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(250957..251187) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854831.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene acpP CDS complement(251281..252024) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858551.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene fabG CDS complement(252079..252843) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775643.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(252836..253357) product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880124.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(253357..254046) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779268.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene queC CDS 254157..254561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 254561..255232 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851903.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(255367..255576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(255670..256698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(256702..257946) product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852758.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(257960..258460) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852880.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene petA CDS complement(258618..260099) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117321.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene thrC CDS complement(260198..261097) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544977.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene argB CDS 261177..263906 product RecB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864468.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(263903..264496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(264533..265219) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858390.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(265310..266515) product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858758.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene ilvA CDS complement(266678..267448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(267485..268360) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263669.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 268483..269589 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707233.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(269599..270141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(270122..270745) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864829.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(270847..271203) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852307.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene rplS CDS complement(271200..271877) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868040.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene trmD CDS 271991..272344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 272443..274707 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153987.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene metE CDS 274810..275193 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707699.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(275376..277523) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895217.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(277560..277790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(277821..278906) product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331752.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 279125..280705 product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene sirA CDS complement(280714..282990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(283079..283579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(283563..285131) product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070804.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(285141..285440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(285449..287521) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140365.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(287628..288599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(288611..289543) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351829.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(289540..291051) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852018.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(291099..292106) product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857563.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 292276..292845 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415847.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 292847..294046 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858667.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 294043..294657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 rRNA 295045..296559 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 tRNA 296666..296742 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 296768..296843 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 rRNA 297197..300103 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 rRNA 300311..300422 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS complement(300820..301326) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001873572.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(301340..303193) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858598.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 303222..304448 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858324.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene ftsW CDS 304450..305478 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856115.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene murG CDS complement(305475..306242) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002836742.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(306239..306913) product menaquinone biosynthetic enzyme MqnA/MqnD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857885.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 306986..307207 product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857949.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 307209..307658 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781229.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 307655..308470 product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 308556..309983 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858636.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene glnA CDS complement(310084..312075) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858576.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(312078..312767) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948962.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(312764..314239) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057737.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene gpmI CDS 314414..315370 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858494.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene mraY CDS 315374..316543 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858617.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene murD tRNA 316586..316661 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 316674..316750 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 316808..316892 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 316902..316978 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 317190..318398 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040579.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene tuf CDS 318407..318577 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002793551.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene rpmG tRNA 318612..318687 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 318766..318948 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854985.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene secE CDS 318958..319485 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851098.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene nusG CDS 319582..320007 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779452.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene rplK CDS 320096..320794 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854928.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene rplA CDS 320958..321446 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858610.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene rplJ CDS 321495..321863 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858569.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene rplL CDS 322031..326176 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene rpoB CDS 326169..330695 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858508.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene rpoC CDS 330724..331107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 331147..331434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 331697..332479 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973816.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 332467..333231 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973817.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 333228..334460 product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973818.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 334485..335453 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944872.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 335589..337658 product siderophore enterobactin receptor FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350196.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene fepA CDS 337668..338069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 338214..338915 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880277.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(338949..340094) product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108639.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene araJ CDS complement(340152..340907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 341117..341497 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002782934.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene rpsL CDS 341513..341980 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254357.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene rpsG CDS 341990..344098 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779472.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene fusA CDS 344221..345087 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858573.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 345089..346618 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871805.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 346687..349554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 349669..350958 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077422.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 350970..352226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 352266..352760 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852194.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene purE CDS 352760..352990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 352992..353876 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150920.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene glyQ CDS 353878..354633 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852315.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 354626..355354 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 355356..356504 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852277.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene waaA CDS 356495..357247 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852134.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 357396..358748 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852163.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene ffh CDS 358830..359057 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852274.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene rpsP CDS 359074..359313 product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852144.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 359314..359841 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965064.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene rimM CDS complement(359846..360751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(360756..361130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(361147..361935) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946438.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene flgG CDS 362100..362471 product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002866134.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 362485..363393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 363409..364128 product flagellar hook-basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858501.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 364128..364532 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989548.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene flgB CDS 364545..366290 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364750.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene fliF CDS 366294..367298 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201853.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene fliG CDS 367298..367957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 368018..368305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 368316..369002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 369012..370490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 370569..372632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 372693..373022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 373031..375028 product motility protein PflB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858651.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene pflB CDS 375096..375404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 375414..376280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 376282..376581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 376590..376967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 376936..377346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 377343..378488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 378492..379310 product flagella biosynthesis ATPase FlhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851985.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene flhG CDS 379364..379693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 379703..380008 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851122.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene fliE CDS 380024..380488 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858484.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene flgC CDS 380498..382579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 382579..383328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 note possible pseudo, internal stop codon, frameshifted CDS 383339..384388 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858726.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene flhB CDS 384393..386390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 386387..387691 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851735.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene fliI CDS 387688..388821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 388842..390956 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852599.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene flhA CDS 391032..392216 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858477.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 392296..392859 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132255.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(393070..393498) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene mscL CDS 393707..396625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(396638..397474) product DUF5718 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061002828.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(397618..399117) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036607.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(399293..400276) product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041092.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(400310..401368) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256083.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(401379..403898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(403917..405065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(405333..405971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 406047..406346 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545154.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene clpS CDS 406350..408560 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495889.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene clpA CDS 408624..409127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 rRNA 409701..411215 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 tRNA 411322..411398 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 411424..411499 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 rRNA 411853..414759 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 rRNA 414967..415078 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 CDS complement(416046..416540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(416554..418137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(418146..418451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(418505..420634) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206936.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(420721..421404) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 421482..423185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(423187..423966) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852725.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(423969..425357) product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852810.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(425354..426337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(426337..426849) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292536.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene bcp CDS complement(426972..427679) product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859101.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene cmoA CDS complement(427700..428536) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931634.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(428505..429212) product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852328.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(429209..429682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 429786..430358 product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858665.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 430389..431885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(431872..432477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(432478..433542) product DUF5644 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851142.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(433542..434810) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857102.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene murA CDS 434913..435791 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891853.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 435802..436599 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858652.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene kdsA repeat_region 436703..436934 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttaatctactctcaaatccccatttgatataat CDS complement(436983..437348) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene cas2 CDS complement(437345..437566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(437463..438206) product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene cas1 CDS complement(438311..441823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 441951..442421 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854278.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene ribE CDS 442423..442818 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002824771.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene nusB CDS 442820..443518 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858700.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene pyrF tRNA 443595..443684 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 443687..443763 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 443835..443911 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 443945..444021 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 444039..444115 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 444133..444209 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 444227..444301 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 444356..445078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(445075..445398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 445595..446377 product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986202.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 446421..447254 product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611949.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 447257..447985 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851687.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 448024..448278 product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055463.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 448280..449749 product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074267.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 449749..450750 product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858077.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene waaC CDS 450743..451657 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021790.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 451654..452439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662421.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 452429..452782 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165710.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 452798..453802 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016469.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 453840..454730 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795876.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene rfbA CDS 454733..455308 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene rfbC CDS 455301..456188 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931999.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene rfbD CDS 456178..457209 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014548761.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene rfbB CDS 457199..458044 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657976.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 458169..459305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 459298..460260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 460268..461194 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202149.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 461200..462660 product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 462671..463801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 463837..465300 product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 465310..466473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963531.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(466856..467476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(467470..468537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 468646..469395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108792.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 469385..470152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 470149..471069 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868996.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 471062..472132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 472170..473120 product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002875425.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene waaF CDS 473223..474830 product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091675.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 474811..475506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(475516..477414) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065250839.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(477510..478115) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566736.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene gmhA CDS complement(478102..479532) product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene rfaE1 CDS complement(479529..480536) product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858041.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene rfaD CDS complement(480539..481054) product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853963.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene gmhB CDS 481145..482017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 482082..482270 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854974.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene rpmB CDS 482293..483420 product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461981.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 483420..484601 product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330363.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene argJ CDS 484659..484874 product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468330.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 485020..487596 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857904.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene gyrA CDS 487598..488635 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852931.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 488636..489148 product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852919.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 489163..490200 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853233.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene hemE tRNA 490348..490422 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 rRNA 490711..492225 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 tRNA 492332..492408 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 492434..492509 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 rRNA 492863..495769 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 rRNA 495977..496088 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 CDS 496737..497471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 497567..498358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 498355..498603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 498630..499340 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858648.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene ubiE CDS 499341..500528 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382848.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene xseA CDS 500586..501065 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199265.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene cheW CDS 501074..502270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(502281..502829) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722402.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 502908..503291 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142250.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene panD CDS 503284..503604 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851172.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 503605..504477 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851379.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 504600..504857 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002825273.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene groES CDS 504857..506488 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858047.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene groL CDS complement(506531..507094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 507151..507879 product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene dccR CDS 507883..509691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 509898..510671 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938969.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 510720..512522 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858421.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene glmS CDS 512635..513906 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852836.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene metK CDS 513937..514806 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851791.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene accD CDS 514807..515418 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene thiE CDS 515408..515863 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869860.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 515925..516938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 516938..517870 product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346174.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 517949..518764 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852657.