>Feature sequence01 2379 463 gene locus_tag LOCUS_00010 2379 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3064 2372 gene locus_tag LOCUS_00020 3064 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3544 3068 gene locus_tag LOCUS_00030 3544 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 8211 3658 gene locus_tag LOCUS_00040 8211 3658 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792884.1 protein_id gnl|my_center|LOCUS_00040 10207 9086 gene locus_tag LOCUS_00050 10207 9086 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939630.1 protein_id gnl|my_center|LOCUS_00050 10469 10278 gene locus_tag LOCUS_00060 10469 10278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 11931 10561 gene locus_tag LOCUS_00070 gene pelG 11931 10561 CDS product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091283.1 protein_id gnl|my_center|LOCUS_00070 13463 11919 gene locus_tag LOCUS_00080 gene pelF 13463 11919 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113954.1 protein_id gnl|my_center|LOCUS_00080 14599 13460 gene locus_tag LOCUS_00090 14599 13460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 15986 14577 gene locus_tag LOCUS_00100 15986 14577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 18155 15993 gene locus_tag LOCUS_00110 18155 15993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 21056 18198 gene locus_tag LOCUS_00120 21056 18198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 22978 21053 gene locus_tag LOCUS_00130 22978 21053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 22961 23200 gene locus_tag LOCUS_00140 22961 23200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 23785 23213 gene locus_tag LOCUS_00150 23785 23213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 23951 24895 gene locus_tag LOCUS_00160 23951 24895 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081643.1 protein_id gnl|my_center|LOCUS_00160 25057 26325 gene locus_tag LOCUS_00170 25057 26325 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409361.1 protein_id gnl|my_center|LOCUS_00170 27928 26705 gene locus_tag LOCUS_00180 27928 26705 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939045.1 protein_id gnl|my_center|LOCUS_00180 28839 28399 gene locus_tag LOCUS_00190 28839 28399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 29342 28839 gene locus_tag LOCUS_00200 29342 28839 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938696.1 protein_id gnl|my_center|LOCUS_00200 30373 29339 gene locus_tag LOCUS_00210 gene amrS 30373 29339 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409338.1 protein_id gnl|my_center|LOCUS_00210 30720 30388 gene locus_tag LOCUS_00220 30720 30388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 30801 31877 gene locus_tag LOCUS_00230 gene purM 30801 31877 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938699.1 protein_id gnl|my_center|LOCUS_00230 32005 32829 gene locus_tag LOCUS_00240 32005 32829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 33232 33038 gene locus_tag LOCUS_00250 33232 33038 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938662.1 protein_id gnl|my_center|LOCUS_00250 33575 35254 gene locus_tag LOCUS_00260 33575 35254 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938663.1 protein_id gnl|my_center|LOCUS_00260 35299 35790 gene locus_tag LOCUS_00270 35299 35790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 35819 36841 gene locus_tag LOCUS_00280 35819 36841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938665.1 protein_id gnl|my_center|LOCUS_00280 37156 37833 gene locus_tag LOCUS_00290 37156 37833 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938666.1 protein_id gnl|my_center|LOCUS_00290 37980 38282 gene locus_tag LOCUS_00300 37980 38282 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938667.1 protein_id gnl|my_center|LOCUS_00300 38292 38798 gene locus_tag LOCUS_00310 38292 38798 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938668.1 protein_id gnl|my_center|LOCUS_00310 38801 39109 gene locus_tag LOCUS_00320 38801 39109 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938669.1 protein_id gnl|my_center|LOCUS_00320 39134 39364 gene locus_tag LOCUS_00330 39134 39364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938670.1 protein_id gnl|my_center|LOCUS_00330 39365 41056 gene locus_tag LOCUS_00340 gene ilvB 39365 41056 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938671.1 protein_id gnl|my_center|LOCUS_00340 41066 41554 gene locus_tag LOCUS_00350 gene ilvN 41066 41554 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938672.1 protein_id gnl|my_center|LOCUS_00350 41662 42651 gene locus_tag LOCUS_00360 gene ilvC 41662 42651 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_00360 42797 42982 gene locus_tag LOCUS_00370 42797 42982 CDS product DUF1508 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940654.1 protein_id gnl|my_center|LOCUS_00370 44407 43046 gene locus_tag LOCUS_00380 44407 43046 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938716.1 protein_id gnl|my_center|LOCUS_00380 45865 44417 gene locus_tag LOCUS_00390 gene gcvPB 45865 44417 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938717.1 protein_id gnl|my_center|LOCUS_00390 47196 45865 gene locus_tag LOCUS_00400 gene gcvPA 47196 45865 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938718.1 protein_id gnl|my_center|LOCUS_00400 47897 47514 gene locus_tag LOCUS_00410 gene gcvH 47897 47514 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938719.1 protein_id gnl|my_center|LOCUS_00410 48536 48123 gene locus_tag LOCUS_00420 48536 48123 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938720.1 protein_id gnl|my_center|LOCUS_00420 50286 48607 gene locus_tag LOCUS_00430 gene pgm 50286 48607 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938721.1 protein_id gnl|my_center|LOCUS_00430 54015 50422 gene locus_tag LOCUS_00440 54015 50422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 55198 54290 gene locus_tag LOCUS_00450 55198 54290 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942175.1 protein_id gnl|my_center|LOCUS_00450 56363 55263 gene locus_tag LOCUS_00460 gene ychF 56363 55263 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938722.1 protein_id gnl|my_center|LOCUS_00460 59381 56619 gene locus_tag LOCUS_00470 59381 56619 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_00470 59804 61795 gene locus_tag LOCUS_00480 59804 61795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 64428 61843 gene locus_tag LOCUS_00490 64428 61843 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938725.1 protein_id gnl|my_center|LOCUS_00490 64904 64560 gene locus_tag LOCUS_00500 64904 64560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938727.1 protein_id gnl|my_center|LOCUS_00500 66164 64962 gene locus_tag LOCUS_00510 66164 64962 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938728.1 protein_id gnl|my_center|LOCUS_00510 66416 66598 gene locus_tag LOCUS_00520 66416 66598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 67750 66683 gene locus_tag LOCUS_00530 67750 66683 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938731.1 protein_id gnl|my_center|LOCUS_00530 69957 67852 gene locus_tag LOCUS_00540 69957 67852 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_00540 69980 70681 gene locus_tag LOCUS_00550 gene rnc 69980 70681 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938733.1 protein_id gnl|my_center|LOCUS_00550 71655 70762 gene locus_tag LOCUS_00560 71655 70762 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938734.1 protein_id gnl|my_center|LOCUS_00560 71937 72338 gene locus_tag LOCUS_00570 71937 72338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 72544 74118 gene locus_tag LOCUS_00580 72544 74118 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791517.1 protein_id gnl|my_center|LOCUS_00580 75955 74303 gene locus_tag LOCUS_00590 75955 74303 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938736.1 protein_id gnl|my_center|LOCUS_00590 76805 76086 gene locus_tag LOCUS_00600 76805 76086 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938737.1 protein_id gnl|my_center|LOCUS_00600 78596 76818 gene locus_tag LOCUS_00610 78596 76818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 80153 78714 gene locus_tag LOCUS_00620 80153 78714 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938739.1 protein_id gnl|my_center|LOCUS_00620 81956 80160 gene locus_tag LOCUS_00630 81956 80160 CDS product DUF3880 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938740.1 protein_id gnl|my_center|LOCUS_00630 82714 81959 gene locus_tag LOCUS_00640 82714 81959 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937942.1 protein_id gnl|my_center|LOCUS_00640 83470 82718 gene locus_tag LOCUS_00650 83470 82718 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937943.1 protein_id gnl|my_center|LOCUS_00650 84597 83479 gene locus_tag LOCUS_00660 84597 83479 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938741.1 protein_id gnl|my_center|LOCUS_00660 84955 84611 gene locus_tag LOCUS_00670 84955 84611 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_00670 85374 84943 gene locus_tag LOCUS_00680 85374 84943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 86521 85367 gene locus_tag LOCUS_00690 86521 85367 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792382.1 protein_id gnl|my_center|LOCUS_00690 87027 86518 gene locus_tag LOCUS_00700 gene dtd 87027 86518 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938745.1 protein_id gnl|my_center|LOCUS_00700 88920 87058 gene locus_tag LOCUS_00710 88920 87058 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792381.1 protein_id gnl|my_center|LOCUS_00710 89365 89150 gene locus_tag LOCUS_00720 89365 89150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 89510 90172 gene locus_tag LOCUS_00730 gene modB 89510 90172 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190258.1 protein_id gnl|my_center|LOCUS_00730 90194 90940 gene locus_tag LOCUS_00740 gene modA 90194 90940 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937488.1 protein_id gnl|my_center|LOCUS_00740 91000 91782 gene locus_tag LOCUS_00750 91000 91782 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937490.1 protein_id gnl|my_center|LOCUS_00750 92736 91858 gene locus_tag LOCUS_00760 gene dapA 92736 91858 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939154.1 protein_id gnl|my_center|LOCUS_00760 93655 92810 gene locus_tag LOCUS_00770 gene dapF 93655 92810 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939153.1 protein_id gnl|my_center|LOCUS_00770 94402 93716 gene locus_tag LOCUS_00780 94402 93716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939152.1 protein_id gnl|my_center|LOCUS_00780 94901 94626 gene locus_tag LOCUS_00790 94901 94626 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939150.1 protein_id gnl|my_center|LOCUS_00790 95838 95020 gene locus_tag LOCUS_00800 95838 95020 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939149.1 protein_id gnl|my_center|LOCUS_00800 96726 95854 gene locus_tag LOCUS_00810 96726 95854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 97657 96713 gene locus_tag LOCUS_00820 gene prfB 97657 96713 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939147.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00820 99359 97833 gene locus_tag LOCUS_00830 gene lnt 99359 97833 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939146.1 protein_id gnl|my_center|LOCUS_00830 100262 99444 gene locus_tag LOCUS_00840 100262 99444 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942919.1 protein_id gnl|my_center|LOCUS_00840 101439 100378 gene locus_tag LOCUS_00850 101439 100378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939117.1 protein_id gnl|my_center|LOCUS_00850 103487 101580 gene locus_tag LOCUS_00860 gene mnmG 103487 101580 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939115.1 protein_id gnl|my_center|LOCUS_00860 104816 103596 gene locus_tag LOCUS_00870 104816 103596 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939114.1 protein_id gnl|my_center|LOCUS_00870 105250 104978 gene locus_tag LOCUS_00880 105250 104978 CDS product PxxKW family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939113.1 protein_id gnl|my_center|LOCUS_00880 106706 105393 gene locus_tag LOCUS_00890 106706 105393 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 protein_id gnl|my_center|LOCUS_00890 106857 107654 gene locus_tag LOCUS_00900 106857 107654 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939111.1 protein_id gnl|my_center|LOCUS_00900 107939 109462 gene locus_tag LOCUS_00910 107939 109462 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939110.1 protein_id gnl|my_center|LOCUS_00910 109467 109907 gene locus_tag LOCUS_00920 109467 109907 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941894.1 protein_id gnl|my_center|LOCUS_00920 109931 111211 gene locus_tag LOCUS_00930 109931 111211 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941893.1 protein_id gnl|my_center|LOCUS_00930 111237 112328 gene locus_tag LOCUS_00940 111237 112328 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939109.1 protein_id gnl|my_center|LOCUS_00940 112331 113089 gene locus_tag LOCUS_00950 112331 113089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939108.1 protein_id gnl|my_center|LOCUS_00950 113266 113604 gene locus_tag LOCUS_00960 113266 113604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 113841 115439 gene locus_tag LOCUS_00970 gene secD 113841 115439 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939106.1 protein_id gnl|my_center|LOCUS_00970 115450 116544 gene locus_tag LOCUS_00980 gene secF 115450 116544 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939105.1 protein_id gnl|my_center|LOCUS_00980 116740 117600 gene locus_tag LOCUS_00990 116740 117600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 117909 119111 gene locus_tag LOCUS_01000 117909 119111 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939574.1 protein_id gnl|my_center|LOCUS_01000 119101 119937 gene locus_tag LOCUS_01010 119101 119937 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939573.1 protein_id gnl|my_center|LOCUS_01010 119955 120806 gene locus_tag LOCUS_01020 119955 120806 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939572.1 protein_id gnl|my_center|LOCUS_01020 120999 121313 gene locus_tag LOCUS_01030 120999 121313 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939104.1 protein_id gnl|my_center|LOCUS_01030 121581 122360 gene locus_tag LOCUS_01040 121581 122360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 122474 124108 gene locus_tag LOCUS_01050 gene ctaD 122474 124108 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939102.1 protein_id gnl|my_center|LOCUS_01050 124095 124691 gene locus_tag LOCUS_01060 124095 124691 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792207.1 protein_id gnl|my_center|LOCUS_01060 124701 124994 gene locus_tag LOCUS_01070 124701 124994 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939100.1 protein_id gnl|my_center|LOCUS_01070 125005 126234 gene locus_tag LOCUS_01080 gene coxB 125005 126234 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939099.1 protein_id gnl|my_center|LOCUS_01080 126244 127239 gene locus_tag LOCUS_01090 126244 127239 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939098.1 protein_id gnl|my_center|LOCUS_01090 127417 127857 gene locus_tag LOCUS_01100 127417 127857 CDS product DUF4079 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939097.1 protein_id gnl|my_center|LOCUS_01100 129309 128008 gene locus_tag LOCUS_01110 129309 128008 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938906.1 protein_id gnl|my_center|LOCUS_01110 129542 130156 gene locus_tag LOCUS_01120 129542 130156 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_01120 130179 130568 gene locus_tag LOCUS_01130 gene rsfS 130179 130568 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938909.1 protein_id gnl|my_center|LOCUS_01130 130565 132121 gene locus_tag LOCUS_01140 gene gpmI 130565 132121 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938910.1 protein_id gnl|my_center|LOCUS_01140 132157 132402 gene locus_tag LOCUS_01150 132157 132402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938911.1 protein_id gnl|my_center|LOCUS_01150 132936 132490 gene locus_tag LOCUS_01160 132936 132490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938912.1 protein_id gnl|my_center|LOCUS_01160 133140 133847 gene locus_tag LOCUS_01170 133140 133847 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195593.1 protein_id gnl|my_center|LOCUS_01170 133957 134919 gene locus_tag LOCUS_01180 133957 134919 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_01180 135072 135758 gene locus_tag LOCUS_01190 135072 135758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 136364 135924 gene locus_tag LOCUS_01200 136364 135924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 137372 136563 gene locus_tag LOCUS_01210 137372 136563 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938913.1 protein_id gnl|my_center|LOCUS_01210 137699 139333 gene locus_tag LOCUS_01220 137699 139333 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938914.1 protein_id gnl|my_center|LOCUS_01220 139626 140447 gene locus_tag LOCUS_01230 gene kdsA 139626 140447 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938915.1 protein_id gnl|my_center|LOCUS_01230 140437 140958 gene locus_tag LOCUS_01240 140437 140958 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938916.1 protein_id gnl|my_center|LOCUS_01240 140959 141555 gene locus_tag LOCUS_01250 140959 141555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 141629 142150 gene locus_tag LOCUS_01260 141629 142150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 142160 142882 gene locus_tag LOCUS_01270 gene lptB 142160 142882 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938918.1 protein_id gnl|my_center|LOCUS_01270 143158 144534 gene locus_tag LOCUS_01280 gene rpoN 143158 144534 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938919.1 protein_id gnl|my_center|LOCUS_01280 144663 145205 gene locus_tag LOCUS_01290 gene raiA 144663 145205 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938920.1 protein_id gnl|my_center|LOCUS_01290 145216 145665 gene locus_tag LOCUS_01300 145216 145665 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_01300 145679 146569 gene locus_tag LOCUS_01310 gene rapZ 145679 146569 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938922.1 protein_id gnl|my_center|LOCUS_01310 146623 147060 gene locus_tag LOCUS_01320 146623 147060 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938923.1 protein_id gnl|my_center|LOCUS_01320 147070 147531 gene locus_tag LOCUS_01330 147070 147531 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938924.1 protein_id gnl|my_center|LOCUS_01330 147792 148241 gene locus_tag LOCUS_01340 147792 148241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 148385 149305 gene locus_tag LOCUS_01350 148385 149305 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938927.1 protein_id gnl|my_center|LOCUS_01350 150555 149386 gene locus_tag LOCUS_01360 150555 149386 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939122.1 protein_id gnl|my_center|LOCUS_01360 150600 151532 gene locus_tag LOCUS_01370 150600 151532 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939121.1 protein_id gnl|my_center|LOCUS_01370 151596 155309 gene locus_tag LOCUS_01380 151596 155309 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939120.1 protein_id gnl|my_center|LOCUS_01380 155560 159138 gene locus_tag LOCUS_01390 155560 159138 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939119.1 protein_id gnl|my_center|LOCUS_01390 160637 159327 gene locus_tag LOCUS_01400 160637 159327 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_01400 161180 160752 gene locus_tag LOCUS_01410 161180 160752 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939136.1 protein_id gnl|my_center|LOCUS_01410 161376 162020 gene locus_tag LOCUS_01420 161376 162020 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524381.1 protein_id gnl|my_center|LOCUS_01420 162033 162614 gene locus_tag LOCUS_01430 162033 162614 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939134.1 protein_id gnl|my_center|LOCUS_01430 162739 163641 gene locus_tag LOCUS_01440 162739 163641 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939133.1 protein_id gnl|my_center|LOCUS_01440 163707 164351 gene locus_tag LOCUS_01450 163707 164351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 164353 164907 gene locus_tag LOCUS_01460 gene pgsA 164353 164907 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939132.1 protein_id gnl|my_center|LOCUS_01460 165001 165273 gene locus_tag LOCUS_01470 165001 165273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939131.1 protein_id gnl|my_center|LOCUS_01470 165276 165602 gene locus_tag LOCUS_01480 165276 165602 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939130.1 protein_id gnl|my_center|LOCUS_01480 165586 166497 gene locus_tag LOCUS_01490 165586 166497 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939129.1 protein_id gnl|my_center|LOCUS_01490 166587 167849 gene locus_tag LOCUS_01500 166587 167849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 167866 168876 gene locus_tag LOCUS_01510 gene fbp 167866 168876 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939127.1 protein_id gnl|my_center|LOCUS_01510 169125 170249 gene locus_tag LOCUS_01520 gene tsaD 169125 170249 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939126.1 protein_id gnl|my_center|LOCUS_01520 170398 170721 gene locus_tag LOCUS_01530 gene trxA 170398 170721 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939125.1 protein_id gnl|my_center|LOCUS_01530 170721 171638 gene locus_tag LOCUS_01540 170721 171638 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939124.1 protein_id gnl|my_center|LOCUS_01540 171638 172369 gene locus_tag LOCUS_01550 171638 172369 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792195.1 protein_id gnl|my_center|LOCUS_01550 173129 172503 gene locus_tag LOCUS_01560 gene yihA 173129 172503 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938953.1 protein_id gnl|my_center|LOCUS_01560 173253 173711 gene locus_tag LOCUS_01570 173253 173711 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938954.1 protein_id gnl|my_center|LOCUS_01570 173789 174349 gene locus_tag LOCUS_01580 gene efp 173789 174349 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938955.1 protein_id gnl|my_center|LOCUS_01580 174454 176811 gene locus_tag LOCUS_01590 174454 176811 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938956.1 protein_id gnl|my_center|LOCUS_01590 176855 177580 gene locus_tag LOCUS_01600 gene lolA 176855 177580 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938957.1 protein_id gnl|my_center|LOCUS_01600 178735 177659 gene locus_tag LOCUS_01610 178735 177659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 179362 178748 gene locus_tag LOCUS_01620 gene yedF 179362 178748 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938959.1 protein_id gnl|my_center|LOCUS_01620 179467 181287 gene locus_tag LOCUS_01630 179467 181287 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938960.1 protein_id gnl|my_center|LOCUS_01630 181288 181926 gene locus_tag LOCUS_01640 181288 181926 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938961.1 protein_id gnl|my_center|LOCUS_01640 181938 182870 gene locus_tag LOCUS_01650 181938 182870 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938962.1 protein_id gnl|my_center|LOCUS_01650 182970 185339 gene locus_tag LOCUS_01660 182970 185339 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090647.1 protein_id gnl|my_center|LOCUS_01660 186776 186114 gene locus_tag LOCUS_01670 gene fsa 186776 186114 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938947.1 protein_id gnl|my_center|LOCUS_01670 187416 187120 gene locus_tag LOCUS_01680 187416 187120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938946.1 protein_id gnl|my_center|LOCUS_01680 187911 187438 gene locus_tag LOCUS_01690 gene folK 187911 187438 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081428870.1 protein_id gnl|my_center|LOCUS_01690 189104 187938 gene locus_tag LOCUS_01700 189104 187938 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938944.1 protein_id gnl|my_center|LOCUS_01700 189418 190344 gene locus_tag LOCUS_01710 gene xerD 189418 190344 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792251.1 protein_id gnl|my_center|LOCUS_01710 190348 193113 gene locus_tag LOCUS_01720 190348 193113 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938942.1 protein_id gnl|my_center|LOCUS_01720 193241 193723 gene locus_tag LOCUS_01730 193241 193723 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524404.1 protein_id gnl|my_center|LOCUS_01730 193780 194166 gene locus_tag LOCUS_01740 193780 194166 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938940.1 protein_id gnl|my_center|LOCUS_01740 194176 195285 gene locus_tag LOCUS_01750 194176 195285 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938939.1 protein_id gnl|my_center|LOCUS_01750 195412 198132 gene locus_tag LOCUS_01760 gene mutS 195412 198132 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938938.1 protein_id gnl|my_center|LOCUS_01760 198134 198613 gene locus_tag LOCUS_01770 198134 198613 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938937.1 protein_id gnl|my_center|LOCUS_01770 198640 199881 gene locus_tag LOCUS_01780 gene lysA 198640 199881 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938936.1 protein_id gnl|my_center|LOCUS_01780 199962 200708 gene locus_tag LOCUS_01790 199962 200708 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939955.1 protein_id gnl|my_center|LOCUS_01790 202641 201232 gene locus_tag LOCUS_01800 202641 201232 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522157.1 protein_id gnl|my_center|LOCUS_01800 203293 202697 gene locus_tag LOCUS_01810 gene cysC 203293 202697 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524672.1 protein_id gnl|my_center|LOCUS_01810 203810 203724 gene locus_tag LOCUS_t00010 203810 203724 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 204202 203855 gene locus_tag LOCUS_01820 gene secG 204202 203855 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938965.1 protein_id gnl|my_center|LOCUS_01820 204999 204247 gene locus_tag LOCUS_01830 gene tpiA 204999 204247 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938966.1 protein_id gnl|my_center|LOCUS_01830 205560 205048 gene locus_tag LOCUS_01840 gene rimI 205560 205048 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938967.1 protein_id gnl|my_center|LOCUS_01840 205666 206241 gene locus_tag LOCUS_01850 205666 206241 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938968.1 protein_id gnl|my_center|LOCUS_01850 207114 206329 gene locus_tag LOCUS_01860 207114 206329 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938969.1 protein_id gnl|my_center|LOCUS_01860 208353 207331 gene locus_tag LOCUS_01870 208353 207331 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938970.1 protein_id gnl|my_center|LOCUS_01870 209412 208354 gene locus_tag LOCUS_01880 209412 208354 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938971.1 protein_id gnl|my_center|LOCUS_01880 209754 211481 gene locus_tag LOCUS_01890 209754 211481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938972.1 protein_id gnl|my_center|LOCUS_01890 211554 212654 gene locus_tag LOCUS_01900 gene gcvT 211554 212654 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938973.1 protein_id gnl|my_center|LOCUS_01900 212833 212615 gene locus_tag LOCUS_01910 212833 212615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 213069 212833 gene locus_tag LOCUS_01920 213069 212833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 213052 213624 gene locus_tag LOCUS_01930 213052 213624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 213621 214832 gene locus_tag LOCUS_01940 213621 214832 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938975.1 protein_id gnl|my_center|LOCUS_01940 214844 215509 gene locus_tag LOCUS_01950 214844 215509 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938976.1 protein_id gnl|my_center|LOCUS_01950 215506 216057 gene locus_tag LOCUS_01960 215506 216057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 217867 216182 gene locus_tag LOCUS_01970 gene ettA 217867 216182 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939856.1 protein_id gnl|my_center|LOCUS_01970 218147 218929 gene locus_tag LOCUS_01980 218147 218929 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938977.1 protein_id gnl|my_center|LOCUS_01980 219491 220069 gene locus_tag LOCUS_01990 219491 220069 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792236.1 protein_id gnl|my_center|LOCUS_01990 221821 220256 gene locus_tag LOCUS_02000 221821 220256 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937928.1 protein_id gnl|my_center|LOCUS_02000 222290 221814 gene locus_tag LOCUS_02010 222290 221814 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937927.1 protein_id gnl|my_center|LOCUS_02010 222657 225272 gene locus_tag LOCUS_02020 222657 225272 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937925.1 protein_id gnl|my_center|LOCUS_02020 225274 226791 gene locus_tag LOCUS_02030 225274 226791 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937924.1 protein_id gnl|my_center|LOCUS_02030 227258 226875 gene locus_tag LOCUS_02040 227258 226875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938981.1 protein_id gnl|my_center|LOCUS_02040 228446 227493 gene locus_tag LOCUS_02050 gene gluQRS 228446 227493 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_02050 228883 228959 gene locus_tag LOCUS_t00020 228883 228959 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 229408 230664 gene locus_tag LOCUS_02060 229408 230664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937575.1 protein_id gnl|my_center|LOCUS_02060 230679 231338 gene locus_tag LOCUS_02070 230679 231338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937574.1 protein_id gnl|my_center|LOCUS_02070 231360 232679 gene locus_tag LOCUS_02080 231360 232679 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937573.1 protein_id gnl|my_center|LOCUS_02080 232696 233100 gene locus_tag LOCUS_02090 232696 233100 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937572.1 protein_id gnl|my_center|LOCUS_02090 233137 233697 gene locus_tag LOCUS_02100 233137 233697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937571.1 protein_id gnl|my_center|LOCUS_02100 233701 234609 gene locus_tag LOCUS_02110 233701 234609 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937570.1 protein_id gnl|my_center|LOCUS_02110 234641 235066 gene locus_tag LOCUS_02120 234641 235066 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937569.1 protein_id gnl|my_center|LOCUS_02120 235089 235481 gene locus_tag LOCUS_02130 235089 235481 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937568.1 protein_id gnl|my_center|LOCUS_02130 235648 237642 gene locus_tag LOCUS_02140 235648 237642 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937567.1 protein_id gnl|my_center|LOCUS_02140 238909 237731 gene locus_tag LOCUS_02150 238909 237731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 241260 238906 gene locus_tag LOCUS_02160 241260 238906 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937579.1 protein_id gnl|my_center|LOCUS_02160 241870 241337 gene locus_tag LOCUS_02170 241870 241337 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937578.1 protein_id gnl|my_center|LOCUS_02170 242307 242570 gene locus_tag LOCUS_02180 242307 242570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 242890 242654 gene locus_tag LOCUS_02190 242890 242654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 245680 243203 gene locus_tag LOCUS_02200 245680 243203 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792370.1 protein_id gnl|my_center|LOCUS_02200 246129 245698 gene locus_tag LOCUS_02210 246129 245698 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938764.1 protein_id gnl|my_center|LOCUS_02210 246472 246963 gene locus_tag LOCUS_02220 gene greA 246472 246963 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940503.1 protein_id gnl|my_center|LOCUS_02220 247117 247605 gene locus_tag LOCUS_02230 gene greA 247117 247605 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940503.1 protein_id gnl|my_center|LOCUS_02230 248137 247856 gene locus_tag LOCUS_02240 248137 247856 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615953.1 protein_id gnl|my_center|LOCUS_02240 248306 249787 gene locus_tag LOCUS_02250 248306 249787 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938762.1 protein_id gnl|my_center|LOCUS_02250 249944 251386 gene locus_tag LOCUS_02260 249944 251386 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938761.1 protein_id gnl|my_center|LOCUS_02260 251551 252930 gene locus_tag LOCUS_02270 gene hslU 251551 252930 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938760.1 protein_id gnl|my_center|LOCUS_02270 252967 253854 gene locus_tag LOCUS_02280 gene argB 252967 253854 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938759.1 protein_id gnl|my_center|LOCUS_02280 253938 255551 gene locus_tag LOCUS_02290 253938 255551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 256971 255691 gene locus_tag LOCUS_02300 256971 255691 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938758.1 protein_id gnl|my_center|LOCUS_02300 258280 257012 gene locus_tag LOCUS_02310 258280 257012 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938757.1 protein_id gnl|my_center|LOCUS_02310 258440 259129 gene locus_tag LOCUS_02320 258440 259129 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938756.1 protein_id gnl|my_center|LOCUS_02320 259116 259937 gene locus_tag LOCUS_02330 gene ccsA 259116 259937 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792376.1 protein_id gnl|my_center|LOCUS_02330 259941 261284 gene locus_tag LOCUS_02340 gene hemA 259941 261284 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938754.1 protein_id gnl|my_center|LOCUS_02340 261281 261613 gene locus_tag LOCUS_02350 261281 261613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938753.1 protein_id gnl|my_center|LOCUS_02350 261768 262949 gene locus_tag LOCUS_02360 gene tilS 261768 262949 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792378.1 protein_id gnl|my_center|LOCUS_02360 263034 263705 gene locus_tag LOCUS_02370 263034 263705 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939218.1 protein_id gnl|my_center|LOCUS_02370 265407 263959 gene locus_tag LOCUS_02380 265407 263959 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_02380 266813 265416 gene locus_tag LOCUS_02390 gene trkA 266813 265416 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_02390 267288 267025 gene locus_tag LOCUS_02400 gene rpsT 267288 267025 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_02400 269546 267444 gene locus_tag LOCUS_02410 gene glyS 269546 267444 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939183.1 protein_id gnl|my_center|LOCUS_02410 270448 269570 gene locus_tag LOCUS_02420 gene glyQ 270448 269570 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939184.1 protein_id gnl|my_center|LOCUS_02420 271051 270530 gene locus_tag LOCUS_02430 271051 270530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 272418 271282 gene locus_tag LOCUS_02440 272418 271282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 273411 272449 gene locus_tag LOCUS_02450 273411 272449 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294672.1 protein_id gnl|my_center|LOCUS_02450 273625 273461 gene locus_tag LOCUS_02460 273625 273461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 274692 273733 gene locus_tag LOCUS_02470 274692 273733 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792159.1 protein_id gnl|my_center|LOCUS_02470 278164 274694 gene locus_tag LOCUS_02480 gene mfd 278164 274694 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792158.1 protein_id gnl|my_center|LOCUS_02480 278747 278271 gene locus_tag LOCUS_02490 278747 278271 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_02490 278976 279203 gene locus_tag LOCUS_02500 278976 279203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792157.1 protein_id gnl|my_center|LOCUS_02500 280709 279372 gene locus_tag LOCUS_02510 280709 279372 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939193.1 protein_id gnl|my_center|LOCUS_02510 280923 281648 gene locus_tag LOCUS_02520 280923 281648 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939194.1 protein_id gnl|my_center|LOCUS_02520 281842 282219 gene locus_tag LOCUS_02530 281842 282219 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939195.1 protein_id gnl|my_center|LOCUS_02530 282251 283924 gene locus_tag LOCUS_02540 282251 283924 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939196.1 protein_id gnl|my_center|LOCUS_02540 283903 284352 gene locus_tag LOCUS_02550 283903 284352 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939197.1 protein_id gnl|my_center|LOCUS_02550 284368 284892 gene locus_tag LOCUS_02560 gene tsaE 284368 284892 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939198.1 protein_id gnl|my_center|LOCUS_02560 284928 286154 gene locus_tag LOCUS_02570 284928 286154 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939199.1 protein_id gnl|my_center|LOCUS_02570 286157 287776 gene locus_tag LOCUS_02580 gene cimA 286157 287776 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939200.1 protein_id gnl|my_center|LOCUS_02580 288607 287945 gene locus_tag LOCUS_02590 gene ribB 288607 287945 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705223.1 protein_id gnl|my_center|LOCUS_02590 290099 289023 gene locus_tag LOCUS_02600 290099 289023 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939074.1 protein_id gnl|my_center|LOCUS_02600 291035 290217 gene locus_tag LOCUS_02610 291035 290217 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792219.1 protein_id gnl|my_center|LOCUS_02610 292885 291116 gene locus_tag LOCUS_02620 gene rpoD 292885 291116 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939076.1 protein_id gnl|my_center|LOCUS_02620 294896 292872 gene locus_tag LOCUS_02630 294896 292872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 297275 294969 gene locus_tag LOCUS_02640 297275 294969 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939078.1 protein_id gnl|my_center|LOCUS_02640 297741 297298 gene locus_tag LOCUS_02650 297741 297298 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939079.1 protein_id gnl|my_center|LOCUS_02650 298071 297868 gene locus_tag LOCUS_02660 gene rpsU 298071 297868 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939080.1 protein_id gnl|my_center|LOCUS_02660 298546 298349 gene locus_tag LOCUS_02670 298546 298349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939082.1 protein_id gnl|my_center|LOCUS_02670 298840 298568 gene locus_tag LOCUS_02680 298840 298568 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939083.1 protein_id gnl|my_center|LOCUS_02680 299853 299035 gene locus_tag LOCUS_02690 gene rsmA 299853 299035 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792217.1 protein_id gnl|my_center|LOCUS_02690 300600 299911 gene locus_tag LOCUS_02700 300600 299911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 302708 300663 gene locus_tag LOCUS_02710 gene fusA 302708 300663 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939087.1 protein_id gnl|my_center|LOCUS_02710 303675 302770 gene locus_tag LOCUS_02720 303675 302770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940655.1 protein_id gnl|my_center|LOCUS_02720 304984 303806 gene locus_tag LOCUS_02730 304984 303806 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938952.1 protein_id gnl|my_center|LOCUS_02730 306144 304981 gene locus_tag LOCUS_02740 gene lptF 306144 304981 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938951.1 protein_id gnl|my_center|LOCUS_02740 306549 306172 gene locus_tag LOCUS_02750 306549 306172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 306549 307355 gene locus_tag LOCUS_02760 306549 307355 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938949.1 protein_id gnl|my_center|LOCUS_02760 307468 307544 gene locus_tag LOCUS_t00030 307468 307544 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 307693 307769 gene locus_tag LOCUS_t00040 307693 307769 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 311636 307896 gene locus_tag LOCUS_02770 311636 307896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 311902 311639 gene locus_tag LOCUS_02780 311902 311639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 312260 312844 gene locus_tag LOCUS_02790 312260 312844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294673.1 protein_id gnl|my_center|LOCUS_02790 313073 312882 gene locus_tag LOCUS_02800 313073 312882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 313162 313520 gene locus_tag LOCUS_tm00010 313162 313520 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 313842 314099 gene locus_tag LOCUS_02810 313842 314099 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939030.1 protein_id gnl|my_center|LOCUS_02810 314099 314362 gene locus_tag LOCUS_02820 gene yoeB 314099 314362 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_02820 314709 314407 gene locus_tag LOCUS_02830 314709 314407 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389060.1 protein_id gnl|my_center|LOCUS_02830 315008 314709 gene locus_tag LOCUS_02840 315008 314709 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_02840 315421 316074 gene locus_tag LOCUS_02850 315421 316074 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257688.1 protein_id gnl|my_center|LOCUS_02850 316061 316855 gene locus_tag LOCUS_02860 316061 316855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391257.1 protein_id gnl|my_center|LOCUS_02860 316856 318751 gene locus_tag LOCUS_02870 316856 318751 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_02870 318761 319648 gene locus_tag LOCUS_02880 318761 319648 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391255.1 protein_id gnl|my_center|LOCUS_02880 319651 320694 gene locus_tag LOCUS_02890 319651 320694 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463596.1 protein_id gnl|my_center|LOCUS_02890 320744 321901 gene locus_tag LOCUS_02900 320744 321901 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391253.1 protein_id gnl|my_center|LOCUS_02900 322000 322797 gene locus_tag LOCUS_02910 322000 322797 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_02910 322858 324123 gene locus_tag LOCUS_02920 322858 324123 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940511.1 protein_id gnl|my_center|LOCUS_02920 324132 325589 gene locus_tag LOCUS_02930 324132 325589 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944028.1 protein_id gnl|my_center|LOCUS_02930 325600 327204 gene locus_tag LOCUS_02940 325600 327204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 327710 329806 gene locus_tag LOCUS_02950 327710 329806 CDS product thiosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937484.1 protein_id gnl|my_center|LOCUS_02950 329825 330277 gene locus_tag LOCUS_02960 329825 330277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 330525 331247 gene locus_tag LOCUS_02970 330525 331247 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925340.1 protein_id gnl|my_center|LOCUS_02970 331947 331384 gene locus_tag LOCUS_02980 331947 331384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 332234 331971 gene locus_tag LOCUS_02990 332234 331971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 332586 332395 gene locus_tag LOCUS_03000 332586 332395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03000 332975 332583 gene locus_tag LOCUS_03010 332975 332583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03010 333230 333015 gene locus_tag LOCUS_03020 333230 333015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 334501 333842 gene locus_tag LOCUS_03030 334501 333842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 335558 335208 gene locus_tag LOCUS_03040 335558 335208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 335490 337655 gene locus_tag LOCUS_03050 335490 337655 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083633.1 protein_id gnl|my_center|LOCUS_03050 338230 337781 gene locus_tag LOCUS_03060 338230 337781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093116.1 protein_id gnl|my_center|LOCUS_03060 338863 338282 gene locus_tag LOCUS_03070 338863 338282 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792177.1 protein_id gnl|my_center|LOCUS_03070 341674 339062 gene locus_tag LOCUS_03080 gene clpB 341674 339062 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939160.1 protein_id gnl|my_center|LOCUS_03080 342051 341734 gene locus_tag LOCUS_03090 342051 341734 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939161.1 protein_id gnl|my_center|LOCUS_03090 343014 342076 gene locus_tag LOCUS_03100 343014 342076 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_03100 343248 344249 gene locus_tag LOCUS_03110 343248 344249 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939163.1 protein_id gnl|my_center|LOCUS_03110 345355 344324 gene locus_tag LOCUS_03120 345355 344324 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939164.1 protein_id gnl|my_center|LOCUS_03120 346497 345370 gene locus_tag LOCUS_03130 346497 345370 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792173.1 protein_id gnl|my_center|LOCUS_03130 347238 346597 gene locus_tag LOCUS_03140 347238 346597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 347485 348486 gene locus_tag LOCUS_03150 347485 348486 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_03150 348449 350941 gene locus_tag LOCUS_03160 348449 350941 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629711.1 protein_id gnl|my_center|LOCUS_03160 350956 351522 gene locus_tag LOCUS_03170 gene ybeY 350956 351522 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939169.1 protein_id gnl|my_center|LOCUS_03170 351771 351610 gene locus_tag LOCUS_03180 351771 351610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 352024 351773 gene locus_tag LOCUS_03190 352024 351773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 352067 353236 gene locus_tag LOCUS_03200 352067 353236 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939181.1 protein_id gnl|my_center|LOCUS_03200 353548 353276 gene locus_tag LOCUS_03210 353548 353276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 353459 355324 gene locus_tag LOCUS_03220 353459 355324 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939228.1 protein_id gnl|my_center|LOCUS_03220 355400 355840 gene locus_tag LOCUS_03230 355400 355840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 355921 356154 gene locus_tag LOCUS_03240 355921 356154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939229.1 protein_id gnl|my_center|LOCUS_03240 356553 356263 gene locus_tag LOCUS_03250 356553 356263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939234.1 protein_id gnl|my_center|LOCUS_03250 357522 356902 gene locus_tag LOCUS_03260 357522 356902 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939233.1 protein_id gnl|my_center|LOCUS_03260 358343 357522 gene locus_tag LOCUS_03270 358343 357522 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939232.1 protein_id gnl|my_center|LOCUS_03270 359508 358351 gene locus_tag LOCUS_03280 359508 358351 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939231.1 protein_id gnl|my_center|LOCUS_03280 359669 359502 gene locus_tag LOCUS_03290 359669 359502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 359971 361626 gene locus_tag LOCUS_03300 359971 361626 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257911.1 protein_id gnl|my_center|LOCUS_03300 363352 361772 gene locus_tag LOCUS_03310 363352 361772 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939235.1 protein_id gnl|my_center|LOCUS_03310 363958 363368 gene locus_tag LOCUS_03320 363958 363368 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939236.1 protein_id gnl|my_center|LOCUS_03320 365797 363959 gene locus_tag LOCUS_03330 gene iorA 365797 363959 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939237.1 protein_id gnl|my_center|LOCUS_03330 366670 365858 gene locus_tag LOCUS_03340 366670 365858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 366931 368190 gene locus_tag LOCUS_03350 366931 368190 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939239.1 protein_id gnl|my_center|LOCUS_03350 368192 368884 gene locus_tag LOCUS_03360 gene nadD 368192 368884 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939240.1 protein_id gnl|my_center|LOCUS_03360 370637 368874 gene locus_tag LOCUS_03370 370637 368874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 370887 371714 gene locus_tag LOCUS_03380 370887 371714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939241.1 protein_id gnl|my_center|LOCUS_03380 372723 371686 gene locus_tag LOCUS_03390 372723 371686 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939242.1 protein_id gnl|my_center|LOCUS_03390 373052 372807 gene locus_tag LOCUS_03400 373052 372807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 373289 375628 gene locus_tag LOCUS_03410 373289 375628 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939245.1 protein_id gnl|my_center|LOCUS_03410 375912 377684 gene locus_tag LOCUS_03420 375912 377684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 380175 377827 gene locus_tag LOCUS_03430 380175 377827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 380788 380498 gene locus_tag LOCUS_03440 gene ilvN 380788 380498 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703881.1 protein_id gnl|my_center|LOCUS_03440 382460 380781 gene locus_tag LOCUS_03450 gene ilvB 382460 380781 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937667.1 protein_id gnl|my_center|LOCUS_03450 382710 382579 gene locus_tag LOCUS_03460 382710 382579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 383131 383349 gene locus_tag LOCUS_03470 383131 383349 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940352.1 protein_id gnl|my_center|LOCUS_03470 383888 385495 gene locus_tag LOCUS_03480 383888 385495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 386522 385728 gene locus_tag LOCUS_03490 386522 385728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 387078 387002 gene locus_tag LOCUS_t00050 387078 387002 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 387168 387890 gene locus_tag LOCUS_03500 387168 387890 