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 518767..520809 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852796.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene ftsH CDS complement(520852..521331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 521449..522624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(522672..523706) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856044.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(523703..524722) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856258.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene ruvB CDS complement(524726..525535) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062669.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene panB CDS 525639..526379 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene trpA CDS 526380..527117 product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853863.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 527204..527569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(527572..529482) product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865443.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene feoB CDS complement(529475..529699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 529847..530290 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854230.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(530313..530810) product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261228.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene fldB CDS complement(530826..531581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(531581..531916) product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855637.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(532055..532552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(532632..533348) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880005.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(533345..533869) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022399.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 533912..534589 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 534876..535898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(535895..537211) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858753.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene ccoG CDS 537330..537965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(537993..539183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(539180..539521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 539786..540247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 540395..541174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 541189..541725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 541809..542333 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083317.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(542760..542966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(543251..544006) product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268011.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(544039..544578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(544589..545818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(545911..546354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(546429..546644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(546634..548439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(548451..549638) product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219492.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene dcm CDS complement(549632..550231) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144032.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 550934..551440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 551453..551578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 551994..552440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(552531..552893) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704672.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(552903..553202) product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(553300..554136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(554209..554886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 554995..555228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(555427..555660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 555753..556277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 556270..556431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 556391..556615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 556605..557993 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349722.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 557993..558181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 558171..559013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 559014..559682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 559812..560474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 560471..562351 product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 562351..562569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 562644..562991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(563075..563512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(563509..564357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(564468..565340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(565460..565702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 565951..566805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(566829..567101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 567299..567532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 567532..568980 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460141.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 569017..570909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 570911..571252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 571249..571524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 571521..571805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 571814..572737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 572747..573040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 573133..573345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 573342..575576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 575578..575907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 575909..576535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 576532..576921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 576909..580820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 580821..581807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 581820..582272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 582287..582628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 582631..582897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 582887..583231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 583194..583502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 583499..584077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(584142..585389) product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129562.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 tmRNA complement(585588..585987) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 586139..587332 product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852026.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 587504..588646 product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene nspC CDS 588663..589613 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852184.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene ppk2 CDS 589610..590743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 590848..592149 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851938.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene tig CDS 592164..592748 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806309.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene clpP CDS 592765..593280 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851936.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene def CDS complement(593290..593664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 593781..595292 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851902.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 595536..597086 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980887.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 597119..597445 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071041.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 597446..597868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 597865..600819 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494923.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene mutS CDS 601031..602491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 602554..603153 product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939073.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(603172..604986) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880333.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 604961..605098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(605100..605807) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545163.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene hisA CDS complement(605829..606434) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496519.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene hisH CDS 606561..608309 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456248.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 608299..608562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(608537..609109) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852959.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(609373..611160) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002837927.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene lepA CDS complement(611281..612342) product outer membrane porin OprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087843.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene oprF CDS complement(612477..613502) product fibronectin-binding outer membrane protein CadF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851185.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene cadF CDS complement(613568..614500) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853293.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 614754..615866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(615901..616938) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851977.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene mnmA CDS complement(616950..618053) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544237.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene mnmA CDS complement(618101..618586) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851803.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene folK CDS complement(618658..619683) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677174.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 619760..620245 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852001.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene aroQ CDS 620245..621468 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851913.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 621461..622345 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851869.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene sppA CDS complement(622581..623789) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016959.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(623813..624808) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627902.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene pta CDS complement(625051..626241) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(626321..626944) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086891.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(626937..628778) product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086890.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(628831..630498) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202721.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(630498..630815) product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388394.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(631051..632697) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402531.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(632697..633008) product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388394.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(633145..633756) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388391.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(633756..635573) product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262771.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(635570..637312) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188216241.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(637314..637574) product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874728.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(637647..638309) product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene dccR CDS complement(638290..639873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 tRNA complement(639947..640023) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(640036..640111) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(640137..640211) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(640232..640307) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(640326..640402) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(640415..640490) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(640509..640583) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(640602..640677) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(640733..641239) product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478554.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene pncC CDS complement(641341..642699) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854402.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 642882..645611 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907389.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene ileS CDS 645727..646002 product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858971.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 646004..646600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851410.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 646578..647861 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865460.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 648091..648888 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002892710.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene rpsB CDS 648888..649931 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864836.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene tsf CDS 649972..650655 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891917.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 650649..651482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 651472..652086 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860253.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene gmk CDS complement(652079..653698) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528391.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 653804..656227 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891913.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 656243..656464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(656501..656791) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939104.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(656824..656988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 657327..657920 product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023389.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 657910..658851 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364269.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene hemH CDS 658953..659873 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263293.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 659983..661188 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894643.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 661263..661832 product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017326.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(661891..662307) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097334.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 662457..663236 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438284.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 663421..664722 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene leuA CDS 664822..665256 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206007.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 665256..666221 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816609.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(666236..666520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(666517..666765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 666919..669294 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206936.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 669525..670388 product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201977.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene rhuM CDS complement(670449..671510) product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 671568..672107 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114482.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 672108..673085 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816609.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(673123..673542) product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(673539..673838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 674013..676346 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268707.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 676383..676688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 676697..678313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 678310..678807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 679163..680344 product pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114507.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene pvdR CDS 680338..682308 product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267356.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 682310..683668 product pyoverdine export/recycling transporter outer membrane subunit OmpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895610.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene ompQ CDS complement(683679..683819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(684022..684240) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551414.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 684533..685618 product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 685602..686069 product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186633.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene ybaK CDS 686087..686284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(686291..687184) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693993.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 687287..687790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(687824..688258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 688369..688962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 note possible pseudo, internal stop codon CDS 688963..689559 product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107436.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 689537..692206 product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076860.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 692300..693727 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856117.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 693739..694221 product Cj1386 family hemin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858381.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(694254..694631) product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172296.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(694718..696052) product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673390.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene qseC CDS complement(696049..696711) product two-component system response regulator QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649974.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(696770..698656) product invasion protein CiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858322.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene ciaB CDS complement(698737..699861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(699866..700057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(700066..700419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(700484..700678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 700855..701439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 701459..702199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 702350..704257 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957241.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene htpG CDS 704327..704908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(704933..706294) product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921089.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene thiC CDS complement(706304..706852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(707140..707538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(707548..708948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(708970..709914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(710192..711055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 note possible pseudo, frameshifted CDS 711304..711852 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611471.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 711849..713213 product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071179.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene dbpA CDS 713269..715395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(715400..716038) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072804.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene pdxH CDS complement(716089..716598) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124198.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 716723..718606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 718653..719393 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891839.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 719403..720200 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891838.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 720280..721116 product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457108.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 721181..721720 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852593.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene tpx CDS 721821..722531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 722659..724056 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857888.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene fumC CDS 724071..724316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 724442..725665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 725910..727955 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852419.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 727968..729152 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542869.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 729364..730698 product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene soxC CDS 730667..731851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 731862..732212 product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926970.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene soxX CDS 732228..732680 product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932696.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene soxY CDS 732747..733055 product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene soxZ CDS 733089..734003 product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932698.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene soxA CDS 734015..734437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 734510..736276 product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene soxB CDS 736354..737148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 737145..737594 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228600.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 737587..738027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 738040..738819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(738920..739060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(739419..739616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 tRNA complement(739983..740069) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(740092..740167) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(740189..740273) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(740296..740370) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(740442..741188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(741198..743303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144336993.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(743313..745418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(745426..746391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767375.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(746395..747876) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317502.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(747877..749706) product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857930.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene selB CDS complement(749699..751048) product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545074.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene selA tRNA 751105..751199 product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 751503..752687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 note possible pseudo, frameshifted CDS 752887..754380 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762485.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 754460..755278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 note possible pseudo, frameshifted CDS 755275..755784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 note possible pseudo, frameshifted CDS 755968..758313 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268707.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(758359..758841) product glycoside hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957963.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(758985..760022) product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012159590.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene selD CDS 760249..761343 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071609.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(761300..761557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 761670..761948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 762200..764305 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208087.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 764322..765080 product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225093.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(765176..765688) product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368844.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(765744..766298) product transcriptional regulator YxaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227022.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene yxaF CDS complement(766374..767033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(767030..768595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(768592..769734) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 769874..771559 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857979.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 771540..772136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 772217..772441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 772469..775267 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891941.1 transl_table 11 codon_start 1 transl_except (pos:773009..773011,aa:Sec) note codon on position 181 is selenocysteine opal codon. locus_tag LOCUS_07530 CDS 775279..775875 product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851264.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene fdh3B CDS 775886..776845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 776842..777678 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851178.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene fdhD CDS 777671..778651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 778654..779904 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856962.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(779930..781216) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(781233..781529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 781743..783011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(783053..784540) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620206.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 784716..785024 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323760.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(785072..786043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(786099..786923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 787045..789267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(789289..789756) product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(789756..790133) product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392777.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 790244..790585 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 790588..792666 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002327795.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 792678..793526 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966313.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 793588..795147 product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 795157..796551 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767538.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 796548..797714 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101216.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 797734..798729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 798853..801711 product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331330.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(801765..803195) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031529.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene lpdA CDS complement(803206..804861) product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070783.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene aceF CDS complement(804872..807544) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070782.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene aceE CDS 807651..808367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 808369..809256 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941048.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene lipA CDS complement(809274..809705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 809676..809807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 809804..811255 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583120.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene nadB CDS 811316..812851 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853189.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene guaA CDS 812948..813787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(813798..815489) product protein adenylyltransferase SelO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125671.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 815651..816949 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940453.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(816966..817160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 817306..818004 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206998.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 818083..819240 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964711.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(819266..820258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(820268..821650) product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 821736..822641 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462366.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 822678..823811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(823823..825562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 825691..826098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 826098..826694 product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858707.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 826759..827805 product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 827816..828877 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639875.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(829053..830069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(830066..831904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(831917..834448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(834727..837081) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 837193..837567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 837668..839323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 839572..841017 product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095647.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene dgt CDS complement(841053..843869) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858721.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene uvrA CDS 844311..845570 product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929970.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 845583..846071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(846147..846404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 846491..847954 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208658.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene thiI CDS 847967..849877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 849889..851787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(851807..852106) product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 852195..853721 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964339.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 853714..854409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(854466..855323) product PDC sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852871.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(855421..856512) product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207473.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(856678..857730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 857797..859032 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229222.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 859097..859516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 859534..859734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 859727..859936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 860046..860366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 860363..862210 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852169.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 862248..862940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(862983..863171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 863446..864024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 864129..865880 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590871.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(865922..867094) product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388899.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 867317..868018 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262987.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 868028..869221 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 869218..869820 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948926.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(869834..870841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 871021..871326 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263159.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(871399..873003) product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650259.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(873097..874269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(874364..875041) product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022247.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(875043..875870) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(875883..877145) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858710.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(877222..877530) product DUF6172 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 877644..879269 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853239.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(879282..879968) product response regulator transcription factor VncR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697956.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene vncR CDS complement(880016..881590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 881719..884676 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266519.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 884739..887840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(888212..888550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(888544..889383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(889380..889658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(889655..891262) product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035506.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(891276..893642) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104883.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(893743..894696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(894696..895166) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082669.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(895230..897755) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087385.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 897845..898237 product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 898298..898933 product disulfide bond formation protein BdbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228414.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene bdbD CDS 898933..899232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 899229..899798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 899923..902511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 902579..903340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 903341..904561 product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192948.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 904551..905279 product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091679.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene napG CDS 905276..905833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 905834..906271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 906280..907173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 907170..907808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 907795..908229 product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865665.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 908226..909053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 909050..909523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(909555..910193) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940859.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(910365..910928) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067248.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(910925..913405) product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(913408..913989) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852394.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(913991..914737) product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853724.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 914888..915598 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780603.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 915618..916196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 916204..917832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 917839..918354 product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 918351..919574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(919580..920338) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 920629..923205 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932230.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene acnB CDS complement(923279..924160) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853697.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(924160..925329) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967300.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 925412..926005 product DUF45 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858500.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(926014..926958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(926955..928289) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853860.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(928282..929052) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853622.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(929087..929749) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853534.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(929746..930939) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858203.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene trmB CDS complement(930956..932218) product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108527784.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(932166..933152) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174316.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 933172..934281 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864601.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(934287..935075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 935244..936527 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421462.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene hemL CDS 936536..936850 product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454504.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 936855..937172 product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010071.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 937159..937704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 937791..938645 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684382.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 938716..939438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 939435..940787 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(940920..941153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 941245..941823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 941820..942527 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902128.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 942592..942855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 943011..944411 product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289376.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(944475..944891) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933626.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 945093..945611 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942963.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(945659..947428) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261885.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 947513..947755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 947745..948413 product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene dccR CDS 948370..949563 product two-component system sensor histidine kinase DccS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853219.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene dccS CDS 949551..949889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 949953..950456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 950499..951011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 951258..952568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(952651..953856) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853329.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(953858..956476) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858134.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene secA CDS 956533..957060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(957406..958041) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853160.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 958334..958849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 958849..959559 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178201.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 959591..959761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 959781..961613 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 961615..962463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 962438..963139 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901785.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 963136..964092 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903477.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 964242..965003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693980.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(965012..966121) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071592.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 966387..967682 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851243.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 967679..968353 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 tRNA 968534..968608 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 rRNA 968897..970411 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00130 tRNA 970518..970594 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 970620..970695 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 rRNA 971049..973955 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00140 rRNA 974163..974274 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00150 CDS 974994..975455 product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852389.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 975452..975838 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216764.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 975852..976352 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233034.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 976352..977008 product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene dccR CDS 977001..978167 product two-component system sensor histidine kinase DccS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853219.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene dccS CDS 978227..978808 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855131.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 978810..979268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(979269..980273) product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864239.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 980387..981028 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861474.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene rpe CDS 981031..981624 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545776.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 981611..982423 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858535.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(982412..982921) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene sixA CDS complement(983001..983207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 983260..984234 product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 984277..985296 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002185292.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 985718..985951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 985948..987819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 988037..988777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 988788..989018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 989148..996482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 996674..997267 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 note possible pseudo, frameshifted CDS complement(997554..998432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(998489..1000360) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852997.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene rpoD CDS 1000512..1001012 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544917.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene leuD CDS 1001012..1002079 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880105.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene leuB CDS 1002101..1003030 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(1003037..1003396) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858673.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 1003606..1003764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 1003770..1004138 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800121.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene rpsM CDS 1004148..1004540 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779544.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene rpsK CDS 1004551..1005177 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851551.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene rpsD CDS 1005195..1006193 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851403.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 1006208..1006558 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851332.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene rplQ CDS 1006721..1008076 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853884.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene gatA CDS 1008094..1009539 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852968.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene guaB CDS 1009724..1012255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 1012388..1013368 product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775988.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 1013471..1015018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(1015037..1015834) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891854.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(1015831..1016448) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966112.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 1016509..1017183 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224821.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene pgeF CDS 1017367..1018200 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852510.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene purU CDS 1018200..1018667 product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852450.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(1018671..1018916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(1018903..1020666) product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791319.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 1020777..1021439 product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene dccR CDS 1021429..1022292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 1022289..1022663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 1022799..1026146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 1026143..1026937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(1027116..1027544) product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932687.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(1027644..1028804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256189.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(1028920..1029588) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964441.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene aat CDS 1029650..1030348 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038721.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 1030410..1030766 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene arsC CDS 1030756..1031121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 1031108..1033408 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434402.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 1033497..1034960 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574070.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 1034963..1036342 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891881.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene ftsA CDS 1036342..1037487 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852071.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene ftsZ CDS complement(1037512..1038606) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965785.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(1038609..1038872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 1039028..1040143 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943101.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 1040145..1040339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 1040421..1041098 product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926908.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 1041098..1041721 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932936.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 1041792..1045034 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858661.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene carB CDS 1045037..1045480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229996.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 tRNA 1045543..1045618 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(1045634..1047391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 1047587..1048621 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852978.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene aroB CDS 1048622..1050280 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852957.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 1050297..1051565 product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858158.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene mtaB CDS 1051546..1053009 product ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852990.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 1052999..1053514 product pimelyl-ACP methyl ester esterase BioV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210594.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene bioV CDS 1053511..1054038 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070478.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene mog CDS complement(1054054..1054683) product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047977.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene ribB CDS complement(1054938..1055210) product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072932.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 1055449..1055883 product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854048.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 1055893..1056912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 1057111..1057593 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815594.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 1057590..1058525 product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084282.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 1058691..1061039 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268707.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 1061238..1062119 product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584032.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 1062140..1064386 product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene hypF CDS 1064402..1064707 product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002831611.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(1064711..1065352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 1065463..1066272 product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072157.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene hypB CDS 1066277..1066540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 1066524..1067648 product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072155.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene hypD CDS 1067738..1068448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 1068445..1069293 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400423.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 1069303..1069659 product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329333.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 1069660..1070655 product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072154.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene hypE CDS 1070760..1071101 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072153.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene hypA CDS 1071194..1071919 product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546093.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 1071923..1072525 product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391247.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene cbiM CDS 1072522..1072980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 1072977..1073621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 1073618..1074316 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339131.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(1074267..1074767) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964366.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 1074907..1075137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 1075134..1076261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 1076273..1076413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 1076413..1077552 product membrane-bound O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040546.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 1077549..1078985 product D-alanine--poly(phosphoribitol) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040545.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(1079020..1080255) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852200.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 1080354..1080602 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002890722.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 1080603..1081589 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880074.