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939330.1 protein_id gnl|my_center|LOCUS_03500 387910 388344 gene locus_tag LOCUS_03510 387910 388344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 388631 388446 gene locus_tag LOCUS_03520 388631 388446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 388561 389271 gene locus_tag LOCUS_03530 388561 389271 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939331.1 protein_id gnl|my_center|LOCUS_03530 390757 389456 gene locus_tag LOCUS_03540 390757 389456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 392414 390750 gene locus_tag LOCUS_03550 392414 390750 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939515.1 protein_id gnl|my_center|LOCUS_03550 393628 392525 gene locus_tag LOCUS_03560 393628 392525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 393784 395127 gene locus_tag LOCUS_03570 393784 395127 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939339.1 protein_id gnl|my_center|LOCUS_03570 395190 398606 gene locus_tag LOCUS_03580 395190 398606 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939340.1 protein_id gnl|my_center|LOCUS_03580 398620 401781 gene locus_tag LOCUS_03590 398620 401781 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939341.1 protein_id gnl|my_center|LOCUS_03590 401904 403007 gene locus_tag LOCUS_03600 401904 403007 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939342.1 protein_id gnl|my_center|LOCUS_03600 404528 403212 gene locus_tag LOCUS_03610 404528 403212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 405380 404718 gene locus_tag LOCUS_03620 405380 404718 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393403.1 protein_id gnl|my_center|LOCUS_03620 405610 406053 gene locus_tag LOCUS_03630 405610 406053 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932389.1 protein_id gnl|my_center|LOCUS_03630 406057 407355 gene locus_tag LOCUS_03640 406057 407355 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_03640 407580 408287 gene locus_tag LOCUS_03650 407580 408287 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707332.1 protein_id gnl|my_center|LOCUS_03650 408418 409146 gene locus_tag LOCUS_03660 408418 409146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 410374 409292 gene locus_tag LOCUS_03670 410374 409292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 411365 410412 gene locus_tag LOCUS_03680 411365 410412 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939345.1 protein_id gnl|my_center|LOCUS_03680 412217 411375 gene locus_tag LOCUS_03690 412217 411375 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939346.1 protein_id gnl|my_center|LOCUS_03690 412663 412214 gene locus_tag LOCUS_03700 412663 412214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 414124 412706 gene locus_tag LOCUS_03710 414124 412706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 414541 414140 gene locus_tag LOCUS_03720 414541 414140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 414861 415247 gene locus_tag LOCUS_03730 414861 415247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 415700 415548 gene locus_tag LOCUS_03740 415700 415548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 415803 416756 gene locus_tag LOCUS_03750 415803 416756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939349.1 protein_id gnl|my_center|LOCUS_03750 416767 418119 gene locus_tag LOCUS_03760 416767 418119 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792854.1 protein_id gnl|my_center|LOCUS_03760 419233 418247 gene locus_tag LOCUS_03770 gene gap 419233 418247 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939421.1 protein_id gnl|my_center|LOCUS_03770 419653 419276 gene locus_tag LOCUS_03780 419653 419276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937583.1 protein_id gnl|my_center|LOCUS_03780 420508 419879 gene locus_tag LOCUS_03790 gene thiE 420508 419879 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939368.1 protein_id gnl|my_center|LOCUS_03790 421173 420505 gene locus_tag LOCUS_03800 gene thiF 421173 420505 CDS product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939369.1 protein_id gnl|my_center|LOCUS_03800 422340 421213 gene locus_tag LOCUS_03810 422340 421213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 423132 422341 gene locus_tag LOCUS_03820 423132 422341 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939371.1 protein_id gnl|my_center|LOCUS_03820 423332 423132 gene locus_tag LOCUS_03830 gene thiS 423332 423132 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939372.1 protein_id gnl|my_center|LOCUS_03830 424189 423836 gene locus_tag LOCUS_03840 424189 423836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 424095 424763 gene locus_tag LOCUS_03850 424095 424763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938371.1 protein_id gnl|my_center|LOCUS_03850 426129 424816 gene locus_tag LOCUS_03860 426129 424816 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_03860 428069 426315 gene locus_tag LOCUS_03870 428069 426315 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939426.1 protein_id gnl|my_center|LOCUS_03870 428453 428091 gene locus_tag LOCUS_03880 gene dksA 428453 428091 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939427.1 protein_id gnl|my_center|LOCUS_03880 428939 429013 gene locus_tag LOCUS_t00060 428939 429013 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 429441 429515 gene locus_tag LOCUS_t00070 429441 429515 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 429520 429594 gene locus_tag LOCUS_t00080 429520 429594 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 429673 429747 gene locus_tag LOCUS_t00090 429673 429747 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 429782 429856 gene locus_tag LOCUS_t00100 429782 429856 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 430563 430057 gene locus_tag LOCUS_03890 430563 430057 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937593.1 protein_id gnl|my_center|LOCUS_03890 430750 430619 gene locus_tag LOCUS_03900 430750 430619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 430839 431582 gene locus_tag LOCUS_03910 430839 431582 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939484.1 protein_id gnl|my_center|LOCUS_03910 431584 433314 gene locus_tag LOCUS_03920 431584 433314 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939485.1 protein_id gnl|my_center|LOCUS_03920 434788 433364 gene locus_tag LOCUS_03930 434788 433364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 434907 435884 gene locus_tag LOCUS_03940 434907 435884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 438513 435955 gene locus_tag LOCUS_03950 438513 435955 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294662.1 protein_id gnl|my_center|LOCUS_03950 438600 438962 gene locus_tag LOCUS_03960 438600 438962 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939487.1 protein_id gnl|my_center|LOCUS_03960 439157 439002 gene locus_tag LOCUS_03970 439157 439002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 439286 439843 gene locus_tag LOCUS_03980 439286 439843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 439824 441683 gene locus_tag LOCUS_03990 439824 441683 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001442038.1 protein_id gnl|my_center|LOCUS_03990 441909 444341 gene locus_tag LOCUS_04000 441909 444341 CDS product Cache 3/Cache 2 fusion domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294650.1 protein_id gnl|my_center|LOCUS_04000 445904 444546 gene locus_tag LOCUS_04010 445904 444546 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938391.1 protein_id gnl|my_center|LOCUS_04010 447525 446401 gene locus_tag LOCUS_04020 447525 446401 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938390.1 protein_id gnl|my_center|LOCUS_04020 447694 448740 gene locus_tag LOCUS_04030 gene recA 447694 448740 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938389.1 protein_id gnl|my_center|LOCUS_04030 448852 451497 gene locus_tag LOCUS_04040 gene alaS 448852 451497 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938388.1 protein_id gnl|my_center|LOCUS_04040 452794 451592 gene locus_tag LOCUS_04050 452794 451592 CDS product GAK system CofD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938386.1 protein_id gnl|my_center|LOCUS_04050 453439 453188 gene locus_tag LOCUS_04060 453439 453188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 454444 453785 gene locus_tag LOCUS_04070 gene phoU 454444 453785 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938384.1 protein_id gnl|my_center|LOCUS_04070 455204 454455 gene locus_tag LOCUS_04080 gene pstB 455204 454455 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938383.1 protein_id gnl|my_center|LOCUS_04080 455920 455231 gene locus_tag LOCUS_04090 455920 455231 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_04090 456782 456156 gene locus_tag LOCUS_04100 456782 456156 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524311.1 protein_id gnl|my_center|LOCUS_04100 458198 456888 gene locus_tag LOCUS_04110 458198 456888 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938380.1 protein_id gnl|my_center|LOCUS_04110 458929 458285 gene locus_tag LOCUS_04120 458929 458285 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792541.1 protein_id gnl|my_center|LOCUS_04120 459092 459271 gene locus_tag LOCUS_04130 459092 459271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 460772 459303 gene locus_tag LOCUS_04140 gene mnmE 460772 459303 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938378.1 protein_id gnl|my_center|LOCUS_04140 462318 460855 gene locus_tag LOCUS_04150 462318 460855 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938377.1 protein_id gnl|my_center|LOCUS_04150 463973 462360 gene locus_tag LOCUS_04160 gene yidC 463973 462360 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938376.1 protein_id gnl|my_center|LOCUS_04160 464474 464235 gene locus_tag LOCUS_04170 464474 464235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 465024 465200 gene locus_tag LOCUS_04180 465024 465200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 465985 465140 gene locus_tag LOCUS_04190 465985 465140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 466690 465992 gene locus_tag LOCUS_04200 466690 465992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 467152 466814 gene locus_tag LOCUS_04210 467152 466814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 468936 467293 gene locus_tag LOCUS_04220 gene groL 468936 467293 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939262.1 protein_id gnl|my_center|LOCUS_04220 469256 468972 gene locus_tag LOCUS_04230 gene groES 469256 468972 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939263.1 protein_id gnl|my_center|LOCUS_04230 472026 469567 gene locus_tag LOCUS_04240 472026 469567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 472782 472039 gene locus_tag LOCUS_04250 472782 472039 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102821.1 protein_id gnl|my_center|LOCUS_04250 473454 472894 gene locus_tag LOCUS_04260 473454 472894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 474570 473734 gene locus_tag LOCUS_04270 474570 473734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 476758 474773 gene locus_tag LOCUS_04280 476758 474773 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939265.1 protein_id gnl|my_center|LOCUS_04280 477748 477377 gene locus_tag LOCUS_04290 477748 477377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 477629 478219 gene locus_tag LOCUS_04300 477629 478219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04300 478270 479097 gene locus_tag LOCUS_04310 478270 479097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04310 479336 479719 gene locus_tag LOCUS_04320 479336 479719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939266.1 protein_id gnl|my_center|LOCUS_04320 480368 479877 gene locus_tag LOCUS_04330 480368 479877 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939267.1 protein_id gnl|my_center|LOCUS_04330 482053 480467 gene locus_tag LOCUS_04340 482053 480467 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939268.1 protein_id gnl|my_center|LOCUS_04340 482531 483553 gene locus_tag LOCUS_04350 482531 483553 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939269.1 protein_id gnl|my_center|LOCUS_04350 483823 484527 gene locus_tag LOCUS_04360 483823 484527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 484602 485084 gene locus_tag LOCUS_04370 484602 485084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 485326 486345 gene locus_tag LOCUS_04380 485326 486345 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294587.1 protein_id gnl|my_center|LOCUS_04380 486523 488952 gene locus_tag LOCUS_04390 486523 488952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 490159 488999 gene locus_tag LOCUS_04400 490159 488999 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463327.1 protein_id gnl|my_center|LOCUS_04400 491352 490426 gene locus_tag LOCUS_04410 491352 490426 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_04410 492684 491626 gene locus_tag LOCUS_04420 492684 491626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 494312 492765 gene locus_tag LOCUS_04430 494312 492765 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938369.1 protein_id gnl|my_center|LOCUS_04430 495237 494317 gene locus_tag LOCUS_04440 495237 494317 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938368.1 protein_id gnl|my_center|LOCUS_04440 496364 495234 gene locus_tag LOCUS_04450 496364 495234 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938367.1 protein_id gnl|my_center|LOCUS_04450 497551 496403 gene locus_tag LOCUS_04460 497551 496403 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_04460 498154 497666 gene locus_tag LOCUS_04470 gene gpt 498154 497666 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938365.1 protein_id gnl|my_center|LOCUS_04470 499741 498527 gene locus_tag LOCUS_04480 499741 498527 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_04480 501419 499773 gene locus_tag LOCUS_04490 501419 499773 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939625.1 protein_id gnl|my_center|LOCUS_04490 501584 503251 gene locus_tag LOCUS_04500 501584 503251 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791922.1 protein_id gnl|my_center|LOCUS_04500 503248 504504 gene locus_tag LOCUS_04510 503248 504504 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939627.1 protein_id gnl|my_center|LOCUS_04510 505400 504810 gene locus_tag LOCUS_04520 505400 504810 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939628.1 protein_id gnl|my_center|LOCUS_04520 505807 507276 gene locus_tag LOCUS_04530 505807 507276 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939629.1 protein_id gnl|my_center|LOCUS_04530 507503 508267 gene locus_tag LOCUS_04540 gene cbiM 507503 508267 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938357.1 protein_id gnl|my_center|LOCUS_04540 508277 509056 gene locus_tag LOCUS_04550 gene cbiQ 508277 509056 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938356.1 protein_id gnl|my_center|LOCUS_04550 509053 509838 gene locus_tag LOCUS_04560 509053 509838 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938355.1 protein_id gnl|my_center|LOCUS_04560 510990 509935 gene locus_tag LOCUS_04570 510990 509935 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938354.1 protein_id gnl|my_center|LOCUS_04570 511643 510987 gene locus_tag LOCUS_04580 511643 510987 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938353.1 protein_id gnl|my_center|LOCUS_04580 511850 512887 gene locus_tag LOCUS_04590 511850 512887 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792562.1 protein_id gnl|my_center|LOCUS_04590 513312 513728 gene locus_tag LOCUS_04600 513312 513728 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938350.1 protein_id gnl|my_center|LOCUS_04600 513806 515719 gene locus_tag LOCUS_04610 513806 515719 CDS product cytochrome c-type biogenesis CcmF C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938349.1 protein_id gnl|my_center|LOCUS_04610 515709 516356 gene locus_tag LOCUS_04620 515709 516356 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938348.1 protein_id gnl|my_center|LOCUS_04620 516350 517027 gene locus_tag LOCUS_04630 516350 517027 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938347.1 protein_id gnl|my_center|LOCUS_04630 517101 517775 gene locus_tag LOCUS_04640 gene ccsA 517101 517775 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_04640 517806 517958 gene locus_tag LOCUS_04650 517806 517958 CDS product CcmD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938345.1 protein_id gnl|my_center|LOCUS_04650 517948 518547 gene locus_tag LOCUS_04660 517948 518547 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938344.1 protein_id gnl|my_center|LOCUS_04660 519011 518559 gene locus_tag LOCUS_04670 519011 518559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 519281 520738 gene locus_tag LOCUS_04680 gene guaB 519281 520738 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938343.1 protein_id gnl|my_center|LOCUS_04680 520766 522316 gene locus_tag LOCUS_04690 gene guaA 520766 522316 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938342.1 protein_id gnl|my_center|LOCUS_04690 522347 522790 gene locus_tag LOCUS_04700 gene tatB 522347 522790 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938341.1 protein_id gnl|my_center|LOCUS_04700 522787 523998 gene locus_tag LOCUS_04710 gene tatC 522787 523998 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294586.1 protein_id gnl|my_center|LOCUS_04710 524069 524662 gene locus_tag LOCUS_04720 gene hisB 524069 524662 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938339.1 protein_id gnl|my_center|LOCUS_04720 524659 525303 gene locus_tag LOCUS_04730 524659 525303 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938338.1 protein_id gnl|my_center|LOCUS_04730 525300 526034 gene locus_tag LOCUS_04740 gene hisA 525300 526034 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938337.1 protein_id gnl|my_center|LOCUS_04740 526230 526727 gene locus_tag LOCUS_04750 526230 526727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 526739 529024 gene locus_tag LOCUS_04760 gene recQ 526739 529024 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091724.1 protein_id gnl|my_center|LOCUS_04760 531667 529031 gene locus_tag LOCUS_04770 531667 529031 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938486.1 protein_id gnl|my_center|LOCUS_04770 532268 532044 gene locus_tag LOCUS_04780 532268 532044 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938477.1 protein_id gnl|my_center|LOCUS_04780 533337 532270 gene locus_tag LOCUS_04790 533337 532270 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792516.1 protein_id gnl|my_center|LOCUS_04790 534314 533334 gene locus_tag LOCUS_04800 534314 533334 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792515.1 protein_id gnl|my_center|LOCUS_04800 535566 534307 gene locus_tag LOCUS_04810 535566 534307 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938480.1 protein_id gnl|my_center|LOCUS_04810 535812 536300 gene locus_tag LOCUS_04820 535812 536300 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938481.1 protein_id gnl|my_center|LOCUS_04820 536369 537214 gene locus_tag LOCUS_04830 gene mazG 536369 537214 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938482.1 protein_id gnl|my_center|LOCUS_04830 537398 538609 gene locus_tag LOCUS_04840 537398 538609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141291167.1 protein_id gnl|my_center|LOCUS_04840 539031 538834 gene locus_tag LOCUS_04850 539031 538834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 539385 539540 gene locus_tag LOCUS_04860 539385 539540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524329.1 protein_id gnl|my_center|LOCUS_04860 539565 540725 gene locus_tag LOCUS_04870 539565 540725 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524330.1 protein_id gnl|my_center|LOCUS_04870 542809 541076 gene locus_tag LOCUS_04880 542809 541076 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938476.1 protein_id gnl|my_center|LOCUS_04880 543051 543641 gene locus_tag LOCUS_04890 543051 543641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294583.1 protein_id gnl|my_center|LOCUS_04890 544238 543675 gene locus_tag LOCUS_04900 544238 543675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938473.1 protein_id gnl|my_center|LOCUS_04900 544642 544947 gene locus_tag LOCUS_04910 544642 544947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 544992 545384 gene locus_tag LOCUS_04920 544992 545384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938471.1 protein_id gnl|my_center|LOCUS_04920 547156 545573 gene locus_tag LOCUS_04930 gene murJ 547156 545573 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792519.1 protein_id gnl|my_center|LOCUS_04930 547658 547927 gene locus_tag LOCUS_04940 547658 547927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792520.1 protein_id gnl|my_center|LOCUS_04940 548531 548031 gene locus_tag LOCUS_04950 548531 548031 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938392.1 protein_id gnl|my_center|LOCUS_04950 550353 548797 gene locus_tag LOCUS_04960 550353 548797 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176720.1 protein_id gnl|my_center|LOCUS_04960 551767 550835 gene locus_tag LOCUS_04970 551767 550835 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063757.1 protein_id gnl|my_center|LOCUS_04970 552383 551907 gene locus_tag LOCUS_04980 552383 551907 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741976.1 protein_id gnl|my_center|LOCUS_04980 552829 553662 gene locus_tag LOCUS_04990 552829 553662 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939936.1 protein_id gnl|my_center|LOCUS_04990 553664 554542 gene locus_tag LOCUS_05000 553664 554542 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791710.1 protein_id gnl|my_center|LOCUS_05000 554539 555426 gene locus_tag LOCUS_05010 554539 555426 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791711.1 protein_id gnl|my_center|LOCUS_05010 555465 556277 gene locus_tag LOCUS_05020 555465 556277 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939933.1 protein_id gnl|my_center|LOCUS_05020 556265 556798 gene locus_tag LOCUS_05030 556265 556798 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939932.1 protein_id gnl|my_center|LOCUS_05030 557002 559491 gene locus_tag LOCUS_05040 557002 559491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 561407 559599 gene locus_tag LOCUS_05050 561407 559599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 562006 563319 gene locus_tag LOCUS_05060 gene ablA 562006 563319 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_05060 563306 564289 gene locus_tag LOCUS_05070 gene ablB 563306 564289 CDS product putative beta-lysine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399564.1 protein_id gnl|my_center|LOCUS_05070 565173 564331 gene locus_tag LOCUS_05080 565173 564331 CDS product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929312.1 protein_id gnl|my_center|LOCUS_05080 565380 566351 gene locus_tag LOCUS_05090 565380 566351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 566869 567060 gene locus_tag LOCUS_05100 566869 567060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 567401 567174 gene locus_tag LOCUS_05110 567401 567174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 567583 568014 gene locus_tag LOCUS_05120 567583 568014 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939250.1 protein_id gnl|my_center|LOCUS_05120 568608 569027 gene locus_tag LOCUS_05130 568608 569027 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939253.1 protein_id gnl|my_center|LOCUS_05130 569255 570499 gene locus_tag LOCUS_05140 569255 570499 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939254.1 protein_id gnl|my_center|LOCUS_05140 570511 571116 gene locus_tag LOCUS_05150 570511 571116 CDS product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939255.1 protein_id gnl|my_center|LOCUS_05150 571235 571588 gene locus_tag LOCUS_05160 571235 571588 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937568.1 protein_id gnl|my_center|LOCUS_05160 571673 573634 gene locus_tag LOCUS_05170 571673 573634 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937567.1 protein_id gnl|my_center|LOCUS_05170 574359 573778 gene locus_tag LOCUS_05180 574359 573778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 574721 575998 gene locus_tag LOCUS_05190 574721 575998 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942255.1 protein_id gnl|my_center|LOCUS_05190 576001 579114 gene locus_tag LOCUS_05200 576001 579114 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937745.1 protein_id gnl|my_center|LOCUS_05200 579856 579191 gene locus_tag LOCUS_05210 579856 579191 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791362.1 protein_id gnl|my_center|LOCUS_05210 581027 579864 gene locus_tag LOCUS_05220 581027 579864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 581476 581027 gene locus_tag LOCUS_05230 581476 581027 CDS product DUF2318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940578.1 protein_id gnl|my_center|LOCUS_05230 582085 582297 gene locus_tag LOCUS_05240 582085 582297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 582502 583404 gene locus_tag LOCUS_05250 gene yieE 582502 583404 CDS product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365699.1 protein_id gnl|my_center|LOCUS_05250 583584 584684 gene locus_tag LOCUS_05260 583584 584684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 585006 585377 gene locus_tag LOCUS_05270 585006 585377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 585847 585482 gene locus_tag LOCUS_05280 585847 585482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 586550 586041 gene locus_tag LOCUS_05290 586550 586041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 586857 587507 gene locus_tag LOCUS_05300 586857 587507 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869135.1 protein_id gnl|my_center|LOCUS_05300 588544 587672 gene locus_tag LOCUS_05310 gene metF 588544 587672 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938296.1 protein_id gnl|my_center|LOCUS_05310 588790 589068 gene locus_tag LOCUS_05320 588790 589068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 589180 590247 gene locus_tag LOCUS_05330 589180 590247 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938295.1 protein_id gnl|my_center|LOCUS_05330 590410 590721 gene locus_tag LOCUS_05340 590410 590721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 591568 590846 gene locus_tag LOCUS_05350 591568 590846 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938201.1 protein_id gnl|my_center|LOCUS_05350 592751 591795 gene locus_tag LOCUS_05360 592751 591795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 593026 595272 gene locus_tag LOCUS_05370 593026 595272 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939742.1 protein_id gnl|my_center|LOCUS_05370 595828 595373 gene locus_tag LOCUS_05380 595828 595373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 596283 597473 gene locus_tag LOCUS_05390 596283 597473 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937749.1 protein_id gnl|my_center|LOCUS_05390 597693 600293 gene locus_tag LOCUS_05400 597693 600293 CDS product Cache 3/Cache 2 fusion domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294650.1 protein_id gnl|my_center|LOCUS_05400 600412 601446 gene locus_tag LOCUS_05410 600412 601446 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_05410 601567 602787 gene locus_tag LOCUS_05420 601567 602787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 602801 603970 gene locus_tag LOCUS_05430 gene pstA 602801 603970 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530184.1 protein_id gnl|my_center|LOCUS_05430 604183 604473 gene locus_tag LOCUS_05440 604183 604473 CDS product late competence development ComFB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791814.1 protein_id gnl|my_center|LOCUS_05440 604489 605310 gene locus_tag LOCUS_05450 604489 605310 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939760.1 protein_id gnl|my_center|LOCUS_05450 605357 607900 gene locus_tag LOCUS_05460 605357 607900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 608179 607946 gene locus_tag LOCUS_05470 608179 607946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 608558 608376 gene locus_tag LOCUS_05480 608558 608376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 608502 609458 gene locus_tag LOCUS_05490 608502 609458 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791810.1 protein_id gnl|my_center|LOCUS_05490 609806 610666 gene locus_tag LOCUS_05500 609806 610666 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939764.1 protein_id gnl|my_center|LOCUS_05500 611437 610778 gene locus_tag LOCUS_05510 611437 610778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 612218 611787 gene locus_tag LOCUS_05520 612218 611787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 612556 612230 gene locus_tag LOCUS_05530 612556 612230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 613115 612549 gene locus_tag LOCUS_05540 613115 612549 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082042.1 protein_id gnl|my_center|LOCUS_05540 615333 613414 gene locus_tag LOCUS_05550 gene dxs 615333 613414 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938645.1 protein_id gnl|my_center|LOCUS_05550 616344 615448 gene locus_tag LOCUS_05560 616344 615448 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792441.1 protein_id gnl|my_center|LOCUS_05560 616570 616325 gene locus_tag LOCUS_05570 616570 616325 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938643.1 protein_id gnl|my_center|LOCUS_05570 617603 616656 gene locus_tag LOCUS_05580 617603 616656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 619075 617672 gene locus_tag LOCUS_05590 gene xseA 619075 617672 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938641.1 protein_id gnl|my_center|LOCUS_05590 620938 619208 gene locus_tag LOCUS_05600 620938 619208 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938640.1 protein_id gnl|my_center|LOCUS_05600 622020 620938 gene locus_tag LOCUS_05610 gene ispG 622020 620938 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629734.1 protein_id gnl|my_center|LOCUS_05610 622359 623447 gene locus_tag LOCUS_05620 622359 623447 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_05620 623451 624314 gene locus_tag LOCUS_05630 623451 624314 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938637.1 protein_id gnl|my_center|LOCUS_05630 624314 625144 gene locus_tag LOCUS_05640 624314 625144 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938636.1 protein_id gnl|my_center|LOCUS_05640 625141 625971 gene locus_tag LOCUS_05650 625141 625971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 626128 626481 gene locus_tag LOCUS_05660 626128 626481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 627734 626739 gene locus_tag LOCUS_05670 627734 626739 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939508.1 protein_id gnl|my_center|LOCUS_05670 627862 629055 gene locus_tag LOCUS_05680 627862 629055 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939509.1 protein_id gnl|my_center|LOCUS_05680 630156 629044 gene locus_tag LOCUS_05690 630156 629044 CDS product CobD/CbiB family cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939512.1 protein_id gnl|my_center|LOCUS_05690 630615 630157 gene locus_tag LOCUS_05700 630615 630157 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629306.1 protein_id gnl|my_center|LOCUS_05700 631937 630693 gene locus_tag LOCUS_05710 631937 630693 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938556.1 protein_id gnl|my_center|LOCUS_05710 633903 632284 gene locus_tag LOCUS_05720 633903 632284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 634250 633909 gene locus_tag LOCUS_05730 634250 633909 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792460.1 protein_id gnl|my_center|LOCUS_05730 634889 634497 gene locus_tag LOCUS_05740 634889 634497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 637366 634961 gene locus_tag LOCUS_05750 gene priA 637366 634961 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938580.1 protein_id gnl|my_center|LOCUS_05750 638407 637535 gene locus_tag LOCUS_05760 gene galU 638407 637535 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792462.1 protein_id gnl|my_center|LOCUS_05760 639800 638448 gene locus_tag LOCUS_05770 gene glmM 639800 638448 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938578.1 protein_id gnl|my_center|LOCUS_05770 640770 639868 gene locus_tag LOCUS_05780 640770 639868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 641522 640773 gene locus_tag LOCUS_05790 gene cdaA 641522 640773 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938576.1 protein_id gnl|my_center|LOCUS_05790 642524 641652 gene locus_tag LOCUS_05800 gene folP 642524 641652 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938575.1 protein_id gnl|my_center|LOCUS_05800 644569 642518 gene locus_tag LOCUS_05810 gene ftsH 644569 642518 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938574.1 protein_id gnl|my_center|LOCUS_05810 644896 644990 gene locus_tag LOCUS_t00110 644896 644990 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 645480 645208 gene locus_tag LOCUS_05820 645480 645208 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939702.1 protein_id gnl|my_center|LOCUS_05820 646081 647154 gene locus_tag LOCUS_05830 646081 647154 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070705.1 protein_id gnl|my_center|LOCUS_05830 647494 647285 gene locus_tag LOCUS_05840 647494 647285 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_05840 649277 647898 gene locus_tag LOCUS_05850 gene argH 649277 647898 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938393.1 protein_id gnl|my_center|LOCUS_05850 650501 649305 gene locus_tag LOCUS_05860 650501 649305 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938394.1 protein_id gnl|my_center|LOCUS_05860 651434 650592 gene locus_tag LOCUS_05870 gene argF 651434 650592 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938395.1 protein_id gnl|my_center|LOCUS_05870 651858 653018 gene locus_tag LOCUS_05880 651858 653018 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939904.1 protein_id gnl|my_center|LOCUS_05880 653049 653987 gene locus_tag LOCUS_05890 653049 653987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 654079 655221 gene locus_tag LOCUS_05900 654079 655221 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257254.1 protein_id gnl|my_center|LOCUS_05900 655259 656005 gene locus_tag LOCUS_05910 655259 656005 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792531.1 protein_id gnl|my_center|LOCUS_05910 657317 656139 gene locus_tag LOCUS_05920 657317 656139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 657650 657725 gene locus_tag LOCUS_t00120 657650 657725 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 658601 658347 gene locus_tag LOCUS_05930 658601 658347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 659855 659097 gene locus_tag LOCUS_05940 659855 659097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 >Feature sequence02 166 498 gene locus_tag LOCUS_05950 166 498 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_05950 1549 932 gene locus_tag LOCUS_05960 1549 932 CDS product DVUA0089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176667.1 protein_id gnl|my_center|LOCUS_05960 2122 3891 gene locus_tag LOCUS_05970 2122 3891 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939591.1 protein_id gnl|my_center|LOCUS_05970 4568 3987 gene locus_tag LOCUS_05980 4568 3987 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938113.1 protein_id gnl|my_center|LOCUS_05980 5838 4609 gene locus_tag LOCUS_05990 gene hrcA 5838 4609 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938114.1 protein_id gnl|my_center|LOCUS_05990 8208 6073 gene locus_tag LOCUS_06000 8208 6073 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112620.1 protein_id gnl|my_center|LOCUS_06000 8921 8223 gene locus_tag LOCUS_06010 8921 8223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 9170 10729 gene locus_tag LOCUS_06020 9170 10729 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938117.1 protein_id gnl|my_center|LOCUS_06020 13365 10849 gene locus_tag LOCUS_06030 13365 10849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 14733 13684 gene locus_tag LOCUS_06040 14733 13684 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937406.1 protein_id gnl|my_center|LOCUS_06040 15551 14733 gene locus_tag LOCUS_06050 gene potC 15551 14733 CDS product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937407.1 protein_id gnl|my_center|LOCUS_06050 16448 15552 gene locus_tag LOCUS_06060 16448 15552 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937408.1 protein_id gnl|my_center|LOCUS_06060 17547 16432 gene locus_tag LOCUS_06070 gene potA 17547 16432 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937409.1 protein_id gnl|my_center|LOCUS_06070 17814 17665 gene locus_tag LOCUS_06080 17814 17665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 18415 17996 gene locus_tag LOCUS_06090 18415 17996 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939765.1 protein_id gnl|my_center|LOCUS_06090 18863 18432 gene locus_tag LOCUS_06100 18863 18432 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084100.1 protein_id gnl|my_center|LOCUS_06100 19329 18907 gene locus_tag LOCUS_06110 19329 18907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 19930 19415 gene locus_tag LOCUS_06120 19930 19415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 20113 21240 gene locus_tag LOCUS_06130 20113 21240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 22010 21303 gene locus_tag LOCUS_06140 22010 21303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 22257 22182 gene locus_tag LOCUS_t00130 22257 22182 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 22506 22430 gene locus_tag LOCUS_t00140 22506 22430 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22676 23554 gene locus_tag LOCUS_06150 22676 23554 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940296.1 protein_id gnl|my_center|LOCUS_06150 23551 24531 gene locus_tag LOCUS_06160 23551 24531 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294642.1 protein_id gnl|my_center|LOCUS_06160 25698 24568 gene locus_tag LOCUS_06170 25698 24568 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388450.1 protein_id gnl|my_center|LOCUS_06170 27397 25730 gene locus_tag LOCUS_06180 27397 25730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 27839 28594 gene locus_tag LOCUS_06190 27839 28594 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_06190 28579 29787 gene locus_tag LOCUS_06200 28579 29787 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391447.1 protein_id gnl|my_center|LOCUS_06200 29784 32945 gene locus_tag LOCUS_06210 29784 32945 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529195.1 protein_id gnl|my_center|LOCUS_06210 35337 33022 gene locus_tag LOCUS_06220 gene metE 35337 33022 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940626.1 protein_id gnl|my_center|LOCUS_06220 36431 35736 gene locus_tag LOCUS_06230 36431 35736 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792760.1 protein_id gnl|my_center|LOCUS_06230 37818 36970 gene locus_tag LOCUS_06240 37818 36970 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937986.1 protein_id gnl|my_center|LOCUS_06240 38910 37822 gene locus_tag LOCUS_06250 gene hflK 38910 37822 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409358.1 protein_id gnl|my_center|LOCUS_06250 39017 40381 gene locus_tag LOCUS_06260 39017 40381 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937988.1 protein_id gnl|my_center|LOCUS_06260 40731 41039 gene locus_tag LOCUS_06270 40731 41039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 41029 42786 gene locus_tag LOCUS_06280 41029 42786 CDS product aldehyde ferredoxin oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792756.1 protein_id gnl|my_center|LOCUS_06280 42801 43295 gene locus_tag LOCUS_06290 42801 43295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937991.1 protein_id gnl|my_center|LOCUS_06290 43395 43868 gene locus_tag LOCUS_06300 gene rnhA 43395 43868 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937992.1 protein_id gnl|my_center|LOCUS_06300 43934 44671 gene locus_tag LOCUS_06310 43934 44671 CDS product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937993.1 protein_id gnl|my_center|LOCUS_06310 44718 45707 gene locus_tag LOCUS_06320 44718 45707 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937994.1 protein_id gnl|my_center|LOCUS_06320 46071 45793 gene locus_tag LOCUS_06330 46071 45793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 47310 46087 gene locus_tag LOCUS_06340 47310 46087 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176674.1 protein_id gnl|my_center|LOCUS_06340 48273 47314 gene locus_tag LOCUS_06350 48273 47314 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194565.1 protein_id gnl|my_center|LOCUS_06350 49774 48512 gene locus_tag LOCUS_06360 gene nrfD 49774 48512 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937995.1 protein_id gnl|my_center|LOCUS_06360 50545 49781 gene locus_tag LOCUS_06370 50545 49781 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937996.1 protein_id gnl|my_center|LOCUS_06370 52627 50558 gene locus_tag LOCUS_06380 52627 50558 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937997.1 protein_id gnl|my_center|LOCUS_06380 53271 52642 gene locus_tag LOCUS_06390 53271 52642 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940677.1 protein_id gnl|my_center|LOCUS_06390 54019 53459 gene locus_tag LOCUS_06400 gene rfbC 54019 53459 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938000.1 protein_id gnl|my_center|LOCUS_06400 54308 55975 gene locus_tag LOCUS_06410 54308 55975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 56118 56209 gene locus_tag LOCUS_t00150 56118 56209 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 56388 56624 gene locus_tag LOCUS_06420 56388 56624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06420 56687 57613 gene locus_tag LOCUS_06430 56687 57613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06430 57725 58432 gene locus_tag LOCUS_06440 57725 58432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 58665 58874 gene locus_tag LOCUS_06450 58665 58874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 58874 59143 gene locus_tag LOCUS_06460 58874 59143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 59136 62189 gene locus_tag LOCUS_06470 59136 62189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 62186 62545 gene locus_tag LOCUS_06480 62186 62545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 62760 64253 gene locus_tag LOCUS_06490 62760 64253 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070743.1 protein_id gnl|my_center|LOCUS_06490 64246 65418 gene locus_tag LOCUS_06500 64246 65418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 65434 68535 gene locus_tag LOCUS_06510 65434 68535 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018258731.1 protein_id gnl|my_center|LOCUS_06510 68545 69078 gene locus_tag LOCUS_06520 68545 69078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 69079 69810 gene locus_tag LOCUS_06530 69079 69810 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_06530 71060 69822 gene locus_tag LOCUS_06540 71060 69822 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891837.1 protein_id gnl|my_center|LOCUS_06540 73416 71053 gene locus_tag LOCUS_06550 73416 71053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 74229 74492 gene locus_tag LOCUS_06560 74229 74492 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582790.1 protein_id gnl|my_center|LOCUS_06560 74748 74524 gene locus_tag LOCUS_06570 74748 74524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 75510 74935 gene locus_tag LOCUS_06580 75510 74935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 75739 76029 gene locus_tag LOCUS_06590 75739 76029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 76772 76509 gene locus_tag LOCUS_06600 76772 76509 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939702.1 protein_id gnl|my_center|LOCUS_06600 77322 79022 gene locus_tag LOCUS_06610 77322 79022 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939840.1 protein_id gnl|my_center|LOCUS_06610 79550 80008 gene locus_tag LOCUS_06620 79550 80008 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938003.1 protein_id gnl|my_center|LOCUS_06620 80018 82045 gene locus_tag LOCUS_06630 80018 82045 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940440.1 protein_id gnl|my_center|LOCUS_06630 82734 82309 gene locus_tag LOCUS_06640 82734 82309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 82951 84087 gene locus_tag LOCUS_06650 gene tgt 82951 84087 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938027.1 protein_id gnl|my_center|LOCUS_06650 84084 84752 gene locus_tag LOCUS_06660 84084 84752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 84969 87131 gene locus_tag LOCUS_06670 84969 87131 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938026.1 protein_id gnl|my_center|LOCUS_06670 88550 87762 gene locus_tag LOCUS_06680 88550 87762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 90146 88788 gene locus_tag LOCUS_06690 90146 88788 CDS product BPL-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294597.1 protein_id gnl|my_center|LOCUS_06690 90525 93176 gene locus_tag LOCUS_06700 90525 93176 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938033.1 protein_id gnl|my_center|LOCUS_06700 93317 93826 gene locus_tag LOCUS_06710 93317 93826 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938034.1 protein_id gnl|my_center|LOCUS_06710 93873 94892 gene locus_tag LOCUS_06720 93873 94892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 94882 95547 gene locus_tag LOCUS_06730 94882 95547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 95570 97075 gene locus_tag LOCUS_06740 gene cobA 95570 97075 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_06740 97175 97861 gene locus_tag LOCUS_06750 gene purN 97175 97861 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938037.1 protein_id gnl|my_center|LOCUS_06750 100126 97889 gene locus_tag LOCUS_06760 100126 97889 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938038.1 protein_id gnl|my_center|LOCUS_06760 101256 100123 gene locus_tag LOCUS_06770 101256 100123 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938039.1 protein_id gnl|my_center|LOCUS_06770 101458 102027 gene locus_tag LOCUS_06780 gene amrA 101458 102027 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938040.1 protein_id gnl|my_center|LOCUS_06780 102079 102303 gene locus_tag LOCUS_06790 102079 102303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 102239 104086 gene locus_tag LOCUS_06800 102239 104086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 104935 104129 gene locus_tag LOCUS_06810 gene phnE 104935 104129 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939220.1 protein_id gnl|my_center|LOCUS_06810 105710 104928 gene locus_tag LOCUS_06820 gene phnE 105710 104928 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524368.1 protein_id gnl|my_center|LOCUS_06820 106501 105707 gene locus_tag LOCUS_06830 gene phnC 106501 105707 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939222.1 protein_id gnl|my_center|LOCUS_06830 107530 106520 gene locus_tag LOCUS_06840 gene phnD 107530 106520 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939223.1 protein_id gnl|my_center|LOCUS_06840 108996 107917 gene locus_tag LOCUS_06850 108996 107917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 110338 109139 gene locus_tag LOCUS_06860 110338 109139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 111225 110335 gene locus_tag LOCUS_06870 111225 110335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 113054 111303 gene locus_tag LOCUS_06880 gene asnB 113054 111303 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_06880 114029 113094 gene locus_tag LOCUS_06890 114029 113094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 115301 114267 gene locus_tag LOCUS_06900 115301 114267 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211684.1 protein_id gnl|my_center|LOCUS_06900 115496 117049 gene locus_tag LOCUS_06910 gene nikA 115496 117049 CDS product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493127.1 protein_id gnl|my_center|LOCUS_06910 117052 117996 gene locus_tag LOCUS_06920 gene nikB 117052 117996 CDS product nickel ABC transporter permease subunit NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947070.1 protein_id gnl|my_center|LOCUS_06920 118024 118815 gene locus_tag LOCUS_06930 118024 118815 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990759.1 protein_id gnl|my_center|LOCUS_06930 118836 119756 gene locus_tag LOCUS_06940 118836 119756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173871.1 protein_id gnl|my_center|LOCUS_06940 119746 120543 gene locus_tag LOCUS_06950 119746 120543 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082587.1 protein_id gnl|my_center|LOCUS_06950 120717 122012 gene locus_tag LOCUS_06960 120717 122012 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337311.1 protein_id gnl|my_center|LOCUS_06960 122158 122081 gene locus_tag LOCUS_t00160 122158 122081 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 122239 122165 gene locus_tag LOCUS_t00170 122239 122165 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 123048 122377 gene locus_tag LOCUS_06970 123048 122377 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938048.1 protein_id gnl|my_center|LOCUS_06970 123740 123045 gene locus_tag LOCUS_06980 123740 123045 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792728.1 protein_id gnl|my_center|LOCUS_06980 124658 123837 gene locus_tag LOCUS_06990 124658 123837 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938046.1 protein_id gnl|my_center|LOCUS_06990 126325 125480 gene locus_tag LOCUS_07000 126325 125480 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938043.1 protein_id gnl|my_center|LOCUS_07000 126868 126386 gene locus_tag LOCUS_07010 126868 126386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938042.1 protein_id gnl|my_center|LOCUS_07010 128127 126964 gene locus_tag LOCUS_07020 128127 126964 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938041.1 protein_id gnl|my_center|LOCUS_07020 128126 128398 gene locus_tag LOCUS_07030 128126 128398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 