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene trpD CDS 1081589..1082005 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852319.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene tsaE CDS 1081974..1082723 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855252.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene lptB CDS 1082755..1083786 product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852104.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(1083951..1084088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(1084089..1085594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(1085689..1086087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(1086339..1086791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(1086788..1087150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(1087196..1087936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(1087991..1088749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(1088751..1089785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(1089907..1091115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(1091118..1091351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(1091351..1091800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(1091797..1091982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(1091982..1093334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(1093450..1093845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(1094006..1094218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(1094231..1094536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(1094538..1094747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(1094749..1094961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(1094979..1095200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(1095203..1095772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 1095916..1096497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 1096500..1096721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 1096739..1096951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 1096953..1097162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 1097164..1097469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 1097482..1097694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 1097855..1098250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 1098366..1099718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 1099718..1099903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 1099900..1100349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 1100349..1100582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 1100585..1101793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 1101798..1101920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 1101910..1102944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 1102946..1103704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 1103759..1104499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 1104550..1104927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 1104941..1105315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 1105582..1105980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 1106075..1107580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 1107910..1108962 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852607.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(1108973..1109251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(1109259..1109741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(1109797..1111761) product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483790.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(1111777..1112604) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176078.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(1112614..1113609) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852262.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene hemW CDS 1113761..1114255 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852091.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 1114275..1115486 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891865.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 1115488..1116039 product HobA family DNA replication regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852154.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 1116042..1116665 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852167.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 1116668..1117810 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858587.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene folP CDS 1117892..1119268 product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355104.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 1119270..1120127 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364457.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene galU CDS 1120127..1121356 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855462.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 1121364..1122275 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599434.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(1122272..1122985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 1123081..1123326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 1123326..1124114 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851821.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 1124194..1125180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(1125197..1126111) product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864121.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene cmoB CDS 1126235..1128979 product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793250.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene ccsA CDS 1129044..1130333 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853369.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 1130403..1131983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 1132053..1135040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 1135124..1135660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 1135738..1137063 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851723.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(1137095..1139302) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891903.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(1139379..1139909) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966655.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 1140034..1140375 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388928.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(1140376..1140993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946301.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(1141344..1142306) product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082671.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(1142308..1142784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(1142857..1144353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(1144337..1144924) product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939209.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(1144958..1145659) product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880394.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene cybH CDS complement(1145669..1147393) product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853190.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(1147393..1148628) product nickel-dependent hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072163.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene hyaA CDS complement(1148905..1149831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(1149833..1151323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(1151325..1151501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(1151507..1152079) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853214.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene recR CDS 1152190..1153299 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853203.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene dnaJ CDS 1153320..1153910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(1153931..1154134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(1154208..1155026) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002890476.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 1155081..1155680 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852433.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 1155685..1156590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 1156598..1157593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(1157610..1158440) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 1158547..1160793 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851708.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene bamA CDS 1160793..1161866 product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851090.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 1161924..1163162 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714010.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 1163166..1164467 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871824.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene gltX CDS 1164464..1164736 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852501.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 1164743..1166410 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210646.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(1166379..1166861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 1166963..1167460 product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852644.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene mobB CDS 1167461..1168303 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864856.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 1168296..1168499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002797008.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 1168514..1170466 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852639.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene metG CDS 1170466..1171464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(1171461..1172117) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070966.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 1172460..1174040 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853265.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene pckA CDS complement(1174118..1175188) product protein-glutamate methylesterase/protein glutamine deamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036391.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene cheB CDS complement(1175209..1175886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(1175883..1176728) product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525698.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(1176732..1178801) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061308.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene cheA CDS complement(1178814..1179182) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(1179309..1181453) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853182.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(1181460..1182125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(1182100..1184292) product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853186.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(1184285..1184728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(1184733..1186001) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853212.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene purD CDS complement(1186245..1186886) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862414.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(1186861..1188441) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124397.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(1188449..1189912) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858744.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene der CDS complement(1189990..1190532) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671185.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene raiA CDS complement(1190618..1193395) product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016450.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 1193448..1194572 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859067.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene mltG CDS 1194691..1196883 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942111.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 1196992..1197282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 1197378..1197656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(1197687..1198091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(1198088..1198648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(1198645..1199817) product FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021418.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene mnmC CDS 1199904..1200266 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205282.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 1200276..1200893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 1200890..1202389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 1202458..1203324 product DnaJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045822.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 1203339..1203722 product heat shock transcriptional regulator HspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853230.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene hspR CDS complement(1203723..1204400) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584046.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(1204378..1204542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(1204520..1206655) product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 1206836..1207762 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858026.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene argF CDS 1207762..1209129 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853363.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene hemN CDS complement(1209169..1211265) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268707.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(1211441..1212394) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852582.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(1212396..1213535) product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(1213549..1214301) product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852555.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(1214322..1214543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(1214545..1214775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(1214775..1215530) product DnaJ family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853334.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 1215613..1216014 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852097.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene tatB CDS 1216014..1216742 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852171.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene tatC CDS 1216743..1217765 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852279.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene queA CDS 1217776..1218519 product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816172.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene exoX CDS complement(1218508..1219755) product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002873165.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 1219852..1220859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 1220952..1222232 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853398.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 1222234..1223043 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854600.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene lgt CDS complement(1223083..1223292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(1223300..1223992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(1224091..1226775) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858644.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene polA CDS 1226844..1227572 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852502.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene kdsB CDS 1227562..1228863 product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080877.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(1228878..1229162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(1229155..1230060) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891880.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene rsmH CDS 1230117..1230695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 1230808..1231083 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859562.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 tRNA 1231124..1231209 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 1231383..1231766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 note possible pseudo, internal stop codon, frameshifted CDS 1231982..1232263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 note possible pseudo, internal stop codon, frameshifted CDS 1232260..1232727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 note possible pseudo, frameshifted CDS 1232835..1233131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 note possible pseudo, internal stop codon, frameshifted CDS 1233091..1233339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 note possible pseudo, internal stop codon, frameshifted CDS 1233361..1234083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 note possible pseudo, internal stop codon CDS complement(1234145..1235131) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033910908.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(1235436..1240310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(1240595..1241731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(1242080..1244095) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858294.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene glyS CDS complement(1244088..1244246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(1244256..1244624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(1244626..1244847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(1244850..1245431) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068828.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene rsmG CDS complement(1245428..1246003) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853056.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene ribA CDS 1246063..1247037 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852925.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene hemB CDS 1247039..1248112 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851243.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 1248109..1248765 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(1248792..1249871) product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023287.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(1249916..1251211) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902388.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene brnQ CDS complement(1251204..1251506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(1251526..1253634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(1253793..1254740) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852180.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene lpxD CDS complement(1254779..1255276) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852211.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene ilvN CDS complement(1255276..1256973) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852093.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(1257013..1257210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 1257135..1257920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(1257917..1258846) product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930648.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(1258843..1259400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1259397..1260509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 1260596..1261090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 1261077..1261316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 1261318..1261749 product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706262.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene trxC CDS complement(1261755..1262255) product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069669028.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(1262252..1263034) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851719.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 1263146..1263346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 1263346..1264563 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858151.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 1264563..1265456 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139790.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(1265463..1266353) product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530123.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(1266356..1267519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(1267516..1268733) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858475.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(1268766..1269251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(1269252..1269617) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853400.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(1269635..1269805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(1269838..1271571) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022302.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1271578..1272684) product UDP-N-acetylbacillosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852877.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene pglE CDS complement(1272677..1273279) product UDP-N-acetylbacillosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852865.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene pglD CDS complement(1273279..1273872) product undecaprenyl phosphate N,N'-diacetylbacillosamine 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852766.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene pglC CDS complement(1273865..1274965) product N,N'-diacetylbacillosaminyl-diphospho-undecaprenol alpha-1,3-N-acetylgalactosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852885.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene pglA CDS complement(1274958..1276094) product N-acetylgalactosamine-N,N'-diacetylbacillosaminyl-diphospho-undecaprenol 4-alpha-N-acetylgalactosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852870.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene pglJ CDS complement(1276084..1277901) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022291.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene asnB CDS complement(1277903..1278793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(1279096..1280025) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073068.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(1280015..1281526) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073069.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(1281523..1282245) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208949.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(1282242..1282460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(1282464..1283537) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042001299.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(1283546..1283770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(1283760..1284563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(1284560..1286068) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(1286079..1286726) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289363.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(1286727..1287800) product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014989.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(1287797..1288834) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014548761.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene rfbB CDS complement(1288824..1289678) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073074.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene rfbA CDS complement(1289683..1290927) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963428.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(1290924..1292015) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931922.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(1292030..1293205) product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704802.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene ugd CDS complement(1293277..1293477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(1293552..1294034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 1294135..1295367 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786913.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 1295364..1296401 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 1296404..1299553 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 1299613..1300194 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene pnuC CDS 1300191..1300961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(1300977..1303409) product aspartate chemotaxis receptor CcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851362.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene ccaA CDS 1303611..1305470 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774319.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene uvrC CDS 1305448..1306482 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852617.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 1306518..1308029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 1308031..1310538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 1310540..1310818 product FlhB-like flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852641.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 1310885..1311325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 1311322..1313100 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852196.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene mrdA CDS 1313146..1313871 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852529.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene fliP CDS 1314003..1315826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 1315947..1317311 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880416.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 1317308..1318030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 1318023..1319582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 note possible pseudo, frameshifted CDS 1319579..1321234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 note possible pseudo, frameshifted CDS 1321328..1321822 product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109277682.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 1321886..1322839 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene argC CDS complement(1322870..1324462) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942070.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(1324562..1326058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(1326181..1326810) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185713.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(1326831..1327418) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212179.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 1327553..1327924 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388928.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 1327928..1328830 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940938.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(1328868..1329887) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766269.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 1329987..1330862 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852976.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 1330922..1331659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(1331723..1332277) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963151.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(1332347..1333156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(1333226..1334371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(1334358..1335020) product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene dccR CDS complement(1335017..1335961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(1335977..1336975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(1337069..1337953) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965523.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(1337965..1338489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 1338655..1338972 product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417824.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene sugE CDS 1338980..1339768 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065769.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 1339841..1340476 product UPF0323 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743516.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 1340479..1341657 product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858689.