129107 128373 gene locus_tag LOCUS_07040 129107 128373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940006.1 protein_id gnl|my_center|LOCUS_07040 129880 129107 gene locus_tag LOCUS_07050 129880 129107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940007.1 protein_id gnl|my_center|LOCUS_07050 130963 129887 gene locus_tag LOCUS_07060 130963 129887 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940008.1 protein_id gnl|my_center|LOCUS_07060 131914 130988 gene locus_tag LOCUS_07070 131914 130988 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940009.1 protein_id gnl|my_center|LOCUS_07070 133204 132044 gene locus_tag LOCUS_07080 133204 132044 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940010.1 protein_id gnl|my_center|LOCUS_07080 133756 134709 gene locus_tag LOCUS_07090 133756 134709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940012.1 protein_id gnl|my_center|LOCUS_07090 135001 135294 gene locus_tag LOCUS_07100 135001 135294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792814.1 protein_id gnl|my_center|LOCUS_07100 135456 135965 gene locus_tag LOCUS_07110 135456 135965 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937895.1 protein_id gnl|my_center|LOCUS_07110 136248 138722 gene locus_tag LOCUS_07120 136248 138722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 138733 139209 gene locus_tag LOCUS_07130 138733 139209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 140220 139261 gene locus_tag LOCUS_07140 140220 139261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 140326 140502 gene locus_tag LOCUS_07150 140326 140502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 141024 140479 gene locus_tag LOCUS_07160 gene msrB 141024 140479 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792822.1 protein_id gnl|my_center|LOCUS_07160 141232 141609 gene locus_tag LOCUS_07170 141232 141609 CDS product flagellar basal body rod C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940153.1 protein_id gnl|my_center|LOCUS_07170 141789 142820 gene locus_tag LOCUS_07180 141789 142820 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940154.1 protein_id gnl|my_center|LOCUS_07180 143065 146736 gene locus_tag LOCUS_07190 143065 146736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 146797 147633 gene locus_tag LOCUS_07200 146797 147633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 147649 148533 gene locus_tag LOCUS_07210 147649 148533 CDS product WcbI family polysaccharide biosynthesis putative acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791626.1 protein_id gnl|my_center|LOCUS_07210 148678 149178 gene locus_tag LOCUS_07220 148678 149178 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938036.1 protein_id gnl|my_center|LOCUS_07220 150039 149341 gene locus_tag LOCUS_07230 150039 149341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 151353 150040 gene locus_tag LOCUS_07240 151353 150040 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940204.1 protein_id gnl|my_center|LOCUS_07240 151962 151402 gene locus_tag LOCUS_07250 gene pyrE 151962 151402 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940203.1 protein_id gnl|my_center|LOCUS_07250 153274 151982 gene locus_tag LOCUS_07260 gene purB 153274 151982 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940202.1 protein_id gnl|my_center|LOCUS_07260 153683 153372 gene locus_tag LOCUS_07270 153683 153372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 154831 153989 gene locus_tag LOCUS_07280 154831 153989 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940199.1 protein_id gnl|my_center|LOCUS_07280 156017 154845 gene locus_tag LOCUS_07290 156017 154845 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940198.1 protein_id gnl|my_center|LOCUS_07290 157617 156259 gene locus_tag LOCUS_07300 157617 156259 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940197.1 protein_id gnl|my_center|LOCUS_07300 158580 157822 gene locus_tag LOCUS_07310 gene gpmA 158580 157822 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940195.1 protein_id gnl|my_center|LOCUS_07310 160108 158681 gene locus_tag LOCUS_07320 160108 158681 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940194.1 protein_id gnl|my_center|LOCUS_07320 161518 160124 gene locus_tag LOCUS_07330 161518 160124 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940193.1 protein_id gnl|my_center|LOCUS_07330 162477 161515 gene locus_tag LOCUS_07340 162477 161515 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160961434.1 protein_id gnl|my_center|LOCUS_07340 164810 162573 gene locus_tag LOCUS_07350 164810 162573 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940191.1 protein_id gnl|my_center|LOCUS_07350 165417 164827 gene locus_tag LOCUS_07360 165417 164827 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791612.1 protein_id gnl|my_center|LOCUS_07360 166302 165598 gene locus_tag LOCUS_07370 166302 165598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937857.1 protein_id gnl|my_center|LOCUS_07370 167080 166295 gene locus_tag LOCUS_07380 167080 166295 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937856.1 protein_id gnl|my_center|LOCUS_07380 168306 167080 gene locus_tag LOCUS_07390 gene livM 168306 167080 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937855.1 protein_id gnl|my_center|LOCUS_07390 169275 168367 gene locus_tag LOCUS_07400 169275 168367 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937854.1 protein_id gnl|my_center|LOCUS_07400 170532 169414 gene locus_tag LOCUS_07410 170532 169414 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937853.1 protein_id gnl|my_center|LOCUS_07410 170423 170794 gene locus_tag LOCUS_07420 170423 170794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 170986 172116 gene locus_tag LOCUS_07430 170986 172116 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837901.1 protein_id gnl|my_center|LOCUS_07430 172113 175145 gene locus_tag LOCUS_07440 gene vmeI 172113 175145 CDS product efflux RND transporter permease subunit VmeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478902.1 protein_id gnl|my_center|LOCUS_07440 177416 175227 gene locus_tag LOCUS_07450 177416 175227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 177975 178226 gene locus_tag LOCUS_07460 177975 178226 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_07460 178271 180046 gene locus_tag LOCUS_07470 178271 180046 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_07470 180281 182467 gene locus_tag LOCUS_07480 180281 182467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 182593 183312 gene locus_tag LOCUS_07490 182593 183312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 183519 185264 gene locus_tag LOCUS_07500 183519 185264 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_07500 185541 185332 gene locus_tag LOCUS_07510 185541 185332 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968955.1 protein_id gnl|my_center|LOCUS_07510 185951 186433 gene locus_tag LOCUS_07520 185951 186433 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765165.1 protein_id gnl|my_center|LOCUS_07520 186695 187930 gene locus_tag LOCUS_07530 186695 187930 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940165.1 protein_id gnl|my_center|LOCUS_07530 188990 187914 gene locus_tag LOCUS_07540 gene rlmN 188990 187914 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940164.1 protein_id gnl|my_center|LOCUS_07540 190298 189312 gene locus_tag LOCUS_07550 190298 189312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 191744 190599 gene locus_tag LOCUS_07560 191744 190599 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535005.1 protein_id gnl|my_center|LOCUS_07560 192366 191749 gene locus_tag LOCUS_07570 192366 191749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 193837 192524 gene locus_tag LOCUS_07580 193837 192524 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940163.1 protein_id gnl|my_center|LOCUS_07580 195384 194110 gene locus_tag LOCUS_07590 195384 194110 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940162.1 protein_id gnl|my_center|LOCUS_07590 196337 195381 gene locus_tag LOCUS_07600 196337 195381 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940161.1 protein_id gnl|my_center|LOCUS_07600 197448 196360 gene locus_tag LOCUS_07610 197448 196360 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940160.1 protein_id gnl|my_center|LOCUS_07610 197426 197761 gene locus_tag LOCUS_07620 197426 197761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 199849 198005 gene locus_tag LOCUS_07630 199849 198005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 200411 202894 gene locus_tag LOCUS_07640 200411 202894 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_07640 204124 203021 gene locus_tag LOCUS_07650 204124 203021 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249955.1 protein_id gnl|my_center|LOCUS_07650 205115 204312 gene locus_tag LOCUS_07660 gene proC 205115 204312 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939605.1 protein_id gnl|my_center|LOCUS_07660 205534 205115 gene locus_tag LOCUS_07670 gene ndk 205534 205115 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939606.1 protein_id gnl|my_center|LOCUS_07670 207033 205615 gene locus_tag LOCUS_07680 207033 205615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 208397 207105 gene locus_tag LOCUS_07690 208397 207105 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939609.1 protein_id gnl|my_center|LOCUS_07690 209590 208427 gene locus_tag LOCUS_07700 209590 208427 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294660.1 protein_id gnl|my_center|LOCUS_07700 210249 209587 gene locus_tag LOCUS_07710 210249 209587 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939611.1 protein_id gnl|my_center|LOCUS_07710 210987 210625 gene locus_tag LOCUS_07720 210987 210625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 211164 212219 gene locus_tag LOCUS_07730 gene hgcA 211164 212219 CDS product mercury methylation corrinoid protein HgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942086.1 protein_id gnl|my_center|LOCUS_07730 212228 212518 gene locus_tag LOCUS_07740 gene hgcB 212228 212518 CDS product mercury methylation ferredoxin HgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942087.1 protein_id gnl|my_center|LOCUS_07740 215619 212773 gene locus_tag LOCUS_07750 gene hrpB 215619 212773 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294574.1 protein_id gnl|my_center|LOCUS_07750 215501 215743 gene locus_tag LOCUS_07760 215501 215743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 216724 215945 gene locus_tag LOCUS_07770 216724 215945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 216986 218785 gene locus_tag LOCUS_07780 216986 218785 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546634.1 protein_id gnl|my_center|LOCUS_07780 218869 219786 gene locus_tag LOCUS_07790 gene folD 218869 219786 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230259.1 protein_id gnl|my_center|LOCUS_07790 219842 220603 gene locus_tag LOCUS_07800 219842 220603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 220800 222710 gene locus_tag LOCUS_07810 gene nuoF 220800 222710 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_07810 222728 225475 gene locus_tag LOCUS_07820 gene fdhF 222728 225475 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:223841..223843,aa:Sec) note codon on position 372 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_07820 226151 225687 gene locus_tag LOCUS_07830 226151 225687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 227867 226593 gene locus_tag LOCUS_07840 227867 226593 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787310.1 protein_id gnl|my_center|LOCUS_07840 228391 229221 gene locus_tag LOCUS_07850 gene nifH 228391 229221 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176593.1 protein_id gnl|my_center|LOCUS_07850 229281 229622 gene locus_tag LOCUS_07860 229281 229622 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176592.1 protein_id gnl|my_center|LOCUS_07860 229619 229993 gene locus_tag LOCUS_07870 229619 229993 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933200.1 protein_id gnl|my_center|LOCUS_07870 230029 231657 gene locus_tag LOCUS_07880 gene nifD 230029 231657 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933201.1 protein_id gnl|my_center|LOCUS_07880 231676 233052 gene locus_tag LOCUS_07890 gene nifK 231676 233052 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933202.1 protein_id gnl|my_center|LOCUS_07890 233169 234389 gene locus_tag LOCUS_07900 gene nifB 233169 234389 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933205.1 protein_id gnl|my_center|LOCUS_07900 234434 234742 gene locus_tag LOCUS_07910 234434 234742 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_07910 234849 236369 gene locus_tag LOCUS_07920 gene nifE 234849 236369 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787306.1 protein_id gnl|my_center|LOCUS_07920 236366 237721 gene locus_tag LOCUS_07930 236366 237721 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933204.1 protein_id gnl|my_center|LOCUS_07930 237776 239044 gene locus_tag LOCUS_07940 gene nifB 237776 239044 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933205.1 protein_id gnl|my_center|LOCUS_07940 239329 239132 gene locus_tag LOCUS_07950 239329 239132 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_07950 240609 239332 gene locus_tag LOCUS_07960 240609 239332 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108203.1 protein_id gnl|my_center|LOCUS_07960 240959 241609 gene locus_tag LOCUS_07970 240959 241609 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938268.1 protein_id gnl|my_center|LOCUS_07970 241630 242334 gene locus_tag LOCUS_07980 241630 242334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 242523 243443 gene locus_tag LOCUS_07990 242523 243443 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938270.1 protein_id gnl|my_center|LOCUS_07990 243534 244790 gene locus_tag LOCUS_08000 243534 244790 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938271.1 protein_id gnl|my_center|LOCUS_08000 244826 245683 gene locus_tag LOCUS_08010 gene ubiA 244826 245683 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792606.1 protein_id gnl|my_center|LOCUS_08010 246975 245776 gene locus_tag LOCUS_08020 246975 245776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 247136 246972 gene locus_tag LOCUS_08030 247136 246972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 248321 247443 gene locus_tag LOCUS_08040 248321 247443 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939380.1 protein_id gnl|my_center|LOCUS_08040 249471 248314 gene locus_tag LOCUS_08050 249471 248314 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939381.1 protein_id gnl|my_center|LOCUS_08050 250020 249718 gene locus_tag LOCUS_08060 250020 249718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 250431 250072 gene locus_tag LOCUS_08070 250431 250072 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939385.1 protein_id gnl|my_center|LOCUS_08070 250928 250428 gene locus_tag LOCUS_08080 250928 250428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 252757 251285 gene locus_tag LOCUS_08090 gene orpR 252757 251285 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_08090 253427 252771 gene locus_tag LOCUS_08100 gene hypB 253427 252771 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939602.1 protein_id gnl|my_center|LOCUS_08100 253793 253440 gene locus_tag LOCUS_08110 253793 253440 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939601.1 protein_id gnl|my_center|LOCUS_08110 254140 254928 gene locus_tag LOCUS_08120 254140 254928 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938201.1 protein_id gnl|my_center|LOCUS_08120 254967 255797 gene locus_tag LOCUS_08130 254967 255797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049758070.1 protein_id gnl|my_center|LOCUS_08130 255856 256707 gene locus_tag LOCUS_08140 255856 256707 CDS product AMIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939600.1 protein_id gnl|my_center|LOCUS_08140 257002 256802 gene locus_tag LOCUS_08150 257002 256802 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939599.1 protein_id gnl|my_center|LOCUS_08150 257412 259907 gene locus_tag LOCUS_08160 257412 259907 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939598.1 protein_id gnl|my_center|LOCUS_08160 260484 260062 gene locus_tag LOCUS_08170 260484 260062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939597.1 protein_id gnl|my_center|LOCUS_08170 262145 260652 gene locus_tag LOCUS_08180 262145 260652 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791938.1 protein_id gnl|my_center|LOCUS_08180 264286 262433 gene locus_tag LOCUS_08190 264286 262433 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791940.1 protein_id gnl|my_center|LOCUS_08190 265252 264581 gene locus_tag LOCUS_08200 265252 264581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 265861 265364 gene locus_tag LOCUS_08210 265861 265364 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939592.1 protein_id gnl|my_center|LOCUS_08210 268358 266085 gene locus_tag LOCUS_08220 268358 266085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 268462 269100 gene locus_tag LOCUS_08230 268462 269100 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939589.1 protein_id gnl|my_center|LOCUS_08230 269958 269224 gene locus_tag LOCUS_08240 gene pgl 269958 269224 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939587.1 protein_id gnl|my_center|LOCUS_08240 270567 270848 gene locus_tag LOCUS_08250 270567 270848 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792621.1 protein_id gnl|my_center|LOCUS_08250 270866 271258 gene locus_tag LOCUS_08260 270866 271258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938236.1 protein_id gnl|my_center|LOCUS_08260 271579 271899 gene locus_tag LOCUS_08270 271579 271899 CDS product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704632.1 protein_id gnl|my_center|LOCUS_08270 271996 272745 gene locus_tag LOCUS_08280 271996 272745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938238.1 protein_id gnl|my_center|LOCUS_08280 272916 273704 gene locus_tag LOCUS_08290 272916 273704 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938239.1 protein_id gnl|my_center|LOCUS_08290 273707 274582 gene locus_tag LOCUS_08300 273707 274582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 274747 277659 gene locus_tag LOCUS_08310 274747 277659 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938240.1 protein_id gnl|my_center|LOCUS_08310 277759 278193 gene locus_tag LOCUS_08320 277759 278193 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938241.1 protein_id gnl|my_center|LOCUS_08320 278333 279139 gene locus_tag LOCUS_08330 278333 279139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 279824 279171 gene locus_tag LOCUS_08340 279824 279171 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939847.1 protein_id gnl|my_center|LOCUS_08340 281570 280383 gene locus_tag LOCUS_08350 281570 280383 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943261.1 protein_id gnl|my_center|LOCUS_08350 281872 282771 gene locus_tag LOCUS_08360 281872 282771 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_08360 282768 283886 gene locus_tag LOCUS_08370 282768 283886 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_08370 283879 284835 gene locus_tag LOCUS_08380 283879 284835 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942376.1 protein_id gnl|my_center|LOCUS_08380 284837 285589 gene locus_tag LOCUS_08390 284837 285589 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_08390 285586 286902 gene locus_tag LOCUS_08400 285586 286902 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942374.1 protein_id gnl|my_center|LOCUS_08400 287320 287487 gene locus_tag LOCUS_08410 287320 287487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 287527 287775 gene locus_tag LOCUS_08420 287527 287775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 287942 288178 gene locus_tag LOCUS_08430 287942 288178 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939842.1 protein_id gnl|my_center|LOCUS_08430 288216 290516 gene locus_tag LOCUS_08440 gene feoB 288216 290516 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939841.1 protein_id gnl|my_center|LOCUS_08440 292344 290593 gene locus_tag LOCUS_08450 292344 290593 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939632.1 protein_id gnl|my_center|LOCUS_08450 292741 293844 gene locus_tag LOCUS_08460 292741 293844 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939630.1 protein_id gnl|my_center|LOCUS_08460 294979 293810 gene locus_tag LOCUS_08470 294979 293810 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938358.1 protein_id gnl|my_center|LOCUS_08470 296140 295058 gene locus_tag LOCUS_08480 296140 295058 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938359.1 protein_id gnl|my_center|LOCUS_08480 297251 296148 gene locus_tag LOCUS_08490 297251 296148 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938360.1 protein_id gnl|my_center|LOCUS_08490 298049 297255 gene locus_tag LOCUS_08500 gene larB 298049 297255 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938361.1 protein_id gnl|my_center|LOCUS_08500 298222 299736 gene locus_tag LOCUS_08510 298222 299736 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792552.1 protein_id gnl|my_center|LOCUS_08510 300154 302085 gene locus_tag LOCUS_08520 300154 302085 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938363.1 protein_id gnl|my_center|LOCUS_08520 302125 304020 gene locus_tag LOCUS_08530 302125 304020 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_08530 304180 304743 gene locus_tag LOCUS_08540 304180 304743 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120861.1 protein_id gnl|my_center|LOCUS_08540 304881 305186 gene locus_tag LOCUS_08550 304881 305186 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531854.1 protein_id gnl|my_center|LOCUS_08550 306158 305307 gene locus_tag LOCUS_08560 306158 305307 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939814.1 protein_id gnl|my_center|LOCUS_08560 308115 306430 gene locus_tag LOCUS_08570 gene hcp 308115 306430 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791786.1 protein_id gnl|my_center|LOCUS_08570 308439 308513 gene locus_tag LOCUS_t00180 308439 308513 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 308591 310525 gene locus_tag LOCUS_08580 gene thrS 308591 310525 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939808.1 protein_id gnl|my_center|LOCUS_08580 310551 311057 gene locus_tag LOCUS_08590 gene infC 310551 311057 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939807.1 protein_id gnl|my_center|LOCUS_08590 311247 311444 gene locus_tag LOCUS_08600 gene rpmI 311247 311444 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939806.1 protein_id gnl|my_center|LOCUS_08600 311551 311904 gene locus_tag LOCUS_08610 gene rplT 311551 311904 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939805.1 protein_id gnl|my_center|LOCUS_08610 311919 312956 gene locus_tag LOCUS_08620 gene pheS 311919 312956 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939804.1 protein_id gnl|my_center|LOCUS_08620 313059 315488 gene locus_tag LOCUS_08630 gene pheT 313059 315488 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939803.1 protein_id gnl|my_center|LOCUS_08630 315639 316550 gene locus_tag LOCUS_08640 315639 316550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 316562 317368 gene locus_tag LOCUS_08650 gene rpe 316562 317368 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939801.1 protein_id gnl|my_center|LOCUS_08650 317595 319589 gene locus_tag LOCUS_08660 gene tkt 317595 319589 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939800.1 protein_id gnl|my_center|LOCUS_08660 319898 321076 gene locus_tag LOCUS_08670 319898 321076 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939799.1 protein_id gnl|my_center|LOCUS_08670 321253 321756 gene locus_tag LOCUS_08680 321253 321756 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791692.1 protein_id gnl|my_center|LOCUS_08680 321753 322271 gene locus_tag LOCUS_08690 321753 322271 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940018.1 protein_id gnl|my_center|LOCUS_08690 322449 323435 gene locus_tag LOCUS_08700 322449 323435 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940020.1 protein_id gnl|my_center|LOCUS_08700 323799 323536 gene locus_tag LOCUS_08710 323799 323536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939819.1 protein_id gnl|my_center|LOCUS_08710 324023 324652 gene locus_tag LOCUS_08720 324023 324652 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939818.1 protein_id gnl|my_center|LOCUS_08720 324725 325408 gene locus_tag LOCUS_08730 324725 325408 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939817.1 protein_id gnl|my_center|LOCUS_08730 325866 327224 gene locus_tag LOCUS_08740 gene nhaA 325866 327224 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_08740 328138 327308 gene locus_tag LOCUS_08750 328138 327308 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931500.1 protein_id gnl|my_center|LOCUS_08750 329033 328125 gene locus_tag LOCUS_08760 329033 328125 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192869.1 protein_id gnl|my_center|LOCUS_08760 329839 329030 gene locus_tag LOCUS_08770 329839 329030 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940422.1 protein_id gnl|my_center|LOCUS_08770 330719 329847 gene locus_tag LOCUS_08780 330719 329847 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815927.1 protein_id gnl|my_center|LOCUS_08780 332099 330819 gene locus_tag LOCUS_08790 332099 330819 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815926.1 protein_id gnl|my_center|LOCUS_08790 333129 332083 gene locus_tag LOCUS_08800 333129 332083 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940419.1 protein_id gnl|my_center|LOCUS_08800 333944 333126 gene locus_tag LOCUS_08810 333944 333126 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173767.1 protein_id gnl|my_center|LOCUS_08810 334182 335051 gene locus_tag LOCUS_08820 334182 335051 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433836.1 protein_id gnl|my_center|LOCUS_08820 336283 335090 gene locus_tag LOCUS_08830 336283 335090 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118495.1 protein_id gnl|my_center|LOCUS_08830 336507 337214 gene locus_tag LOCUS_08840 336507 337214 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939740.1 protein_id gnl|my_center|LOCUS_08840 337278 338375 gene locus_tag LOCUS_08850 gene lpxK 337278 338375 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939738.1 protein_id gnl|my_center|LOCUS_08850 338379 340829 gene locus_tag LOCUS_08860 gene rnr 338379 340829 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939737.1 protein_id gnl|my_center|LOCUS_08860 342454 340916 gene locus_tag LOCUS_08870 342454 340916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939734.1 protein_id gnl|my_center|LOCUS_08870 344153 342543 gene locus_tag LOCUS_08880 344153 342543 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939733.1 protein_id gnl|my_center|LOCUS_08880 345084 344248 gene locus_tag LOCUS_08890 345084 344248 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939732.1 protein_id gnl|my_center|LOCUS_08890 346083 345085 gene locus_tag LOCUS_08900 346083 345085 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939731.1 protein_id gnl|my_center|LOCUS_08900 346757 346224 gene locus_tag LOCUS_08910 346757 346224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791831.1 protein_id gnl|my_center|LOCUS_08910 347380 346766 gene locus_tag LOCUS_08920 gene rdgC 347380 346766 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939729.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence03 854 135 gene locus_tag LOCUS_08930 854 135 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174408902.1 protein_id gnl|my_center|LOCUS_08930 1559 1395 gene locus_tag LOCUS_08940 1559 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1831 1965 gene locus_tag LOCUS_08950 1831 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 1974 2156 gene locus_tag LOCUS_08960 1974 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 2278 2514 gene locus_tag LOCUS_08970 2278 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 2492 3079 gene locus_tag LOCUS_08980 2492 3079 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002888.1 protein_id gnl|my_center|LOCUS_08980 6523 3107 gene locus_tag LOCUS_08990 6523 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 20485 6677 gene locus_tag LOCUS_09000 20485 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 20576 21649 gene locus_tag LOCUS_09010 20576 21649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 22262 22774 gene locus_tag LOCUS_09020 22262 22774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 22787 22993 gene locus_tag LOCUS_09030 22787 22993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 23099 23647 gene locus_tag LOCUS_09040 23099 23647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 23948 25087 gene locus_tag LOCUS_09050 23948 25087 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881057.1 protein_id gnl|my_center|LOCUS_09050 25137 25925 gene locus_tag LOCUS_09060 25137 25925 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267336.1 protein_id gnl|my_center|LOCUS_09060 26553 26134 gene locus_tag LOCUS_09070 26553 26134 CDS product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836561.1 protein_id gnl|my_center|LOCUS_09070 27086 26727 gene locus_tag LOCUS_09080 27086 26727 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904036.1 protein_id gnl|my_center|LOCUS_09080 28398 27289 gene locus_tag LOCUS_09090 28398 27289 CDS product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704260.1 protein_id gnl|my_center|LOCUS_09090 28896 28615 gene locus_tag LOCUS_09100 28896 28615 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719393.1 protein_id gnl|my_center|LOCUS_09100 29360 28932 gene locus_tag LOCUS_09110 29360 28932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 29975 29379 gene locus_tag LOCUS_09120 29975 29379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 30263 29979 gene locus_tag LOCUS_09130 30263 29979 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016131.1 protein_id gnl|my_center|LOCUS_09130 30870 30277 gene locus_tag LOCUS_09140 30870 30277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 31730 30915 gene locus_tag LOCUS_09150 gene eutJ 31730 30915 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815263.1 protein_id gnl|my_center|LOCUS_09150 32436 31711 gene locus_tag LOCUS_09160 32436 31711 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868832.1 protein_id gnl|my_center|LOCUS_09160 33000 32716 gene locus_tag LOCUS_09170 gene eutM 33000 32716 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423991.1 protein_id gnl|my_center|LOCUS_09170 34559 33060 gene locus_tag LOCUS_09180 34559 33060 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836566.1 protein_id gnl|my_center|LOCUS_09180 35157 34564 gene locus_tag LOCUS_09190 35157 34564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 36194 35262 gene locus_tag LOCUS_09200 gene cutD 36194 35262 CDS product choline TMA-lyase-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986624.1 protein_id gnl|my_center|LOCUS_09200 38804 36258 gene locus_tag LOCUS_09210 gene cutC 38804 36258 CDS product choline trimethylamine-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358179.1 protein_id gnl|my_center|LOCUS_09210 40388 38826 gene locus_tag LOCUS_09220 40388 38826 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986625.1 protein_id gnl|my_center|LOCUS_09220 41114 40497 gene locus_tag LOCUS_09230 41114 40497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 41891 42988 gene locus_tag LOCUS_09240 41891 42988 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986628.1 protein_id gnl|my_center|LOCUS_09240 42975 43241 gene locus_tag LOCUS_09250 42975 43241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986627.1 protein_id gnl|my_center|LOCUS_09250 43454 43666 gene locus_tag LOCUS_09260 43454 43666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 43725 44612 gene locus_tag LOCUS_09270 43725 44612 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402124.1 protein_id gnl|my_center|LOCUS_09270 46117 44732 gene locus_tag LOCUS_09280 46117 44732 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163428.1 protein_id gnl|my_center|LOCUS_09280 48522 46552 gene locus_tag LOCUS_09290 48522 46552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 50216 48933 gene locus_tag LOCUS_09300 50216 48933 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939271.1 protein_id gnl|my_center|LOCUS_09300 53078 50289 gene locus_tag LOCUS_09310 gene uvrA 53078 50289 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939273.1 protein_id gnl|my_center|LOCUS_09310 54119 53433 gene locus_tag LOCUS_09320 54119 53433 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939274.1 protein_id gnl|my_center|LOCUS_09320 54261 54347 gene locus_tag LOCUS_t00190 54261 54347 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 54846 55091 gene locus_tag LOCUS_09330 54846 55091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 55117 55326 gene locus_tag LOCUS_09340 55117 55326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 55377 55820 gene locus_tag LOCUS_09350 55377 55820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence04 137 1693 gene locus_tag LOCUS_09360 137 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 3627 1903 gene locus_tag LOCUS_09370 gene ade 3627 1903 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_09370 4559 3630 gene locus_tag LOCUS_09380 4559 3630 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_09380 5632 4559 gene locus_tag LOCUS_09390 5632 4559 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_09390 7232 5649 gene locus_tag LOCUS_09400 7232 5649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938369.1 protein_id gnl|my_center|LOCUS_09400 7882 7235 gene locus_tag LOCUS_09410 7882 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 9616 8165 gene locus_tag LOCUS_09420 9616 8165 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787371.1 protein_id gnl|my_center|LOCUS_09420 10285 9839 gene locus_tag LOCUS_09430 10285 9839 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460706.1 protein_id gnl|my_center|LOCUS_09430 11581 10484 gene locus_tag LOCUS_09440 11581 10484 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_09440 11918 12712 gene locus_tag LOCUS_09450 11918 12712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 12869 12794 gene locus_tag LOCUS_t00200 12869 12794 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 13029 12954 gene locus_tag LOCUS_t00210 13029 12954 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 15438 13378 gene locus_tag LOCUS_09460 15438 13378 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938319.1 protein_id gnl|my_center|LOCUS_09460 16362 15496 gene locus_tag LOCUS_09470 16362 15496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 17686 16364 gene locus_tag LOCUS_09480 17686 16364 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938317.1 protein_id gnl|my_center|LOCUS_09480 19852 17699 gene locus_tag LOCUS_09490 19852 17699 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938316.1 protein_id gnl|my_center|LOCUS_09490 >Feature sequence05 558 3434 gene locus_tag LOCUS_09500 558 3434 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939652.1 protein_id gnl|my_center|LOCUS_09500 3439 4326 gene locus_tag LOCUS_09510 3439 4326 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939653.1 protein_id gnl|my_center|LOCUS_09510 4372 6366 gene locus_tag LOCUS_09520 4372 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 6466 9036 gene locus_tag LOCUS_09530 6466 9036 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939656.1 protein_id gnl|my_center|LOCUS_09530 9247 11049 gene locus_tag LOCUS_09540 9247 11049 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939657.1 protein_id gnl|my_center|LOCUS_09540 11052 12173 gene locus_tag LOCUS_09550 11052 12173 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706126.1 protein_id gnl|my_center|LOCUS_09550 12166 13194 gene locus_tag LOCUS_09560 12166 13194 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_09560 13191 14837 gene locus_tag LOCUS_09570 13191 14837 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103058.1 protein_id gnl|my_center|LOCUS_09570 14834 15910 gene locus_tag LOCUS_09580 14834 15910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 15910 17382 gene locus_tag LOCUS_09590 15910 17382 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_09590 17379 18008 gene locus_tag LOCUS_09600 17379 18008 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940072.1 protein_id gnl|my_center|LOCUS_09600 18005 18412 gene locus_tag LOCUS_09610 18005 18412 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_09610 18409 19080 gene locus_tag LOCUS_09620 18409 19080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 19101 20321 gene locus_tag LOCUS_09630 19101 20321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 20403 21113 gene locus_tag LOCUS_09640 20403 21113 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524570.1 protein_id gnl|my_center|LOCUS_09640 21122 21919 gene locus_tag LOCUS_09650 21122 21919 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_09650 22165 23397 gene locus_tag LOCUS_09660 22165 23397 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868912.1 protein_id gnl|my_center|LOCUS_09660 23409 25106 gene locus_tag LOCUS_09670 23409 25106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 25390 27774 gene locus_tag LOCUS_09680 25390 27774 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792363.1 protein_id gnl|my_center|LOCUS_09680 29172 27844 gene locus_tag LOCUS_09690 29172 27844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 32300 29298 gene locus_tag LOCUS_09700 32300 29298 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761136.1 protein_id gnl|my_center|LOCUS_09700 33923 32370 gene locus_tag LOCUS_09710 33923 32370 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074089.1 protein_id gnl|my_center|LOCUS_09710 34240 37830 gene locus_tag LOCUS_09720 34240 37830 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940330.1 protein_id gnl|my_center|LOCUS_09720 38047 37889 gene locus_tag LOCUS_09730 38047 37889 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940442.1 protein_id gnl|my_center|LOCUS_09730 38454 38074 gene locus_tag LOCUS_09740 38454 38074 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940441.1 protein_id gnl|my_center|LOCUS_09740 38965 38624 gene locus_tag LOCUS_09750 38965 38624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 41090 39081 gene locus_tag LOCUS_09760 41090 39081 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940440.1 protein_id gnl|my_center|LOCUS_09760 42375 41356 gene locus_tag LOCUS_09770 42375 41356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 42828 42397 gene locus_tag LOCUS_09780 gene ruvX 42828 42397 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940329.1 protein_id gnl|my_center|LOCUS_09780 44704 43025 gene locus_tag LOCUS_09790 44704 43025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 45620 44970 gene locus_tag LOCUS_09800 45620 44970 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940346.1 protein_id gnl|my_center|LOCUS_09800 47147 45723 gene locus_tag LOCUS_09810 47147 45723 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 protein_id gnl|my_center|LOCUS_09810 47398 47144 gene locus_tag LOCUS_09820 47398 47144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940344.1 protein_id gnl|my_center|LOCUS_09820 47924 48316 gene locus_tag LOCUS_09830 47924 48316 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940343.1 protein_id gnl|my_center|LOCUS_09830 48947 48408 gene locus_tag LOCUS_09840 48947 48408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 49247 51064 gene locus_tag LOCUS_09850 49247 51064 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791517.1 protein_id gnl|my_center|LOCUS_09850 51539 52306 gene locus_tag LOCUS_09860 51539 52306 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294645.1 protein_id gnl|my_center|LOCUS_09860 52316 53518 gene locus_tag LOCUS_09870 52316 53518 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940058.1 protein_id gnl|my_center|LOCUS_09870 53518 54477 gene locus_tag LOCUS_09880 53518 54477 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940059.1 protein_id gnl|my_center|LOCUS_09880 54481 55059 gene locus_tag LOCUS_09890 54481 55059 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940060.1 protein_id gnl|my_center|LOCUS_09890 55089 55763 gene locus_tag LOCUS_09900 55089 55763 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940061.1 protein_id gnl|my_center|LOCUS_09900 55775 56350 gene locus_tag LOCUS_09910 55775 56350 CDS product RnfABCDGE type electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940062.1 protein_id gnl|my_center|LOCUS_09910 56412 57302 gene locus_tag LOCUS_09920 56412 57302 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940063.1 protein_id gnl|my_center|LOCUS_09920 57316 58329 gene locus_tag LOCUS_09930 57316 58329 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940064.1 protein_id gnl|my_center|LOCUS_09930 59541 58462 gene locus_tag LOCUS_09940 59541 58462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 59777 60211 gene locus_tag LOCUS_09950 59777 60211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 60799 60449 gene locus_tag LOCUS_09960 60799 60449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940279.1 protein_id gnl|my_center|LOCUS_09960 62114 60966 gene locus_tag LOCUS_09970 62114 60966 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409361.1 protein_id gnl|my_center|LOCUS_09970 62382 65789 gene locus_tag LOCUS_09980 62382 65789 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940281.1 protein_id gnl|my_center|LOCUS_09980 66102 65776 gene locus_tag LOCUS_09990 66102 65776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 66101 67594 gene locus_tag LOCUS_10000 66101 67594 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940282.1 protein_id gnl|my_center|LOCUS_10000 68082 71738 gene locus_tag LOCUS_10010 gene nifJ 68082 71738 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940284.1 protein_id gnl|my_center|LOCUS_10010 72127 73806 gene locus_tag LOCUS_10020 72127 73806 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462890.1 protein_id gnl|my_center|LOCUS_10020 74296 75684 gene locus_tag LOCUS_10030 74296 75684 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940286.1 protein_id gnl|my_center|LOCUS_10030 75688 76977 gene locus_tag LOCUS_10040 75688 76977 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791554.1 protein_id gnl|my_center|LOCUS_10040 77104 79218 gene locus_tag LOCUS_10050 gene pta 77104 79218 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_10050 79242 80450 gene locus_tag LOCUS_10060 79242 80450 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940289.1 protein_id gnl|my_center|LOCUS_10060 80550 81611 gene locus_tag LOCUS_10070 80550 81611 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940290.1 protein_id gnl|my_center|LOCUS_10070 81795 82823 gene locus_tag LOCUS_10080 81795 82823 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892094.1 protein_id gnl|my_center|LOCUS_10080 83008 84111 gene locus_tag LOCUS_10090 83008 84111 CDS product putative 2-aminoethylphosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813130.1 protein_id gnl|my_center|LOCUS_10090 84108 85772 gene locus_tag LOCUS_10100 84108 85772 CDS product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926325.1 protein_id gnl|my_center|LOCUS_10100 86597 85881 gene locus_tag LOCUS_10110 86597 85881 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018208854.1 protein_id gnl|my_center|LOCUS_10110 87943 86744 gene locus_tag LOCUS_10120 87943 86744 CDS product DUF401 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941677.1 protein_id gnl|my_center|LOCUS_10120 88374 88159 gene locus_tag LOCUS_10130 88374 88159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 88577 89515 gene locus_tag LOCUS_10140 88577 89515 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808636.1 protein_id gnl|my_center|LOCUS_10140 89573 90982 gene locus_tag LOCUS_10150 gene fumC 89573 90982 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389978.1 protein_id gnl|my_center|LOCUS_10150 91948 91058 gene locus_tag LOCUS_10160 91948 91058 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937704.1 protein_id gnl|my_center|LOCUS_10160 93036 92134 gene locus_tag LOCUS_10170 93036 92134 CDS product Tim44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791677.1 protein_id gnl|my_center|LOCUS_10170 95062 93239 gene locus_tag LOCUS_10180 95062 93239 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937705.1 protein_id gnl|my_center|LOCUS_10180 95847 95059 gene locus_tag LOCUS_10190 95847 95059 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937706.1 protein_id gnl|my_center|LOCUS_10190 96518 95949 gene locus_tag LOCUS_10200 96518 95949 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937707.1 protein_id gnl|my_center|LOCUS_10200 97018 96761 gene locus_tag LOCUS_10210 97018 96761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792913.1 protein_id gnl|my_center|LOCUS_10210 97535 98848 gene locus_tag LOCUS_10220 gene dsrA 97535 98848 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937709.1 protein_id gnl|my_center|LOCUS_10220 98870 100015 gene locus_tag LOCUS_10230 gene dsrB 98870 100015 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937710.1 protein_id gnl|my_center|LOCUS_10230 100084 100320 gene locus_tag LOCUS_10240 100084 100320 CDS product dissimilatory sulfite reductase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937711.1 protein_id gnl|my_center|LOCUS_10240 100355 101857 gene locus_tag LOCUS_10250 100355 101857 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937712.1 protein_id gnl|my_center|LOCUS_10250 102826 101957 gene locus_tag LOCUS_10260 102826 101957 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792911.1 protein_id gnl|my_center|LOCUS_10260 103329 102823 gene locus_tag LOCUS_10270 103329 102823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 103817 104065 gene locus_tag LOCUS_10280 103817 104065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 105107 104115 gene locus_tag LOCUS_10290 105107 104115 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940417.1 protein_id gnl|my_center|LOCUS_10290 105449 105928 gene locus_tag LOCUS_10300 gene ahbB 105449 105928 CDS product siroheme decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940425.1 protein_id gnl|my_center|LOCUS_10300 105981 107261 gene locus_tag LOCUS_10310 gene hemL 105981 107261 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940426.1 protein_id gnl|my_center|LOCUS_10310 107333 108409 gene locus_tag LOCUS_10320 107333 108409 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943623.1 protein_id gnl|my_center|LOCUS_10320 108406 109338 gene locus_tag LOCUS_10330 gene cobJ 108406 109338 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940428.1 protein_id gnl|my_center|LOCUS_10330 109488 109880 gene locus_tag LOCUS_10340 109488 109880 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940429.1 protein_id gnl|my_center|LOCUS_10340 110085 112304 gene locus_tag LOCUS_10350 110085 112304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 112731 112462 gene locus_tag LOCUS_10360 gene fliQ 112731 112462 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937354.1 protein_id gnl|my_center|LOCUS_10360 113559 112747 gene locus_tag LOCUS_10370 gene fliP 113559 112747 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524186.1 protein_id gnl|my_center|LOCUS_10370 114061 113480 gene locus_tag LOCUS_10380 gene fliO 114061 113480 CDS product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937356.1 protein_id gnl|my_center|LOCUS_10380 114647 114054 gene locus_tag LOCUS_10390 114647 114054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 115192 114701 gene locus_tag LOCUS_10400 115192 114701 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793169.1 protein_id gnl|my_center|LOCUS_10400 115960 115232 gene locus_tag LOCUS_10410 115960 115232 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937359.1 protein_id gnl|my_center|LOCUS_10410 116809 115964 gene locus_tag LOCUS_10420 116809 115964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 117684 116923 gene locus_tag LOCUS_10430 117684 116923 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 protein_id gnl|my_center|LOCUS_10430 118542 117784 gene locus_tag LOCUS_10440 118542 117784 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937362.1 protein_id gnl|my_center|LOCUS_10440 119638 118724 gene locus_tag LOCUS_10450 gene era 119638 118724 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937363.1 protein_id gnl|my_center|LOCUS_10450 120317 119967 gene locus_tag LOCUS_10460 120317 119967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937716.1 protein_id gnl|my_center|LOCUS_10460 120927 120322 gene locus_tag LOCUS_10470 120927 120322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937717.1 protein_id gnl|my_center|LOCUS_10470 122695 121046 gene locus_tag LOCUS_10480 122695 121046 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937718.1 protein_id gnl|my_center|LOCUS_10480 123544 122891 gene locus_tag LOCUS_10490 123544 122891 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937719.1 protein_id gnl|my_center|LOCUS_10490 124883 123561 gene locus_tag LOCUS_10500 124883 123561 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937720.1 protein_id gnl|my_center|LOCUS_10500 125170 126681 gene locus_tag LOCUS_10510 125170 126681 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937722.1 protein_id gnl|my_center|LOCUS_10510 127371 126817 gene locus_tag LOCUS_10520 127371 126817 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940055.1 protein_id gnl|my_center|LOCUS_10520 128168 130087 gene locus_tag LOCUS_10530 gene speA 128168 130087 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792905.1 protein_id gnl|my_center|LOCUS_10530 130125 131324 gene locus_tag LOCUS_10540 130125 131324 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 protein_id gnl|my_center|LOCUS_10540 131712 132854 gene locus_tag LOCUS_10550 gene nspC 131712 132854 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937726.1 protein_id gnl|my_center|LOCUS_10550 132865 133719 gene locus_tag LOCUS_10560 gene speB 132865 133719 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937728.1 protein_id gnl|my_center|LOCUS_10560 134040 133780 gene locus_tag LOCUS_10570 134040 133780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 134874 134569 gene locus_tag LOCUS_10580 134874 134569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 135456 135187 gene locus_tag LOCUS_10590 135456 135187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 135612 137237 gene locus_tag LOCUS_10600 135612 137237 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937393.1 protein_id gnl|my_center|LOCUS_10600 137423 138736 gene locus_tag LOCUS_10610 137423 138736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 138892 139167 gene locus_tag LOCUS_10620 138892 139167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 139449 141134 gene locus_tag LOCUS_10630 139449 141134 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793021.1 protein_id gnl|my_center|LOCUS_10630 141323 142339 gene locus_tag LOCUS_10640 141323 142339 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937445.1 protein_id gnl|my_center|LOCUS_10640 142501 145170 gene locus_tag LOCUS_10650 142501 145170 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937404.1 protein_id gnl|my_center|LOCUS_10650 145693 145514 gene locus_tag LOCUS_10660 145693 145514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 145969 146550 gene locus_tag LOCUS_10670 145969 146550 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764472.1 protein_id gnl|my_center|LOCUS_10670 146603 146845 gene locus_tag LOCUS_10680 146603 146845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940540.1 protein_id gnl|my_center|LOCUS_10680 147318 146905 gene locus_tag LOCUS_10690 147318 146905 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792648.1 protein_id gnl|my_center|LOCUS_10690 147558 148358 gene locus_tag LOCUS_10700 gene lgt 147558 148358 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937326.1 protein_id gnl|my_center|LOCUS_10700 148480 148698 gene locus_tag LOCUS_10710 gene infA 148480 148698 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937325.1 protein_id gnl|my_center|LOCUS_10710 149254 152280 gene locus_tag LOCUS_10720 gene pruA 149254 152280 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940575.1 protein_id gnl|my_center|LOCUS_10720 152444 152896 gene locus_tag LOCUS_10730 152444 152896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 153907 153101 gene locus_tag LOCUS_10740 153907 153101 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937345.1 protein_id gnl|my_center|LOCUS_10740 154181 155056 gene locus_tag LOCUS_10750 154181 155056 CDS product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460946.1 protein_id gnl|my_center|LOCUS_10750 155161 156864 gene locus_tag LOCUS_10760 155161 156864 CDS product LytS/YhcK type 5TM receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101534157.1 protein_id gnl|my_center|LOCUS_10760 156951 157718 gene locus_tag LOCUS_10770 156951 157718 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940517.1 protein_id gnl|my_center|LOCUS_10770 158027 157830 gene locus_tag LOCUS_10780 158027 157830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 159075 160460 gene locus_tag LOCUS_10790 gene asnS 159075 160460 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937318.1 protein_id gnl|my_center|LOCUS_10790 161776 160646 gene locus_tag LOCUS_10800 161776 160646 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461803.1 protein_id gnl|my_center|LOCUS_10800 163379 161826 gene locus_tag LOCUS_10810 163379 161826 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582902.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence06 1695 463 gene locus_tag LOCUS_10820 gene trpB 1695 463 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937396.1 protein_id gnl|my_center|LOCUS_10820 2373 3458 gene locus_tag LOCUS_10830 2373 3458 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931069.1 protein_id gnl|my_center|LOCUS_10830 3690 4160 gene locus_tag LOCUS_10840 3690 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 4170 5477 gene locus_tag LOCUS_10850 4170 5477 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938006.1 protein_id gnl|my_center|LOCUS_10850 6539 5529 gene locus_tag LOCUS_10860 6539 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 7744 6686 gene locus_tag LOCUS_10870 gene hypE 7744 6686 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937633.1 protein_id gnl|my_center|LOCUS_10870 8921 7917 gene locus_tag LOCUS_10880 gene hypD 8921 7917 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937632.1 protein_id gnl|my_center|LOCUS_10880 8835 9044 gene locus_tag LOCUS_10890 8835 9044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 9227 9871 gene locus_tag LOCUS_10900 9227 9871 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937640.1 protein_id gnl|my_center|LOCUS_10900 9828 10751 gene locus_tag LOCUS_10910 9828 10751 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937641.1 protein_id gnl|my_center|LOCUS_10910 10748 12028 gene locus_tag LOCUS_10920 10748 12028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 12305 12607 gene locus_tag LOCUS_10930 12305 12607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 13328 12687 gene locus_tag LOCUS_10940 13328 12687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 13546 13740 gene locus_tag LOCUS_10950 13546 13740 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937612.1 protein_id gnl|my_center|LOCUS_10950 14795 13824 gene locus_tag LOCUS_10960 14795 13824 CDS product nickel transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389506.1 protein_id gnl|my_center|LOCUS_10960 14926 14732 gene locus_tag LOCUS_10970 14926 14732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 15701 15108 gene locus_tag LOCUS_10980 15701 15108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 16160 16435 gene locus_tag LOCUS_10990 16160 16435 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937611.1 protein_id gnl|my_center|LOCUS_10990 16486 16824 gene locus_tag LOCUS_11000 16486 16824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937610.1 protein_id gnl|my_center|LOCUS_11000 17113 17577 gene locus_tag LOCUS_11010 17113 17577 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937609.1 protein_id gnl|my_center|LOCUS_11010 17634 19289 gene locus_tag LOCUS_11020 17634 19289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 19622 20422 gene locus_tag LOCUS_11030 19622 20422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 21856 20477 gene locus_tag LOCUS_11040 21856 20477 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_11040 23351 21861 gene locus_tag LOCUS_11050 23351 21861 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791433.1 protein_id gnl|my_center|LOCUS_11050 24723 23353 gene locus_tag LOCUS_11060 24723 23353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940480.1 protein_id gnl|my_center|LOCUS_11060 26036 24864 gene locus_tag LOCUS_11070 26036 24864 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940481.1 protein_id gnl|my_center|LOCUS_11070 26180 26944 gene locus_tag LOCUS_11080 gene sfsA 26180 26944 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940482.1 protein_id gnl|my_center|LOCUS_11080 28406 27054 gene locus_tag LOCUS_11090 28406 27054 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937602.1 protein_id gnl|my_center|LOCUS_11090 30322 28502 gene locus_tag LOCUS_11100 30322 28502 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629599.1 protein_id gnl|my_center|LOCUS_11100 30572 32146 gene locus_tag LOCUS_11110 30572 32146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 33822 32371 gene locus_tag LOCUS_11120 gene thrC 33822 32371 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791440.1 protein_id gnl|my_center|LOCUS_11120 34427 33822 gene locus_tag LOCUS_11130 34427 33822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 36514 34436 gene locus_tag LOCUS_11140 36514 34436 CDS product ribonuclease catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940465.1 protein_id gnl|my_center|LOCUS_11140 37993 36695 gene locus_tag LOCUS_11150 37993 36695 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791443.1 protein_id gnl|my_center|LOCUS_11150 38225 38605 gene locus_tag LOCUS_11160 38225 38605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940662.1 protein_id gnl|my_center|LOCUS_11160 39949 38522 gene locus_tag LOCUS_11170 39949 38522 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940463.1 protein_id gnl|my_center|LOCUS_11170 40193 41473 gene locus_tag LOCUS_11180 40193 41473 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940462.1 protein_id gnl|my_center|LOCUS_11180 41649 42656 gene locus_tag LOCUS_11190 41649 42656 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940461.1 protein_id gnl|my_center|LOCUS_11190 42988 43800 gene locus_tag LOCUS_11200 42988 43800 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937422.1 protein_id gnl|my_center|LOCUS_11200 43811 45367 gene locus_tag LOCUS_11210 43811 45367 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793125.1 protein_id gnl|my_center|LOCUS_11210 45715 45437 gene locus_tag LOCUS_11220 45715 45437 CDS product DUF4911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294687.1 protein_id gnl|my_center|LOCUS_11220 46181 47143 gene locus_tag LOCUS_11230 46181 47143 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_11230 47269 47766 gene locus_tag LOCUS_11240 47269 47766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940538.1 protein_id gnl|my_center|LOCUS_11240 48535 48002 gene locus_tag LOCUS_11250 gene pal 48535 48002 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940363.1 protein_id gnl|my_center|LOCUS_11250 50118 48784 gene locus_tag LOCUS_11260 gene tolB 50118 48784 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524613.1 protein_id gnl|my_center|LOCUS_11260 51147 50176 gene locus_tag LOCUS_11270 51147 50176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 51591 51160 gene locus_tag LOCUS_11280 gene tolR 51591 51160 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940359.1 protein_id gnl|my_center|LOCUS_11280 52311 51601 gene locus_tag LOCUS_11290 gene tolQ 52311 51601 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940358.1 protein_id gnl|my_center|LOCUS_11290 53870 52770 gene locus_tag LOCUS_11300 53870 52770 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705255.1 protein_id gnl|my_center|LOCUS_11300 54240 54001 gene locus_tag LOCUS_11310 54240 54001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 54306 54590 gene locus_tag LOCUS_11320 54306 54590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 54581 54850 gene locus_tag LOCUS_11330 54581 54850 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325581.1 protein_id gnl|my_center|LOCUS_11330 55042 55311 gene locus_tag LOCUS_11340 55042 55311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 55302 55985 gene locus_tag LOCUS_11350 55302 55985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 56282 57610 gene locus_tag LOCUS_11360 56282 57610 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940356.1 protein_id gnl|my_center|LOCUS_11360 58990 57689 gene locus_tag LOCUS_11370 gene eno 58990 57689 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937629.1 protein_id gnl|my_center|LOCUS_11370 59842 59057 gene locus_tag LOCUS_11380 59842 59057 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937628.1 protein_id gnl|my_center|LOCUS_11380 60148 61239 gene locus_tag LOCUS_11390 60148 61239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939755.1 protein_id gnl|my_center|LOCUS_11390 61241 63889 gene locus_tag LOCUS_11400 61241 63889 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015774797.1 protein_id gnl|my_center|LOCUS_11400 64307 65296 gene locus_tag LOCUS_11410 64307 65296 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940217.1 protein_id gnl|my_center|LOCUS_11410 65308 65745 gene locus_tag LOCUS_11420 65308 65745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940218.1 protein_id gnl|my_center|LOCUS_11420 65979 67409 gene locus_tag LOCUS_11430 65979 67409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 67670 69256 gene locus_tag LOCUS_11440 67670 69256 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940375.1 protein_id gnl|my_center|LOCUS_11440 69392 69811 gene locus_tag LOCUS_11450 69392 69811 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705879.1 protein_id gnl|my_center|LOCUS_11450 69847 70566 gene locus_tag LOCUS_11460 69847 70566 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456820.1 protein_id gnl|my_center|LOCUS_11460 72708 70693 gene locus_tag LOCUS_11470 72708 70693 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937894.1 protein_id gnl|my_center|LOCUS_11470 73135 74475 gene locus_tag LOCUS_11480 73135 74475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 75624 74656 gene locus_tag LOCUS_11490 75624 74656 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546386.1 protein_id gnl|my_center|LOCUS_11490 76935 75664 gene locus_tag LOCUS_11500 76935 75664 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545072.1 protein_id gnl|my_center|LOCUS_11500 77210 78898 gene locus_tag LOCUS_11510 77210 78898 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937340.1 protein_id gnl|my_center|LOCUS_11510 79037 79375 gene locus_tag LOCUS_11520 79037 79375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793178.1 protein_id gnl|my_center|LOCUS_11520 79785 79537 gene locus_tag LOCUS_11530 79785 79537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 80488 79814 gene locus_tag LOCUS_11540 80488 79814 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939913.1 protein_id gnl|my_center|LOCUS_11540 81011 82585 gene locus_tag LOCUS_11550 81011 82585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 82870 83217 gene locus_tag LOCUS_11560 82870 83217 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943583.1 protein_id gnl|my_center|LOCUS_11560 83338 84432 gene locus_tag LOCUS_11570 gene acr3 83338 84432 CDS product arsenite efflux transporter Acr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398718.1 protein_id gnl|my_center|LOCUS_11570 86613 84580 gene locus_tag LOCUS_11580 86613 84580 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792407.1 protein_id gnl|my_center|LOCUS_11580 87826 87086 gene locus_tag LOCUS_11590 87826 87086 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_11590 88076 90352 gene locus_tag LOCUS_11600 gene topA 88076 90352 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940644.1 protein_id gnl|my_center|LOCUS_11600 91543 90386 gene locus_tag LOCUS_11610 gene thiL 91543 90386 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937468.1 protein_id gnl|my_center|LOCUS_11610 92053 92979 gene locus_tag LOCUS_11620 92053 92979 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938043.1 protein_id gnl|my_center|LOCUS_11620 93947 92988 gene locus_tag LOCUS_11630 93947 92988 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791454.1 protein_id gnl|my_center|LOCUS_11630 94233 95591 gene locus_tag LOCUS_11640 gene der 94233 95591 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940452.1 protein_id gnl|my_center|LOCUS_11640 97682 95793 gene locus_tag LOCUS_11650 97682 95793 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937324.1 protein_id gnl|my_center|LOCUS_11650 97861 99099 gene locus_tag LOCUS_11660 97861 99099 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053767.1 protein_id gnl|my_center|LOCUS_11660 99139 99816 gene locus_tag LOCUS_11670 99139 99816 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647270.1 protein_id gnl|my_center|LOCUS_11670 102371 100158 gene locus_tag LOCUS_11680 102371 100158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 102557 103447 gene locus_tag LOCUS_11690 102557 103447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 103480 104859 gene locus_tag LOCUS_11700 103480 104859 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940453.1 protein_id gnl|my_center|LOCUS_11700 105055 105813 gene locus_tag LOCUS_11710 105055 105813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 107711 105834 gene locus_tag LOCUS_11720 107711 105834 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_11720 107962 107813 gene locus_tag LOCUS_11730 107962 107813 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976110.1 protein_id gnl|my_center|LOCUS_11730 108420 108007 gene locus_tag LOCUS_11740 108420 108007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 109669 108434 gene locus_tag LOCUS_11750 109669 108434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 110790 109978 gene locus_tag LOCUS_11760 110790 109978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 111264 112610 gene locus_tag LOCUS_11770 111264 112610 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940646.1 protein_id gnl|my_center|LOCUS_11770 113576 112764 gene locus_tag LOCUS_11780 113576 112764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 114147 116330 gene locus_tag LOCUS_11790 114147 116330 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_11790 117126 116500 gene locus_tag LOCUS_11800 117126 116500 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940530.1 protein_id gnl|my_center|LOCUS_11800 117505 117116 gene locus_tag LOCUS_11810 117505 117116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940531.1 protein_id gnl|my_center|LOCUS_11810 118176 117502 gene locus_tag LOCUS_11820 118176 117502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940532.1 protein_id gnl|my_center|LOCUS_11820 118756 118568 gene locus_tag LOCUS_11830 118756 118568 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_11830 120433 118973 gene locus_tag LOCUS_11840 120433 118973 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791400.1 protein_id gnl|my_center|LOCUS_11840 120668 121753 gene locus_tag LOCUS_11850 gene cobT 120668 121753 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940537.1 protein_id gnl|my_center|LOCUS_11850 123329 121932 gene locus_tag LOCUS_11860 123329 121932 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073029.1 protein_id gnl|my_center|LOCUS_11860 123904 123326 gene locus_tag LOCUS_11870 123904 123326 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073028.1 protein_id gnl|my_center|LOCUS_11870 124906 123917 gene locus_tag LOCUS_11880 124906 123917 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073027.1 protein_id gnl|my_center|LOCUS_11880 125359 126012 gene locus_tag LOCUS_11890 125359 126012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 126189 128075 gene locus_tag LOCUS_11900 126189 128075 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940520.1 protein_id gnl|my_center|LOCUS_11900 128088 128876 gene locus_tag LOCUS_11910 128088 128876 CDS product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940521.1 protein_id gnl|my_center|LOCUS_11910 128863 129699 gene locus_tag LOCUS_11920 128863 129699 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940522.1 protein_id gnl|my_center|LOCUS_11920 129759 130304 gene locus_tag LOCUS_11930 129759 130304 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940523.1 protein_id gnl|my_center|LOCUS_11930 130336 131658 gene locus_tag LOCUS_11940 130336 131658 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937721.1 protein_id gnl|my_center|LOCUS_11940 132130 132978 gene locus_tag LOCUS_11950 132130 132978 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939745.1 protein_id gnl|my_center|LOCUS_11950 132965 134389 gene locus_tag LOCUS_11960 gene gltA 132965 134389 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939746.1 protein_id gnl|my_center|LOCUS_11960 134653 135975 gene locus_tag LOCUS_11970 134653 135975 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939741.1 transl_except (pos:135391..135393,aa:Sec) note codon on position 247 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_11970 136011 139094 gene locus_tag LOCUS_11980 136011 139094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:136236..136238,aa:Sec) note codon on position 76 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_11980 139104 139658 gene locus_tag LOCUS_11990 139104 139658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 139655 140635 gene locus_tag LOCUS_12000 139655 140635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12000 140645 141679 gene locus_tag LOCUS_12010 140645 141679 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791853.1 protein_id gnl|my_center|LOCUS_12010 141827 142666 gene locus_tag LOCUS_12020 141827 142666 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_12020 144949 142790 gene locus_tag LOCUS_12030 144949 142790 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939143.1 protein_id gnl|my_center|LOCUS_12030 145478 145167 gene locus_tag LOCUS_12040 145478 145167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 145572 147224 gene locus_tag LOCUS_12050 145572 147224 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_12050 147234 147875 gene locus_tag LOCUS_12060 147234 147875 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_12060 148868 148071 gene locus_tag LOCUS_12070 148868 148071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938012.1 protein_id gnl|my_center|LOCUS_12070 149556 149074 gene locus_tag LOCUS_12080 149556 149074 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088110.1 protein_id gnl|my_center|LOCUS_12080 150027 151373 gene locus_tag LOCUS_12090 gene gdhA 150027 151373 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_12090 152107 151523 gene locus_tag LOCUS_12100 152107 151523 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937663.1 protein_id gnl|my_center|LOCUS_12100 154557 152455 gene locus_tag LOCUS_12110 154557 152455 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939584.1 protein_id gnl|my_center|LOCUS_12110 155843 155016 gene locus_tag LOCUS_12120 155843 155016 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932822.1 protein_id gnl|my_center|LOCUS_12120 157569 156208 gene locus_tag LOCUS_12130 157569 156208 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937379.1 protein_id gnl|my_center|LOCUS_12130 162245 157668 gene locus_tag LOCUS_12140 162245 157668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 163960 162245 gene locus_tag LOCUS_12150 163960 162245 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937381.1 protein_id gnl|my_center|LOCUS_12150 164167 164493 gene locus_tag LOCUS_12160 164167 164493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 164873 164439 gene locus_tag LOCUS_12170 164873 164439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 166387 165014 gene locus_tag LOCUS_12180 166387 165014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 168189 166522 gene locus_tag LOCUS_12190 168189 166522 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940448.1 protein_id gnl|my_center|LOCUS_12190 168342 169682 gene locus_tag LOCUS_12200 168342 169682 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940447.1 protein_id gnl|my_center|LOCUS_12200 170452 169868 gene locus_tag LOCUS_12210 170452 169868 CDS product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338151.1 protein_id gnl|my_center|LOCUS_12210 171030 170731 gene locus_tag LOCUS_12220 171030 170731 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869489.1 protein_id gnl|my_center|LOCUS_12220 172465 171155 gene locus_tag LOCUS_12230 172465 171155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 172924 172613 gene locus_tag LOCUS_12240 172924 172613 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210705.1 protein_id gnl|my_center|LOCUS_12240 173270 172917 gene locus_tag LOCUS_12250 173270 172917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 174385 173357 gene locus_tag LOCUS_12260 gene cydB 174385 173357 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940528.1 protein_id gnl|my_center|LOCUS_12260 175729 174425 gene locus_tag LOCUS_12270 175729 174425 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940529.1 protein_id gnl|my_center|LOCUS_12270 178467 176422 gene locus_tag LOCUS_12280 178467 176422 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937606.1 protein_id gnl|my_center|LOCUS_12280 179083 178367 gene locus_tag LOCUS_12290 179083 178367 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937607.1 protein_id gnl|my_center|LOCUS_12290 179730 180839 gene locus_tag LOCUS_12300 179730 180839 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940459.1 protein_id gnl|my_center|LOCUS_12300 180935 181768 gene locus_tag LOCUS_12310 180935 181768 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940460.1 protein_id gnl|my_center|LOCUS_12310 181856 182239 gene locus_tag LOCUS_12320 181856 182239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 183566 182316 gene locus_tag LOCUS_12330 183566 182316 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_12330 183829 183563 gene locus_tag LOCUS_12340 183829 183563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 183841 185082 gene locus_tag LOCUS_12350 183841 185082 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940443.1 protein_id gnl|my_center|LOCUS_12350 187451 185442 gene locus_tag LOCUS_12360 187451 185442 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940570.1 protein_id gnl|my_center|LOCUS_12360 187760 188578 gene locus_tag LOCUS_12370 187760 188578 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940571.1 protein_id gnl|my_center|LOCUS_12370 188814 189734 gene locus_tag LOCUS_12380 188814 189734 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940572.1 protein_id gnl|my_center|LOCUS_12380 190074 190988 gene locus_tag LOCUS_12390 190074 190988 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943443.1 protein_id gnl|my_center|LOCUS_12390 192187 191174 gene locus_tag LOCUS_12400 192187 191174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 193459 192359 gene locus_tag LOCUS_12410 193459 192359 CDS product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974532.1 protein_id gnl|my_center|LOCUS_12410 194446 193625 gene locus_tag LOCUS_12420 gene aroE 194446 193625 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937426.1 protein_id gnl|my_center|LOCUS_12420 195006 194611 gene locus_tag LOCUS_12430 gene siaC 195006 194611 CDS product biofilm formation regulator SiaD modulator protein SiaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083913.1 protein_id gnl|my_center|LOCUS_12430 195546 195022 gene locus_tag LOCUS_12440 gene siaB 195546 195022 CDS product biofilm formation regulator kinase SiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083916.1 protein_id gnl|my_center|LOCUS_12440 196795 195563 gene locus_tag LOCUS_12450 196795 195563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 197556 196792 gene locus_tag LOCUS_12460 197556 196792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 198906 198022 gene locus_tag LOCUS_12470 gene hisG 198906 198022 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937425.1 protein_id gnl|my_center|LOCUS_12470 199322 198906 gene locus_tag LOCUS_12480 gene hisI 199322 198906 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937424.1 protein_id gnl|my_center|LOCUS_12480 200588 199470 gene locus_tag LOCUS_12490 gene tsaA 200588 199470 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937469.1 protein_id gnl|my_center|LOCUS_12490 201071 203557 gene locus_tag LOCUS_12500 201071 203557 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044884.1 protein_id gnl|my_center|LOCUS_12500 203588 204976 gene locus_tag LOCUS_12510 203588 204976 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941505.1 protein_id gnl|my_center|LOCUS_12510 205282 206064 gene locus_tag LOCUS_12520 205282 206064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 206421 206798 gene locus_tag LOCUS_12530 206421 206798 CDS product PA2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939881.1 protein_id gnl|my_center|LOCUS_12530 206806 207402 gene locus_tag LOCUS_12540 206806 207402 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939882.1 protein_id gnl|my_center|LOCUS_12540 207399 207896 gene locus_tag LOCUS_12550 207399 207896 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791740.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence07 533 1177 gene locus_tag LOCUS_12560 533 1177 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939849.1 protein_id gnl|my_center|LOCUS_12560 1571 1404 gene locus_tag LOCUS_12570 1571 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1554 4958 gene locus_tag LOCUS_12580 1554 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 5283 5864 gene locus_tag LOCUS_12590 5283 5864 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939852.1 protein_id gnl|my_center|LOCUS_12590 6035 8080 gene locus_tag LOCUS_12600 6035 8080 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941958.1 protein_id gnl|my_center|LOCUS_12600 8910 8155 gene locus_tag LOCUS_12610 8910 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 9887 8907 gene locus_tag LOCUS_12620 9887 8907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 10396 9884 gene locus_tag LOCUS_12630 10396 9884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 12087 10393 gene locus_tag LOCUS_12640 12087 10393 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939873.1 protein_id gnl|my_center|LOCUS_12640 12318 12091 gene locus_tag LOCUS_12650 12318 12091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791744.1 protein_id gnl|my_center|LOCUS_12650 12334 12534 gene locus_tag LOCUS_12660 12334 12534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 12597 12914 gene locus_tag LOCUS_12670 12597 12914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 14197 13049 gene locus_tag LOCUS_12680 gene icd 14197 13049 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937784.1 protein_id gnl|my_center|LOCUS_12680 14699 17233 gene locus_tag LOCUS_12690 14699 17233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 17819 18973 gene locus_tag LOCUS_12700 17819 18973 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868793.1 protein_id gnl|my_center|LOCUS_12700 18970 20883 gene locus_tag LOCUS_12710 18970 20883 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048118.1 protein_id gnl|my_center|LOCUS_12710 21015 21581 gene locus_tag LOCUS_12720 21015 21581 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940325.1 protein_id gnl|my_center|LOCUS_12720 21591 23243 gene locus_tag LOCUS_12730 21591 23243 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940324.1 protein_id gnl|my_center|LOCUS_12730 24691 23345 gene locus_tag LOCUS_12740 24691 23345 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216257.1 protein_id gnl|my_center|LOCUS_12740 25696 25094 gene locus_tag LOCUS_12750 25696 25094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 27212 25689 gene locus_tag LOCUS_12760 27212 25689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939880.1 protein_id gnl|my_center|LOCUS_12760 28998 27670 gene locus_tag LOCUS_12770 28998 27670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 30042 29083 gene locus_tag LOCUS_12780 30042 29083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 30774 30478 gene locus_tag LOCUS_12790 30774 30478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 30682 31071 gene locus_tag LOCUS_12800 30682 31071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12800 31172 31990 gene locus_tag LOCUS_12810 31172 31990 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939259.1 protein_id gnl|my_center|LOCUS_12810 32060 33187 gene locus_tag LOCUS_12820 32060 33187 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939260.1 protein_id gnl|my_center|LOCUS_12820 33923 33348 gene locus_tag LOCUS_12830 33923 33348 CDS product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791734.1 protein_id gnl|my_center|LOCUS_12830 34207 33920 gene locus_tag LOCUS_12840 34207 33920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 34772 34194 gene locus_tag LOCUS_12850 34772 34194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 35703 35146 gene locus_tag LOCUS_12860 35703 35146 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939897.1 protein_id gnl|my_center|LOCUS_12860 36417 36953 gene locus_tag LOCUS_12870 36417 36953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 37075 39516 gene locus_tag LOCUS_12880 37075 39516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 40758 39595 gene locus_tag LOCUS_12890 40758 39595 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939604.1 protein_id gnl|my_center|LOCUS_12890 43999 41144 gene locus_tag LOCUS_12900 43999 41144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 44134 44445 gene locus_tag LOCUS_12910 44134 44445 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939908.1 protein_id gnl|my_center|LOCUS_12910 44607 44359 gene locus_tag LOCUS_12920 44607 44359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 46672 44588 gene locus_tag LOCUS_12930 46672 44588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 47819 46656 gene locus_tag LOCUS_12940 47819 46656 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939815.1 protein_id gnl|my_center|LOCUS_12940 48836 47907 gene locus_tag LOCUS_12950 48836 47907 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940569.1 protein_id gnl|my_center|LOCUS_12950 49189 48929 gene locus_tag LOCUS_12960 49189 48929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 49290 49694 gene locus_tag LOCUS_12970 49290 49694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 51054 49945 gene locus_tag LOCUS_12980 51054 49945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 53093 51387 gene locus_tag LOCUS_12990 gene recJ 53093 51387 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938203.1 protein_id gnl|my_center|LOCUS_12990 54073 53198 gene locus_tag LOCUS_13000 54073 53198 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938202.1 protein_id gnl|my_center|LOCUS_13000 55296 54241 gene locus_tag LOCUS_13010 55296 54241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 56032 55334 gene locus_tag LOCUS_13020 gene pyrF 56032 55334 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938200.1 protein_id gnl|my_center|LOCUS_13020 56711 56025 gene locus_tag LOCUS_13030 gene gmk 56711 56025 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938199.1 protein_id gnl|my_center|LOCUS_13030 56965 56711 gene locus_tag LOCUS_13040 56965 56711 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938198.1 protein_id gnl|my_center|LOCUS_13040 57818 56973 gene locus_tag LOCUS_13050 57818 56973 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938197.1 protein_id gnl|my_center|LOCUS_13050 59698 58235 gene locus_tag LOCUS_13060 59698 58235 CDS product MiaB/RimO family radical SAM methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938196.1 protein_id gnl|my_center|LOCUS_13060 61431 59932 gene locus_tag LOCUS_13070 61431 59932 CDS product NlpC/P60 family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524287.1 protein_id gnl|my_center|LOCUS_13070 61973 61551 gene locus_tag LOCUS_13080 61973 61551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 63040 62111 gene locus_tag LOCUS_13090 63040 62111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 63289 63597 gene locus_tag LOCUS_13100 63289 63597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143154841.1 protein_id gnl|my_center|LOCUS_13100 63588 64037 gene locus_tag LOCUS_13110 63588 64037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 64350 64934 gene locus_tag LOCUS_13120 64350 64934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 64951 65445 gene locus_tag LOCUS_13130 64951 65445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 65442 65765 gene locus_tag LOCUS_13140 65442 65765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 66504 65995 gene locus_tag LOCUS_13150 66504 65995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791839.1 protein_id gnl|my_center|LOCUS_13150 67956 66733 gene locus_tag LOCUS_13160 67956 66733 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294622.1 protein_id gnl|my_center|LOCUS_13160 68605 68243 gene locus_tag LOCUS_13170 68605 68243 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939713.1 protein_id gnl|my_center|LOCUS_13170 69061 68618 gene locus_tag LOCUS_13180 69061 68618 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939712.1 protein_id gnl|my_center|LOCUS_13180 69328 70227 gene locus_tag LOCUS_13190 69328 70227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791835.1 protein_id gnl|my_center|LOCUS_13190 70361 71605 gene locus_tag LOCUS_13200 70361 71605 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939710.1 protein_id gnl|my_center|LOCUS_13200 71602 72372 gene locus_tag LOCUS_13210 71602 72372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141998.1 protein_id gnl|my_center|LOCUS_13210 73042 73206 gene locus_tag LOCUS_13220 73042 73206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 73220 74827 gene locus_tag LOCUS_13230 73220 74827 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877458.1 protein_id gnl|my_center|LOCUS_13230 74929 76536 gene locus_tag LOCUS_13240 74929 76536 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877458.1 protein_id gnl|my_center|LOCUS_13240 76698 77987 gene locus_tag LOCUS_13250 76698 77987 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_13250 77987 79213 gene locus_tag LOCUS_13260 77987 79213 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939709.1 protein_id gnl|my_center|LOCUS_13260 79241 80137 gene locus_tag LOCUS_13270 79241 80137 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402843.1 protein_id gnl|my_center|LOCUS_13270 80134 80556 gene locus_tag LOCUS_13280 80134 80556 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 protein_id gnl|my_center|LOCUS_13280 80722 81150 gene locus_tag LOCUS_13290 80722 81150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 83422 81269 gene locus_tag LOCUS_13300 83422 81269 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791356.1 protein_id gnl|my_center|LOCUS_13300 84020 83565 gene locus_tag LOCUS_13310 84020 83565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 84223 84023 gene locus_tag LOCUS_13320 84223 84023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 84644 85432 gene locus_tag LOCUS_13330 84644 85432 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_13330 85972 85628 gene locus_tag LOCUS_13340 85972 85628 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938183.1 protein_id gnl|my_center|LOCUS_13340 86232 85969 gene locus_tag LOCUS_13350 86232 85969 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938182.1 protein_id gnl|my_center|LOCUS_13350 86860 86363 gene locus_tag LOCUS_13360 86860 86363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 87221 89281 gene locus_tag LOCUS_13370 87221 89281 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938180.1 protein_id gnl|my_center|LOCUS_13370 89450 90193 gene locus_tag LOCUS_13380 89450 90193 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_13380 90169 91827 gene locus_tag LOCUS_13390 90169 91827 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938175.1 protein_id gnl|my_center|LOCUS_13390 91940 92722 gene locus_tag LOCUS_13400 91940 92722 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938174.1 protein_id gnl|my_center|LOCUS_13400 92942 93721 gene locus_tag LOCUS_13410 gene rpsB 92942 93721 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938173.1 protein_id gnl|my_center|LOCUS_13410 93742 94563 gene locus_tag LOCUS_13420 gene tsf 93742 94563 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938172.1 protein_id gnl|my_center|LOCUS_13420 94775 95956 gene locus_tag LOCUS_13430 94775 95956 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_13430 95953 96783 gene locus_tag LOCUS_13440 95953 96783 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938171.1 protein_id gnl|my_center|LOCUS_13440 96854 97570 gene locus_tag LOCUS_13450 gene pyrH 96854 97570 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938170.1 protein_id gnl|my_center|LOCUS_13450 97576 98130 gene locus_tag LOCUS_13460 gene frr 97576 98130 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_13460 98359 98919 gene locus_tag LOCUS_13470 98359 98919 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937870.1 protein_id gnl|my_center|LOCUS_13470 99000 100019 gene locus_tag LOCUS_13480 gene gap 99000 100019 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937869.1 protein_id gnl|my_center|LOCUS_13480 100136 100597 gene locus_tag LOCUS_13490 100136 100597 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939765.1 protein_id gnl|my_center|LOCUS_13490 100934 102442 gene locus_tag LOCUS_13500 100934 102442 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061775.1 protein_id gnl|my_center|LOCUS_13500 104214 102892 gene locus_tag LOCUS_13510 gene ftsZ 104214 102892 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939769.1 protein_id gnl|my_center|LOCUS_13510 105522 104296 gene locus_tag LOCUS_13520 gene ftsA 105522 104296 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939770.1 protein_id gnl|my_center|LOCUS_13520 106273 105548 gene locus_tag LOCUS_13530 106273 105548 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294677.1 protein_id gnl|my_center|LOCUS_13530 107286 106390 gene locus_tag LOCUS_13540 gene murB 107286 106390 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939772.1 protein_id gnl|my_center|LOCUS_13540 108660 107299 gene locus_tag LOCUS_13550 gene murC 108660 107299 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939773.1 protein_id gnl|my_center|LOCUS_13550 109790 108678 gene locus_tag LOCUS_13560 gene murG 109790 108678 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939774.1 protein_id gnl|my_center|LOCUS_13560 110905 109787 gene locus_tag LOCUS_13570 gene ftsW 110905 109787 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791803.1 protein_id gnl|my_center|LOCUS_13570 112239 110902 gene locus_tag LOCUS_13580 gene murD 112239 110902 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939776.1 protein_id gnl|my_center|LOCUS_13580 113341 112265 gene locus_tag LOCUS_13590 gene mraY 113341 112265 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939777.1 protein_id gnl|my_center|LOCUS_13590 114767 113331 gene locus_tag LOCUS_13600 gene murF 114767 113331 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939778.1 protein_id gnl|my_center|LOCUS_13600 116212 114764 gene locus_tag LOCUS_13610 116212 114764 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939779.1 protein_id gnl|my_center|LOCUS_13610 118301 116214 gene locus_tag LOCUS_13620 118301 116214 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939780.1 protein_id gnl|my_center|LOCUS_13620 118641 118342 gene locus_tag LOCUS_13630 118641 118342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939781.1 protein_id gnl|my_center|LOCUS_13630 119627 118650 gene locus_tag LOCUS_13640 gene rsmH 119627 118650 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939782.1 protein_id gnl|my_center|LOCUS_13640 120161 119817 gene locus_tag LOCUS_13650 120161 119817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 120435 121847 gene locus_tag LOCUS_13660 gene pyk 120435 121847 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939784.1 protein_id gnl|my_center|LOCUS_13660 121849 122946 gene locus_tag LOCUS_13670 121849 122946 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939785.1 protein_id gnl|my_center|LOCUS_13670 123656 123174 gene locus_tag LOCUS_13680 123656 123174 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939786.1 protein_id gnl|my_center|LOCUS_13680 124990 123749 gene locus_tag LOCUS_13690 124990 123749 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939787.1 protein_id gnl|my_center|LOCUS_13690 125359 125793 gene locus_tag LOCUS_13700 gene rplM 125359 125793 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939788.1 protein_id gnl|my_center|LOCUS_13700 125816 126208 gene locus_tag LOCUS_13710 gene rpsI 125816 126208 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939789.1 protein_id gnl|my_center|LOCUS_13710 126454 127089 gene locus_tag LOCUS_13720 gene thrB 126454 127089 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939791.1 protein_id gnl|my_center|LOCUS_13720 127086 127694 gene locus_tag LOCUS_13730 127086 127694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939792.1 protein_id gnl|my_center|LOCUS_13730 127715 128206 gene locus_tag LOCUS_13740 127715 128206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 128355 128990 gene locus_tag LOCUS_13750 128355 128990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 129395 129003 gene locus_tag LOCUS_13760 129395 129003 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939797.1 protein_id gnl|my_center|LOCUS_13760 131196 129769 gene locus_tag LOCUS_13770 gene gatB 131196 129769 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939171.1 protein_id gnl|my_center|LOCUS_13770 132114 131440 gene locus_tag LOCUS_13780 132114 131440 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939172.1 protein_id gnl|my_center|LOCUS_13780 133921 132176 gene locus_tag LOCUS_13790 133921 132176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939173.1 protein_id gnl|my_center|LOCUS_13790 134913 134065 gene locus_tag LOCUS_13800 134913 134065 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939174.1 protein_id gnl|my_center|LOCUS_13800 135143 135778 gene locus_tag LOCUS_13810 135143 135778 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939175.1 protein_id gnl|my_center|LOCUS_13810 135891 136130 gene locus_tag LOCUS_13820 135891 136130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 136184 137131 gene locus_tag LOCUS_13830 gene hemC 136184 137131 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939176.1 protein_id gnl|my_center|LOCUS_13830 137182 138261 gene locus_tag LOCUS_13840 gene rsgA 137182 138261 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458373.1 protein_id gnl|my_center|LOCUS_13840 138832 141249 gene locus_tag LOCUS_13850 138832 141249 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792622.1 protein_id gnl|my_center|LOCUS_13850 143474 141333 gene locus_tag LOCUS_13860 143474 141333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 143715 145250 gene locus_tag LOCUS_13870 143715 145250 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_13870 146001 145339 gene locus_tag LOCUS_13880 gene lepB 146001 145339 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938005.1 protein_id gnl|my_center|LOCUS_13880 147875 146070 gene locus_tag LOCUS_13890 gene lepA 147875 146070 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938004.1 protein_id gnl|my_center|LOCUS_13890 149476 148145 gene locus_tag LOCUS_13900 149476 148145 CDS product radical SAM/SPASM family putative metalloenzyme maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176675.1 protein_id gnl|my_center|LOCUS_13900 149967 150689 gene locus_tag LOCUS_13910 149967 150689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 151046 151963 gene locus_tag LOCUS_13920 151046 151963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 153175 151973 gene locus_tag LOCUS_13930 153175 151973 CDS product LarC family nickel insertion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940038.1 protein_id gnl|my_center|LOCUS_13930 153761 154441 gene locus_tag LOCUS_13940 153761 154441 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_13940 154858 155175 gene locus_tag LOCUS_13950 154858 155175 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940042.1 protein_id gnl|my_center|LOCUS_13950 155715 155440 gene locus_tag LOCUS_13960 155715 155440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 157235 155997 gene locus_tag LOCUS_13970 157235 155997 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940045.1 protein_id gnl|my_center|LOCUS_13970 160824 157612 gene locus_tag LOCUS_13980 160824 157612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 161910 161194 gene locus_tag LOCUS_13990 161910 161194 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524570.1 protein_id gnl|my_center|LOCUS_13990 162252 163619 gene locus_tag LOCUS_14000 162252 163619 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 protein_id gnl|my_center|LOCUS_14000 163616 166762 gene locus_tag LOCUS_14010 163616 166762 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 protein_id gnl|my_center|LOCUS_14010 167436 166810 gene locus_tag LOCUS_14020 gene rdgB 167436 166810 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940412.1 protein_id gnl|my_center|LOCUS_14020 169108 167390 gene locus_tag LOCUS_14030 169108 167390 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940410.1 protein_id gnl|my_center|LOCUS_14030 169240 170532 gene locus_tag LOCUS_14040 gene rimO 169240 170532 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940409.1 protein_id gnl|my_center|LOCUS_14040 170864 172579 gene locus_tag LOCUS_14050 170864 172579 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940408.1 protein_id gnl|my_center|LOCUS_14050 172566 173477 gene locus_tag LOCUS_14060 gene sppA 172566 173477 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940407.1 protein_id gnl|my_center|LOCUS_14060 173704 173468 gene locus_tag LOCUS_14070 173704 173468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 173670 174647 gene locus_tag LOCUS_14080 173670 174647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 174850 176352 gene locus_tag LOCUS_14090 gene malQ 174850 176352 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940406.1 protein_id gnl|my_center|LOCUS_14090 176394 177635 gene locus_tag LOCUS_14100 176394 177635 CDS product 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791484.1 protein_id gnl|my_center|LOCUS_14100 179095 177713 gene locus_tag LOCUS_14110 179095 177713 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937697.1 protein_id gnl|my_center|LOCUS_14110 179800 179135 gene locus_tag LOCUS_14120 179800 179135 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937696.1 protein_id gnl|my_center|LOCUS_14120 180561 179800 gene locus_tag LOCUS_14130 180561 179800 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937695.1 protein_id gnl|my_center|LOCUS_14130 181238 180573 gene locus_tag LOCUS_14140 181238 180573 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937694.1 protein_id gnl|my_center|LOCUS_14140 182155 181397 gene locus_tag LOCUS_14150 182155 181397 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937693.1 protein_id gnl|my_center|LOCUS_14150 182502 183074 gene locus_tag LOCUS_14160 182502 183074 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937691.1 protein_id gnl|my_center|LOCUS_14160 183267 184103 gene locus_tag LOCUS_14170 gene