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(1341677..1343623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(1343607..1343813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 1344000..1345082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(1345090..1347039) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852062.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene ligA CDS 1347224..1349218 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704964.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 1349374..1351443 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975761.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 1351652..1352050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 1352040..1353413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 1353569..1355638 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975761.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 1355847..1356245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 1356235..1357596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 1357843..1360170 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009881803.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 1360285..1360752 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 1360755..1361711 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103965.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 1361864..1364236 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104883.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(1364304..1365389) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444586.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(1365398..1365664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 1365754..1366182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 1366191..1366685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 1366830..1368845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 1368966..1369439 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815410.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(1369457..1369924) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(1369914..1370516) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852258.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene yihA CDS complement(1370518..1371003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(1371004..1371543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(1371534..1372031) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593725.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(1372028..1372600) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene hisB CDS complement(1372610..1373497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(1373517..1374752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(1374784..1375299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(1375582..1375884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(1375940..1377268) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852226.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene hslU CDS complement(1377276..1377812) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781630.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene hslV CDS complement(1377815..1378261) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781628.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene rplI CDS complement(1378326..1378961) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074453.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 1379169..1379723 product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780126.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 1379714..1380220 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852633.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene coaD CDS 1380211..1380777 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852526.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene tmk CDS 1380770..1382002 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852541.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene hisS CDS 1381992..1383806 product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891885.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene speA CDS 1383796..1384554 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852612.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene cysE CDS 1384557..1385291 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858695.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(1385309..1385902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 1386041..1386631 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853070.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 1386820..1388769 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852425.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 1388812..1389255 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858625.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 1389259..1390374 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880410.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(1390435..1391283) product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814376.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene modD CDS complement(1391287..1391793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(1391877..1392674) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(1392674..1393267) product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851338.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(1393288..1394832) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858133.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene rny CDS complement(1394840..1395376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 1395438..1395995 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858112.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 1396006..1397040 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864556.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene ftsY CDS 1397062..1397766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(1397759..1398229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 note possible pseudo, internal stop codon CDS complement(1398431..1400236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 note possible pseudo, internal stop codon CDS complement(1400217..1401137) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099334852.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(1401199..1402017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(1402014..1402733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(1402746..1410254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(1410338..1410901) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073646.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 1410997..1412346 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858434.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene radA CDS complement(1412357..1412770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 1412835..1413254 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851664.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene ybeY CDS complement(1413275..1413679) product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858684.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene perR CDS 1413846..1415423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 1415420..1416739 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611242.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene murJ CDS 1416792..1418501 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858782.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 1418546..1419604 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852597.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 1419604..1420917 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852436.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 1420931..1421818 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852574.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene dapA CDS 1421818..1422597 product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891889.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 1422597..1423139 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002812871.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene pgsA CDS 1423149..1424207 product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002934663.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene rseP CDS 1424890..1426770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 1426892..1427275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 note possible pseudo, internal stop codon, frameshifted CDS 1427491..1427772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 note possible pseudo, internal stop codon, frameshifted CDS 1427754..1428236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 note possible pseudo, internal stop codon, frameshifted CDS complement(1428585..1430672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(1430884..1431129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(1431412..1431927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(1431930..1432517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(1432519..1433325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(1433315..1436479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 1436797..1437477 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888213.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(1437488..1437697) product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853198.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 1437788..1438615 product glutamate biosynthesis transcriptional regulator GltR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246132.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene gltR CDS 1438722..1438940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(1439081..1440034) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071380.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(1440022..1441782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 1441932..1442369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 1442398..1443078 product acid response regulator transcription factor ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573710.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene arsR CDS 1443075..1444292 product ArsS family sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853241.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 1444338..1445441 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420964.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 1445495..1446463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 note possible pseudo, frameshifted CDS 1446864..1447235 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546768.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 1447235..1449112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 1449109..1451544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 1451582..1452415 product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(1452436..1453230) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854779.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene trpC CDS complement(1453227..1454531) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855132.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(1454507..1454890) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864630.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(1454883..1455599) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864161.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 1455741..1456070 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851088.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 1456073..1457203 product 2-oxoglutarate synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858560.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 1457205..1458038 product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854895.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 1458048..1458614 product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388051.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(1458640..1459767) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545883.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(1459940..1461157) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028053369.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(1461167..1462234) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895603.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(1462249..1462653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(1462674..1463159) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930808.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(1463244..1464149) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477402.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 1464331..1465497 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(1465553..1466155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(1466253..1467017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(1467034..1467603) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858481.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 1467870..1468511 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357697.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(1468552..1471107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(1471339..1472118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(1472143..1473891) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871806.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene aspS CDS complement(1473935..1475107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853393.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(1475104..1475769) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946023.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(1475856..1476074) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781436.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene infA CDS complement(1476084..1476848) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858416.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene map CDS complement(1476850..1478112) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864789.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene secY CDS complement(1478115..1478513) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851292.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene rplO CDS complement(1478518..1478958) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001860543.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene rpsE CDS complement(1478968..1479327) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851411.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene rplR CDS complement(1479337..1479873) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851302.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene rplF CDS complement(1479883..1480281) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851353.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene rpsH CDS complement(1480294..1480479) product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085694.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(1480479..1481027) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851453.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene rplE CDS complement(1481031..1481267) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779437.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(1481267..1481635) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779438.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene rplN CDS complement(1481635..1481886) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851549.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene rpsQ CDS complement(1481896..1482087) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851566.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene rpmC CDS complement(1482074..1482499) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928961.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene rplP CDS complement(1482502..1483206) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529962.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene rpsC CDS complement(1483206..1483538) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030375.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene rplV CDS complement(1483541..1483816) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851509.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene rpsS CDS complement(1483826..1484653) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002825501.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene rplB CDS complement(1484664..1484945) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851441.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(1484947..1485558) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851146.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene rplD CDS complement(1485555..1486130) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864792.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene rplC CDS complement(1486150..1486464) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779353.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene rpsJ CDS complement(1486670..1487905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(1487950..1488438) product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858543.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(1488448..1489884) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852462.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(1489871..1490590) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852645.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(1490593..1491633) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852516.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(1491655..1492212) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852492.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene ruvA CDS 1492332..1494515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(1494566..1494913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(1494965..1496038) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052415.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene truD CDS complement(1496050..1496877) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130232873.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 1496998..1497522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(1497567..1497881) product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077234.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 1497998..1498261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 1498264..1498878 product recombination protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851895.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene recO CDS complement(1498885..1499709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(1499735..1500838) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858396.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene ychF CDS 1500979..1503078 product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853255.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 1503080..1503277 product KCU-star family selenoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867452.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene kcuS CDS complement(1503573..1504874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(1504886..1505551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035508.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(1505645..1506928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(1507079..1509253) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815626.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 1509516..1509830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 1509830..1510510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 1510514..1510831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 1510828..1511181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 1511174..1511545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 1511558..1513675 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390606.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 1513755..1513877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 1513855..1514118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(1514255..1515466) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971887.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(1515466..1516170) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531071.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(1516160..1517425) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924854.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(1517432..1518649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 1518797..1519225 product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661840.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene exbB CDS 1519206..1519583 product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851470.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene exbD CDS 1519588..1520295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(1520348..1521760) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853317.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(1521750..1522451) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853249.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(1522461..1523672) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966435.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene trpB CDS complement(1523686..1524243) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853297.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene apt CDS 1524365..1525168 product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851175.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(1525170..1525565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(1525627..1527072) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858532.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(1527072..1528133) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852250.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene ispG CDS 1528242..1530314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 1530372..1531076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 1531089..1532612 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858694.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene lysS CDS 1532632..1533894 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858710.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 1533912..1534961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 1534974..1536386 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene trpE CDS 1536396..1537178 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853163.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 1537171..1538097 product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075036.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene pdxA CDS 1538094..1539164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 1539223..1539930 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858454.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene pyrH CDS 1539962..1540177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 1540211..1542370 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858057.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 1542385..1543593 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858315.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene tyrS CDS 1543606..1544685 product decanoate oxidase/trans-2-decenoyl-[acyl-carrier protein] isomerase FabX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255244.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene fabX CDS 1544781..1546211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 1546339..1548615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 1548612..1550546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 1550550..1551635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 1551725..1552054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 note possible pseudo, frameshifted CDS 1552102..1552935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 note possible pseudo, frameshifted CDS complement(1553162..1553605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(1553609..1554676) product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236083.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(1554679..1555233) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858659.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene pth CDS complement(1555243..1555779) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002791314.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 1555934..1556794 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864845.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene folD CDS 1556795..1557577 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852457.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene lepB CDS 1557578..1558033 product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene rpiB CDS 1558169..1559398 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853125.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(1559413..1561734) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009881974.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(1561981..1564269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(1564476..1566452) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253032.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(1566781..1568229) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919528.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(1568451..1570394) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880310.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(1570497..1572173) product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214693.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(1572182..1575856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 1576020..1577015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 1577083..1577493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(1577512..1578162) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852225.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene nth CDS complement(1578167..1580140) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855027.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene uvrB CDS 1580226..1580627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(1580632..1581330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(1581332..1581817) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031337.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene greA CDS 1581879..1582529 product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612425.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 1582593..1583501 product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251148.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(1583542..1584936) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891895.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene argH CDS 1585034..1586281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(1586297..1586932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(1587011..1587955) product iron-sulfur cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051995.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 1588180..1589616 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021047.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene sufB CDS 1589619..1590392 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367012.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene sufC CDS 1590379..1591410 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene sufD CDS 1591413..1592600 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783932.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 1592602..1593009 product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 1593019..1593369 product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(1593448..1593705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 1593798..1594622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 1594791..1595612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 1595749..1597200 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880952.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene accC CDS complement(1597238..1598110) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207359.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(1598210..1598434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(1598478..1599704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(1599715..1600977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(1600967..1601365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 1601500..1601736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(1601793..1603247) product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114563.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(1603237..1604505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(1604515..1604889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 1605042..1606580 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972441.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(1606607..1607344) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880082.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene cobA CDS complement(1607345..1608430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(1608433..1609554) product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113242.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene nirJ CDS complement(1609554..1609862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(1609887..1610687) product peptidylprolyl isomerase PEB4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852119.