mscS 183267 184103 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 protein_id gnl|my_center|LOCUS_14170 185115 184168 gene locus_tag LOCUS_14180 185115 184168 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705146.1 protein_id gnl|my_center|LOCUS_14180 186639 185446 gene locus_tag LOCUS_14190 186639 185446 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966323.1 protein_id gnl|my_center|LOCUS_14190 187061 187942 gene locus_tag LOCUS_14200 187061 187942 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937880.1 protein_id gnl|my_center|LOCUS_14200 187944 188681 gene locus_tag LOCUS_14210 187944 188681 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937881.1 protein_id gnl|my_center|LOCUS_14210 188678 189295 gene locus_tag LOCUS_14220 188678 189295 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937882.1 protein_id gnl|my_center|LOCUS_14220 189292 190329 gene locus_tag LOCUS_14230 gene moaA 189292 190329 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937883.1 protein_id gnl|my_center|LOCUS_14230 191184 190429 gene locus_tag LOCUS_14240 191184 190429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938151.1 protein_id gnl|my_center|LOCUS_14240 192437 191271 gene locus_tag LOCUS_14250 gene qmoC 192437 191271 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938150.1 protein_id gnl|my_center|LOCUS_14250 194700 192451 gene locus_tag LOCUS_14260 194700 192451 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938149.1 protein_id gnl|my_center|LOCUS_14260 195945 194707 gene locus_tag LOCUS_14270 195945 194707 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938148.1 protein_id gnl|my_center|LOCUS_14270 198115 196118 gene locus_tag LOCUS_14280 gene aprA 198115 196118 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938147.1 protein_id gnl|my_center|LOCUS_14280 198653 198165 gene locus_tag LOCUS_14290 gene aprB 198653 198165 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938146.1 protein_id gnl|my_center|LOCUS_14290 199432 201036 gene locus_tag LOCUS_14300 199432 201036 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938144.1 protein_id gnl|my_center|LOCUS_14300 200999 201256 gene locus_tag LOCUS_14310 200999 201256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524279.1 protein_id gnl|my_center|LOCUS_14310 201678 203288 gene locus_tag LOCUS_14320 201678 203288 CDS product outer membrane homotrimeric porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938100.1 protein_id gnl|my_center|LOCUS_14320 203635 204954 gene locus_tag LOCUS_14330 gene hisD 203635 204954 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938097.1 protein_id gnl|my_center|LOCUS_14330 204959 205855 gene locus_tag LOCUS_14340 204959 205855 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938096.1 protein_id gnl|my_center|LOCUS_14340 205954 206724 gene locus_tag LOCUS_14350 205954 206724 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938095.1 protein_id gnl|my_center|LOCUS_14350 207081 207173 gene locus_tag LOCUS_t00220 207081 207173 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 207559 207651 gene locus_tag LOCUS_t00230 207559 207651 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 208487 207726 gene locus_tag LOCUS_14360 208487 207726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 208897 208562 gene locus_tag LOCUS_14370 208897 208562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 209662 208955 gene locus_tag LOCUS_14380 209662 208955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 209912 211327 gene locus_tag LOCUS_14390 209912 211327 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938056.1 protein_id gnl|my_center|LOCUS_14390 211639 212370 gene locus_tag LOCUS_14400 211639 212370 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938054.1 protein_id gnl|my_center|LOCUS_14400 212471 213295 gene locus_tag LOCUS_14410 212471 213295 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938053.1 protein_id gnl|my_center|LOCUS_14410 213555 215354 gene locus_tag LOCUS_14420 213555 215354 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938052.1 protein_id gnl|my_center|LOCUS_14420 215902 217761 gene locus_tag LOCUS_14430 215902 217761 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294605.1 protein_id gnl|my_center|LOCUS_14430 217930 218700 gene locus_tag LOCUS_14440 217930 218700 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707741.1 protein_id gnl|my_center|LOCUS_14440 218889 219863 gene locus_tag LOCUS_14450 218889 219863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 219910 220398 gene locus_tag LOCUS_14460 219910 220398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 221642 220401 gene locus_tag LOCUS_14470 221642 220401 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075901854.1 protein_id gnl|my_center|LOCUS_14470 222932 221694 gene locus_tag LOCUS_14480 222932 221694 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_14480 223806 223228 gene locus_tag LOCUS_14490 223806 223228 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_14490 224516 224052 gene locus_tag LOCUS_14500 224516 224052 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939700.1 protein_id gnl|my_center|LOCUS_14500 224983 226587 gene locus_tag LOCUS_14510 gene nikA 224983 226587 CDS product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389932.1 protein_id gnl|my_center|LOCUS_14510 226598 227542 gene locus_tag LOCUS_14520 gene nikB 226598 227542 CDS product nickel ABC transporter permease subunit NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389931.1 protein_id gnl|my_center|LOCUS_14520 227539 228390 gene locus_tag LOCUS_14530 gene nikC 227539 228390 CDS product nickel ABC transporter permease subunit NikC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389930.1 protein_id gnl|my_center|LOCUS_14530 228387 229274 gene locus_tag LOCUS_14540 gene nikD 228387 229274 CDS product nickel import ATP-binding protein NikD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136250.1 protein_id gnl|my_center|LOCUS_14540 229293 230111 gene locus_tag LOCUS_14550 gene nikE 229293 230111 CDS product nickel import ATP-binding protein NikE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389928.1 protein_id gnl|my_center|LOCUS_14550 231403 230366 gene locus_tag LOCUS_14560 231403 230366 CDS product multidrug resistance efflux transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940923.1 protein_id gnl|my_center|LOCUS_14560 231808 232611 gene locus_tag LOCUS_14570 231808 232611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 233908 232712 gene locus_tag LOCUS_14580 233908 232712 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_14580 235561 234122 gene locus_tag LOCUS_14590 235561 234122 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938245.1 protein_id gnl|my_center|LOCUS_14590 238022 235581 gene locus_tag LOCUS_14600 238022 235581 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938244.1 protein_id gnl|my_center|LOCUS_14600 238380 238114 gene locus_tag LOCUS_14610 238380 238114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 240211 238469 gene locus_tag LOCUS_14620 240211 238469 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524295.1 protein_id gnl|my_center|LOCUS_14620 240649 240735 gene locus_tag LOCUS_t00240 240649 240735 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 240910 241542 gene locus_tag LOCUS_14630 240910 241542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 242688 241603 gene locus_tag LOCUS_14640 242688 241603 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294604.1 protein_id gnl|my_center|LOCUS_14640 243264 242704 gene locus_tag LOCUS_14650 gene yfcE 243264 242704 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937963.1 protein_id gnl|my_center|LOCUS_14650 243651 243283 gene locus_tag LOCUS_14660 243651 243283 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937961.1 protein_id gnl|my_center|LOCUS_14660 244226 243819 gene locus_tag LOCUS_14670 244226 243819 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937960.1 protein_id gnl|my_center|LOCUS_14670 244545 244324 gene locus_tag LOCUS_14680 244545 244324 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937959.1 protein_id gnl|my_center|LOCUS_14680 244923 245789 gene locus_tag LOCUS_14690 244923 245789 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_14690 245891 247342 gene locus_tag LOCUS_14700 245891 247342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 247457 249037 gene locus_tag LOCUS_14710 247457 249037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 249041 251383 gene locus_tag LOCUS_14720 249041 251383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 253021 252080 gene locus_tag LOCUS_14730 253021 252080 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937955.1 protein_id gnl|my_center|LOCUS_14730 253872 253243 gene locus_tag LOCUS_14740 253872 253243 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190275056.1 protein_id gnl|my_center|LOCUS_14740 254390 255487 gene locus_tag LOCUS_14750 254390 255487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937954.1 protein_id gnl|my_center|LOCUS_14750 255914 256819 gene locus_tag LOCUS_14760 255914 256819 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937953.1 protein_id gnl|my_center|LOCUS_14760 256859 257956 gene locus_tag LOCUS_14770 256859 257956 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937952.1 protein_id gnl|my_center|LOCUS_14770 257953 258933 gene locus_tag LOCUS_14780 257953 258933 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937951.1 protein_id gnl|my_center|LOCUS_14780 258926 260233 gene locus_tag LOCUS_14790 258926 260233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 260235 260984 gene locus_tag LOCUS_14800 gene cobI 260235 260984 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937949.1 protein_id gnl|my_center|LOCUS_14800 261571 261236 gene locus_tag LOCUS_14810 261571 261236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 262692 261790 gene locus_tag LOCUS_14820 262692 261790 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941492.1 protein_id gnl|my_center|LOCUS_14820 263897 262935 gene locus_tag LOCUS_14830 263897 262935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937598.1 protein_id gnl|my_center|LOCUS_14830 264973 263882 gene locus_tag LOCUS_14840 264973 263882 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937599.1 protein_id gnl|my_center|LOCUS_14840 265271 265603 gene locus_tag LOCUS_14850 265271 265603 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937600.1 protein_id gnl|my_center|LOCUS_14850 265728 265937 gene locus_tag LOCUS_14860 265728 265937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939510.1 protein_id gnl|my_center|LOCUS_14860 268587 266827 gene locus_tag LOCUS_14870 268587 266827 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_14870 268824 269129 gene locus_tag LOCUS_14880 268824 269129 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940377.1 protein_id gnl|my_center|LOCUS_14880 269446 269886 gene locus_tag LOCUS_14890 269446 269886 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939949.1 protein_id gnl|my_center|LOCUS_14890 270432 270187 gene locus_tag LOCUS_14900 270432 270187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 270350 270997 gene locus_tag LOCUS_14910 270350 270997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 271012 271920 gene locus_tag LOCUS_14920 271012 271920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14920 271904 272530 gene locus_tag LOCUS_14930 271904 272530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14930 272758 273867 gene locus_tag LOCUS_14940 272758 273867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 274148 274381 gene locus_tag LOCUS_14950 274148 274381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 274550 275986 gene locus_tag LOCUS_14960 274550 275986 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937922.1 protein_id gnl|my_center|LOCUS_14960 276255 277589 gene locus_tag LOCUS_14970 276255 277589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 277580 278680 gene locus_tag LOCUS_14980 277580 278680 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838603.1 protein_id gnl|my_center|LOCUS_14980 278683 279819 gene locus_tag LOCUS_14990 278683 279819 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327978.1 protein_id gnl|my_center|LOCUS_14990 279898 280863 gene locus_tag LOCUS_15000 279898 280863 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886400.1 protein_id gnl|my_center|LOCUS_15000 280868 281941 gene locus_tag LOCUS_15010 280868 281941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 281998 282504 gene locus_tag LOCUS_15020 281998 282504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 282527 284413 gene locus_tag LOCUS_15030 282527 284413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 284653 284420 gene locus_tag LOCUS_15040 284653 284420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940206.1 protein_id gnl|my_center|LOCUS_15040 285972 284695 gene locus_tag LOCUS_15050 285972 284695 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_15050 286508 286005 gene locus_tag LOCUS_15060 286508 286005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 286556 287743 gene locus_tag LOCUS_15070 286556 287743 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948785.1 protein_id gnl|my_center|LOCUS_15070 287940 287864 gene locus_tag LOCUS_t00250 287940 287864 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 288109 288033 gene locus_tag LOCUS_t00260 288109 288033 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 288190 288115 gene locus_tag LOCUS_t00270 288190 288115 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 288862 290334 gene locus_tag LOCUS_15080 288862 290334 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939860.1 protein_id gnl|my_center|LOCUS_15080 291205 290402 gene locus_tag LOCUS_15090 291205 290402 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937844.1 protein_id gnl|my_center|LOCUS_15090 291575 293389 gene locus_tag LOCUS_15100 291575 293389 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940294.1 protein_id gnl|my_center|LOCUS_15100 293484 296510 gene locus_tag LOCUS_15110 293484 296510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 297247 296648 gene locus_tag LOCUS_15120 297247 296648 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940315.1 protein_id gnl|my_center|LOCUS_15120 298719 297250 gene locus_tag LOCUS_15130 298719 297250 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940314.1 protein_id gnl|my_center|LOCUS_15130 299746 298766 gene locus_tag LOCUS_15140 299746 298766 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940313.1 protein_id gnl|my_center|LOCUS_15140 299655 299963 gene locus_tag LOCUS_15150 299655 299963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 300045 300959 gene locus_tag LOCUS_15160 300045 300959 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940312.1 protein_id gnl|my_center|LOCUS_15160 302423 301131 gene locus_tag LOCUS_15170 302423 301131 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937796.1 protein_id gnl|my_center|LOCUS_15170 302603 303871 gene locus_tag LOCUS_15180 gene purD 302603 303871 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937795.1 protein_id gnl|my_center|LOCUS_15180 303917 304420 gene locus_tag LOCUS_15190 gene purE 303917 304420 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937794.1 protein_id gnl|my_center|LOCUS_15190 304601 305038 gene locus_tag LOCUS_15200 304601 305038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 305233 308025 gene locus_tag LOCUS_15210 305233 308025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 308523 310139 gene locus_tag LOCUS_15220 308523 310139 CDS product high-molecular-weight cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524248.1 protein_id gnl|my_center|LOCUS_15220 310154 311263 gene locus_tag LOCUS_15230 310154 311263 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937841.1 protein_id gnl|my_center|LOCUS_15230 311264 312424 gene locus_tag LOCUS_15240 gene nrfD 311264 312424 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937840.1 protein_id gnl|my_center|LOCUS_15240 312443 312586 gene locus_tag LOCUS_15250 312443 312586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937839.1 protein_id gnl|my_center|LOCUS_15250 312626 313306 gene locus_tag LOCUS_15260 312626 313306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937838.1 protein_id gnl|my_center|LOCUS_15260 313330 314724 gene locus_tag LOCUS_15270 313330 314724 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937837.1 protein_id gnl|my_center|LOCUS_15270 314808 315164 gene locus_tag LOCUS_15280 314808 315164 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937568.1 protein_id gnl|my_center|LOCUS_15280 315226 315675 gene locus_tag LOCUS_15290 315226 315675 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937835.1 protein_id gnl|my_center|LOCUS_15290 316110 316613 gene locus_tag LOCUS_15300 gene rimP 316110 316613 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937817.1 protein_id gnl|my_center|LOCUS_15300 316677 317990 gene locus_tag LOCUS_15310 gene nusA 316677 317990 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937816.1 protein_id gnl|my_center|LOCUS_15310 318240 321344 gene locus_tag LOCUS_15320 gene infB 318240 321344 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937814.1 protein_id gnl|my_center|LOCUS_15320 321417 321707 gene locus_tag LOCUS_15330 321417 321707 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937813.1 protein_id gnl|my_center|LOCUS_15330 321715 322719 gene locus_tag LOCUS_15340 321715 322719 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937812.1 protein_id gnl|my_center|LOCUS_15340 322757 323650 gene locus_tag LOCUS_15350 gene truB 322757 323650 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792851.1 protein_id gnl|my_center|LOCUS_15350 323685 323948 gene locus_tag LOCUS_15360 gene rpsO 323685 323948 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409373.1 protein_id gnl|my_center|LOCUS_15360 324136 326388 gene locus_tag LOCUS_15370 gene pnp 324136 326388 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937809.1 protein_id gnl|my_center|LOCUS_15370 326686 326958 gene locus_tag LOCUS_15380 326686 326958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 329007 327088 gene locus_tag LOCUS_15390 gene selB 329007 327088 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937806.1 protein_id gnl|my_center|LOCUS_15390 329373 329768 gene locus_tag LOCUS_15400 329373 329768 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937805.1 protein_id gnl|my_center|LOCUS_15400 331319 329880 gene locus_tag LOCUS_15410 gene ahcY 331319 329880 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937910.1 protein_id gnl|my_center|LOCUS_15410 332267 331344 gene locus_tag LOCUS_15420 332267 331344 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 protein_id gnl|my_center|LOCUS_15420 332608 335484 gene locus_tag LOCUS_15430 332608 335484 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937802.1 protein_id gnl|my_center|LOCUS_15430 335527 336729 gene locus_tag LOCUS_15440 335527 336729 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937801.1 protein_id gnl|my_center|LOCUS_15440 336948 338114 gene locus_tag LOCUS_15450 336948 338114 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937800.1 protein_id gnl|my_center|LOCUS_15450 338163 338480 gene locus_tag LOCUS_15460 338163 338480 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937799.1 protein_id gnl|my_center|LOCUS_15460 338649 339707 gene locus_tag LOCUS_15470 gene argC 338649 339707 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937798.1 protein_id gnl|my_center|LOCUS_15470 341937 339910 gene locus_tag LOCUS_15480 341937 339910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 342878 342732 gene locus_tag LOCUS_15490 342878 342732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 342999 344747 gene locus_tag LOCUS_15500 342999 344747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 345110 346726 gene locus_tag LOCUS_15510 345110 346726 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940219.1 protein_id gnl|my_center|LOCUS_15510 346808 347149 gene locus_tag LOCUS_15520 346808 347149 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940220.1 protein_id gnl|my_center|LOCUS_15520 347146 348858 gene locus_tag LOCUS_15530 347146 348858 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940221.1 protein_id gnl|my_center|LOCUS_15530 348862 349287 gene locus_tag LOCUS_15540 348862 349287 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940222.1 protein_id gnl|my_center|LOCUS_15540 349615 350331 gene locus_tag LOCUS_15550 349615 350331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 350364 350771 gene locus_tag LOCUS_15560 350364 350771 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940225.1 protein_id gnl|my_center|LOCUS_15560 351016 352497 gene locus_tag LOCUS_15570 351016 352497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 352482 353891 gene locus_tag LOCUS_15580 352482 353891 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_15580 354102 354503 gene locus_tag LOCUS_15590 354102 354503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 354500 355942 gene locus_tag LOCUS_15600 354500 355942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 355939 356322 gene locus_tag LOCUS_15610 355939 356322 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940473.1 protein_id gnl|my_center|LOCUS_15610 356482 357717 gene locus_tag LOCUS_15620 356482 357717 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793113.1 protein_id gnl|my_center|LOCUS_15620 357721 358428 gene locus_tag LOCUS_15630 357721 358428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937444.1 protein_id gnl|my_center|LOCUS_15630 358469 361084 gene locus_tag LOCUS_15640 358469 361084 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940472.1 protein_id gnl|my_center|LOCUS_15640 362176 361217 gene locus_tag LOCUS_15650 362176 361217 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102782.1 protein_id gnl|my_center|LOCUS_15650 363259 362288 gene locus_tag LOCUS_15660 gene queF 363259 362288 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526121.1 protein_id gnl|my_center|LOCUS_15660 364020 363361 gene locus_tag LOCUS_15670 gene queC 364020 363361 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061849.1 protein_id gnl|my_center|LOCUS_15670 364616 364032 gene locus_tag LOCUS_15680 364616 364032 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761795.1 protein_id gnl|my_center|LOCUS_15680 365241 364837 gene locus_tag LOCUS_15690 gene queD 365241 364837 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870012.1 protein_id gnl|my_center|LOCUS_15690 366134 365385 gene locus_tag LOCUS_15700 366134 365385 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930573.1 protein_id gnl|my_center|LOCUS_15700 366388 367434 gene locus_tag LOCUS_15710 366388 367434 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937388.1 protein_id gnl|my_center|LOCUS_15710 367635 368087 gene locus_tag LOCUS_15720 367635 368087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 368117 368611 gene locus_tag LOCUS_15730 368117 368611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 368712 368789 gene locus_tag LOCUS_t00280 368712 368789 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 369189 370244 gene locus_tag LOCUS_15740 369189 370244 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703846.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence08 56 817 gene locus_tag LOCUS_15750 56 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1260 1949 gene locus_tag LOCUS_15760 1260 1949 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938397.1 protein_id gnl|my_center|LOCUS_15760 4517 2445 gene locus_tag LOCUS_15770 4517 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073778.1 protein_id gnl|my_center|LOCUS_15770 5140 4934 gene locus_tag LOCUS_15780 5140 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 5661 5140 gene locus_tag LOCUS_15790 5661 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 5879 5658 gene locus_tag LOCUS_15800 5879 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 6196 5876 gene locus_tag LOCUS_15810 6196 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 6882 6265 gene locus_tag LOCUS_15820 6882 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 7257 7820 gene locus_tag LOCUS_15830 7257 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 9014 7827 gene locus_tag LOCUS_15840 9014 7827 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108247.1 protein_id gnl|my_center|LOCUS_15840 9798 12452 gene locus_tag LOCUS_15850 9798 12452 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484637.1 protein_id gnl|my_center|LOCUS_15850 13186 12731 gene locus_tag LOCUS_15860 13186 12731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 13456 14280 gene locus_tag LOCUS_15870 13456 14280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 14486 15556 gene locus_tag LOCUS_15880 14486 15556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 15724 15631 gene locus_tag LOCUS_t00290 15724 15631 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17062 15884 gene locus_tag LOCUS_15890 gene argJ 17062 15884 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938124.1 protein_id gnl|my_center|LOCUS_15890 19959 17428 gene locus_tag LOCUS_15900 gene secA 19959 17428 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938126.1 protein_id gnl|my_center|LOCUS_15900 21392 20208 gene locus_tag LOCUS_15910 21392 20208 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938127.1 protein_id gnl|my_center|LOCUS_15910 22085 21396 gene locus_tag LOCUS_15920 22085 21396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 23697 22297 gene locus_tag LOCUS_15930 23697 22297 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938128.1 protein_id gnl|my_center|LOCUS_15930 24186 23719 gene locus_tag LOCUS_15940 gene smpB 24186 23719 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938129.1 protein_id gnl|my_center|LOCUS_15940 25970 24195 gene locus_tag LOCUS_15950 gene ptsP 25970 24195 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938130.1 protein_id gnl|my_center|LOCUS_15950 26303 25971 gene locus_tag LOCUS_15960 26303 25971 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792685.1 protein_id gnl|my_center|LOCUS_15960 27073 26297 gene locus_tag LOCUS_15970 27073 26297 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938132.1 protein_id gnl|my_center|LOCUS_15970 27995 27165 gene locus_tag LOCUS_15980 gene rsmI 27995 27165 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938133.1 protein_id gnl|my_center|LOCUS_15980 28341 27937 gene locus_tag LOCUS_15990 28341 27937 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938134.1 protein_id gnl|my_center|LOCUS_15990 29259 28477 gene locus_tag LOCUS_16000 29259 28477 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938135.1 protein_id gnl|my_center|LOCUS_16000 29807 29460 gene locus_tag LOCUS_16010 gene rplS 29807 29460 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938136.1 protein_id gnl|my_center|LOCUS_16010 31167 29890 gene locus_tag LOCUS_16020 gene trmD 31167 29890 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938137.1 protein_id gnl|my_center|LOCUS_16020 31708 31178 gene locus_tag LOCUS_16030 gene rimM 31708 31178 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938138.1 protein_id gnl|my_center|LOCUS_16030 31957 31724 gene locus_tag LOCUS_16040 31957 31724 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_16040 32271 32035 gene locus_tag LOCUS_16050 gene rpsP 32271 32035 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938140.1 protein_id gnl|my_center|LOCUS_16050 33959 32370 gene locus_tag LOCUS_16060 gene ffh 33959 32370 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938141.1 protein_id gnl|my_center|LOCUS_16060 34464 34231 gene locus_tag LOCUS_16070 34464 34231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_16070 34714 34451 gene locus_tag LOCUS_16080 34714 34451 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_16080 36021 34840 gene locus_tag LOCUS_16090 36021 34840 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938142.1 protein_id gnl|my_center|LOCUS_16090 36369 36608 gene locus_tag LOCUS_16100 36369 36608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 36971 38128 gene locus_tag LOCUS_16110 36971 38128 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 protein_id gnl|my_center|LOCUS_16110 38121 38783 gene locus_tag LOCUS_16120 gene metW 38121 38783 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173533.1 protein_id gnl|my_center|LOCUS_16120 38780 40069 gene locus_tag LOCUS_16130 38780 40069 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_16130 41595 40207 gene locus_tag LOCUS_16140 41595 40207 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292596.1 protein_id gnl|my_center|LOCUS_16140 42237 41899 gene locus_tag LOCUS_16150 gene mazF 42237 41899 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_16150 42482 42231 gene locus_tag LOCUS_16160 42482 42231 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887061.1 protein_id gnl|my_center|LOCUS_16160 43014 42703 gene locus_tag LOCUS_16170 43014 42703 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077234.1 protein_id gnl|my_center|LOCUS_16170 44901 43078 gene locus_tag LOCUS_16180 gene glmS 44901 43078 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940414.1 protein_id gnl|my_center|LOCUS_16180 45120 45476 gene locus_tag LOCUS_16190 45120 45476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 45814 46293 gene locus_tag LOCUS_16200 gene ilvN 45814 46293 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937929.1 protein_id gnl|my_center|LOCUS_16200 46286 47329 gene locus_tag LOCUS_16210 46286 47329 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937930.1 protein_id gnl|my_center|LOCUS_16210 47326 48525 gene locus_tag LOCUS_16220 gene buk 47326 48525 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937931.1 protein_id gnl|my_center|LOCUS_16220 48694 49266 gene locus_tag LOCUS_16230 48694 49266 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937932.1 protein_id gnl|my_center|LOCUS_16230 49530 51122 gene locus_tag LOCUS_16240 49530 51122 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937938.1 protein_id gnl|my_center|LOCUS_16240 51124 51678 gene locus_tag LOCUS_16250 51124 51678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937937.1 protein_id gnl|my_center|LOCUS_16250 52026 54452 gene locus_tag LOCUS_16260 52026 54452 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937936.1 protein_id gnl|my_center|LOCUS_16260 54511 54867 gene locus_tag LOCUS_16270 54511 54867 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023525.1 protein_id gnl|my_center|LOCUS_16270 55046 56668 gene locus_tag LOCUS_16280 55046 56668 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937934.1 protein_id gnl|my_center|LOCUS_16280 56939 56853 gene locus_tag LOCUS_t00300 56939 56853 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 57183 58226 gene locus_tag LOCUS_16290 57183 58226 CDS product DUF1786 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940672.1 protein_id gnl|my_center|LOCUS_16290 58331 59626 gene locus_tag LOCUS_16300 58331 59626 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940001.1 protein_id gnl|my_center|LOCUS_16300 59687 60196 gene locus_tag LOCUS_16310 59687 60196 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940002.1 protein_id gnl|my_center|LOCUS_16310 60289 61110 gene locus_tag LOCUS_16320 60289 61110 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940003.1 protein_id gnl|my_center|LOCUS_16320 62226 61180 gene locus_tag LOCUS_16330 62226 61180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 62225 62602 gene locus_tag LOCUS_16340 62225 62602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 63380 62580 gene locus_tag LOCUS_16350 63380 62580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 64065 63796 gene locus_tag LOCUS_16360 64065 63796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939945.1 protein_id gnl|my_center|LOCUS_16360 64337 65008 gene locus_tag LOCUS_16370 64337 65008 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524547.1 protein_id gnl|my_center|LOCUS_16370 65212 65018 gene locus_tag LOCUS_16380 65212 65018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 66386 65244 gene locus_tag LOCUS_16390 66386 65244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 66903 66508 gene locus_tag LOCUS_16400 66903 66508 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940036.1 protein_id gnl|my_center|LOCUS_16400 68160 67357 gene locus_tag LOCUS_16410 68160 67357 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940035.1 protein_id gnl|my_center|LOCUS_16410 68911 68372 gene locus_tag LOCUS_16420 68911 68372 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938692.1 protein_id gnl|my_center|LOCUS_16420 70695 69226 gene locus_tag LOCUS_16430 70695 69226 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839227.1 protein_id gnl|my_center|LOCUS_16430 73001 71619 gene locus_tag LOCUS_16440 73001 71619 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940561.1 protein_id gnl|my_center|LOCUS_16440 73341 74609 gene locus_tag LOCUS_16450 73341 74609 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938250.1 protein_id gnl|my_center|LOCUS_16450 74624 75397 gene locus_tag LOCUS_16460 74624 75397 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938251.1 protein_id gnl|my_center|LOCUS_16460 75563 76756 gene locus_tag LOCUS_16470 gene tyrS 75563 76756 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938252.1 protein_id gnl|my_center|LOCUS_16470 76892 77800 gene locus_tag LOCUS_16480 76892 77800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 77865 79124 gene locus_tag LOCUS_16490 77865 79124 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061500.1 protein_id gnl|my_center|LOCUS_16490 79270 79731 gene locus_tag LOCUS_16500 79270 79731 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108259.1 protein_id gnl|my_center|LOCUS_16500 81452 79935 gene locus_tag LOCUS_16510 81452 79935 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_16510 81987 83111 gene locus_tag LOCUS_16520 81987 83111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 83538 84482 gene locus_tag LOCUS_16530 83538 84482 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937367.1 protein_id gnl|my_center|LOCUS_16530 84497 84886 gene locus_tag LOCUS_16540 84497 84886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 85929 85042 gene locus_tag LOCUS_16550 85929 85042 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937979.1 protein_id gnl|my_center|LOCUS_16550 86828 85995 gene locus_tag LOCUS_16560 86828 85995 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937978.1 protein_id gnl|my_center|LOCUS_16560 87707 86871 gene locus_tag LOCUS_16570 87707 86871 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626073.1 protein_id gnl|my_center|LOCUS_16570 89541 87952 gene locus_tag LOCUS_16580 89541 87952 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937971.1 protein_id gnl|my_center|LOCUS_16580 90663 91658 gene locus_tag LOCUS_16590 90663 91658 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792769.1 protein_id gnl|my_center|LOCUS_16590 91708 92700 gene locus_tag LOCUS_16600 91708 92700 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792769.1 protein_id gnl|my_center|LOCUS_16600 92969 93814 gene locus_tag LOCUS_16610 gene nifU 92969 93814 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_16610 93811 95004 gene locus_tag LOCUS_16620 gene nifS 93811 95004 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_16620 95227 96165 gene locus_tag LOCUS_16630 gene cysK 95227 96165 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937966.1 protein_id gnl|my_center|LOCUS_16630 96211 97167 gene locus_tag LOCUS_16640 96211 97167 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937965.1 protein_id gnl|my_center|LOCUS_16640 97957 97286 gene locus_tag LOCUS_16650 97957 97286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 98336 102145 gene locus_tag LOCUS_16660 98336 102145 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938260.1 protein_id gnl|my_center|LOCUS_16660 104709 102280 gene locus_tag LOCUS_16670 104709 102280 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939179.1 protein_id gnl|my_center|LOCUS_16670 105009 105755 gene locus_tag LOCUS_16680 105009 105755 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939178.1 protein_id gnl|my_center|LOCUS_16680 105758 106486 gene locus_tag LOCUS_16690 105758 106486 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792164.1 protein_id gnl|my_center|LOCUS_16690 106541 107692 gene locus_tag LOCUS_16700 106541 107692 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_16700 107914 108867 gene locus_tag LOCUS_16710 107914 108867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560783.1 protein_id gnl|my_center|LOCUS_16710 111284 109005 gene locus_tag LOCUS_16720 111284 109005 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793192.1 protein_id gnl|my_center|LOCUS_16720 111644 111471 gene locus_tag LOCUS_16730 111644 111471 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937335.1 protein_id gnl|my_center|LOCUS_16730 114274 111716 gene locus_tag LOCUS_16740 114274 111716 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294664.1 protein_id gnl|my_center|LOCUS_16740 114895 114365 gene locus_tag LOCUS_16750 114895 114365 CDS product TadE/TadG family type IV pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939405.1 protein_id gnl|my_center|LOCUS_16750 116192 114909 gene locus_tag LOCUS_16760 116192 114909 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792063.1 protein_id gnl|my_center|LOCUS_16760 116599 116210 gene locus_tag LOCUS_16770 116599 116210 CDS product TadE/TadG family type IV pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939403.1 protein_id gnl|my_center|LOCUS_16770 118369 116612 gene locus_tag LOCUS_16780 118369 116612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 119466 118432 gene locus_tag LOCUS_16790 119466 118432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 120452 119481 gene locus_tag LOCUS_16800 120452 119481 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939400.1 protein_id gnl|my_center|LOCUS_16800 122175 120490 gene locus_tag LOCUS_16810 122175 120490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 122134 122283 gene locus_tag LOCUS_16820 122134 122283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 122305 122508 gene locus_tag LOCUS_16830 122305 122508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 123735 122515 gene locus_tag LOCUS_16840 123735 122515 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939398.1 protein_id gnl|my_center|LOCUS_16840 124064 123762 gene locus_tag LOCUS_16850 124064 123762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 125583 124090 gene locus_tag LOCUS_16860 125583 124090 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939396.1 protein_id gnl|my_center|LOCUS_16860 126407 125580 gene locus_tag LOCUS_16870 gene cpaB 126407 125580 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939395.1 protein_id gnl|my_center|LOCUS_16870 126990 126439 gene locus_tag LOCUS_16880 126990 126439 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939394.1 protein_id gnl|my_center|LOCUS_16880 127276 127109 gene locus_tag LOCUS_16890 127276 127109 CDS product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939393.1 protein_id gnl|my_center|LOCUS_16890 129156 127747 gene locus_tag LOCUS_16900 129156 127747 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939391.1 protein_id gnl|my_center|LOCUS_16900 129339 130481 gene locus_tag LOCUS_16910 129339 130481 CDS product FIST signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106998.1 protein_id gnl|my_center|LOCUS_16910 130611 131795 gene locus_tag LOCUS_16920 gene purT 130611 131795 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938024.1 protein_id gnl|my_center|LOCUS_16920 133734 132127 gene locus_tag LOCUS_16930 133734 132127 CDS product outer membrane homotrimeric porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938100.1 protein_id gnl|my_center|LOCUS_16930 134014 136005 gene locus_tag LOCUS_16940 gene uvrC 134014 136005 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524276.1 protein_id gnl|my_center|LOCUS_16940 136546 136034 gene locus_tag LOCUS_16950 gene tsaA 136546 136034 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_16950 136851 137999 gene locus_tag LOCUS_16960 136851 137999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 138023 139618 gene locus_tag LOCUS_16970 138023 139618 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938105.1 protein_id gnl|my_center|LOCUS_16970 139801 140325 gene locus_tag LOCUS_16980 139801 140325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 140334 140738 gene locus_tag LOCUS_16990 140334 140738 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792700.1 protein_id gnl|my_center|LOCUS_16990 141904 140801 gene locus_tag LOCUS_17000 gene mnmA 141904 140801 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938108.1 protein_id gnl|my_center|LOCUS_17000 143371 141908 gene locus_tag LOCUS_17010 gene gatA 143371 141908 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938109.1 protein_id gnl|my_center|LOCUS_17010 143796 143512 gene locus_tag LOCUS_17020 gene gatC 143796 143512 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938110.1 protein_id gnl|my_center|LOCUS_17020 146280 144190 gene locus_tag LOCUS_17030 146280 144190 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524277.1 protein_id gnl|my_center|LOCUS_17030 148291 146381 gene locus_tag LOCUS_17040 gene dnaK 148291 146381 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938112.1 protein_id gnl|my_center|LOCUS_17040 148865 148533 gene locus_tag LOCUS_17050 148865 148533 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388090.1 protein_id gnl|my_center|LOCUS_17050 148993 149319 gene locus_tag LOCUS_17060 148993 149319 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388091.1 protein_id gnl|my_center|LOCUS_17060 149316 150098 gene locus_tag LOCUS_17070 149316 150098 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388092.1 protein_id gnl|my_center|LOCUS_17070 150177 150338 gene locus_tag LOCUS_17080 150177 150338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 150810 151217 gene locus_tag LOCUS_17090 150810 151217 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940473.1 protein_id gnl|my_center|LOCUS_17090 151227 153893 gene locus_tag LOCUS_17100 151227 153893 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940472.1 protein_id gnl|my_center|LOCUS_17100 153890 155539 gene locus_tag LOCUS_17110 153890 155539 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940474.1 protein_id gnl|my_center|LOCUS_17110 155581 156003 gene locus_tag LOCUS_17120 155581 156003 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546418.1 protein_id gnl|my_center|LOCUS_17120 156144 156830 gene locus_tag LOCUS_17130 156144 156830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 156902 157306 gene locus_tag LOCUS_17140 156902 157306 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937456.1 protein_id gnl|my_center|LOCUS_17140 160082 157317 gene locus_tag LOCUS_17150 160082 157317 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940472.1 protein_id gnl|my_center|LOCUS_17150 160595 160903 gene locus_tag LOCUS_17160 160595 160903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 160927 161994 gene locus_tag LOCUS_17170 160927 161994 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937460.1 protein_id gnl|my_center|LOCUS_17170 162101 162355 gene locus_tag LOCUS_17180 162101 162355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 162418 162639 gene locus_tag LOCUS_17190 162418 162639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 165543 163018 gene locus_tag LOCUS_17200 165543 163018 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937462.1 protein_id gnl|my_center|LOCUS_17200 165920 166474 gene locus_tag LOCUS_17210 165920 166474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 166530 167984 gene locus_tag LOCUS_17220 166530 167984 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808163.1 protein_id gnl|my_center|LOCUS_17220 168043 168492 gene locus_tag LOCUS_17230 168043 168492 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940222.1 protein_id gnl|my_center|LOCUS_17230 168559 168780 gene locus_tag LOCUS_17240 168559 168780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 168910 170592 gene locus_tag LOCUS_17250 168910 170592 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940474.1 protein_id gnl|my_center|LOCUS_17250 170696 173266 gene locus_tag LOCUS_17260 170696 173266 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937463.1 protein_id gnl|my_center|LOCUS_17260 173303 173407 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 173528 176239 gene locus_tag LOCUS_17270 173528 176239 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937462.1 protein_id gnl|my_center|LOCUS_17270 176886 176437 gene locus_tag LOCUS_17280 176886 176437 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940496.1 protein_id gnl|my_center|LOCUS_17280 178446 176980 gene locus_tag LOCUS_17290 178446 176980 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546144.1 protein_id gnl|my_center|LOCUS_17290 179056 178502 gene locus_tag LOCUS_17300 179056 178502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 179757 179681 gene locus_tag LOCUS_t00310 179757 179681 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 179941 181209 gene locus_tag LOCUS_17310 179941 181209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 181503 182927 gene locus_tag LOCUS_17320 gene selA 181503 182927 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940143.1 protein_id gnl|my_center|LOCUS_17320 182993 183160 gene locus_tag LOCUS_17330 182993 183160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 183198 184637 gene locus_tag LOCUS_17340 183198 184637 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940144.1 protein_id gnl|my_center|LOCUS_17340 184757 185941 gene locus_tag LOCUS_17350 184757 185941 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940145.1 protein_id gnl|my_center|LOCUS_17350 186746 186012 gene locus_tag LOCUS_17360 186746 186012 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940148.1 protein_id gnl|my_center|LOCUS_17360 187291 186743 gene locus_tag LOCUS_17370 187291 186743 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940149.1 protein_id gnl|my_center|LOCUS_17370 187502 187924 gene locus_tag LOCUS_17380 187502 187924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 188037 188702 gene locus_tag LOCUS_17390 188037 188702 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294676.1 protein_id gnl|my_center|LOCUS_17390 188748 189167 gene locus_tag LOCUS_17400 gene nikR 188748 189167 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940151.1 protein_id gnl|my_center|LOCUS_17400 189172 189942 gene locus_tag LOCUS_17410 gene folE2 189172 189942 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629168.1 protein_id gnl|my_center|LOCUS_17410 190834 190316 gene locus_tag LOCUS_17420 190834 190316 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938092.1 protein_id gnl|my_center|LOCUS_17420 191844 190831 gene locus_tag LOCUS_17430 191844 190831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 192095 193132 gene locus_tag LOCUS_17440 192095 193132 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_17440 193164 194066 gene locus_tag LOCUS_17450 gene mreC 193164 194066 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938089.1 protein_id gnl|my_center|LOCUS_17450 194110 194598 gene locus_tag LOCUS_17460 194110 194598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938088.1 protein_id gnl|my_center|LOCUS_17460 194588 196393 gene locus_tag LOCUS_17470 gene mrdA 194588 196393 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938087.1 protein_id gnl|my_center|LOCUS_17470 196383 197495 gene locus_tag LOCUS_17480 gene rodA 196383 197495 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938086.1 protein_id gnl|my_center|LOCUS_17480 197555 197926 gene locus_tag LOCUS_17490 197555 197926 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938085.1 protein_id gnl|my_center|LOCUS_17490 198132 198548 gene locus_tag LOCUS_17500 198132 198548 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792709.1 protein_id gnl|my_center|LOCUS_17500 198579 199142 gene locus_tag LOCUS_17510 198579 199142 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792710.1 protein_id gnl|my_center|LOCUS_17510 199139 199690 gene locus_tag LOCUS_17520 gene atpH 199139 199690 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938079.1 protein_id gnl|my_center|LOCUS_17520 199695 201203 gene locus_tag LOCUS_17530 gene atpA 199695 201203 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938078.1 protein_id gnl|my_center|LOCUS_17530 201219 202100 gene locus_tag LOCUS_17540 201219 202100 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938077.1 protein_id gnl|my_center|LOCUS_17540 202120 203526 gene locus_tag LOCUS_17550 gene atpD 202120 203526 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938076.1 protein_id gnl|my_center|LOCUS_17550 203545 203946 gene locus_tag LOCUS_17560 203545 203946 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_17560 204164 205537 gene locus_tag LOCUS_17570 gene glmU 204164 205537 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939937.1 protein_id gnl|my_center|LOCUS_17570 205575 205811 gene locus_tag LOCUS_17580 205575 205811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 205818 206084 gene locus_tag LOCUS_17590 gene zapA 205818 206084 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939939.1 protein_id gnl|my_center|LOCUS_17590 206401 206231 gene locus_tag LOCUS_17600 206401 206231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 206465 208024 gene locus_tag LOCUS_17610 gene rny 206465 208024 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939940.1 protein_id gnl|my_center|LOCUS_17610 208138 208638 gene locus_tag LOCUS_17620 208138 208638 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062386646.1 protein_id gnl|my_center|LOCUS_17620 208638 208973 gene locus_tag LOCUS_17630 208638 208973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938093.1 protein_id gnl|my_center|LOCUS_17630 209309 208995 gene locus_tag LOCUS_17640 209309 208995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792721.1 