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene peb4 CDS complement(1610697..1612271) product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497115.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(1612331..1613983) product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene nirS CDS complement(1614068..1614232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(1614245..1615666) product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene norB CDS complement(1615656..1616327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(1616352..1616681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(1616803..1617366) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853058.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(1617366..1619783) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868636.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene lon CDS complement(1619841..1620494) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852961.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 1620606..1621370 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888161.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene proC CDS 1621357..1621644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 1621592..1621975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(1622296..1622895) product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853680.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene rdgB CDS 1622971..1624281 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857990.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 1624314..1624955 product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832895.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 1624969..1627185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 1627216..1627971 product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462426.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene elyC CDS complement(1627993..1628910) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169775301.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 1628999..1630006 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048260.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(1630045..1630710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 1630841..1633456 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864150.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(1633502..1633933) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061029547.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 1634063..1634389 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727879.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(1634466..1634846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(1634848..1635417) product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880784.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 1635539..1636561 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 1636571..1636963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(1636972..1637463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(1637536..1638036) product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(1638023..1639429) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851742.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene aspA CDS complement(1639486..1640187) product aminodeoxyfutalosine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859787.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene pfs CDS complement(1640180..1641109) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851630.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene fabD CDS complement(1641199..1641840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(1641864..1642841) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851738.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(1642845..1643387) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851617.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene pal CDS complement(1643556..1644830) product Tol-Pal system protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269995.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene tolB CDS complement(1644837..1645568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(1645571..1645960) product ExbD/TolR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105106.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(1645966..1646529) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887310.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(1646536..1646913) product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851752.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene atpC CDS complement(1646934..1648328) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852005.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene atpD CDS complement(1648350..1649234) product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851834.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene atpG CDS complement(1649245..1650762) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851836.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene atpA CDS complement(1650784..1651314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(1651314..1651826) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851681.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(1651842..1652264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(1652381..1653235) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034353519.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(1653257..1654033) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851697.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(1654030..1654665) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858812.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 1654739..1655632 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584138.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(1655642..1656562) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223483.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene fmt CDS complement(1656574..1657335) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851769.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene proB CDS complement(1657336..1658421) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851611.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene obgE CDS complement(1658550..1658807) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800974.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene rpmA CDS complement(1658837..1659214) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119318.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene rplU CDS complement(1659262..1660896) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601638.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene dnaG CDS 1660976..1662025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163504.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 1662078..1662758 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851153.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene rnc CDS 1662755..1663831 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094036.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene aroC CDS 1663821..1664573 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987089.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 1664583..1667237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(1667361..1668362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 1668462..1668923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(1669091..1669771) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965197.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(1669789..1671087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(1671222..1671404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(1671530..1671928) product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816150.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(1671948..1672322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(1672319..1672717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 1672986..1674449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 1674563..1676224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 1676240..1676902 product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene dccR CDS complement(1676876..1677559) product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938028.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 1677665..1678150 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(1678152..1678562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(1678575..1679945) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853397.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene mnmE CDS complement(1679920..1680783) product Jag N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853389.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(1680801..1682381) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853384.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene yidC CDS complement(1682374..1682706) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853395.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene yidD CDS complement(1683026..1683160) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776864.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene rpmH CDS complement(1683234..1685816) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858618.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 1685937..1686509 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853153.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(1686526..1687422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(1687479..1687793) product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868800.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 1687865..1688203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(1688196..1688684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(1689073..1690218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 1690986..1691450 product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360775.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(1691462..1691977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(1691967..1692149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(1692215..1693078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(1693089..1693454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(1694076..1694453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(1694486..1695073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(1695070..1695711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 1695809..1696054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(1696147..1697901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(1698271..1698699) product methionine-R-sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853613.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 1698763..1699104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(1699097..1699765) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435254.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(1699774..1701045) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263576.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene bioA CDS complement(1701049..1703622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(1703767..1705299) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853339.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene purH CDS complement(1705377..1707590) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858406.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene purL CDS complement(1707654..1708613) product cell shape-determining L,D-carboxypeptidase Csd6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757130.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene csd6 CDS 1708694..1709884 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852845.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(1709905..1710477) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851990.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene folE CDS complement(1710502..1711452) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943935.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene corA CDS complement(1711470..1712657) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891769.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(1712654..1714009) product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864463.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(1713981..1714715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(1714696..1715568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(1715644..1716531) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852114.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene era CDS complement(1716593..1716958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(1716970..1717677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 1717799..1718959 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 1718956..1720458 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910561.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 1720455..1721009 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619543.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1721224..1722414) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(1722523..1723986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(1723983..1724879) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864655.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 1724991..1725365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 1725358..1726578 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071545.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene nhaA CDS complement(1726596..1727609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 note possible pseudo, internal stop codon CDS complement(1727691..1728725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 note possible pseudo, internal stop codon CDS complement(1728880..1730007) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651618.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(1729946..1730908) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265511.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(1730911..1731855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(1731855..1733219) product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268823.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(1733229..1734581) product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457828.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(1734668..1736731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 1736900..1737211 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853292.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 tRNA 1737362..1737445 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(1737821..1739767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17110 note possible pseudo, internal stop codon CDS complement(1739783..1741177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 note possible pseudo, internal stop codon CDS 1741459..1742397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 1742565..1743887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 1743970..1744209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 1744500..1745237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 1745281..1745589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 1745695..1745955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 1745952..1747121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(1747264..1747656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(1747665..1747979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 1748262..1748495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 1748560..1749795 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545857.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 1749804..1751675 product beta-1,6-glucan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087383.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(1751885..1752805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(1752818..1753447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(1753459..1753962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(1754107..1754691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(1754670..1755707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(1755707..1757977) product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261845.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene tssI CDS complement(1758000..1758623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(1758626..1761964) product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261627.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene tssM CDS complement(1761964..1762809) product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418702.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene icmH CDS complement(1762818..1764146) product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105481.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene tssK CDS complement(1764149..1764604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(1764613..1765881) product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261630.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene tagH CDS complement(1765885..1766007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(1766030..1768555) product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261632.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene tssH CDS complement(1768545..1769546) product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705716.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene tssG CDS complement(1769551..1771323) product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046464013.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene tssF CDS complement(1771324..1771734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(1771738..1773210) product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105492.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene tssC CDS complement(1773220..1773711) product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418723.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene tssB CDS complement(1773729..1775246) product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261637.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene tssA CDS 1775411..1779079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 1779094..1780122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 1780137..1783325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 1783341..1784171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 1784172..1785197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 1785368..1786012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 1786208..1786363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(1786360..1789128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(1789125..1790816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(1790970..1791209) product Rad51 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074138.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(1791275..1794262) product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858240.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(1794262..1794567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 1794681..1794917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(1794936..1795643) product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263502.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 1795770..1797476 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071465.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(1797501..1798016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(1798118..1800235) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808733.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(1800222..1801394) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798455.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(1801391..1801918) product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202125.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene lptE CDS complement(1801922..1804390) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852890.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene leuS CDS complement(1804387..1804731) product DUF6394 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383778.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 1804887..1805645 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366185.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene motA CDS 1805648..1806403 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085308.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene motB CDS 1806393..1806800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(1806793..1806963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(1806991..1807959) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858025.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene secF CDS complement(1807959..1809524) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857963.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene secD CDS complement(1809587..1809862) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002786346.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene yajC CDS 1810113..1811123 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237964.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(1811124..1811945) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019314.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 1812000..1812779 product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851318.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(1812821..1814587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(1814598..1815038) product DUF3015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732920.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(1815081..1816313) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868507.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(1816288..1817151) product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene mscS CDS complement(1817155..1818861) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891863.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(1818891..1820213) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878972.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene hemA CDS complement(1820215..1821114) product hexaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864642.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(1821115..1821417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(1821417..1822712) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943721.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene hisD CDS complement(1822699..1823220) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904001.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(1823236..1824105) product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072070.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 1824167..1824634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 1824638..1825030 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 1825170..1826348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(1826456..1827328) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480609.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(1827338..1828276) product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545174.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(1828289..1829110) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119813.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(1829137..1829328) product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831035.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(1829465..1830253) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(1830253..1831281) product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013499.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene dmpG CDS complement(1831283..1832164) product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419251.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(1832301..1833089) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(1833099..1834556) product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110130.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene hpaE CDS complement(1834556..1834978) product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255194.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(1834981..1835928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(1835925..1836239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(1836385..1837317) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597533.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene mdh CDS complement(1837348..1838154) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(1838222..1839280) product phenol 2-monooxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206216.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(1839284..1839643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(1839655..1841169) product aromatic/alkene/methane monooxygenase hydroxylase/oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206217.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(1841190..1841465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(1841496..1842488) product aromatic/alkene monooxygenase hydroxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206218.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(1842504..1842737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 1842875..1844149 product histidine kinase dimerization/phosphoacceptor domain -containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876616.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 1844149..1844907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(1844954..1846450) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207086.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(1846587..1847654) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene fbaA CDS complement(1847664..1848470) product peptidylprolyl isomerase CBF2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739470.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene cbf2 CDS 1848666..1849346 product homeostatic response regulator transcription factor HsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857553.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene hsrA CDS 1849483..1850634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(1850647..1851087) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846164.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(1851098..1852135) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612141.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(1852135..1852533) product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852609.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(1852655..1852927) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852579.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene rpsO CDS complement(1853027..1853998) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868437.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene moaA CDS complement(1854011..1854928) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880083.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 1855014..1855679 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356133.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 1855676..1856668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 1856792..1859602 product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852404.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene napA CDS 1859612..1860415 product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852504.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene napG CDS 1860412..1861215 product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705483.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene napH CDS 1861212..1861814 product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891887.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 1861816..1862301 product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704259.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 1862298..1863263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 1863268..1863654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 1863656..1864099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 1864163..1865782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 1865779..1866165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(1866446..1867687) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858681.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene serS CDS 1867843..1869840 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482128.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 1870164..1871141 product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158910.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene hlyD CDS 1871143..1872843 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168099.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 1872840..1873928 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168097.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 1873928..1875019 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061625.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(1875028..1876089) product CDF family cation-efflux transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852858.