protein_id gnl|my_center|LOCUS_17640 210555 209356 gene locus_tag LOCUS_17650 210555 209356 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938060.1 protein_id gnl|my_center|LOCUS_17650 210730 211578 gene locus_tag LOCUS_17660 210730 211578 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972415.1 protein_id gnl|my_center|LOCUS_17660 211723 213972 gene locus_tag LOCUS_17670 211723 213972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 214174 213947 gene locus_tag LOCUS_17680 214174 213947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 215429 214422 gene locus_tag LOCUS_17690 215429 214422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 215580 215792 gene locus_tag LOCUS_17700 215580 215792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 216541 215957 gene locus_tag LOCUS_17710 216541 215957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 217045 216575 gene locus_tag LOCUS_17720 217045 216575 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938063.1 protein_id gnl|my_center|LOCUS_17720 217424 217699 gene locus_tag LOCUS_17730 217424 217699 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938065.1 protein_id gnl|my_center|LOCUS_17730 219131 217794 gene locus_tag LOCUS_17740 219131 217794 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938066.1 protein_id gnl|my_center|LOCUS_17740 220608 219745 gene locus_tag LOCUS_17750 gene lipA 220608 219745 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938204.1 protein_id gnl|my_center|LOCUS_17750 221194 220550 gene locus_tag LOCUS_17760 gene lipB 221194 220550 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938205.1 protein_id gnl|my_center|LOCUS_17760 222358 221222 gene locus_tag LOCUS_17770 222358 221222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 223977 222355 gene locus_tag LOCUS_17780 223977 222355 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792640.1 protein_id gnl|my_center|LOCUS_17780 224256 224756 gene locus_tag LOCUS_17790 224256 224756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 224930 225910 gene locus_tag LOCUS_17800 gene fliM 224930 225910 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938209.1 protein_id gnl|my_center|LOCUS_17800 226858 226064 gene locus_tag LOCUS_17810 226858 226064 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938210.1 protein_id gnl|my_center|LOCUS_17810 227566 226862 gene locus_tag LOCUS_17820 227566 226862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629479.1 protein_id gnl|my_center|LOCUS_17820 227960 227526 gene locus_tag LOCUS_17830 gene fliJ 227960 227526 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938212.1 protein_id gnl|my_center|LOCUS_17830 228953 228219 gene locus_tag LOCUS_17840 228953 228219 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938213.1 protein_id gnl|my_center|LOCUS_17840 229764 228955 gene locus_tag LOCUS_17850 229764 228955 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938214.1 protein_id gnl|my_center|LOCUS_17850 230759 230118 gene locus_tag LOCUS_17860 230759 230118 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938215.1 protein_id gnl|my_center|LOCUS_17860 231161 230856 gene locus_tag LOCUS_17870 gene atpE 231161 230856 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792634.1 protein_id gnl|my_center|LOCUS_17870 231919 231218 gene locus_tag LOCUS_17880 gene atpB 231919 231218 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938217.1 protein_id gnl|my_center|LOCUS_17880 232358 231924 gene locus_tag LOCUS_17890 232358 231924 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294593.1 protein_id gnl|my_center|LOCUS_17890 232605 232330 gene locus_tag LOCUS_17900 232605 232330 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792632.1 protein_id gnl|my_center|LOCUS_17900 232810 233256 gene locus_tag LOCUS_17910 232810 233256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 233386 235044 gene locus_tag LOCUS_17920 233386 235044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 235603 235115 gene locus_tag LOCUS_17930 235603 235115 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524292.1 protein_id gnl|my_center|LOCUS_17930 237175 235769 gene locus_tag LOCUS_17940 gene rlmD 237175 235769 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938223.1 protein_id gnl|my_center|LOCUS_17940 237371 237514 gene locus_tag LOCUS_17950 237371 237514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 238805 237939 gene locus_tag LOCUS_17960 gene rfbA 238805 237939 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938224.1 protein_id gnl|my_center|LOCUS_17960 239098 239277 gene locus_tag LOCUS_17970 239098 239277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 239446 239754 gene locus_tag LOCUS_17980 gene rplU 239446 239754 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938226.1 protein_id gnl|my_center|LOCUS_17980 239821 240093 gene locus_tag LOCUS_17990 gene rpmA 239821 240093 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938227.1 protein_id gnl|my_center|LOCUS_17990 240246 241346 gene locus_tag LOCUS_18000 gene obgE 240246 241346 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938228.1 protein_id gnl|my_center|LOCUS_18000 241379 242587 gene locus_tag LOCUS_18010 gene proB 241379 242587 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938229.1 protein_id gnl|my_center|LOCUS_18010 242625 243488 gene locus_tag LOCUS_18020 gene thiD 242625 243488 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938230.1 protein_id gnl|my_center|LOCUS_18020 243751 244935 gene locus_tag LOCUS_18030 243751 244935 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938231.1 protein_id gnl|my_center|LOCUS_18030 244962 245705 gene locus_tag LOCUS_18040 244962 245705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 246295 245888 gene locus_tag LOCUS_18050 246295 245888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 247087 246341 gene locus_tag LOCUS_18060 247087 246341 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939585.1 protein_id gnl|my_center|LOCUS_18060 247859 247365 gene locus_tag LOCUS_18070 247859 247365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940525.1 protein_id gnl|my_center|LOCUS_18070 249948 247984 gene locus_tag LOCUS_18080 249948 247984 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706766.1 protein_id gnl|my_center|LOCUS_18080 250436 250774 gene locus_tag LOCUS_18090 250436 250774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938273.1 protein_id gnl|my_center|LOCUS_18090 250833 251372 gene locus_tag LOCUS_18100 gene yjgA 250833 251372 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938274.1 protein_id gnl|my_center|LOCUS_18100 253204 251561 gene locus_tag LOCUS_18110 253204 251561 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937974.1 protein_id gnl|my_center|LOCUS_18110 254549 253449 gene locus_tag LOCUS_18120 254549 253449 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940034.1 protein_id gnl|my_center|LOCUS_18120 255222 254554 gene locus_tag LOCUS_18130 255222 254554 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940033.1 protein_id gnl|my_center|LOCUS_18130 255442 255197 gene locus_tag LOCUS_18140 255442 255197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 256161 255526 gene locus_tag LOCUS_18150 256161 255526 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940031.1 protein_id gnl|my_center|LOCUS_18150 256724 256164 gene locus_tag LOCUS_18160 256724 256164 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940030.1 protein_id gnl|my_center|LOCUS_18160 257016 259478 gene locus_tag LOCUS_18170 257016 259478 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791682.1 protein_id gnl|my_center|LOCUS_18170 259491 260414 gene locus_tag LOCUS_18180 259491 260414 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940028.1 protein_id gnl|my_center|LOCUS_18180 260458 261678 gene locus_tag LOCUS_18190 gene cbiD 260458 261678 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940016.1 protein_id gnl|my_center|LOCUS_18190 261966 263174 gene locus_tag LOCUS_18200 261966 263174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 263308 264399 gene locus_tag LOCUS_18210 263308 264399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 264497 265450 gene locus_tag LOCUS_18220 264497 265450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 266257 265547 gene locus_tag LOCUS_18230 266257 265547 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937892.1 protein_id gnl|my_center|LOCUS_18230 267339 266620 gene locus_tag LOCUS_18240 267339 266620 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937891.1 protein_id gnl|my_center|LOCUS_18240 270375 267343 gene locus_tag LOCUS_18250 gene fdnG 270375 267343 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937890.1 protein_id gnl|my_center|LOCUS_18250 270641 270402 gene locus_tag LOCUS_18260 270641 270402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 271811 271092 gene locus_tag LOCUS_18270 271811 271092 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937891.1 protein_id gnl|my_center|LOCUS_18270 274847 271815 gene locus_tag LOCUS_18280 gene fdnG 274847 271815 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937890.1 transl_except (pos:complement(274272..274274),aa:Sec) note codon on position 192 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_18280 274967 275143 gene locus_tag LOCUS_18290 274967 275143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 275511 276695 gene locus_tag LOCUS_18300 275511 276695 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_18300 276695 279871 gene locus_tag LOCUS_18310 276695 279871 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_18310 279965 280498 gene locus_tag LOCUS_18320 279965 280498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 281472 280762 gene locus_tag LOCUS_18330 281472 280762 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937891.1 protein_id gnl|my_center|LOCUS_18330 284508 281476 gene locus_tag LOCUS_18340 gene fdnG 284508 281476 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937890.1 protein_id gnl|my_center|LOCUS_18340 284996 285211 gene locus_tag LOCUS_18350 284996 285211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 286086 285166 gene locus_tag LOCUS_18360 286086 285166 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792819.1 protein_id gnl|my_center|LOCUS_18360 286663 286094 gene locus_tag LOCUS_18370 286663 286094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 286828 288111 gene locus_tag LOCUS_18380 286828 288111 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937886.1 protein_id gnl|my_center|LOCUS_18380 288111 290138 gene locus_tag LOCUS_18390 288111 290138 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937885.1 protein_id gnl|my_center|LOCUS_18390 290138 290842 gene locus_tag LOCUS_18400 290138 290842 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937884.1 protein_id gnl|my_center|LOCUS_18400 292834 290885 gene locus_tag LOCUS_18410 292834 290885 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937662.1 protein_id gnl|my_center|LOCUS_18410 293495 293022 gene locus_tag LOCUS_18420 gene ahbA 293495 293022 CDS product siroheme decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938154.1 protein_id gnl|my_center|LOCUS_18420 294595 293522 gene locus_tag LOCUS_18430 gene ahbD 294595 293522 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938155.1 protein_id gnl|my_center|LOCUS_18430 294753 294592 gene locus_tag LOCUS_18440 294753 294592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 294692 294943 gene locus_tag LOCUS_18450 294692 294943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 295898 294906 gene locus_tag LOCUS_18460 gene hemB 295898 294906 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938156.1 protein_id gnl|my_center|LOCUS_18460 297243 296059 gene locus_tag LOCUS_18470 gene ahbC 297243 296059 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938157.1 protein_id gnl|my_center|LOCUS_18470 297560 298771 gene locus_tag LOCUS_18480 297560 298771 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938160.1 protein_id gnl|my_center|LOCUS_18480 298768 300195 gene locus_tag LOCUS_18490 298768 300195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 300284 301252 gene locus_tag LOCUS_18500 300284 301252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 301268 301888 gene locus_tag LOCUS_18510 301268 301888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 302310 303392 gene locus_tag LOCUS_18520 302310 303392 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792670.1 protein_id gnl|my_center|LOCUS_18520 303857 304657 gene locus_tag LOCUS_18530 303857 304657 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823741.1 protein_id gnl|my_center|LOCUS_18530 304832 305488 gene locus_tag LOCUS_18540 304832 305488 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461612.1 protein_id gnl|my_center|LOCUS_18540 305500 306237 gene locus_tag LOCUS_18550 305500 306237 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616938.1 protein_id gnl|my_center|LOCUS_18550 306397 307878 gene locus_tag LOCUS_18560 306397 307878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 307949 308284 gene locus_tag LOCUS_18570 307949 308284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 308382 308206 gene locus_tag LOCUS_18580 308382 308206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 308516 309286 gene locus_tag LOCUS_18590 308516 309286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 310389 309379 gene locus_tag LOCUS_18600 gene fliS 310389 309379 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938161.1 protein_id gnl|my_center|LOCUS_18600 312123 310399 gene locus_tag LOCUS_18610 gene fliD 312123 310399 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938162.1 protein_id gnl|my_center|LOCUS_18610 313282 312455 gene locus_tag LOCUS_18620 gene tsaB 313282 312455 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938163.1 protein_id gnl|my_center|LOCUS_18620 314321 313263 gene locus_tag LOCUS_18630 gene rseP 314321 313263 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938164.1 protein_id gnl|my_center|LOCUS_18630 315619 314318 gene locus_tag LOCUS_18640 gene dxr 315619 314318 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938165.1 protein_id gnl|my_center|LOCUS_18640 317181 315613 gene locus_tag LOCUS_18650 317181 315613 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792662.1 protein_id gnl|my_center|LOCUS_18650 318000 317197 gene locus_tag LOCUS_18660 318000 317197 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938167.1 protein_id gnl|my_center|LOCUS_18660 318737 317997 gene locus_tag LOCUS_18670 gene uppS 318737 317997 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938168.1 protein_id gnl|my_center|LOCUS_18670 318885 319097 gene locus_tag LOCUS_18680 318885 319097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 319413 321113 gene locus_tag LOCUS_18690 gene sulP 319413 321113 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937588.1 protein_id gnl|my_center|LOCUS_18690 321297 321947 gene locus_tag LOCUS_18700 321297 321947 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940552.1 protein_id gnl|my_center|LOCUS_18700 322177 324201 gene locus_tag LOCUS_18710 322177 324201 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140386.1 protein_id gnl|my_center|LOCUS_18710 324744 324262 gene locus_tag LOCUS_18720 324744 324262 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937609.1 protein_id gnl|my_center|LOCUS_18720 325906 324851 gene locus_tag LOCUS_18730 325906 324851 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868924.1 protein_id gnl|my_center|LOCUS_18730 326964 325969 gene locus_tag LOCUS_18740 326964 325969 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939354.1 protein_id gnl|my_center|LOCUS_18740 328349 327258 gene locus_tag LOCUS_18750 328349 327258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791735.1 protein_id gnl|my_center|LOCUS_18750 328802 329920 gene locus_tag LOCUS_18760 328802 329920 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938013.1 protein_id gnl|my_center|LOCUS_18760 330010 330915 gene locus_tag LOCUS_18770 330010 330915 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938014.1 protein_id gnl|my_center|LOCUS_18770 330915 331877 gene locus_tag LOCUS_18780 330915 331877 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938015.1 protein_id gnl|my_center|LOCUS_18780 331877 332647 gene locus_tag LOCUS_18790 331877 332647 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_18790 332660 333370 gene locus_tag LOCUS_18800 332660 333370 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938017.1 protein_id gnl|my_center|LOCUS_18800 333885 333478 gene locus_tag LOCUS_18810 333885 333478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 334170 333949 gene locus_tag LOCUS_18820 334170 333949 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939689.1 protein_id gnl|my_center|LOCUS_18820 334664 334203 gene locus_tag LOCUS_18830 334664 334203 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939688.1 protein_id gnl|my_center|LOCUS_18830 336169 334739 gene locus_tag LOCUS_18840 336169 334739 CDS product DNA integrity scanning protein DisA nucleotide-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791846.1 protein_id gnl|my_center|LOCUS_18840 336416 338908 gene locus_tag LOCUS_18850 336416 338908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 341366 339171 gene locus_tag LOCUS_18860 341366 339171 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939685.1 protein_id gnl|my_center|LOCUS_18860 341790 343784 gene locus_tag LOCUS_18870 341790 343784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 344410 344054 gene locus_tag LOCUS_18880 344410 344054 CDS product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939683.1 protein_id gnl|my_center|LOCUS_18880 344844 344769 gene locus_tag LOCUS_t00320 344844 344769 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 345082 345007 gene locus_tag LOCUS_t00330 345082 345007 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 345297 346880 gene locus_tag LOCUS_18890 gene lysS 345297 346880 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791906.1 protein_id gnl|my_center|LOCUS_18890 346891 348117 gene locus_tag LOCUS_18900 346891 348117 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939648.1 protein_id gnl|my_center|LOCUS_18900 348114 348806 gene locus_tag LOCUS_18910 348114 348806 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939647.1 protein_id gnl|my_center|LOCUS_18910 348790 351468 gene locus_tag LOCUS_18920 gene bamA 348790 351468 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791908.1 protein_id gnl|my_center|LOCUS_18920 351671 353593 gene locus_tag LOCUS_18930 351671 353593 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791909.1 protein_id gnl|my_center|LOCUS_18930 353730 354254 gene locus_tag LOCUS_18940 353730 354254 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939643.1 protein_id gnl|my_center|LOCUS_18940 354260 355288 gene locus_tag LOCUS_18950 gene lpxD 354260 355288 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939642.1 protein_id gnl|my_center|LOCUS_18950 355293 355775 gene locus_tag LOCUS_18960 gene fabZ 355293 355775 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939641.1 protein_id gnl|my_center|LOCUS_18960 355776 356561 gene locus_tag LOCUS_18970 gene lpxA 355776 356561 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939640.1 protein_id gnl|my_center|LOCUS_18970 356652 357473 gene locus_tag LOCUS_18980 gene lpxI 356652 357473 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_18980 357675 358862 gene locus_tag LOCUS_18990 357675 358862 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939637.1 protein_id gnl|my_center|LOCUS_18990 359091 359888 gene locus_tag LOCUS_19000 gene thiM 359091 359888 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939636.1 protein_id gnl|my_center|LOCUS_19000 359885 360517 gene locus_tag LOCUS_19010 gene thiE 359885 360517 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939635.1 protein_id gnl|my_center|LOCUS_19010 361324 360569 gene locus_tag LOCUS_19020 361324 360569 CDS product FAD/NAD-binding family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939633.1 protein_id gnl|my_center|LOCUS_19020 362019 361594 gene locus_tag LOCUS_19030 362019 361594 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939839.1 protein_id gnl|my_center|LOCUS_19030 363269 362100 gene locus_tag LOCUS_19040 363269 362100 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939838.1 protein_id gnl|my_center|LOCUS_19040 364386 363409 gene locus_tag LOCUS_19050 364386 363409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 364720 365421 gene locus_tag LOCUS_19060 364720 365421 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939837.1 protein_id gnl|my_center|LOCUS_19060 365424 366752 gene locus_tag LOCUS_19070 gene lysA 365424 366752 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939836.1 protein_id gnl|my_center|LOCUS_19070 367491 367297 gene locus_tag LOCUS_19080 367491 367297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 368030 367659 gene locus_tag LOCUS_19090 368030 367659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 368307 369671 gene locus_tag LOCUS_19100 368307 369671 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939825.1 protein_id gnl|my_center|LOCUS_19100 369652 370536 gene locus_tag LOCUS_19110 369652 370536 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939824.1 protein_id gnl|my_center|LOCUS_19110 370679 370906 gene locus_tag LOCUS_19120 370679 370906 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791779.1 protein_id gnl|my_center|LOCUS_19120 370926 372341 gene locus_tag LOCUS_19130 gene gltX 370926 372341 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939822.1 protein_id gnl|my_center|LOCUS_19130 372629 372342 gene locus_tag LOCUS_19140 372629 372342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 372665 373855 gene locus_tag LOCUS_19150 372665 373855 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938190.1 protein_id gnl|my_center|LOCUS_19150 373830 375140 gene locus_tag LOCUS_19160 373830 375140 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938189.1 protein_id gnl|my_center|LOCUS_19160 375140 376489 gene locus_tag LOCUS_19170 375140 376489 CDS product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792650.1 protein_id gnl|my_center|LOCUS_19170 378128 376593 gene locus_tag LOCUS_19180 378128 376593 CDS product histidine kinase dimerization/phosphoacceptor domain -containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294594.1 protein_id gnl|my_center|LOCUS_19180 379345 378146 gene locus_tag LOCUS_19190 379345 378146 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938186.1 protein_id gnl|my_center|LOCUS_19190 379637 380167 gene locus_tag LOCUS_19200 gene aroL 379637 380167 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938191.1 protein_id gnl|my_center|LOCUS_19200 380243 380665 gene locus_tag LOCUS_19210 380243 380665 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792648.1 protein_id gnl|my_center|LOCUS_19210 380675 381775 gene locus_tag LOCUS_19220 gene aroC 380675 381775 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938193.1 protein_id gnl|my_center|LOCUS_19220 381800 384046 gene locus_tag LOCUS_19230 381800 384046 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_19230 384656 384309 gene locus_tag LOCUS_19240 384656 384309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938073.1 protein_id gnl|my_center|LOCUS_19240 385361 385597 gene locus_tag LOCUS_19250 385361 385597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938074.1 protein_id gnl|my_center|LOCUS_19250 385951 387537 gene locus_tag LOCUS_19260 385951 387537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 390131 388242 gene locus_tag LOCUS_19270 gene htpG 390131 388242 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939912.1 protein_id gnl|my_center|LOCUS_19270 390812 394414 gene locus_tag LOCUS_19280 390812 394414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 395812 394574 gene locus_tag LOCUS_19290 gene hydF 395812 394574 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925770.1 protein_id gnl|my_center|LOCUS_19290 397059 395809 gene locus_tag LOCUS_19300 gene hydE 397059 395809 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073670.1 protein_id gnl|my_center|LOCUS_19300 397737 397081 gene locus_tag LOCUS_19310 397737 397081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041722858.1 protein_id gnl|my_center|LOCUS_19310 399154 397724 gene locus_tag LOCUS_19320 399154 397724 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939054.1 protein_id gnl|my_center|LOCUS_19320 400861 399452 gene locus_tag LOCUS_19330 gene hydG 400861 399452 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073668.1 protein_id gnl|my_center|LOCUS_19330 401132 400902 gene locus_tag LOCUS_19340 401132 400902 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545214.1 protein_id gnl|my_center|LOCUS_19340 401637 401296 gene locus_tag LOCUS_19350 401637 401296 CDS product iron hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939058.1 protein_id gnl|my_center|LOCUS_19350 402960 401647 gene locus_tag LOCUS_19360 402960 401647 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939057.1 protein_id gnl|my_center|LOCUS_19360 404252 403467 gene locus_tag LOCUS_19370 404252 403467 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939910.1 protein_id gnl|my_center|LOCUS_19370 404730 404287 gene locus_tag LOCUS_19380 404730 404287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939911.1 protein_id gnl|my_center|LOCUS_19380 405949 404798 gene locus_tag LOCUS_19390 405949 404798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 406996 406124 gene locus_tag LOCUS_19400 406996 406124 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938303.1 protein_id gnl|my_center|LOCUS_19400 407338 408207 gene locus_tag LOCUS_19410 407338 408207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 408325 410427 gene locus_tag LOCUS_19420 408325 410427 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387750.1 protein_id gnl|my_center|LOCUS_19420 410424 411707 gene locus_tag LOCUS_19430 410424 411707 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464847.1 protein_id gnl|my_center|LOCUS_19430 415109 411978 gene locus_tag LOCUS_19440 415109 411978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 416093 415203 gene locus_tag LOCUS_19450 gene rarD 416093 415203 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791842.1 protein_id gnl|my_center|LOCUS_19450 416731 416180 gene locus_tag LOCUS_19460 416731 416180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791841.1 protein_id gnl|my_center|LOCUS_19460 418310 416871 gene locus_tag LOCUS_19470 418310 416871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 419549 418422 gene locus_tag LOCUS_19480 419549 418422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 419718 420560 gene locus_tag LOCUS_19490 419718 420560 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937487.1 protein_id gnl|my_center|LOCUS_19490 420666 421595 gene locus_tag LOCUS_19500 420666 421595 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294680.1 protein_id gnl|my_center|LOCUS_19500 422149 421718 gene locus_tag LOCUS_19510 422149 421718 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939695.1 protein_id gnl|my_center|LOCUS_19510 422391 422972 gene locus_tag LOCUS_19520 422391 422972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 423160 423669 gene locus_tag LOCUS_19530 423160 423669 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064860.1 protein_id gnl|my_center|LOCUS_19530 423672 423863 gene locus_tag LOCUS_19540 423672 423863 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939693.1 protein_id gnl|my_center|LOCUS_19540 424048 424341 gene locus_tag LOCUS_19550 424048 424341 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261920.1 protein_id gnl|my_center|LOCUS_19550 424537 424875 gene locus_tag LOCUS_19560 424537 424875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939692.1 protein_id gnl|my_center|LOCUS_19560 426377 424980 gene locus_tag LOCUS_19570 gene dnaB 426377 424980 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938258.1 protein_id gnl|my_center|LOCUS_19570 426918 426415 gene locus_tag LOCUS_19580 gene rplI 426918 426415 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938257.1 protein_id gnl|my_center|LOCUS_19580 427194 426931 gene locus_tag LOCUS_19590 gene rpsR 427194 426931 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938256.1 protein_id gnl|my_center|LOCUS_19590 427499 427194 gene locus_tag LOCUS_19600 gene rpsF 427499 427194 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938255.1 protein_id gnl|my_center|LOCUS_19600 428829 427678 gene locus_tag LOCUS_19610 gene alr 428829 427678 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938254.1 protein_id gnl|my_center|LOCUS_19610 429185 431419 gene locus_tag LOCUS_19620 gene lptD 429185 431419 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792614.1 protein_id gnl|my_center|LOCUS_19620 431553 431726 gene locus_tag LOCUS_19630 431553 431726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938264.1 protein_id gnl|my_center|LOCUS_19630 432036 432854 gene locus_tag LOCUS_19640 432036 432854 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938265.1 protein_id gnl|my_center|LOCUS_19640 433105 434115 gene locus_tag LOCUS_19650 433105 434115 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938266.1 protein_id gnl|my_center|LOCUS_19650 434112 434843 gene locus_tag LOCUS_19660 434112 434843 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409382.1 protein_id gnl|my_center|LOCUS_19660 435085 435567 gene locus_tag LOCUS_19670 435085 435567 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228279.1 protein_id gnl|my_center|LOCUS_19670 437440 435686 gene locus_tag LOCUS_19680 437440 435686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 439676 437637 gene locus_tag LOCUS_19690 439676 437637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 440650 439793 gene locus_tag LOCUS_19700 440650 439793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 441192 440665 gene locus_tag LOCUS_19710 441192 440665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 441289 442977 gene locus_tag LOCUS_19720 441289 442977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 443166 443909 gene locus_tag LOCUS_19730 443166 443909 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938239.1 protein_id gnl|my_center|LOCUS_19730 444455 443994 gene locus_tag LOCUS_19740 444455 443994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 445912 444482 gene locus_tag LOCUS_19750 445912 444482 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941505.1 protein_id gnl|my_center|LOCUS_19750 447080 446301 gene locus_tag LOCUS_19760 447080 446301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 447866 449170 gene locus_tag LOCUS_19770 447866 449170 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522157.1 protein_id gnl|my_center|LOCUS_19770 449197 450252 gene locus_tag LOCUS_19780 449197 450252 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787328.1 protein_id gnl|my_center|LOCUS_19780 450261 451466 gene locus_tag LOCUS_19790 450261 451466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 451463 452581 gene locus_tag LOCUS_19800 451463 452581 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_19800 452594 454447 gene locus_tag LOCUS_19810 452594 454447 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838546.1 protein_id gnl|my_center|LOCUS_19810 454447 455721 gene locus_tag LOCUS_19820 454447 455721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 455714 456340 gene locus_tag LOCUS_19830 455714 456340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 456340 457533 gene locus_tag LOCUS_19840 456340 457533 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_19840 457530 458753 gene locus_tag LOCUS_19850 457530 458753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 458777 459961 gene locus_tag LOCUS_19860 458777 459961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 459958 461079 gene locus_tag LOCUS_19870 459958 461079 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_19870 461114 461716 gene locus_tag LOCUS_19880 461114 461716 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787337.1 protein_id gnl|my_center|LOCUS_19880 461713 462750 gene locus_tag LOCUS_19890 461713 462750 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870574.1 protein_id gnl|my_center|LOCUS_19890 462774 463922 gene locus_tag LOCUS_19900 462774 463922 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776663.1 protein_id gnl|my_center|LOCUS_19900 464138 465112 gene locus_tag LOCUS_19910 464138 465112 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942606.1 protein_id gnl|my_center|LOCUS_19910 465180 467459 gene locus_tag LOCUS_19920 465180 467459 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294690.1 protein_id gnl|my_center|LOCUS_19920 467550 468119 gene locus_tag LOCUS_19930 467550 468119 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942604.1 protein_id gnl|my_center|LOCUS_19930 468144 469151 gene locus_tag LOCUS_19940 468144 469151 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070687.1 protein_id gnl|my_center|LOCUS_19940 469164 470222 gene locus_tag LOCUS_19950 469164 470222 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141615041.1 protein_id gnl|my_center|LOCUS_19950 470209 471237 gene locus_tag LOCUS_19960 470209 471237 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139014079.1 protein_id gnl|my_center|LOCUS_19960 471234 471950 gene locus_tag LOCUS_19970 471234 471950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 472128 472727 gene locus_tag LOCUS_19980 472128 472727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 472819 473685 gene locus_tag LOCUS_19990 472819 473685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 473788 474936 gene locus_tag LOCUS_20000 473788 474936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 475982 475170 gene locus_tag LOCUS_20010 475982 475170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 476834 476145 gene locus_tag LOCUS_20020 476834 476145 CDS product CAAX prenyl protease-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942635.1 protein_id gnl|my_center|LOCUS_20020 477952 476837 gene locus_tag LOCUS_20030 477952 476837 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176599.1 protein_id gnl|my_center|LOCUS_20030 478638 477949 gene locus_tag LOCUS_20040 478638 477949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176600.1 protein_id gnl|my_center|LOCUS_20040 479768 478638 gene locus_tag LOCUS_20050 479768 478638 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176601.1 protein_id gnl|my_center|LOCUS_20050 479920 479765 gene locus_tag LOCUS_20060 479920 479765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 480323 482968 gene locus_tag LOCUS_20070 gene prsT 480323 482968 CDS product PEP-CTERM system TPR-repeat protein PrsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942631.1 protein_id gnl|my_center|LOCUS_20070 482990 484345 gene locus_tag LOCUS_20080 482990 484345 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_20080 484453 485253 gene locus_tag LOCUS_20090 484453 485253 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942629.1 protein_id gnl|my_center|LOCUS_20090 485255 486766 gene locus_tag LOCUS_20100 485255 486766 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942628.1 protein_id gnl|my_center|LOCUS_20100 486784 487650 gene locus_tag LOCUS_20110 486784 487650 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942627.1 protein_id gnl|my_center|LOCUS_20110 487659 488843 gene locus_tag LOCUS_20120 487659 488843 CDS product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044863.1 protein_id gnl|my_center|LOCUS_20120 488954 490186 gene locus_tag LOCUS_20130 488954 490186 CDS product TIGR03016 family PEP-CTERM system-associated outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942625.1 protein_id gnl|my_center|LOCUS_20130 490300 491244 gene locus_tag LOCUS_20140 490300 491244 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176621.1 protein_id gnl|my_center|LOCUS_20140 491507 492355 gene locus_tag LOCUS_20150 gene xrt 491507 492355 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176633.1 protein_id gnl|my_center|LOCUS_20150 492345 492971 gene locus_tag LOCUS_20160 492345 492971 CDS product EpsI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176634.1 protein_id gnl|my_center|LOCUS_20160 492987 495020 gene locus_tag LOCUS_20170 gene prsK 492987 495020 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176643.1 protein_id gnl|my_center|LOCUS_20170 495046 496410 gene locus_tag LOCUS_20180 gene prsR 495046 496410 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942585.1 protein_id gnl|my_center|LOCUS_20180 497009 496614 gene locus_tag LOCUS_20190 497009 496614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 498390 497497 gene locus_tag LOCUS_20200 498390 497497 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939359.1 protein_id gnl|my_center|LOCUS_20200 500259 498748 gene locus_tag LOCUS_20210 gene glpK 500259 498748 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259133.1 protein_id gnl|my_center|LOCUS_20210 501281 500466 gene locus_tag LOCUS_20220 501281 500466 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_20220 503257 501278 gene locus_tag LOCUS_20230 503257 501278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 504741 503467 gene locus_tag LOCUS_20240 gene glpB 504741 503467 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939225.1 protein_id gnl|my_center|LOCUS_20240 506357 504738 gene locus_tag LOCUS_20250 gene glpA 506357 504738 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939226.1 protein_id gnl|my_center|LOCUS_20250 506919 507812 gene locus_tag LOCUS_20260 506919 507812 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437127.1 protein_id gnl|my_center|LOCUS_20260 507867 508949 gene locus_tag LOCUS_20270 507867 508949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740065.1 protein_id gnl|my_center|LOCUS_20270 508964 510061 gene locus_tag LOCUS_20280 508964 510061 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531811.1 protein_id gnl|my_center|LOCUS_20280 510071 510943 gene locus_tag LOCUS_20290 510071 510943 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810946.1 protein_id gnl|my_center|LOCUS_20290 510940 511743 gene locus_tag LOCUS_20300 510940 511743 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531809.1 protein_id gnl|my_center|LOCUS_20300 511753 512031 gene locus_tag LOCUS_20310 511753 512031 CDS product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376264.1 protein_id gnl|my_center|LOCUS_20310 512286 514025 gene locus_tag LOCUS_20320 512286 514025 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148771775.1 protein_id gnl|my_center|LOCUS_20320 514492 514226 gene locus_tag LOCUS_20330 514492 514226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 515238 515687 gene locus_tag LOCUS_20340 515238 515687 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940343.1 protein_id gnl|my_center|LOCUS_20340 518289 515893 gene locus_tag LOCUS_20350 518289 515893 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870178.1 protein_id gnl|my_center|LOCUS_20350 519241 518291 gene locus_tag LOCUS_20360 519241 518291 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870179.1 protein_id gnl|my_center|LOCUS_20360 519732 519388 gene locus_tag LOCUS_20370 519732 519388 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941930.1 protein_id gnl|my_center|LOCUS_20370 522351 520099 gene locus_tag LOCUS_20380 522351 520099 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937467.1 protein_id gnl|my_center|LOCUS_20380 523910 522483 gene locus_tag LOCUS_20390 523910 522483 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937466.1 protein_id gnl|my_center|LOCUS_20390 524209 524604 gene locus_tag LOCUS_20400 524209 524604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 524705 524791 gene locus_tag LOCUS_t00340 524705 524791 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 524949 528758 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggatcatccccgcgggtgcggggaacac 529150 528854 gene locus_tag LOCUS_20410 gene cas2e 529150 528854 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942042.1 protein_id gnl|my_center|LOCUS_20410 530045 529131 gene locus_tag LOCUS_20420 gene cas1e 530045 529131 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942041.1 protein_id gnl|my_center|LOCUS_20420 530710 530042 gene locus_tag LOCUS_20430 gene cas6e 530710 530042 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387929.1 protein_id gnl|my_center|LOCUS_20430 531563 530697 gene locus_tag LOCUS_20440 531563 530697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 532698 531568 gene locus_tag LOCUS_20450 gene cas7e 532698 531568 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206445.1 protein_id gnl|my_center|LOCUS_20450 533237 532695 gene locus_tag LOCUS_20460 533237 532695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 534838 533234 gene locus_tag LOCUS_20470 gene casA 534838 533234 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366321.1 protein_id gnl|my_center|LOCUS_20470 535761 535459 gene locus_tag LOCUS_20480 535761 535459 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390183.1 protein_id gnl|my_center|LOCUS_20480 536050 535772 gene locus_tag LOCUS_20490 536050 535772 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605676.1 protein_id gnl|my_center|LOCUS_20490 538810 536123 gene locus_tag LOCUS_20500 538810 536123 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387934.1 protein_id gnl|my_center|LOCUS_20500 540219 539251 gene locus_tag LOCUS_20510 540219 539251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 542503 540746 gene locus_tag LOCUS_20520 542503 540746 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939591.1 protein_id gnl|my_center|LOCUS_20520 543642 542806 gene locus_tag LOCUS_20530 543642 542806 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940086.1 protein_id gnl|my_center|LOCUS_20530 545637 543739 gene locus_tag LOCUS_20540 545637 543739 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791648.1 protein_id gnl|my_center|LOCUS_20540 546863 545853 gene locus_tag LOCUS_20550 546863 545853 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940088.1 protein_id gnl|my_center|LOCUS_20550 547529 550024 gene locus_tag LOCUS_20560 547529 550024 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940090.1 protein_id gnl|my_center|LOCUS_20560 550170 551117 gene locus_tag LOCUS_20570 550170 551117 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940091.1 protein_id gnl|my_center|LOCUS_20570 551270 552664 gene locus_tag LOCUS_20580 551270 552664 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940093.1 protein_id gnl|my_center|LOCUS_20580 552798 553526 gene locus_tag LOCUS_20590 552798 553526 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073771.1 protein_id gnl|my_center|LOCUS_20590 554520 555803 gene locus_tag LOCUS_20600 554520 555803 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810293.1 protein_id gnl|my_center|LOCUS_20600 555813 556373 gene locus_tag LOCUS_20610 555813 556373 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810294.1 protein_id gnl|my_center|LOCUS_20610 559180 556475 gene locus_tag LOCUS_20620 559180 556475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 560145 559291 gene locus_tag LOCUS_20630 560145 559291 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791673.1 protein_id gnl|my_center|LOCUS_20630 563123 560589 gene locus_tag LOCUS_20640 gene lon 563123 560589 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938487.1 protein_id gnl|my_center|LOCUS_20640 563483 563163 gene locus_tag LOCUS_20650 563483 563163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 564226 563513 gene locus_tag LOCUS_20660 gene radC 564226 563513 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938489.1 protein_id gnl|my_center|LOCUS_20660 565315 564266 gene locus_tag LOCUS_20670 565315 564266 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792509.1 protein_id gnl|my_center|LOCUS_20670 566204 565686 gene locus_tag LOCUS_20680 gene lptE 566204 565686 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938491.1 protein_id gnl|my_center|LOCUS_20680 568716 566227 gene locus_tag LOCUS_20690 gene leuS 568716 566227 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938492.1 protein_id gnl|my_center|LOCUS_20690 569323 568859 gene locus_tag LOCUS_20700 gene nusB 569323 568859 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938493.1 protein_id gnl|my_center|LOCUS_20700 569798 569328 gene locus_tag LOCUS_20710 gene ribE 569798 569328 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938494.1 protein_id gnl|my_center|LOCUS_20710 571151 569928 gene locus_tag LOCUS_20720 571151 569928 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938495.1 protein_id gnl|my_center|LOCUS_20720 571912 571235 gene locus_tag LOCUS_20730 571912 571235 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938496.1 protein_id gnl|my_center|LOCUS_20730 573048 571897 gene locus_tag LOCUS_20740 gene ribD 573048 571897 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938497.1 protein_id gnl|my_center|LOCUS_20740 573512 573048 gene locus_tag LOCUS_20750 573512 573048 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938498.1 protein_id gnl|my_center|LOCUS_20750 574899 573661 gene locus_tag LOCUS_20760 574899 573661 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938499.1 protein_id gnl|my_center|LOCUS_20760 576255 575008 gene locus_tag LOCUS_20770 gene fabF 576255 575008 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938500.1 protein_id gnl|my_center|LOCUS_20770 576661 576431 gene locus_tag LOCUS_20780 gene acpP 576661 576431 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938501.1 protein_id gnl|my_center|LOCUS_20780 577489 576746 gene locus_tag LOCUS_20790 gene fabG 577489 576746 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938502.1 protein_id gnl|my_center|LOCUS_20790 578615 577626 gene locus_tag LOCUS_20800 578615 577626 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938503.1 protein_id gnl|my_center|LOCUS_20800 579722 578670 gene locus_tag LOCUS_20810 gene plsX 579722 578670 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938504.1 protein_id gnl|my_center|LOCUS_20810 579891 579715 gene locus_tag LOCUS_20820 gene rpmF 579891 579715 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938505.1 protein_id gnl|my_center|LOCUS_20820 580580 579945 gene locus_tag LOCUS_20830 580580 579945 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938506.1 protein_id gnl|my_center|LOCUS_20830 580696 580905 gene locus_tag LOCUS_20840 gene rpmB 580696 580905 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938507.1 protein_id gnl|my_center|LOCUS_20840 581344 582213 gene locus_tag LOCUS_20850 581344 582213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 582380 583150 gene locus_tag LOCUS_20860 582380 583150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 584891 583281 gene locus_tag LOCUS_20870 584891 583281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 589001 584985 gene locus_tag LOCUS_20880 589001 584985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 591028 589334 gene locus_tag LOCUS_20890 591028 589334 CDS product DUF3880 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939536.1 protein_id gnl|my_center|LOCUS_20890 591082 591729 gene locus_tag LOCUS_20900 591082 591729 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939535.1 protein_id gnl|my_center|LOCUS_20900 591803 592546 gene locus_tag LOCUS_20910 591803 592546 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939534.1 protein_id gnl|my_center|LOCUS_20910 592712 593227 gene locus_tag LOCUS_20920 gene ruvC 592712 593227 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939533.1 protein_id gnl|my_center|LOCUS_20920 593373 593978 gene locus_tag LOCUS_20930 593373 593978 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939531.1 protein_id gnl|my_center|LOCUS_20930 593978 594961 gene locus_tag LOCUS_20940 gene ruvB 593978 594961 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939530.1 protein_id gnl|my_center|LOCUS_20940 595236 595958 gene locus_tag LOCUS_20950 gene thyX 595236 595958 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939529.1 protein_id gnl|my_center|LOCUS_20950 596317 597876 gene locus_tag LOCUS_20960 596317 597876 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939527.1 protein_id gnl|my_center|LOCUS_20960 598138 598695 gene locus_tag LOCUS_20970 598138 598695 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939526.1 protein_id gnl|my_center|LOCUS_20970 598725 598913 gene locus_tag LOCUS_20980 598725 598913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 598986 600650 gene locus_tag LOCUS_20990 598986 600650 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939525.1 protein_id gnl|my_center|LOCUS_20990 602969 600795 gene locus_tag LOCUS_21000 602969 600795 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939521.1 protein_id gnl|my_center|LOCUS_21000 603084 603323 gene locus_tag LOCUS_21010 603084 603323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940656.1 protein_id gnl|my_center|LOCUS_21010 603897 603445 gene locus_tag LOCUS_21020 603897 603445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938521.1 protein_id gnl|my_center|LOCUS_21020 604769 604254 gene locus_tag LOCUS_21030 gene tpx 604769 604254 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938524.1 protein_id gnl|my_center|LOCUS_21030 605213 606418 gene locus_tag LOCUS_21040 605213 606418 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938527.1 protein_id gnl|my_center|LOCUS_21040 606525 606863 gene locus_tag LOCUS_21050 606525 606863 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938528.1 protein_id gnl|my_center|LOCUS_21050 606947 609604 gene locus_tag LOCUS_21060 gene glnD 606947 609604 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938529.1 protein_id gnl|my_center|LOCUS_21060 609761 610489 gene locus_tag LOCUS_21070 609761 610489 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792492.1 protein_id gnl|my_center|LOCUS_21070 611320 610577 gene locus_tag LOCUS_21080 611320 610577 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938532.1 protein_id gnl|my_center|LOCUS_21080 612098 611307 gene locus_tag LOCUS_21090 612098 611307 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792490.1 protein_id gnl|my_center|LOCUS_21090 612935 612195 gene locus_tag LOCUS_21100 612935 612195 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938534.1 protein_id gnl|my_center|LOCUS_21100 613714 613115 gene locus_tag LOCUS_21110 613714 613115 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938535.1 protein_id gnl|my_center|LOCUS_21110 613988 613704 gene locus_tag LOCUS_21120 613988 613704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 614000 614290 gene locus_tag LOCUS_21130 614000 614290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 614259 614576 gene locus_tag LOCUS_21140 614259 614576 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938537.1 protein_id gnl|my_center|LOCUS_21140 615543 614707 gene locus_tag LOCUS_21150 615543 614707 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938538.1 protein_id gnl|my_center|LOCUS_21150 616215 615562 gene locus_tag LOCUS_21160 616215 615562 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938539.1 protein_id gnl|my_center|LOCUS_21160 616665 616219 gene locus_tag LOCUS_21170 gene mlaD 616665 616219 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938540.1 protein_id gnl|my_center|LOCUS_21170 617527 616706 gene locus_tag LOCUS_21180 617527 616706 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938541.1 protein_id gnl|my_center|LOCUS_21180 618355 617549 gene locus_tag LOCUS_21190 618355 617549 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938542.1 protein_id gnl|my_center|LOCUS_21190 619372 618539 gene locus_tag LOCUS_21200 619372 618539 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938543.1 protein_id gnl|my_center|LOCUS_21200 621040 619385 gene locus_tag LOCUS_21210 gene argS 621040 619385 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938544.1 protein_id gnl|my_center|LOCUS_21210 622391 621432 gene locus_tag LOCUS_21220 gene fabD 622391 621432 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938545.1 protein_id gnl|my_center|LOCUS_21220 622561 623217 gene locus_tag LOCUS_21230 622561 623217 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938546.1 protein_id gnl|my_center|LOCUS_21230 623402 623178 gene locus_tag LOCUS_21240 623402 623178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938547.1 protein_id gnl|my_center|LOCUS_21240 623456 623752 gene locus_tag LOCUS_21250 623456 623752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 623918 626083 gene locus_tag LOCUS_21260 623918 626083 CDS product STT3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938548.1 protein_id gnl|my_center|LOCUS_21260 626628 626158 gene locus_tag LOCUS_21270 626628 626158 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938550.1 protein_id gnl|my_center|LOCUS_21270 626741 627433 gene locus_tag LOCUS_21280 626741 627433 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938551.1 protein_id gnl|my_center|LOCUS_21280 627977 628432 gene locus_tag LOCUS_21290 627977 628432 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_21290 628837 630288 gene locus_tag LOCUS_21300 gene glgA 628837 630288 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939519.1 protein_id gnl|my_center|LOCUS_21300 630311 632221 gene locus_tag LOCUS_21310 gene glgB 630311 632221 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939518.1 protein_id gnl|my_center|LOCUS_21310 632266 633171 gene locus_tag LOCUS_21320 632266 633171 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939517.1 protein_id gnl|my_center|LOCUS_21320 634253 633294 gene locus_tag LOCUS_21330 634253 633294 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939337.1 protein_id gnl|my_center|LOCUS_21330 634835 634275 gene locus_tag LOCUS_21340 634835 634275 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792111.1 protein_id gnl|my_center|LOCUS_21340 635064 636746 gene locus_tag LOCUS_21350 gene ricT 635064 636746 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939335.1 protein_id gnl|my_center|LOCUS_21350 636849 638816 gene locus_tag LOCUS_21360 gene metG 636849 638816 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_21360 640142 638979 gene locus_tag LOCUS_21370 gene nrfD 640142 638979 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938582.1 protein_id gnl|my_center|LOCUS_21370 640928 640152 gene locus_tag LOCUS_21380 640928 640152 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938583.1 protein_id gnl|my_center|LOCUS_21380 641308 640928 gene locus_tag LOCUS_21390 gene dsrJ 641308 640928 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938584.1 protein_id gnl|my_center|LOCUS_21390 642921 641311 gene locus_tag LOCUS_21400 gene dsrK 642921 641311 CDS product [DsrC]-trisulfide reductase DsrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938585.1 protein_id gnl|my_center|LOCUS_21400 643938 642931 gene locus_tag LOCUS_21410 gene dsrM 643938 642931 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938586.1 protein_id gnl|my_center|LOCUS_21410 644497 643958 gene locus_tag LOCUS_21420 644497 643958 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938587.1 protein_id gnl|my_center|LOCUS_21420 644707 644513 gene locus_tag LOCUS_21430 644707 644513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 645999 644998 gene locus_tag LOCUS_21440 645999 644998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294577.1 protein_id gnl|my_center|LOCUS_21440 646244 646897 gene locus_tag LOCUS_21450 646244 646897 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932386.1 protein_id gnl|my_center|LOCUS_21450 646971 647753 gene locus_tag LOCUS_21460 646971 647753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 649158 647881 gene locus_tag LOCUS_21470 gene sat 649158 647881 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938590.1 protein_id gnl|my_center|LOCUS_21470 649291 649103 gene locus_tag LOCUS_21480 649291 649103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 649853 650224 gene locus_tag LOCUS_21490 gene rpsL 649853 650224 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_21490 650243 650713 gene locus_tag LOCUS_21500 gene rpsG 650243 650713 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938594.1 protein_id gnl|my_center|LOCUS_21500 650729 652804 gene locus_tag LOCUS_21510 gene fusA 650729 652804 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938595.1 protein_id gnl|my_center|LOCUS_21510 653509 653826 gene locus_tag LOCUS_21520 gene rpsJ 653509 653826 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938597.1 protein_id gnl|my_center|LOCUS_21520 653839 654468 gene locus_tag LOCUS_21530 gene rplC 653839 654468 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938598.1 protein_id gnl|my_center|LOCUS_21530 654481 655101 gene locus_tag LOCUS_21540 gene rplD 654481 655101 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938599.1 protein_id gnl|my_center|LOCUS_21540 655114 655404 gene locus_tag LOCUS_21550 gene rplW 655114 655404 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792455.1 protein_id gnl|my_center|LOCUS_21550 655408 656238 gene locus_tag LOCUS_21560 gene rplB 655408 656238 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938601.1 protein_id gnl|my_center|LOCUS_21560 656248 656529 gene locus_tag LOCUS_21570 gene rpsS 656248 656529 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_21570 656543 656875 gene locus_tag LOCUS_21580 gene rplV 656543 656875 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938603.1 protein_id gnl|my_center|LOCUS_21580 656885 657526 gene locus_tag LOCUS_21590 gene rpsC 656885 657526 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938604.1 protein_id gnl|my_center|LOCUS_21590 657526 657939 gene locus_tag LOCUS_21600 gene rplP 657526 657939 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938605.1 protein_id gnl|my_center|LOCUS_21600 657940 658128 gene locus_tag LOCUS_21610 gene rpmC 657940 658128 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938606.1 protein_id gnl|my_center|LOCUS_21610 658130 658396 gene locus_tag LOCUS_21620 gene rpsQ 658130 658396 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938607.1 protein_id gnl|my_center|LOCUS_21620 658406 658774 gene locus_tag LOCUS_21630 gene rplN 658406 658774 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938608.1 protein_id gnl|my_center|LOCUS_21630 658784 659107 gene locus_tag LOCUS_21640 gene rplX 658784 659107 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938609.1 protein_id gnl|my_center|LOCUS_21640 659120 659659 gene locus_tag LOCUS_21650 gene rplE 659120 659659 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938610.1 protein_id gnl|my_center|LOCUS_21650 659672 659857 gene locus_tag LOCUS_21660 659672 659857 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938611.1 protein_id gnl|my_center|LOCUS_21660 659876 660256 gene locus_tag LOCUS_21670 gene rpsH 659876 660256 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938612.1 protein_id gnl|my_center|LOCUS_21670 660268 660804 gene locus_tag LOCUS_21680 gene rplF 660268 660804 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938613.1 protein_id gnl|my_center|LOCUS_21680 660819 661175 gene locus_tag LOCUS_21690 gene rplR 660819 661175 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938614.1 protein_id gnl|my_center|LOCUS_21690 661195 661686 gene locus_tag LOCUS_21700 gene rpsE 661195 661686 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938615.1 protein_id gnl|my_center|LOCUS_21700 661698 661868 gene locus_tag LOCUS_21710 gene rpmD 661698 661868 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421137.1 protein_id gnl|my_center|LOCUS_21710 661868 662317 gene locus_tag LOCUS_21720 gene rplO 661868 662317 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938617.1 protein_id gnl|my_center|LOCUS_21720 662325 663641 gene locus_tag LOCUS_21730 gene secY 662325 663641 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938618.1 protein_id gnl|my_center|LOCUS_21730 663645 664412 gene locus_tag LOCUS_21740 gene map 663645 664412 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938619.1 protein_id gnl|my_center|LOCUS_21740 664673 665044 gene locus_tag LOCUS_21750 gene rpsM 664673 665044 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938621.1 protein_id gnl|my_center|LOCUS_21750 665199 665588 gene locus_tag LOCUS_21760 gene rpsK 665199 665588 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938622.1 protein_id gnl|my_center|LOCUS_21760 665604 666230 gene locus_tag LOCUS_21770 gene rpsD 665604 666230 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938623.1 protein_id gnl|my_center|LOCUS_21770 666244 667287 gene locus_tag LOCUS_21780 666244 667287 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938624.1 protein_id gnl|my_center|LOCUS_21780 667334 667780 gene locus_tag LOCUS_21790 667334 667780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 667910 668836 gene locus_tag LOCUS_21800 667910 668836 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938626.1 protein_id gnl|my_center|LOCUS_21800 669034 669900 gene locus_tag LOCUS_21810 gene selD 669034 669900 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:B8DNL1 protein_id gnl|my_center|LOCUS_21810 670085 670168 gene locus_tag LOCUS_t00350 670085 670168 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 670270 671586 gene locus_tag LOCUS_21820 gene tig 670270 671586 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938629.1 protein_id gnl|my_center|LOCUS_21820 671834 672433 gene locus_tag LOCUS_21830 gene clpP 671834 672433 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938630.1 protein_id gnl|my_center|LOCUS_21830 672447 673700 gene locus_tag LOCUS_21840 gene clpX 672447 673700 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938631.1 protein_id gnl|my_center|LOCUS_21840 673872 676346 gene locus_tag LOCUS_21850 gene lon 673872 676346 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938632.1 protein_id gnl|my_center|LOCUS_21850 677666 676521 gene locus_tag LOCUS_21860 gene lpxB 677666 676521 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938656.1 protein_id gnl|my_center|LOCUS_21860 678707 677685 gene locus_tag LOCUS_21870 678707 677685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938657.1 protein_id gnl|my_center|LOCUS_21870 679603 678704 gene locus_tag LOCUS_21880 gene rfbD 679603 678704 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938658.1 protein_id gnl|my_center|LOCUS_21880 680625 679600 gene locus_tag LOCUS_21890 gene rfbB 680625 679600 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938659.1 protein_id gnl|my_center|LOCUS_21890 680906 681721 gene locus_tag LOCUS_21900 680906 681721 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938660.1 protein_id gnl|my_center|LOCUS_21900 683040 681868 gene locus_tag LOCUS_21910 683040 681868 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990816.1 protein_id gnl|my_center|LOCUS_21910 683508 684680 gene locus_tag LOCUS_21920 683508 684680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 686065 684791 gene locus_tag LOCUS_21930 686065 684791 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938700.1 protein_id gnl|my_center|LOCUS_21930 686194 688305 gene locus_tag LOCUS_21940 686194 688305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 688368 688841 gene locus_tag LOCUS_21950 688368 688841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 690097 689105 gene locus_tag LOCUS_21960 690097 689105 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629424.1 protein_id gnl|my_center|LOCUS_21960 690293 691582 gene locus_tag LOCUS_21970 gene thiC 690293 691582 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938704.1 protein_id gnl|my_center|LOCUS_21970 691923 692753 gene locus_tag LOCUS_21980 gene zupT 691923 692753 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176713.1 protein_id gnl|my_center|LOCUS_21980 693835 692867 gene locus_tag LOCUS_21990 693835 692867 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938705.1 protein_id gnl|my_center|LOCUS_21990 693976 695217 gene locus_tag LOCUS_22000 693976 695217 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842634.1 protein_id gnl|my_center|LOCUS_22000 695214 698240 gene locus_tag LOCUS_22010 695214 698240 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938707.1 protein_id gnl|my_center|LOCUS_22010 698343 701753 gene locus_tag LOCUS_22020 698343 701753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 702432 704138 gene locus_tag LOCUS_22030 702432 704138 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938711.1 protein_id gnl|my_center|LOCUS_22030 704138 705550 gene locus_tag LOCUS_22040 704138 705550 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938712.1 protein_id gnl|my_center|LOCUS_22040 705723 706094 gene locus_tag LOCUS_22050 705723 706094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 706304 706495 gene locus_tag LOCUS_22060 706304 706495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 707298 706816 gene locus_tag LOCUS_22070 707298 706816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 708611 707547 gene locus_tag LOCUS_22080 708611 707547 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792396.1 protein_id gnl|my_center|LOCUS_22080 708987 708772 gene locus_tag LOCUS_22090 708987 708772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938676.1 protein_id gnl|my_center|LOCUS_22090 709506 709321 gene locus_tag LOCUS_22100 709506 709321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 711097 709751 gene locus_tag LOCUS_22110 711097 709751 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405015.1 protein_id gnl|my_center|LOCUS_22110 711307 712881 gene locus_tag LOCUS_22120 711307 712881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 713118 713042 gene locus_tag LOCUS_t00360 713118 713042 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 713357 714442 gene locus_tag LOCUS_22130 713357 714442 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939356.1 protein_id gnl|my_center|LOCUS_22130 714499 716430 gene locus_tag LOCUS_22140 714499 716430 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939355.1 protein_id gnl|my_center|LOCUS_22140 716431 717309 gene locus_tag LOCUS_22150 716431 717309 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939354.1 protein_id gnl|my_center|LOCUS_22150 717354 718130 gene locus_tag LOCUS_22160 717354 718130 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939353.1 protein_id gnl|my_center|LOCUS_22160 718127 718891 gene locus_tag LOCUS_22170 718127 718891 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939352.1 protein_id gnl|my_center|LOCUS_22170 718901 719269 gene locus_tag LOCUS_22180 718901 719269 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939351.1 protein_id gnl|my_center|LOCUS_22180 719407 722292 gene locus_tag LOCUS_22190 719407 722292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 723026 724072 gene locus_tag LOCUS_22200 723026 724072 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546086.1 protein_id gnl|my_center|LOCUS_22200 724062 724895 gene locus_tag LOCUS_22210 724062 724895 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546652.1 protein_id gnl|my_center|LOCUS_22210 724905 725651 gene locus_tag LOCUS_22220 724905 725651 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546316.1 protein_id gnl|my_center|LOCUS_22220 725671 727263 gene locus_tag LOCUS_22230 725671 727263 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544964.1 protein_id gnl|my_center|LOCUS_22230 727884 727330 gene locus_tag LOCUS_22240 727884 727330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 728216 728010 gene locus_tag LOCUS_22250 728216 728010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 728917 728294 gene locus_tag LOCUS_22260 728917 728294 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524345.1 protein_id gnl|my_center|LOCUS_22260 729319 728921 gene locus_tag LOCUS_22270 gene queD 729319 728921 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938647.1 protein_id gnl|my_center|LOCUS_22270 732794 729312 gene locus_tag LOCUS_22280 gene dnaE 732794 729312 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938648.1 protein_id gnl|my_center|LOCUS_22280 733001 733462 gene locus_tag LOCUS_22290 733001 733462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 733468 734394 gene locus_tag LOCUS_22300 733468 734394 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938651.1 protein_id gnl|my_center|LOCUS_22300 738658 734756 gene locus_tag LOCUS_22310 738658 734756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 739106 740287 gene locus_tag LOCUS_22320 739106 740287 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108945.1 protein_id gnl|my_center|LOCUS_22320 740299 741057 gene locus_tag LOCUS_22330 740299 741057 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938652.1 protein_id gnl|my_center|LOCUS_22330 741846 741142 gene locus_tag LOCUS_22340 741846 741142 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792434.1 protein_id gnl|my_center|LOCUS_22340 741772 742023 gene locus_tag LOCUS_22350 741772 742023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 742067 743239 gene locus_tag LOCUS_22360 742067 743239 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_22360 744269 743322 gene locus_tag LOCUS_22370 744269 743322 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294576.1 protein_id gnl|my_center|LOCUS_22370 744243 744497 gene locus_tag LOCUS_22380 744243 744497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 744651 745664 gene locus_tag LOCUS_22390 gene galE 744651 745664 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938655.1 protein_id gnl|my_center|LOCUS_22390 746099 746869 gene locus_tag LOCUS_22400 746099 746869 CDS product FlgO family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938634.1 protein_id gnl|my_center|LOCUS_22400 746879 747229 gene locus_tag LOCUS_22410 746879 747229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 747241 747927 gene locus_tag LOCUS_22420 747241 747927 CDS product FlgO family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938633.1 protein_id gnl|my_center|LOCUS_22420 749900 748065 gene locus_tag LOCUS_22430 gene typA 749900 748065 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939506.1 protein_id gnl|my_center|LOCUS_22430 752201 750300 gene locus_tag LOCUS_22440 752201 750300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 752478 752732 gene locus_tag LOCUS_22450 752478 752732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 752753 753235 gene locus_tag LOCUS_22460 752753 753235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 754114 753317 gene locus_tag LOCUS_22470 754114 753317 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939505.1 protein_id gnl|my_center|LOCUS_22470 754269 755024 gene locus_tag LOCUS_22480 754269 755024 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939504.1 protein_id gnl|my_center|LOCUS_22480 755014 755748 gene locus_tag LOCUS_22490 755014 755748 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939503.1 protein_id gnl|my_center|LOCUS_22490 755761 756141 gene locus_tag LOCUS_22500 755761 756141 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939502.1 protein_id gnl|my_center|LOCUS_22500 756167 757585 gene locus_tag LOCUS_22510 756167 757585 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939501.1 protein_id gnl|my_center|LOCUS_22510 757675 759942 gene locus_tag LOCUS_22520 757675 759942 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939500.1 protein_id gnl|my_center|LOCUS_22520 759954 760604 gene locus_tag LOCUS_22530 759954 760604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939499.1 protein_id gnl|my_center|LOCUS_22530 760617 760964 gene locus_tag LOCUS_22540 760617 760964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 761014 761556 gene locus_tag LOCUS_22550 761014 761556 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939497.1 protein_id gnl|my_center|LOCUS_22550 761909 762967 gene locus_tag LOCUS_22560 761909 762967 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791554.1 protein_id gnl|my_center|LOCUS_22560 763043 764155 gene locus_tag LOCUS_22570 763043 764155 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_22570 764152 765018 gene locus_tag LOCUS_22580 764152 765018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 765015 765869 gene locus_tag LOCUS_22590 765015 765869 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257555.1 protein_id gnl|my_center|LOCUS_22590 767999 766074 gene locus_tag LOCUS_22600 767999 766074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 768653 769990 gene locus_tag LOCUS_22610 768653 769990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 769993 773277 gene locus_tag LOCUS_22620 769993 773277 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_22620 773870 774913 gene locus_tag LOCUS_22630 773870 774913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 774961 775572 gene locus_tag LOCUS_22640 774961 775572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 776168 782758 gene locus_tag LOCUS_22650 776168 782758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 782925 784616 gene locus_tag LOCUS_22660 782925 784616 CDS product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205070.1 protein_id gnl|my_center|LOCUS_22660 784613 785113 gene locus_tag LOCUS_22670 784613 785113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 785116 786321 gene locus_tag LOCUS_22680 785116 786321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 786609 786445 gene locus_tag LOCUS_22690 786609 786445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 786757 787854 gene locus_tag LOCUS_22700 786757 787854 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930810.1 protein_id gnl|my_center|LOCUS_22700 787947 790577 gene locus_tag LOCUS_22710 787947 790577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 791427 790558 gene locus_tag LOCUS_22720 791427 790558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 791807 795046 gene locus_tag LOCUS_22730 791807 795046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 797557 795104 gene locus_tag LOCUS_22740 797557 795104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 798130 800466 gene locus_tag LOCUS_22750 798130 800466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 800522 800776 gene locus_tag LOCUS_22760 800522 800776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 802043 800745 gene locus_tag LOCUS_22770 802043 800745 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673537.1 protein_id gnl|my_center|LOCUS_22770 803094 802258 gene locus_tag LOCUS_22780 803094 802258 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940021.1 protein_id gnl|my_center|LOCUS_22780 803255 804430 gene locus_tag LOCUS_22790 gene mqnE 803255 804430 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940022.1 protein_id gnl|my_center|LOCUS_22790 804430 805557 gene locus_tag LOCUS_22800 gene mqnC 804430 805557 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940023.1 protein_id gnl|my_center|LOCUS_22800 805554 806432 gene locus_tag LOCUS_22810 805554 806432 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940024.1 protein_id gnl|my_center|LOCUS_22810 806669 807745 gene locus_tag LOCUS_22820 806669 807745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 807855 808496 gene locus_tag LOCUS_22830 807855 808496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 808489 808671 gene locus_tag LOCUS_22840 808489 808671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 811010 808905 gene locus_tag LOCUS_22850 gene acs 811010 808905 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938049.1 protein_id gnl|my_center|LOCUS_22850 811903 811007 gene locus_tag LOCUS_22860 811903 811007 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938050.1 protein_id gnl|my_center|LOCUS_22860 812208 812690 gene locus_tag LOCUS_22870 812208 812690 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869593.1 protein_id gnl|my_center|LOCUS_22870 812802 813230 gene locus_tag LOCUS_22880 812802 813230 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938935.1 protein_id gnl|my_center|LOCUS_22880 814621 813347 gene locus_tag LOCUS_22890 814621 813347 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938275.1 protein_id gnl|my_center|LOCUS_22890 814796 814966 gene locus_tag LOCUS_22900 814796 814966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 815446 815030 gene locus_tag LOCUS_22910 815446 815030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 818765 815643 gene locus_tag LOCUS_22920 818765 815643 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_22920 820508 818883 gene locus_tag LOCUS_22930 820508 818883 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226507.1 protein_id gnl|my_center|LOCUS_22930 821217 820561 gene locus_tag LOCUS_22940 821217 820561 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938281.1 protein_id gnl|my_center|LOCUS_22940 822392 821586 gene locus_tag LOCUS_22950 822392 821586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 823342 822698 gene locus_tag LOCUS_22960 823342 822698 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938282.1 protein_id gnl|my_center|LOCUS_22960 824784 823336 gene locus_tag LOCUS_22970 gene miaB 824784 823336 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938283.1 protein_id gnl|my_center|LOCUS_22970 825169 824906 gene locus_tag LOCUS_22980 825169 824906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 825823 825461 gene locus_tag LOCUS_22990 825823 825461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 826247 826447 gene locus_tag LOCUS_23000 826247 826447 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938286.1 protein_id gnl|my_center|LOCUS_23000 826771 826574 gene locus_tag LOCUS_23010 826771 826574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 827727 826801 gene locus_tag LOCUS_23020 827727 826801 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938287.1 protein_id gnl|my_center|LOCUS_23020 828298 827888 gene locus_tag LOCUS_23030 828298 827888 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294592.1 protein_id gnl|my_center|LOCUS_23030 828929 828627 gene locus_tag LOCUS_23040 828929 828627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 829046 829771 gene locus_tag LOCUS_23050 gene nth 829046 829771 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938289.1 protein_id gnl|my_center|LOCUS_23050 829768 830607 gene locus_tag LOCUS_23060 829768 830607 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938290.1 protein_id gnl|my_center|LOCUS_23060 830778 831734 gene locus_tag LOCUS_23070 830778 831734 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938291.1 protein_id gnl|my_center|LOCUS_23070 832638 831805 gene locus_tag LOCUS_23080 832638 831805 CDS product DUF4344 domain-containing metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464873.1 protein_id gnl|my_center|LOCUS_23080 834026 832854 gene locus_tag LOCUS_23090 gene metK 834026 832854 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939720.1 protein_id gnl|my_center|LOCUS_23090 834730 834023 gene locus_tag LOCUS_23100 834730 834023 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 protein_id gnl|my_center|LOCUS_23100 835638 834790 gene locus_tag LOCUS_23110 gene panC 835638 834790 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939719.1 protein_id gnl|my_center|LOCUS_23110 836027 836620 gene locus_tag LOCUS_23120 836027 836620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939718.1 protein_id gnl|my_center|LOCUS_23120 837393 836617 gene locus_tag LOCUS_23130 gene panB 837393 836617 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939717.1 protein_id gnl|my_center|LOCUS_23130 838051 838938 gene locus_tag LOCUS_23140 838051 838938 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939715.1 protein_id gnl|my_center|LOCUS_23140 839149 839820 gene locus_tag LOCUS_23150 839149 839820 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939714.1 protein_id gnl|my_center|LOCUS_23150 840261 839962 gene locus_tag LOCUS_23160 840261 839962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 840524 841147 gene locus_tag LOCUS_23170 840524 841147 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939708.1 protein_id gnl|my_center|LOCUS_23170 842534 841185 gene locus_tag LOCUS_23180 gene trmFO 842534 841185 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791925.1 protein_id gnl|my_center|LOCUS_23180 843608 842733 gene locus_tag LOCUS_23190 843608 842733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 846246 843679 gene locus_tag LOCUS_23200 gene glgP 846246 843679 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939622.1 protein_id gnl|my_center|LOCUS_23200 846685 846503 gene locus_tag LOCUS_23210 846685 846503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 846670 847191 gene locus_tag LOCUS_23220 gene dut 846670 847191 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791926.1 protein_id gnl|my_center|LOCUS_23220 847253 848455 gene locus_tag LOCUS_23230 847253 848455 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939620.1 protein_id gnl|my_center|LOCUS_23230 848641 848919 gene locus_tag LOCUS_23240 848641 848919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 849499 850236 gene locus_tag LOCUS_23250 849499 850236 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939616.1 protein_id gnl|my_center|LOCUS_23250 850304 851116 gene locus_tag LOCUS_23260 850304 851116 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939615.1 protein_id gnl|my_center|LOCUS_23260 851185 851886 gene locus_tag LOCUS_23270 851185 851886 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939614.1 protein_id gnl|my_center|LOCUS_23270 851897 852589 gene locus_tag LOCUS_23280 851897 852589 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939613.1 protein_id gnl|my_center|LOCUS_23280 852597 853451 gene locus_tag LOCUS_23290 852597 853451 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939612.1 protein_id gnl|my_center|LOCUS_23290 853937 854719 gene locus_tag LOCUS_23300 853937 854719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 855019 856101 gene locus_tag LOCUS_23310 855019 856101 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938297.1 protein_id gnl|my_center|LOCUS_23310 858249 856114 gene locus_tag LOCUS_23320 858249 856114 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294591.1 protein_id gnl|my_center|LOCUS_23320 858369 858443 gene locus_tag LOCUS_t00370 858369 858443 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 858476 858550 gene locus_tag LOCUS_t00380 858476 858550 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 859889 858639 gene locus_tag LOCUS_23330 859889 858639 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938299.1 protein_id gnl|my_center|LOCUS_23330 860084 860500 gene locus_tag LOCUS_23340 860084 860500 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792591.1 protein_id gnl|my_center|LOCUS_23340 860510 861034 gene locus_tag LOCUS_23350 860510 861034 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938301.1 protein_id gnl|my_center|LOCUS_23350 861192 862055 gene locus_tag LOCUS_23360 861192 862055 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938302.1 protein_id gnl|my_center|LOCUS_23360 862149 863093 gene locus_tag LOCUS_23370 862149 863093 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938246.1 protein_id gnl|my_center|LOCUS_23370 863531 863094 gene locus_tag LOCUS_23380 863531 863094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 863959 864765 gene locus_tag LOCUS_23390 863959 864765 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940146.1 protein_id gnl|my_center|LOCUS_23390 864938 865354 gene locus_tag LOCUS_23400 864938 865354 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787381.1 protein_id gnl|my_center|LOCUS_23400 865663 866592 gene locus_tag LOCUS_23410 865663 866592 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940340.1 protein_id gnl|my_center|LOCUS_23410 867154 866759 gene locus_tag LOCUS_23420 867154 866759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 867462 867241 gene locus_tag LOCUS_23430 867462 867241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 867758 868516 gene locus_tag LOCUS_23440 867758 868516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 869747 868587 gene locus_tag LOCUS_23450 869747 868587 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938320.1 protein_id gnl|my_center|LOCUS_23450 870549 869749 gene locus_tag LOCUS_23460 870549 869749 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938321.1 protein_id gnl|my_center|LOCUS_23460 871415 870657 gene locus_tag LOCUS_23470 871415 870657 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938322.1 protein_id gnl|my_center|LOCUS_23470 873050 871434 gene locus_tag LOCUS_23480 gene coaE 873050 871434 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938323.1 protein_id gnl|my_center|LOCUS_23480 873266 873892 gene locus_tag LOCUS_23490 gene upp 873266 873892 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938324.1 protein_id gnl|my_center|LOCUS_23490 874095 875348 gene locus_tag LOCUS_23500 874095 875348 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938325.1 protein_id gnl|my_center|LOCUS_23500 875505 876392 gene locus_tag LOCUS_23510 875505 876392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 >Feature sequence09 896 279 gene locus_tag LOCUS_23520 896 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 1507 908 gene locus_tag LOCUS_23530 1507 908 CDS product DUF2313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940116.1 protein_id gnl|my_center|LOCUS_23530 2577 1507 gene locus_tag LOCUS_23540 2577 1507 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937528.1 protein_id gnl|my_center|LOCUS_23540 3026 2574 gene locus_tag LOCUS_23550 3026 2574 CDS product phage GP46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763330.1 protein_id gnl|my_center|LOCUS_23550 3713 3027 gene locus_tag LOCUS_23560 3713 3027 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940119.1 protein_id gnl|my_center|LOCUS_23560 4801 3713 gene locus_tag LOCUS_23570 4801 3713 CDS product contractile injection system protein, VgrG/Pvc8 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072645.1 protein_id gnl|my_center|LOCUS_23570 5969 4791 gene locus_tag LOCUS_23580 5969 4791 CDS product DNA circularization N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940121.1 protein_id gnl|my_center|LOCUS_23580 7841 5979 gene locus_tag LOCUS_23590 7841 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 8326 7937 gene locus_tag LOCUS_23600 8326 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 8689 8336 gene locus_tag LOCUS_23610 8689 8336 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693533.1 protein_id gnl|my_center|LOCUS_23610 10192 8726 gene locus_tag LOCUS_23620 10192 8726 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937520.1 protein_id gnl|my_center|LOCUS_23620 10417 10196 gene locus_tag LOCUS_23630 10417 10196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 11030 10422 gene locus_tag LOCUS_23640 11030 10422 CDS product DUF1834 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939982.1 protein_id gnl|my_center|LOCUS_23640 11516 11031 gene locus_tag LOCUS_23650 11516 11031 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939977.1 protein_id gnl|my_center|LOCUS_23650 11932 11516 gene locus_tag LOCUS_23660 11932 11516 CDS product DUF1320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071001.1 protein_id gnl|my_center|LOCUS_23660 12240 11944 gene locus_tag LOCUS_23670 12240 11944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 13146 12253 gene locus_tag LOCUS_23680 13146 12253 CDS product Mu-like prophage major head subunit gpT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070999.1 protein_id gnl|my_center|LOCUS_23680 13556 13155 gene locus_tag LOCUS_23690 13556 13155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 14672 13557 gene locus_tag LOCUS_23700 14672 13557 CDS product phage protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939978.1 protein_id gnl|my_center|LOCUS_23700 16354 15053 gene locus_tag LOCUS_23710 16354 15053 CDS product phage head morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046893.1 protein_id gnl|my_center|LOCUS_23710 17909 16338 gene locus_tag LOCUS_23720 17909 16338 CDS product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072627.1 protein_id gnl|my_center|LOCUS_23720 19438 17909 gene locus_tag LOCUS_23730 19438 17909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169542415.1 protein_id gnl|my_center|LOCUS_23730 19992 19435 gene locus_tag LOCUS_23740 19992 19435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 20297 20001 gene locus_tag LOCUS_23750 20297 20001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072623.1 protein_id gnl|my_center|LOCUS_23750 20658 20299 gene locus_tag LOCUS_23760 20658 20299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 20878 20651 gene locus_tag LOCUS_23770 20878 20651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 21344 20922 gene locus_tag LOCUS_23780 21344 20922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 21682 21344 gene locus_tag LOCUS_23790 21682 21344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 22287 21682 gene locus_tag LOCUS_23800 22287 21682 CDS product glycosyl hydrolase 108 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174404961.1 protein_id gnl|my_center|LOCUS_23800 22899 22423 gene locus_tag LOCUS_23810 22899 22423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 23676 23005 gene locus_tag LOCUS_23820 23676 23005 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939955.1 protein_id gnl|my_center|LOCUS_23820 23891 24379 gene locus_tag LOCUS_23830 23891 24379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938442.1 protein_id gnl|my_center|LOCUS_23830 24376 24711 gene locus_tag LOCUS_23840 24376 24711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 24920 25231 gene locus_tag LOCUS_23850 24920 25231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 25228 25527 gene locus_tag LOCUS_23860 25228 25527 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937611.1 protein_id gnl|my_center|LOCUS_23860 25648 25926 gene locus_tag LOCUS_23870 25648 25926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 25907 26104 gene locus_tag LOCUS_23880 25907 26104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 26097 26345 gene locus_tag LOCUS_23890 26097 26345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 26338 27159 gene locus_tag LOCUS_23900 26338 27159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 27162 27491 gene locus_tag LOCUS_23910 27162 27491 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049025.1 protein_id gnl|my_center|LOCUS_23910 27548 28642 gene locus_tag LOCUS_23920 27548 28642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 28651 30414 gene locus_tag LOCUS_23930 28651 30414 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990532.1 protein_id gnl|my_center|LOCUS_23930 30414 31568 gene locus_tag LOCUS_23940 30414 31568 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960679.1 protein_id gnl|my_center|LOCUS_23940 31581 32180 gene locus_tag LOCUS_23950 31581 32180 CDS product DUF3164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072605.1 protein_id gnl|my_center|LOCUS_23950 32193 32645 gene locus_tag LOCUS_23960 32193 32645 CDS product regulatory protein GemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170114.1 protein_id gnl|my_center|LOCUS_23960 32642 32989 gene locus_tag LOCUS_23970 32642 32989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 33569 33760 gene locus_tag LOCUS_23980 33569 33760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 34493 34777 gene locus_tag LOCUS_23990 34493 34777 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_23990 34955 35254 gene locus_tag LOCUS_24000 34955 35254 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939018.1 protein_id gnl|my_center|LOCUS_24000 36369 35293 gene locus_tag LOCUS_24010 36369 35293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055010900.1 protein_id gnl|my_center|LOCUS_24010 37067 36369 gene locus_tag LOCUS_24020 37067 36369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24020 37621 37064 gene locus_tag LOCUS_24030 37621 37064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 38538 37633 gene locus_tag LOCUS_24040 38538 37633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 39306 38545 gene locus_tag LOCUS_24050 39306 38545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 40448 39315 gene locus_tag LOCUS_24060 40448 39315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 41779 40448 gene locus_tag LOCUS_24070 41779 40448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 42378 41794 gene locus_tag LOCUS_24080 42378 41794 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767209.1 protein_id gnl|my_center|LOCUS_24080 43560 42379 gene locus_tag LOCUS_24090 43560 42379 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097385.1 protein_id gnl|my_center|LOCUS_24090 43487 43885 gene locus_tag LOCUS_24100 43487 43885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 43866 44180 gene locus_tag LOCUS_24110 43866 44180 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932149.1 protein_id gnl|my_center|LOCUS_24110 44528 44190 gene locus_tag LOCUS_24120 44528 44190 CDS product DUF2590 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938931.1 protein_id gnl|my_center|LOCUS_24120 46316 44532 gene locus_tag LOCUS_24130 46316 44532 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792272.1 protein_id gnl|my_center|LOCUS_24130 46482 46330 gene locus_tag LOCUS_24140 46482 46330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 46775 46506 gene locus_tag LOCUS_24150 46775 46506 CDS product putative phage tail assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097388.1 protein_id gnl|my_center|LOCUS_24150 47044 46784 gene locus_tag LOCUS_24160 47044 46784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 47576 47046 gene locus_tag LOCUS_24170 47576 47046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 48061 47573 gene locus_tag LOCUS_24180 48061 47573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 48261 48058 gene locus_tag LOCUS_24190 48261 48058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 48716 48270 gene locus_tag LOCUS_24200 48716 48270 CDS product DUF2597 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097392.1 protein_id gnl|my_center|LOCUS_24200 49850 48720 gene locus_tag LOCUS_24210 49850 48720 CDS product DUF2586 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220193.1 protein_id gnl|my_center|LOCUS_24210 50612 49869 gene locus_tag LOCUS_24220 50612 49869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 51075 50605 gene locus_tag LOCUS_24230 51075 50605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 >Feature sequence10 <1 5104 gene locus_tag LOCUS_24240 <1 5104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086345.1:VCBS domain-containing protein 5255 6643 gene locus_tag LOCUS_24250 5255 6643 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938312.1 protein_id gnl|my_center|LOCUS_24250 6968 7852 gene locus_tag LOCUS_24260 6968 7852 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812339.1 protein_id gnl|my_center|LOCUS_24260 8070 7984 gene locus_tag LOCUS_t00390 8070 7984 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8535 9479 gene locus_tag LOCUS_24270 8535 9479 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937757.1 protein_id gnl|my_center|LOCUS_24270 9516 11330 gene locus_tag LOCUS_24280 9516 11330 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937758.1 protein_id gnl|my_center|LOCUS_24280 11753 11388 gene locus_tag LOCUS_24290 11753 11388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 12614 11766 gene locus_tag LOCUS_24300 12614 11766 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881009.1 protein_id gnl|my_center|LOCUS_24300 13489 12611 gene locus_tag LOCUS_24310 13489 12611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 14283 13486 gene locus_tag LOCUS_24320 14283 13486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 14552 17986 gene locus_tag LOCUS_24330 14552 17986 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937760.1 protein_id gnl|my_center|LOCUS_24330 18296 18144 gene locus_tag LOCUS_24340 18296 18144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524242.1 protein_id gnl|my_center|LOCUS_24340 18491 19555 gene locus_tag LOCUS_24350 gene cbiR 18491 19555 CDS product cobamide remodeling phosphodiesterase CbiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294611.1 protein_id gnl|my_center|LOCUS_24350 19552 20058 gene locus_tag LOCUS_24360 gene cobU 19552 20058 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071296.1 protein_id gnl|my_center|LOCUS_24360 20062 21213 gene locus_tag LOCUS_24370 20062 21213 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937763.1 protein_id gnl|my_center|LOCUS_24370 22838 21570 gene locus_tag LOCUS_24380 22838 21570 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937764.1 protein_id gnl|my_center|LOCUS_24380 23366 23040 gene locus_tag LOCUS_24390 23366 23040 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083241.1 protein_id gnl|my_center|LOCUS_24390 24763 23381 gene locus_tag LOCUS_24400 24763 23381 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083240.1 protein_id gnl|my_center|LOCUS_24400 25337 26137 gene locus_tag LOCUS_24410 25337 26137 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937767.1 protein_id gnl|my_center|LOCUS_24410 26178 26978 gene locus_tag LOCUS_24420 26178 26978 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937767.1 protein_id gnl|my_center|LOCUS_24420 27001 27972 gene locus_tag LOCUS_24430 27001 27972 CDS product 3-dehydroquinate synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937768.1 protein_id gnl|my_center|LOCUS_24430 27975 29204 gene locus_tag LOCUS_24440 gene pheA 27975 29204 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937769.1 protein_id gnl|my_center|LOCUS_24440 29209 30534 gene locus_tag LOCUS_24450 29209 30534 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937770.1 protein_id gnl|my_center|LOCUS_24450 30531 31322 gene locus_tag LOCUS_24460 30531 31322 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792876.1 protein_id gnl|my_center|LOCUS_24460 31449 32864 gene locus_tag LOCUS_24470 31449 32864 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937772.1 protein_id gnl|my_center|LOCUS_24470 32845 33429 gene locus_tag LOCUS_24480 32845 33429 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937773.1 protein_id gnl|my_center|LOCUS_24480 33465 34460 gene locus_tag LOCUS_24490 gene trpD 33465 34460 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937774.1 protein_id gnl|my_center|LOCUS_24490 34453 35214 gene locus_tag LOCUS_24500 34453 35214 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937775.1 protein_id gnl|my_center|LOCUS_24500 35259 35897 gene locus_tag LOCUS_24510 35259 35897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 35964 37151 gene locus_tag LOCUS_24520 gene trpB 35964 37151 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937777.1 protein_id gnl|my_center|LOCUS_24520 37161 37928 gene locus_tag LOCUS_24530 gene trpA 37161 37928 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937778.1 protein_id gnl|my_center|LOCUS_24530 38067 40388 gene locus_tag LOCUS_24540 gene hypF 38067 40388 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629133.1 protein_id gnl|my_center|LOCUS_24540 40398 41750 gene locus_tag LOCUS_24550 40398 41750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 42593 41757 gene locus_tag LOCUS_24560 42593 41757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 44269 42770 gene locus_tag LOCUS_24570 44269 42770 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940512.1 protein_id gnl|my_center|LOCUS_24570 45539 44274 gene locus_tag LOCUS_24580 45539 44274 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940511.1 protein_id gnl|my_center|LOCUS_24580 47221 45743 gene locus_tag LOCUS_24590 gene mdrR2 47221 45743 CDS product transcriptional regulator MdrR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106149.1 protein_id gnl|my_center|LOCUS_24590 47359 48090 gene locus_tag LOCUS_24600 47359 48090 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246986.1 protein_id gnl|my_center|LOCUS_24600 49556 48144 gene locus_tag LOCUS_24610 49556 48144 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_24610 50377 49730 gene locus_tag LOCUS_24620 50377 49730 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940237.1 protein_id gnl|my_center|LOCUS_24620 50508 51494 gene locus_tag LOCUS_24630 50508 51494 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_24630 