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene czcD CDS complement(1876100..1876399) product Ni(II)/Co(II)-binding transcriptional repressor RcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369853.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene rcnR CDS complement(1876510..1877481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 1877593..1879677 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044346855.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 1879768..1881552 product yersiniabactin ABC transporter ATP-binding/permease protein YbtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001327262.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene ybtP CDS 1881545..1883326 product yersiniabactin ABC transporter ATP-binding/permease protein YbtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212761.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene ybtQ CDS 1883323..1884543 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390089.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 1884530..1885705 product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983670.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 1885699..1886238 product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 1886377..1887342 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858719.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene trpS CDS 1887344..1888678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 1888669..1889415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 1889504..1890451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 1890441..1892531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 1892528..1893577 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037024.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 1893581..1894129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(1894126..1894983) product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746206.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(1894986..1895690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(1895690..1896298) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956489.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene hisG CDS complement(1896276..1896911) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864777.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(1896898..1897230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 1897301..1898083 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073449.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 1898085..1898552 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707143.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(1898549..1900363) product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865770.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 1900618..1900980 product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964322.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene ndhC CDS 1900971..1901486 product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524416.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 1901479..1903110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 1903110..1903595 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene nuoE CDS 1903585..1904835 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829484.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene nuoF CDS 1904857..1906143 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851494.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 1906174..1907610 product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238899.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 1907607..1908884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 1908886..1909386 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941014.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene nuoI CDS 1909383..1909907 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888135.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 1909911..1910225 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813222.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene nuoK CDS 1910222..1912108 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene nuoL CDS 1912110..1913597 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 1913594..1915114 product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 1915301..1916101 product fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854660.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 1916101..1918086 product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854193.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 1918086..1918817 product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854302.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 1918914..1921262 product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857319.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 1921262..1923286 product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858743.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(1923300..1923854) product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071746.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 1923995..1924609 product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(1924615..1925349) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(1925360..1925977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(1925993..1928317) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009881974.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(1928587..1930815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(1931066..1931311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(1931461..1932729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(1932741..1933124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(1933137..1933373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 1933540..1934586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(1934588..1935637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 1935772..1936980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 1936987..1937997 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858561.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 1937994..1938122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(1938169..1939095) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(1939105..1940082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 1940253..1941140 product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052176.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene prpB CDS 1941187..1942338 product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036232.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene prpC CDS 1942396..1944993 product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224931.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene acnD CDS 1945094..1946272 product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065151.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene prpF CDS complement(1946377..1946919) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(1947032..1947970) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856753.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene hemC CDS complement(1947974..1948834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(1948894..1950819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(1950816..1951598) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964198.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene murI CDS 1951697..1952374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(1952492..1953844) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289187.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene gdhA CDS complement(1953982..1955304) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004715.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene rho CDS complement(1955465..1956061) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854219.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 1956236..1956508 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858671.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 1956616..1957029 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858685.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene ndk CDS 1957036..1957413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858727.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 1957427..1957579 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858674.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene rpmF CDS 1957579..1958586 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858645.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene plsX CDS 1958606..1959604 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858639.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(1959626..1960066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 1960105..1960746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(1960728..1961288) product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794135.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(1961298..1962308) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694271.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(1962301..1963179) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852714.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 1963276..1965606 product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451094.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 1965827..1967047 product group 1 major outer membrane porin protein PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891919.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene porA CDS 1967202..1967402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(1967754..1968848) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851710.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene fliM CDS complement(1968850..1969899) product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832067.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 1969997..1971241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 1971243..1971503 product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851290.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene fliQ CDS 1971506..1971910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 1971920..1972396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 1972408..1972935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 1972935..1973363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 1973353..1974060 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864738.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene flgH CDS 1974116..1976002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 1976023..1977336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 1977414..1977770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 1977746..1978015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(1978027..1979088) product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858079.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene mqnE CDS complement(1979098..1979415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(1979405..1980058) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851887.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(1980045..1981148) product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491853.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(1981340..1981672) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211699.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(1981675..1981875) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546191.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene thiS CDS complement(1981928..1982932) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864617.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(1982959..1983690) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721366.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 1984131..1984283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 1984382..1985875 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858708.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene pyk CDS complement(1985886..1986146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(1986170..1986958) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854555.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene surE CDS complement(1986933..1990496) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852165.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene dnaE CDS complement(1990587..1991129) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241398.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 1991246..1991920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 1991920..1992507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(1992502..1994067) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853146.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene recJ CDS complement(1994067..1995683) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853102.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(1995809..1997191) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858753.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene ccoG CDS 1997452..1998468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(1998581..1999768) product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(1999799..2000110) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854273.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(2000107..2000730) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854681.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene plsY CDS 2000822..2001811 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141770.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene nadA CDS 2001808..2002629 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405980.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene nadC CDS 2002632..2003618 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881055.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 2003602..2005038 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858680.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 2005004..2005930 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815275.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene lpxC CDS 2005934..2006386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 2006399..2007280 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261726.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene thrB CDS 2007319..2007609 product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232480.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 2007584..2010229 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864659.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene infB CDS 2010283..2010594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 2010591..2011019 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800873.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene rimP CDS 2011033..2012046 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891948.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene ribD CDS complement(2012048..2013628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(2013635..2014249) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867614.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(2014249..2015517) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858634.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene miaB CDS complement(2015578..2015820) product HP0268 family nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859022.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 2015971..2017152 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858478.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene nusA CDS 2017154..2018557 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471359.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene cysS CDS complement(2018552..2018749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(2018825..2019091) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853032.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene rpsR CDS complement(2019107..2019622) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865738.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(2019642..2019998) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216713.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene rpsF CDS complement(2020082..2021062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 2021129..2021503 product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862609.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene fliW CDS complement(2021493..2023340) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891871.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 2023450..2024472 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858483.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene ilvC CDS 2024517..2025749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 2025793..2026566 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077645213.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene dprA CDS complement(2026590..2027894) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894779.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene murC CDS complement(2027894..2028481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(2028494..2029921) product COG3400 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717228.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 2030026..2031147 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853029.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene tgt CDS 2031208..2031501 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858734.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene gatC CDS 2031511..2031852 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925714.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(2031912..2033264) product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268550.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(2033328..2034320) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155041.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene tal CDS complement(2034323..2034949) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851598.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene serB CDS 2035032..2035946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 2035943..2036332 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852281.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene ruvX CDS complement(2036487..2037083) product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687047.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(2037240..2037593) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857939.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene acpS CDS 2037622..2038581 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546375.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 2038606..2039424 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264323.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene panC CDS complement(2039467..2039904) product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462359.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 2040019..2041359 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851299.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene rimO CDS 2041356..2042333 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851521.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene tilS CDS complement(2042323..2043348) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852008.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene pyrC CDS complement(2043345..2043683) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717795.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene glnB CDS complement(2043738..2044922) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 2045145..2047073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 2047063..2049519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(2049506..2052988) product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857980.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 2053100..2054416 product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852850.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(2054463..2054933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 2055073..2055477 product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483612.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(2055489..2055815) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382924.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(2055834..2057084) product arsenite efflux transporter membrane subunit ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455949.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene arsB CDS complement(2057091..2057453) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881834.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(2057534..2059450) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858130.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene tkt CDS complement(2059557..2064293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(2064402..2065181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(2065230..2078957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(2079067..2080590) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(2080592..2082751) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060991856.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(2082765..2084558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 2084712..2085413 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 2085429..2087810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(2087807..2090587) product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986599.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 2090686..2092731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 2092764..2093462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(2093459..2094334) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937586.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 2094476..2094739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 2094743..2096584 product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 2096704..2096832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 tRNA complement(2096850..2096926) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(2096991..2097067) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(2097077..2097161) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(2097167..2097243) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(2097257..2097333) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(2097353..2097430) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS complement(2097540..2098319) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881431.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(2098316..2098627) product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545706.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene cutA CDS complement(2098624..2100009) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954017.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(2100033..2100377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(2100379..2101374) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864246.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene tsaD CDS complement(2101371..2101934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(2101921..2102217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(2102207..2103274) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260724.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene dxr CDS complement(2103271..2104029) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656886.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(2104153..2104929) product conjugal transfer complement resistance protein TraT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782438.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene traT CDS complement(2105021..2106349) product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864240.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 2106438..2106758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 2106835..2108436 product DUF3373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942839.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(2108462..2108977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 2109089..2110897 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858701.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene thrS CDS 2110894..2111421 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851726.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene infC CDS 2111557..2111754 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125542.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene rpmI CDS 2111852..2112208 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851731.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene rplT CDS complement(2112281..2113366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(2113464..2113691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(2113693..2115162) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(2115258..2115842) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867312.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(2115909..2117189) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895941.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene leuC CDS complement(2117249..2117719) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921378.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene lspA CDS complement(2117716..2119050) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860288.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene glmM CDS 2119133..2119393 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851317.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene rpsT CDS 2119409..2120476 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851189.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene prfA CDS complement(2120507..2121520) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861329.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene gap CDS complement(2121571..2122263) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399305.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(2122278..2123039) product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106098.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(2123060..2123611) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(2123608..2124093) product MarR family transcriptional regulator MhqR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232475.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene mhqR CDS complement(2124265..2124852) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855621.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 2124981..2126087 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924085.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 2126094..2126939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 2126942..2128192 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851458.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 2128195..2128746 product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237418.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 2128746..2129840 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851156.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene carA CDS 2129958..2130452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852223.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(2130460..2131272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(2131319..2132062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(2132063..2132503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(2132506..2133021) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857890.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene luxS CDS 2133154..2134266 product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851140.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 2134268..2135005 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851414.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 2135005..2135919 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851168.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 2135909..2136490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(2136526..2137560) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984070.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(2137557..2138210) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851542.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(2138221..2139723) product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 2139996..2140808 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948480.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene thiD CDS 2140817..2141638 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene thiM CDS 2141653..2142327 product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171842511.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene tenA CDS complement(2142385..2142774) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227269.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene rpsI CDS complement(2142780..2143199) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779321.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene rplM CDS complement(2143275..2144660) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852536.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(2144654..2145328) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860529.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(2145318..2145713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(2145739..2146407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(2146407..2147189) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene pstB CDS complement(2147200..2148387) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864528.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene pstA CDS complement(2148384..2149313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(2149467..2150522) product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(2150660..2151922) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746824.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(2152084..2153292) product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851675.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(2153297..2154100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(2154117..2154806) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149319.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene rlmB CDS complement(2154821..2155642) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851893.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene rsmI CDS complement(2155652..2155855) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851603.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene rpmE CDS complement(2155935..2156810) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851982.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene miaA CDS complement(2156807..2156998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 2157076..2157945 product menaquinone biosynthesis prenyltransferase MqnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913938.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene mqnP tRNA complement(2158127..2158203) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS 2158373..2159044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 2159269..2159961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 2160122..2160850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 2160847..2161599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 2161596..2162354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 2162469..2165261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 2165271..2166938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 2166942..2167958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 2167969..2169666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 2169654..2170403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 2170400..2170891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 2170888..2173266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 2173247..2174341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 2174350..2175426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(2175460..2176257) product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851407.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(2176288..2176878) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243282.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene coaE CDS 2177036..2178031 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851320.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene purM CDS complement(2178086..2181559) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140480.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene metH CDS complement(2181559..2182161) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002041261.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(2182219..2182824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 2182924..2183844 product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851928.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene ilvE CDS 2183885..2184967 product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121076.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 2185047..2185727 product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene hisIE CDS 2185817..2186074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(2186136..2187311) product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851177.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 2187489..2187707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 2187971..2189440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 2189449..2190270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 2190328..2191452 product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851397.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 2191449..2192339 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851295.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 2192339..2192815 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357337.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(2192902..2193465) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089711913.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(2193523..2196612) product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570460.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(2196616..2197593) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822204.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(2197590..2198780) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(2198780..2199163) product copper resistance determinant CrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731617.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene crdA CDS complement(2199230..2200381) product copper-sensing histidine kinase CrdS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951935.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene crdS CDS complement(2200359..2201018) product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene dccR CDS complement(2201052..2201333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(2201386..2202795) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858284.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene gltX CDS complement(2202886..2203968) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864795.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene rlmN CDS complement(2203955..2204518) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853142.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(2204515..2205207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(2205211..2205972) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene hisF CDS 2206043..2206840 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853083.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene rsmA CDS 2206824..2208785 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864793.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 2208795..2209757 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121932.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 2209754..2210566 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398405.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 2210550..2211737 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060246.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 2211738..2212244 product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506456.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene hemJ CDS 2212248..2213645 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460344.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 2213736..2214116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(2214217..2215809) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398625.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene asnB CDS complement(2215814..2216596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(2216750..2218336) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403632.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(2218694..2220226) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108558166.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(2220447..2221799) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858001.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(2221810..2222289) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853623.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene accB CDS 2222440..2222877 product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 2222942..2223691 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760113.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 2223688..2225058 product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 2225051..2225638 product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790401.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 2225663..2227855 product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545732.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 2227857..2228501 product copper response regulator transcription factor CrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169789.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene crdR CDS 2228589..2230229 product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113903.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 2230349..2233189 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937562.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 2233264..2234085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 2234097..2235533 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858123.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene gatB CDS 2235534..2236430 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859277.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(2236432..2236770) product transcriptional activator HxlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246265.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene hxlR CDS 2236881..2237864 product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016968.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(2237869..2238261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(2238262..2239248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(2239261..2240283) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851758.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(2240314..2242698) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865087.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(2242714..2244042) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865088.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene purB CDS 2244153..2245061 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891825.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(2245088..2245549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(2245618..2246757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(2246762..2247802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(2247866..2248480) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979664.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(2248477..2249298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(2249346..2251571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(2251888..2252805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(2252886..2254766) product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488257.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene cirA CDS complement(2254881..2255657) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005948026.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(2255670..2256698) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(2256707..2257534) product heme ABC transporter substrate-binding protein ShuT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302516.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene shuT CDS complement(2257527..2258084) product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704904.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene hutZ CDS complement(2258201..2259142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 2259370..2260668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 note possible pseudo, internal stop codon CDS 2260669..2261139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 note possible pseudo, internal stop codon CDS 2261165..2261572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 2261752..2262945 product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096289.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene yedE CDS 2262956..2263195 product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790504.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene yedF CDS complement(2263277..2264131) product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648596.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene rhuM CDS complement(2264410..2264751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(2264745..2265584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(2265581..2265859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(2265856..2267463) product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035506.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(2267540..2267800) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(2267800..2268027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(2268092..2270452) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104883.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 2270664..2270897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 2270894..2271184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(2271192..2272139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(2272129..2272611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 2272817..2274631 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859745.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene typA CDS 2274739..2275197 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920478.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 2275461..2276411 product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269279.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 2276412..2277557 product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208027.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene ssuD CDS 2277541..2278326 product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120785.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene ssuC CDS 2278323..2279060 product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105420.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene ssuB CDS 2279074..2279928 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808840.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 2279972..2280925 product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269279.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 2280926..2282083 product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192866.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene ssuD CDS 2282083..2283243 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107732.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 2283245..2283997 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107734.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 2284015..2284686 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357525.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 2284708..2285217 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088482.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 2285204..2286268 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921632.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 2286580..2287653 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941999.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 2287675..2288586 product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 2288583..2289005 product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881100.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 2289007..2289282 product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143402.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 2289285..2290454 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene moeB CDS 2290487..2291431 product family 2A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107594.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 2291415..2292887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 2292890..2294224 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880096.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 2294260..2295480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 2295496..2296254 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852612.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene cysE CDS 2296287..2297219 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene cysK CDS 2297250..2297678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 2297691..2298851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 2299033..2299887 product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene cysT CDS 2299884..2300744 product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142072.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene cysW CDS 2300748..2301773 product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074249.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 2301840..2302280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(2302306..2303199) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908758.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(2303483..2304784) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864147.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(2304850..2306142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 2306208..2307410 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482634.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene trpB CDS complement(2307420..2308001) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962376.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(2308013..2308483) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891952.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene ruvC sequence2 source 1..140289 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(1841..2947) product IS1380-like element ISEcp1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608644.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(3156..4382) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852607.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 4735..5100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(5238..5984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(5986..6114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 6196..7788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 8450..9061 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904906.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(9436..10101) product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768309.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(10122..10385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(10400..10657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(10672..11574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 11706..12719 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852008.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene pyrC CDS 12716..13267 product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121363.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 13298..13684 product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927253.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(13718..14518) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989362.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(14518..15150) product zinc ABC transporter ATP-binding protein ZurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990125.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene zurA CDS complement(15154..16095) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458890.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 16252..19308 product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077210409.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 19504..20298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(20693..21043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(21480..22265) product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020323.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(22411..23163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(23213..24007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095603959.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(24500..25129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(25223..25843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(25923..27905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(27905..29572) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040066179.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(30073..30834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(30923..32269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(32809..33675) product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280038.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(33678..34862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 35019..35582 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074405.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(35743..36081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(36170..37381) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057821871.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(37378..37836) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971009.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(37839..41237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(41273..41485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(41544..41960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(42299..42553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(42627..44213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(44429..44605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(44605..44964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(44978..46435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(46439..47728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(47725..47913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(47921..48160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(48175..49167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(49173..49355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(49650..50297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(50323..51027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(51142..51744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 51993..53822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 53887..54570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 54791..55549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(55612..57057) product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146450.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene dgt CDS complement(57192..61115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(61134..62408) product DUF2779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846383.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(62596..63900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(63893..67255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(67346..68125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203296.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(68134..69864) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064474.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(69878..70876) product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167364873.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(70885..74475) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261790.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(74472..75665) product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261789.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene sbcD CDS 76237..77133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 note possible pseudo, internal stop codon CDS 77557..78471 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479466.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 78481..79497 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 80821..82329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 82344..83669 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349722.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 83685..84656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 84758..86830 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140365.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 86913..88502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 88499..88804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 88820..89266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 90174..90770 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854219.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 90783..91100 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020199.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene trxA CDS complement(91134..91289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 91430..91711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 91724..92002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 92007..92291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 92294..92566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(92582..92764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(92954..93853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 note possible pseudo, frameshifted CDS complement(93856..95151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 note possible pseudo, frameshifted CDS complement(95158..96045) product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(96042..96680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(96811..97095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(97202..97774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(97904..98176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 98324..98626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 98759..98929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 98910..99203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 99208..99489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 99502..99864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 99874..100059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(100115..100366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 100470..101018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 101029..101304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 101393..102103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 102139..103251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 103440..103652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 103717..103845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 104391..104732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 105342..106262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942763.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(106732..107004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(107007..107291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(107296..107574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(107587..107868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 108009..108227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(108334..108951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(108932..109375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 109506..109718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 109807..112188 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 112192..113625 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480516.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 113622..115088 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 115218..116534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS 116546..117613 product DUF4297 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210712.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 117616..117771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS 117809..119383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215945.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 119383..120297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 120294..122027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 122372..123190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 123438..124901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 124979..126328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 126532..127560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 127787..128068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS 128248..128394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS 128891..129247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 130060..130242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 130235..130606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 130603..130770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 130980..131543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(131789..132829) product IS5-like element IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723085.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 133565..133714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(133851..135041) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(135798..136940) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 137197..137922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(137897..138859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(138908..139846) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775527.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930