51709 51984 gene locus_tag LOCUS_24640 51709 51984 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940232.1 protein_id gnl|my_center|LOCUS_24640 52506 53210 gene locus_tag LOCUS_24650 52506 53210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 53265 54089 gene locus_tag LOCUS_24660 53265 54089 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791596.1 protein_id gnl|my_center|LOCUS_24660 54510 56690 gene locus_tag LOCUS_24670 54510 56690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 57158 58093 gene locus_tag LOCUS_24680 57158 58093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 58786 58388 gene locus_tag LOCUS_24690 58786 58388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 59004 59393 gene locus_tag LOCUS_24700 59004 59393 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 protein_id gnl|my_center|LOCUS_24700 60034 59351 gene locus_tag LOCUS_24710 60034 59351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 61006 60251 gene locus_tag LOCUS_24720 61006 60251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 61837 61220 gene locus_tag LOCUS_24730 61837 61220 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937833.1 protein_id gnl|my_center|LOCUS_24730 62267 62683 gene locus_tag LOCUS_24740 62267 62683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937830.1 protein_id gnl|my_center|LOCUS_24740 62711 63019 gene locus_tag LOCUS_24750 gene flgM 62711 63019 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937829.1 protein_id gnl|my_center|LOCUS_24750 63942 63550 gene locus_tag LOCUS_24760 63942 63550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 64214 63975 gene locus_tag LOCUS_24770 gene csrA 64214 63975 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937827.1 protein_id gnl|my_center|LOCUS_24770 65770 64220 gene locus_tag LOCUS_24780 gene flgL 65770 64220 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937826.1 protein_id gnl|my_center|LOCUS_24780 67918 65795 gene locus_tag LOCUS_24790 gene flgK 67918 65795 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937825.1 protein_id gnl|my_center|LOCUS_24790 68395 67931 gene locus_tag LOCUS_24800 68395 67931 CDS product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937824.1 protein_id gnl|my_center|LOCUS_24800 69817 68408 gene locus_tag LOCUS_24810 69817 68408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 71012 69819 gene locus_tag LOCUS_24820 71012 69819 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937822.1 protein_id gnl|my_center|LOCUS_24820 71736 71029 gene locus_tag LOCUS_24830 71736 71029 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937821.1 protein_id gnl|my_center|LOCUS_24830 72792 71794 gene locus_tag LOCUS_24840 gene flgA 72792 71794 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294608.1 protein_id gnl|my_center|LOCUS_24840 73816 73031 gene locus_tag LOCUS_24850 gene flgG 73816 73031 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937819.1 protein_id gnl|my_center|LOCUS_24850 74617 73835 gene locus_tag LOCUS_24860 gene flgF 74617 73835 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937818.1 protein_id gnl|my_center|LOCUS_24860 74911 76881 gene locus_tag LOCUS_24870 74911 76881 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940311.1 protein_id gnl|my_center|LOCUS_24870 76889 77308 gene locus_tag LOCUS_24880 76889 77308 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940310.1 protein_id gnl|my_center|LOCUS_24880 77305 77748 gene locus_tag LOCUS_24890 77305 77748 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940309.1 protein_id gnl|my_center|LOCUS_24890 77975 78388 gene locus_tag LOCUS_24900 77975 78388 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940308.1 protein_id gnl|my_center|LOCUS_24900 78489 79535 gene locus_tag LOCUS_24910 78489 79535 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940307.1 protein_id gnl|my_center|LOCUS_24910 79591 80505 gene locus_tag LOCUS_24920 79591 80505 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940306.1 protein_id gnl|my_center|LOCUS_24920 80614 81681 gene locus_tag LOCUS_24930 80614 81681 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600562.1 protein_id gnl|my_center|LOCUS_24930 81772 82998 gene locus_tag LOCUS_24940 81772 82998 CDS product PhzF family isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966716.1 protein_id gnl|my_center|LOCUS_24940 82995 83273 gene locus_tag LOCUS_24950 82995 83273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 83377 84570 gene locus_tag LOCUS_24960 83377 84570 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937699.1 protein_id gnl|my_center|LOCUS_24960 84570 85442 gene locus_tag LOCUS_24970 84570 85442 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294614.1 protein_id gnl|my_center|LOCUS_24970 85634 87742 gene locus_tag LOCUS_24980 85634 87742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 87972 87896 gene locus_tag LOCUS_t00400 87972 87896 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 88053 87978 gene locus_tag LOCUS_t00410 88053 87978 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 88770 88135 gene locus_tag LOCUS_24990 88770 88135 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964097.1 protein_id gnl|my_center|LOCUS_24990 91094 89031 gene locus_tag LOCUS_25000 91094 89031 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940207.1 protein_id gnl|my_center|LOCUS_25000 91767 92642 gene locus_tag LOCUS_25010 91767 92642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 94789 92867 gene locus_tag LOCUS_25020 94789 92867 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937911.1 protein_id gnl|my_center|LOCUS_25020 95335 96228 gene locus_tag LOCUS_25030 gene murI 95335 96228 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938069.1 protein_id gnl|my_center|LOCUS_25030 96373 97056 gene locus_tag LOCUS_25040 96373 97056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 99783 97225 gene locus_tag LOCUS_25050 99783 97225 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083292.1 protein_id gnl|my_center|LOCUS_25050 100583 99780 gene locus_tag LOCUS_25060 100583 99780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470636.1 protein_id gnl|my_center|LOCUS_25060 100582 101274 gene locus_tag LOCUS_25070 100582 101274 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529696.1 protein_id gnl|my_center|LOCUS_25070 102146 103492 gene locus_tag LOCUS_25080 102146 103492 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_25080 103583 103741 gene locus_tag LOCUS_25090 103583 103741 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933679.1 protein_id gnl|my_center|LOCUS_25090 103929 104651 gene locus_tag LOCUS_25100 103929 104651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 105040 104732 gene locus_tag LOCUS_25110 105040 104732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 105062 106519 gene locus_tag LOCUS_25120 105062 106519 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937901.1 protein_id gnl|my_center|LOCUS_25120 107254 106754 gene locus_tag LOCUS_25130 107254 106754 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939250.1 protein_id gnl|my_center|LOCUS_25130 107186 107377 gene locus_tag LOCUS_25140 107186 107377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 108645 107509 gene locus_tag LOCUS_25150 108645 107509 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_25150 108773 109138 gene locus_tag LOCUS_25160 108773 109138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 110781 109333 gene locus_tag LOCUS_25170 110781 109333 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937982.1 protein_id gnl|my_center|LOCUS_25170 112993 110879 gene locus_tag LOCUS_25180 112993 110879 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792762.1 protein_id gnl|my_center|LOCUS_25180 115028 113031 gene locus_tag LOCUS_25190 115028 113031 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937984.1 protein_id gnl|my_center|LOCUS_25190 115289 116575 gene locus_tag LOCUS_25200 115289 116575 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938312.1 protein_id gnl|my_center|LOCUS_25200 117082 116708 gene locus_tag LOCUS_25210 117082 116708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 118227 117331 gene locus_tag LOCUS_25220 118227 117331 CDS product ArgP/LysG family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937897.1 protein_id gnl|my_center|LOCUS_25220 118399 118983 gene locus_tag LOCUS_25230 118399 118983 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937896.1 protein_id gnl|my_center|LOCUS_25230 119788 119129 gene locus_tag LOCUS_25240 119788 119129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 121180 119822 gene locus_tag LOCUS_25250 121180 119822 CDS product GAK system CofD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938386.1 protein_id gnl|my_center|LOCUS_25250 122415 121261 gene locus_tag LOCUS_25260 122415 121261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 123314 122412 gene locus_tag LOCUS_25270 123314 122412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 124972 123311 gene locus_tag LOCUS_25280 124972 123311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 125247 124975 gene locus_tag LOCUS_25290 125247 124975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 126432 125266 gene locus_tag LOCUS_25300 126432 125266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940477.1 protein_id gnl|my_center|LOCUS_25300 127226 126447 gene locus_tag LOCUS_25310 127226 126447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 131622 127450 gene locus_tag LOCUS_25320 gene rpoC 131622 127450 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940189.1 protein_id gnl|my_center|LOCUS_25320 135837 131728 gene locus_tag LOCUS_25330 gene rpoB 135837 131728 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940188.1 protein_id gnl|my_center|LOCUS_25330 136686 136303 gene locus_tag LOCUS_25340 gene rplL 136686 136303 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940187.1 protein_id gnl|my_center|LOCUS_25340 137248 136727 gene locus_tag LOCUS_25350 gene rplJ 137248 136727 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940186.1 protein_id gnl|my_center|LOCUS_25350 138125 137418 gene locus_tag LOCUS_25360 gene rplA 138125 137418 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940185.1 protein_id gnl|my_center|LOCUS_25360 138671 138249 gene locus_tag LOCUS_25370 gene rplK 138671 138249 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940184.1 protein_id gnl|my_center|LOCUS_25370 139280 138726 gene locus_tag LOCUS_25380 gene nusG 139280 138726 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940183.1 protein_id gnl|my_center|LOCUS_25380 139543 139295 gene locus_tag LOCUS_25390 gene secE 139543 139295 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940182.1 protein_id gnl|my_center|LOCUS_25390 139655 139579 gene locus_tag LOCUS_t00420 139655 139579 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 139822 139673 gene locus_tag LOCUS_25400 gene rpmG 139822 139673 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940181.1 protein_id gnl|my_center|LOCUS_25400 141019 139826 gene locus_tag LOCUS_25410 gene tuf 141019 139826 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940180.1 protein_id gnl|my_center|LOCUS_25410 141144 141069 gene locus_tag LOCUS_t00430 141144 141069 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 141256 141181 gene locus_tag LOCUS_t00440 141256 141181 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 141400 141315 gene locus_tag LOCUS_t00450 141400 141315 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 141479 141404 gene locus_tag LOCUS_t00460 141479 141404 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 142783 141869 gene locus_tag LOCUS_25420 gene lpxC 142783 141869 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940177.1 protein_id gnl|my_center|LOCUS_25420 143801 142896 gene locus_tag LOCUS_25430 gene prmC 143801 142896 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940176.1 protein_id gnl|my_center|LOCUS_25430 144878 143808 gene locus_tag LOCUS_25440 gene prfA 144878 143808 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940174.1 protein_id gnl|my_center|LOCUS_25440 145804 144878 gene locus_tag LOCUS_25450 145804 144878 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940173.1 protein_id gnl|my_center|LOCUS_25450 146282 146073 gene locus_tag LOCUS_25460 gene rpmE 146282 146073 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940172.1 protein_id gnl|my_center|LOCUS_25460 146516 147271 gene locus_tag LOCUS_25470 146516 147271 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940171.1 protein_id gnl|my_center|LOCUS_25470 149820 147286 gene locus_tag LOCUS_25480 149820 147286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 149964 150524 gene locus_tag LOCUS_25490 149964 150524 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949009.1 protein_id gnl|my_center|LOCUS_25490 151507 150551 gene locus_tag LOCUS_25500 151507 150551 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583513.1 protein_id gnl|my_center|LOCUS_25500 152428 151844 gene locus_tag LOCUS_25510 152428 151844 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_25510 152880 152431 gene locus_tag LOCUS_25520 152880 152431 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072119.1 protein_id gnl|my_center|LOCUS_25520 153902 153159 gene locus_tag LOCUS_25530 153902 153159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940168.1 protein_id gnl|my_center|LOCUS_25530 154083 154520 gene locus_tag LOCUS_25540 154083 154520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 154535 155872 gene locus_tag LOCUS_25550 154535 155872 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629647.1 protein_id gnl|my_center|LOCUS_25550 157460 155964 gene locus_tag LOCUS_25560 gene ftsY 157460 155964 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940318.1 protein_id gnl|my_center|LOCUS_25560 157772 160078 gene locus_tag LOCUS_25570 157772 160078 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940320.1 protein_id gnl|my_center|LOCUS_25570 161387 160206 gene locus_tag LOCUS_25580 161387 160206 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112805.1 protein_id gnl|my_center|LOCUS_25580 162315 162572 gene locus_tag LOCUS_25590 162315 162572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 163250 162582 gene locus_tag LOCUS_25600 163250 162582 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811475.1 protein_id gnl|my_center|LOCUS_25600 164608 163247 gene locus_tag LOCUS_25610 164608 163247 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112807.1 protein_id gnl|my_center|LOCUS_25610 166101 164566 gene locus_tag LOCUS_25620 166101 164566 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103137.1 protein_id gnl|my_center|LOCUS_25620 166620 166300 gene locus_tag LOCUS_25630 166620 166300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 167010 166690 gene locus_tag LOCUS_25640 167010 166690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 167042 167230 gene locus_tag LOCUS_25650 167042 167230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 167715 167398 gene locus_tag LOCUS_25660 167715 167398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 169042 167975 gene locus_tag LOCUS_25670 169042 167975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 170300 169101 gene locus_tag LOCUS_25680 170300 169101 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392042.1 protein_id gnl|my_center|LOCUS_25680 172411 170357 gene locus_tag LOCUS_25690 172411 170357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 173535 172408 gene locus_tag LOCUS_25700 173535 172408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 174485 173532 gene locus_tag LOCUS_25710 174485 173532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 175708 174746 gene locus_tag LOCUS_25720 175708 174746 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_25720 176919 175705 gene locus_tag LOCUS_25730 176919 175705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 178017 176935 gene locus_tag LOCUS_25740 gene neuB 178017 176935 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_25740 178628 178014 gene locus_tag LOCUS_25750 178628 178014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 179395 178895 gene locus_tag LOCUS_25760 179395 178895 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_25760 181364 179397 gene locus_tag LOCUS_25770 181364 179397 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940249.1 protein_id gnl|my_center|LOCUS_25770 182532 181429 gene locus_tag LOCUS_25780 gene pspF 182532 181429 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940248.1 protein_id gnl|my_center|LOCUS_25780 182829 183506 gene locus_tag LOCUS_25790 gene pspA 182829 183506 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081428804.1 protein_id gnl|my_center|LOCUS_25790 183772 184065 gene locus_tag LOCUS_25800 183772 184065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 184275 184601 gene locus_tag LOCUS_25810 184275 184601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 185442 184645 gene locus_tag LOCUS_25820 185442 184645 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950478.1 protein_id gnl|my_center|LOCUS_25820 186063 185539 gene locus_tag LOCUS_25830 186063 185539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 186376 186038 gene locus_tag LOCUS_25840 186376 186038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 187500 186427 gene locus_tag LOCUS_25850 gene leuB 187500 186427 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940244.1 protein_id gnl|my_center|LOCUS_25850 188132 187638 gene locus_tag LOCUS_25860 188132 187638 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940242.1 protein_id gnl|my_center|LOCUS_25860 189544 188288 gene locus_tag LOCUS_25870 189544 188288 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940241.1 protein_id gnl|my_center|LOCUS_25870 191069 189546 gene locus_tag LOCUS_25880 191069 189546 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940240.1 protein_id gnl|my_center|LOCUS_25880 192126 191374 gene locus_tag LOCUS_25890 gene pssA 192126 191374 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940239.1 protein_id gnl|my_center|LOCUS_25890 192834 192178 gene locus_tag LOCUS_25900 192834 192178 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940238.1 protein_id gnl|my_center|LOCUS_25900 194543 192951 gene locus_tag LOCUS_25910 gene zwf 194543 192951 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080226.1 protein_id gnl|my_center|LOCUS_25910 195621 194722 gene locus_tag LOCUS_25920 gene gnd 195621 194722 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256404.1 protein_id gnl|my_center|LOCUS_25920 195876 196613 gene locus_tag LOCUS_25930 195876 196613 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937785.1 protein_id gnl|my_center|LOCUS_25930 196632 198095 gene locus_tag LOCUS_25940 196632 198095 CDS product DUF1566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937786.1 protein_id gnl|my_center|LOCUS_25940 198490 199167 gene locus_tag LOCUS_25950 198490 199167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 199343 200314 gene locus_tag LOCUS_25960 gene rfaD 199343 200314 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937788.1 protein_id gnl|my_center|LOCUS_25960 200386 202233 gene locus_tag LOCUS_25970 200386 202233 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791922.1 protein_id gnl|my_center|LOCUS_25970 203847 202378 gene locus_tag LOCUS_25980 203847 202378 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937789.1 protein_id gnl|my_center|LOCUS_25980 206458 204164 gene locus_tag LOCUS_25990 gene mutL 206458 204164 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937790.1 protein_id gnl|my_center|LOCUS_25990 206673 207332 gene locus_tag LOCUS_26000 206673 207332 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792861.1 protein_id gnl|my_center|LOCUS_26000 207329 208111 gene locus_tag LOCUS_26010 gene fetB 207329 208111 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937792.1 protein_id gnl|my_center|LOCUS_26010 208201 208509 gene locus_tag LOCUS_26020 208201 208509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 209626 208604 gene locus_tag LOCUS_26030 209626 208604 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940050.1 protein_id gnl|my_center|LOCUS_26030 210463 209750 gene locus_tag LOCUS_26040 210463 209750 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524570.1 protein_id gnl|my_center|LOCUS_26040 211534 210971 gene locus_tag LOCUS_26050 211534 210971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 212287 211634 gene locus_tag LOCUS_26060 212287 211634 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 protein_id gnl|my_center|LOCUS_26060 213182 212430 gene locus_tag LOCUS_26070 213182 212430 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937416.1 protein_id gnl|my_center|LOCUS_26070 213872 213195 gene locus_tag LOCUS_26080 213872 213195 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937417.1 protein_id gnl|my_center|LOCUS_26080 214705 213965 gene locus_tag LOCUS_26090 gene glnH 214705 213965 CDS product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937418.1 protein_id gnl|my_center|LOCUS_26090 216009 215125 gene locus_tag LOCUS_26100 216009 215125 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937616.1 protein_id gnl|my_center|LOCUS_26100 216110 216547 gene locus_tag LOCUS_26110 216110 216547 CDS product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937615.1 protein_id gnl|my_center|LOCUS_26110 217755 216649 gene locus_tag LOCUS_26120 gene ald 217755 216649 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_26120 218822 218529 gene locus_tag LOCUS_26130 218822 218529 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937703.1 protein_id gnl|my_center|LOCUS_26130 219699 220622 gene locus_tag LOCUS_26140 219699 220622 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937701.1 protein_id gnl|my_center|LOCUS_26140 220895 221680 gene locus_tag LOCUS_26150 220895 221680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 221762 222463 gene locus_tag LOCUS_26160 221762 222463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 225310 222584 gene locus_tag LOCUS_26170 225310 222584 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938001.1 protein_id gnl|my_center|LOCUS_26170 226470 225700 gene locus_tag LOCUS_26180 226470 225700 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_26180 227840 226545 gene locus_tag LOCUS_26190 227840 226545 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937555.1 protein_id gnl|my_center|LOCUS_26190 230311 227840 gene locus_tag LOCUS_26200 230311 227840 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793045.1 protein_id gnl|my_center|LOCUS_26200 230751 230392 gene locus_tag LOCUS_26210 230751 230392 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937557.1 protein_id gnl|my_center|LOCUS_26210 232874 230757 gene locus_tag LOCUS_26220 232874 230757 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937885.1 protein_id gnl|my_center|LOCUS_26220 233914 232874 gene locus_tag LOCUS_26230 233914 232874 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793043.1 protein_id gnl|my_center|LOCUS_26230 234699 233932 gene locus_tag LOCUS_26240 234699 233932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 236065 234863 gene locus_tag LOCUS_26250 236065 234863 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793041.1 protein_id gnl|my_center|LOCUS_26250 237244 236465 gene locus_tag LOCUS_26260 237244 236465 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938683.1 protein_id gnl|my_center|LOCUS_26260 240004 237317 gene locus_tag LOCUS_26270 240004 237317 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940229.1 protein_id gnl|my_center|LOCUS_26270 240652 242637 gene locus_tag LOCUS_26280 gene acs 240652 242637 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940228.1 protein_id gnl|my_center|LOCUS_26280 243006 245177 gene locus_tag LOCUS_26290 243006 245177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 245857 245534 gene locus_tag LOCUS_26300 245857 245534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 246054 246542 gene locus_tag LOCUS_26310 246054 246542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 247290 246874 gene locus_tag LOCUS_26320 247290 246874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 250024 247769 gene locus_tag LOCUS_26330 250024 247769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 251283 250021 gene locus_tag LOCUS_26340 251283 250021 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868924.1 protein_id gnl|my_center|LOCUS_26340 251670 252062 gene locus_tag LOCUS_26350 251670 252062 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_26350 252096 252884 gene locus_tag LOCUS_26360 252096 252884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 252881 254731 gene locus_tag LOCUS_26370 252881 254731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 254728 256182 gene locus_tag LOCUS_26380 254728 256182 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938462.1 protein_id gnl|my_center|LOCUS_26380 256970 256461 gene locus_tag LOCUS_26390 256970 256461 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937834.1 protein_id gnl|my_center|LOCUS_26390 257461 258066 gene locus_tag LOCUS_26400 257461 258066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 258336 259301 gene locus_tag LOCUS_26410 258336 259301 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176666.1 protein_id gnl|my_center|LOCUS_26410 259742 259419 gene locus_tag LOCUS_26420 259742 259419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 259990 259739 gene locus_tag LOCUS_26430 259990 259739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 259904 260164 gene locus_tag LOCUS_26440 259904 260164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 261375 260893 gene locus_tag LOCUS_26450 261375 260893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 261663 262103 gene locus_tag LOCUS_26460 261663 262103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938442.1 protein_id gnl|my_center|LOCUS_26460 262100 262357 gene locus_tag LOCUS_26470 262100 262357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 262386 262838 gene locus_tag LOCUS_26480 262386 262838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 262835 263119 gene locus_tag LOCUS_26490 262835 263119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 263116 263406 gene locus_tag LOCUS_26500 263116 263406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 263406 263945 gene locus_tag LOCUS_26510 263406 263945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 264192 263980 gene locus_tag LOCUS_26520 264192 263980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 264306 266555 gene locus_tag LOCUS_26530 264306 266555 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070968.1 protein_id gnl|my_center|LOCUS_26530 266631 267380 gene locus_tag LOCUS_26540 266631 267380 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070969.1 protein_id gnl|my_center|LOCUS_26540 267384 267965 gene locus_tag LOCUS_26550 267384 267965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 267958 268371 gene locus_tag LOCUS_26560 267958 268371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 268383 268601 gene locus_tag LOCUS_26570 268383 268601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 268611 269219 gene locus_tag LOCUS_26580 268611 269219 CDS product DUF3164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070973.1 protein_id gnl|my_center|LOCUS_26580 269258 269536 gene locus_tag LOCUS_26590 269258 269536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 269624 269815 gene locus_tag LOCUS_26600 269624 269815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 269825 270361 gene locus_tag LOCUS_26610 269825 270361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 270363 270794 gene locus_tag LOCUS_26620 270363 270794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939963.1 protein_id gnl|my_center|LOCUS_26620 270801 271220 gene locus_tag LOCUS_26630 270801 271220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 271230 271799 gene locus_tag LOCUS_26640 271230 271799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 271796 272164 gene locus_tag LOCUS_26650 271796 272164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 272250 272615 gene locus_tag LOCUS_26660 272250 272615 CDS product putative holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938428.1 protein_id gnl|my_center|LOCUS_26660 272612 273391 gene locus_tag LOCUS_26670 272612 273391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 273384 273797 gene locus_tag LOCUS_26680 273384 273797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939969.1 protein_id gnl|my_center|LOCUS_26680 273748 274029 gene locus_tag LOCUS_26690 273748 274029 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938425.1 protein_id gnl|my_center|LOCUS_26690 274029 274469 gene locus_tag LOCUS_26700 274029 274469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 274473 274775 gene locus_tag LOCUS_26710 274473 274775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 274775 275323 gene locus_tag LOCUS_26720 274775 275323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 275343 276749 gene locus_tag LOCUS_26730 gene terL 275343 276749 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399999.1 protein_id gnl|my_center|LOCUS_26730 276753 278186 gene locus_tag LOCUS_26740 276753 278186 CDS product DUF1073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113512.1 protein_id gnl|my_center|LOCUS_26740 278170 279429 gene locus_tag LOCUS_26750 278170 279429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 279426 279680 gene locus_tag LOCUS_26760 279426 279680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 279899 281185 gene locus_tag LOCUS_26770 279899 281185 CDS product DUF2213 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873166.1 protein_id gnl|my_center|LOCUS_26770 281187 281654 gene locus_tag LOCUS_26780 281187 281654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 281686 282621 gene locus_tag LOCUS_26790 281686 282621 CDS product DUF2184 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627464.1 protein_id gnl|my_center|LOCUS_26790 282631 282933 gene locus_tag LOCUS_26800 282631 282933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 282934 283335 gene locus_tag LOCUS_26810 282934 283335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 283338 283838 gene locus_tag LOCUS_26820 283338 283838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008731.1 protein_id gnl|my_center|LOCUS_26820 283835 284200 gene locus_tag LOCUS_26830 283835 284200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 284193 284780 gene locus_tag LOCUS_26840 284193 284780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077064290.1 protein_id gnl|my_center|LOCUS_26840 284785 286254 gene locus_tag LOCUS_26850 284785 286254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 286274 286726 gene locus_tag LOCUS_26860 286274 286726 CDS product DUF3277 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257259.1 protein_id gnl|my_center|LOCUS_26860 286730 287149 gene locus_tag LOCUS_26870 286730 287149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 287329 289038 gene locus_tag LOCUS_26880 287329 289038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 289035 289574 gene locus_tag LOCUS_26890 289035 289574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346974.1 protein_id gnl|my_center|LOCUS_26890 289574 289891 gene locus_tag LOCUS_26900 289574 289891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 289888 290790 gene locus_tag LOCUS_26910 289888 290790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081737.1 protein_id gnl|my_center|LOCUS_26910 290795 291577 gene locus_tag LOCUS_26920 290795 291577 CDS product Gp138 family membrane-puncturing spike protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001685627.1 protein_id gnl|my_center|LOCUS_26920 291574 291927 gene locus_tag LOCUS_26930 291574 291927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270632.1 protein_id gnl|my_center|LOCUS_26930 291927 293099 gene locus_tag LOCUS_26940 291927 293099 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197093.1 protein_id gnl|my_center|LOCUS_26940 293099 293779 gene locus_tag LOCUS_26950 293099 293779 CDS product DUF2612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049938.1 protein_id gnl|my_center|LOCUS_26950 293796 294563 gene locus_tag LOCUS_26960 293796 294563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 >Feature sequence11 1915 323 gene locus_tag LOCUS_26970 1915 323 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937352.1 protein_id gnl|my_center|LOCUS_26970 2139 2897 gene locus_tag LOCUS_26980 2139 2897 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294689.1 protein_id gnl|my_center|LOCUS_26980 3775 3038 gene locus_tag LOCUS_26990 3775 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 4937 3897 gene locus_tag LOCUS_27000 4937 3897 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940211.1 protein_id gnl|my_center|LOCUS_27000 5083 6717 gene locus_tag LOCUS_27010 5083 6717 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940212.1 protein_id gnl|my_center|LOCUS_27010 6974 8386 gene locus_tag LOCUS_27020 6974 8386 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937940.1 protein_id gnl|my_center|LOCUS_27020 9418 8483 gene locus_tag LOCUS_27030 9418 8483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937941.1 protein_id gnl|my_center|LOCUS_27030 9986 10063 gene locus_tag LOCUS_t00470 9986 10063 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10822 11391 gene locus_tag LOCUS_27040 10822 11391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 12483 11680 gene locus_tag LOCUS_27050 12483 11680 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108548.1 protein_id gnl|my_center|LOCUS_27050 13310 12564 gene locus_tag LOCUS_27060 13310 12564 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943078.1 protein_id gnl|my_center|LOCUS_27060 13948 13676 gene locus_tag LOCUS_27070 13948 13676 CDS product CD3324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939495.1 protein_id gnl|my_center|LOCUS_27070 14477 16315 gene locus_tag LOCUS_27080 14477 16315 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940066.1 protein_id gnl|my_center|LOCUS_27080 >Feature sequence12 90 572 gene locus_tag LOCUS_27090 90 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence13 1039 554 gene locus_tag LOCUS_27100 1039 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 2322 1051 gene locus_tag LOCUS_27110 2322 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 2968 2642 gene locus_tag LOCUS_27120 2968 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 3746 2973 gene locus_tag LOCUS_27130 3746 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 4342 3824 gene locus_tag LOCUS_27140 4342 3824 CDS product contact-dependent growth inhibition system immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142760.1 protein_id gnl|my_center|LOCUS_27140 5955 4339 gene locus_tag LOCUS_27150 5955 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 6513 6187 gene locus_tag LOCUS_27160 6513 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 <7995 6523 gene locus_tag LOCUS_27170 <7995 6523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_187820211.1:S-layer family protein >Feature sequence14 >Feature sequence15 >Feature sequence16 690 388 gene locus_tag LOCUS_27180 690 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27180 >Feature sequence17 1577 40 gene locus_tag LOCUS_r00010 1577 40 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence18 371 81 gene locus_tag LOCUS_27190 371 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence19 >Feature sequence20 1099 59 gene locus_tag LOCUS_27200 1099 59 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101899139.1 protein_id gnl|my_center|LOCUS_27200 >Feature sequence21 >Feature sequence22 884 606 gene locus_tag LOCUS_27210 884 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 2086 869 gene locus_tag LOCUS_27220 2086 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 2630 2331 gene locus_tag LOCUS_27230 2630 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 2942 2706 gene locus_tag LOCUS_27240 2942 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 3602 3225 gene locus_tag LOCUS_27250 3602 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 3740 3606 gene locus_tag LOCUS_27260 3740 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 4231 3872 gene locus_tag LOCUS_27270 4231 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 >Feature sequence23 >Feature sequence24 <1 591 gene locus_tag LOCUS_27280 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167121745.1:VWA domain-containing protein >Feature sequence25 258 37 gene locus_tag LOCUS_27290 258 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 >Feature sequence26 2228 1206 gene locus_tag LOCUS_27300 2228 1206 CDS product DUF3150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939321.1 protein_id gnl|my_center|LOCUS_27300 >Feature sequence27 2228 1206 gene locus_tag LOCUS_27310 2228 1206 CDS product DUF3150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939321.1 protein_id gnl|my_center|LOCUS_27310 >Feature sequence28 >Feature sequence29 >Feature sequence30 >Feature sequence31 >Feature sequence32 106 31 gene locus_tag LOCUS_t00480 106 31 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 265 189 gene locus_tag LOCUS_t00490 265 189 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence33 680 96 gene locus_tag LOCUS_27320 680 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 2473 1226 gene locus_tag LOCUS_27330 2473 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 3806 2526 gene locus_tag LOCUS_27340 3806 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 4776 4168 gene locus_tag LOCUS_27350 gene lpoB 4776 4168 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925186.1 protein_id gnl|my_center|LOCUS_27350 5187 4789 gene locus_tag LOCUS_27360 5187 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 6551 5187 gene locus_tag LOCUS_27370 6551 5187 CDS product COG3014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851858.1 protein_id gnl|my_center|LOCUS_27370 7247 8389 gene locus_tag LOCUS_27380 7247 8389 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939668.1 protein_id gnl|my_center|LOCUS_27380 8389 9594 gene locus_tag LOCUS_27390 8389 9594 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011369225.1 protein_id gnl|my_center|LOCUS_27390 9587 10939 gene locus_tag LOCUS_27400 9587 10939 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939666.1 protein_id gnl|my_center|LOCUS_27400 11307 12488 gene locus_tag LOCUS_27410 11307 12488 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939677.1 protein_id gnl|my_center|LOCUS_27410 12613 13167 gene locus_tag LOCUS_27420 12613 13167 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939676.1 protein_id gnl|my_center|LOCUS_27420 13181 14074 gene locus_tag LOCUS_27430 13181 14074 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939675.1 protein_id gnl|my_center|LOCUS_27430 14071 16029 gene locus_tag LOCUS_27440 14071 16029 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939674.1 protein_id gnl|my_center|LOCUS_27440 16017 16526 gene locus_tag LOCUS_27450 16017 16526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27450 16538 17500 gene locus_tag LOCUS_27460 16538 17500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27460 17497 18567 gene locus_tag LOCUS_27470 17497 18567 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791853.1 protein_id gnl|my_center|LOCUS_27470 18560 19399 gene locus_tag LOCUS_27480 18560 19399 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939671.1 protein_id gnl|my_center|LOCUS_27480 19556 21292 gene locus_tag LOCUS_27490 19556 21292 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_27490 21427 22230 gene locus_tag LOCUS_27500 21427 22230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 22823 22629 gene locus_tag LOCUS_27510 22823 22629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 24147 23473 gene locus_tag LOCUS_27520 24147 23473 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176714.1 protein_id gnl|my_center|LOCUS_27520 26146 24134 gene locus_tag LOCUS_27530 26146 24134 CDS product 7TM diverse intracellular signaling domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294695.1 protein_id gnl|my_center|LOCUS_27530 28252 26441 gene locus_tag LOCUS_27540 28252 26441 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787412.1 protein_id gnl|my_center|LOCUS_27540 29455 31149 gene locus_tag LOCUS_27550 29455 31149 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104447.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence34 >Feature sequence35 651 79 gene locus_tag LOCUS_27560 651 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 1214 897 gene locus_tag LOCUS_27570 1214 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 1338 2069 gene locus_tag LOCUS_27580 1338 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 3839 2238 gene locus_tag LOCUS_27590 3839 2238 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_27590 4151 3849 gene locus_tag LOCUS_27600 4151 3849 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940565.1 protein_id gnl|my_center|LOCUS_27600 4927 4208 gene locus_tag LOCUS_27610 4927 4208 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940564.1 protein_id gnl|my_center|LOCUS_27610 5621 5040 gene locus_tag LOCUS_27620 5621 5040 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940563.1 protein_id gnl|my_center|LOCUS_27620 5999 6075 gene locus_tag LOCUS_t00500 5999 6075 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6584 6264 gene locus_tag LOCUS_27630 6584 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 7128 8459 gene locus_tag LOCUS_27640 7128 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 8847 9500 gene locus_tag LOCUS_27650 8847 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 9503 11755 gene locus_tag LOCUS_27660 9503 11755 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064331.1 protein_id gnl|my_center|LOCUS_27660 11768 12328 gene locus_tag LOCUS_27670 11768 12328 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250378.1 protein_id gnl|my_center|LOCUS_27670 12333 13124 gene locus_tag LOCUS_27680 12333 13124 CDS product dimethyl sulfoxide reductase anchor subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417104.1 protein_id gnl|my_center|LOCUS_27680 13376 15049 gene locus_tag LOCUS_27690 13376 15049 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937486.1 protein_id gnl|my_center|LOCUS_27690 15254 15069 gene locus_tag LOCUS_27700 15254 15069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 15208 16512 gene locus_tag LOCUS_27710 15208 16512 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552177.1 protein_id gnl|my_center|LOCUS_27710 18674 16518 gene locus_tag LOCUS_27720 18674 16518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 18911 19924 gene locus_tag LOCUS_27730 gene bioB 18911 19924 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791775.1 protein_id gnl|my_center|LOCUS_27730 21390 19966 gene locus_tag LOCUS_27740 gene chrA 21390 19966 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174403731.1 protein_id gnl|my_center|LOCUS_27740 22186 21509 gene locus_tag LOCUS_27750 22186 21509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 22336 23445 gene locus_tag LOCUS_27760 gene mutY 22336 23445 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629788.1 protein_id gnl|my_center|LOCUS_27760 23790 23455 gene locus_tag LOCUS_27770 23790 23455 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937343.1 protein_id gnl|my_center|LOCUS_27770 24658 23792 gene locus_tag LOCUS_27780 24658 23792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 24770 26476 gene locus_tag LOCUS_27790 24770 26476 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937341.1 protein_id gnl|my_center|LOCUS_27790 27790 26549 gene locus_tag LOCUS_27800 27790 26549 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_27800 29225 27909 gene locus_tag LOCUS_27810 29225 27909 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938231.1 protein_id gnl|my_center|LOCUS_27810 31882 29306 gene locus_tag LOCUS_27820 31882 29306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 33066 31879 gene locus_tag LOCUS_27830 33066 31879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 33225 34877 gene locus_tag LOCUS_27840 33225 34877 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629069.1 protein_id gnl|my_center|LOCUS_27840 37034 34887 gene locus_tag LOCUS_27850 37034 34887 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937715.1 protein_id gnl|my_center|LOCUS_27850 37411 38061 gene locus_tag LOCUS_27860 37411 38061 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877296.1 protein_id gnl|my_center|LOCUS_27860 38077 39567 gene locus_tag LOCUS_27870 38077 39567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 40049 39660 gene locus_tag LOCUS_27880 40049 39660 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_27880 40254 42083 gene locus_tag LOCUS_27890 40254 42083 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403374.1 protein_id gnl|my_center|LOCUS_27890 42085 42840 gene locus_tag LOCUS_27900 42085 42840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 42852 44021 gene locus_tag LOCUS_27910 42852 44021 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403377.1 protein_id gnl|my_center|LOCUS_27910 44026 45195 gene locus_tag LOCUS_27920 gene neuC 44026 45195 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823150.1 protein_id gnl|my_center|LOCUS_27920 45192 46268 gene locus_tag LOCUS_27930 gene neuB 45192 46268 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459663.1 protein_id gnl|my_center|LOCUS_27930 46353 47417 gene locus_tag LOCUS_27940 46353 47417 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_27940 47421 48413 gene locus_tag LOCUS_27950 47421 48413 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942619.1 protein_id gnl|my_center|LOCUS_27950 48425 49561 gene locus_tag LOCUS_27960 48425 49561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 49558 50262 gene locus_tag LOCUS_27970 49558 50262 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392279.1 protein_id gnl|my_center|LOCUS_27970 50259 51134 gene locus_tag LOCUS_27980 gene wbuZ 50259 51134 CDS product glycosyl amidation-associated protein WbuZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213307.1 protein_id gnl|my_center|LOCUS_27980 51143 51775 gene locus_tag LOCUS_27990 gene hisH 51143 51775 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946487.1 protein_id gnl|my_center|LOCUS_27990 51813 53021 gene locus_tag LOCUS_28000 51813 53021 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014841181.1 protein_id gnl|my_center|LOCUS_28000 53163 54068 gene locus_tag LOCUS_28010 53163 54068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 54055 55044 gene locus_tag LOCUS_28020 gene pseB 54055 55044 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_28020 55049 56191 gene locus_tag LOCUS_28030 gene pseC 55049 56191 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_28030 56192 57691 gene locus_tag LOCUS_28040 gene pseG 56192 57691 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097861.1 protein_id gnl|my_center|LOCUS_28040 57681 58751 gene locus_tag LOCUS_28050 gene pseI 57681 58751 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_28050 58888 59451 gene locus_tag LOCUS_28060 58888 59451 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392279.1 protein_id gnl|my_center|LOCUS_28060 59444 60517 gene locus_tag LOCUS_28070 gene neuB 59444 60517 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_28070 62708 63229 gene locus_tag LOCUS_28080 62708 63229 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957191.1 protein_id gnl|my_center|LOCUS_28080 63304 63993 gene locus_tag LOCUS_28090 63304 63993 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937650.1 protein_id gnl|my_center|LOCUS_28090 63996 64919 gene locus_tag LOCUS_28100 63996 64919 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937649.1 protein_id gnl|my_center|LOCUS_28100 64922 65689 gene locus_tag LOCUS_28110 64922 65689 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937648.1 protein_id gnl|my_center|LOCUS_28110 65694 66563 gene locus_tag LOCUS_28120 65694 66563 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924398.1 protein_id gnl|my_center|LOCUS_28120 66560 67465 gene locus_tag LOCUS_28130 66560 67465 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937646.1 protein_id gnl|my_center|LOCUS_28130 67469 68119 gene locus_tag LOCUS_28140 67469 68119 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937645.1 protein_id gnl|my_center|LOCUS_28140 68131 69021 gene locus_tag LOCUS_28150 68131 69021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 69011 69730 gene locus_tag LOCUS_28160 69011 69730 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020539.1 protein_id gnl|my_center|LOCUS_28160 69745 71262 gene locus_tag LOCUS_28170 69745 71262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 71302 72069 gene locus_tag LOCUS_28180 gene rfbF 71302 72069 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937383.1 protein_id gnl|my_center|LOCUS_28180 72317 73420 gene locus_tag LOCUS_28190 gene rfbG 72317 73420 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937384.1 protein_id gnl|my_center|LOCUS_28190 73408 73905 gene locus_tag LOCUS_28200 73408 73905 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937385.1 protein_id gnl|my_center|LOCUS_28200 73909 74772 gene locus_tag LOCUS_28210 gene rfbD 73909 74772 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242585.1 protein_id gnl|my_center|LOCUS_28210 74790 75452 gene locus_tag LOCUS_28220 74790 75452 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869453.1 protein_id gnl|my_center|LOCUS_28220 77210 75513 gene locus_tag LOCUS_28230 77210 75513 CDS product GGDEF and EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294638.1 protein_id gnl|my_center|LOCUS_28230 77535 78713 gene locus_tag LOCUS_28240 77535 78713 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_28240 78703 82158 gene locus_tag LOCUS_28250 78703 82158 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479332.1 protein_id gnl|my_center|LOCUS_28250 82876 82310 gene locus_tag LOCUS_28260 82876 82310 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937625.1 protein_id gnl|my_center|LOCUS_28260 83389 83799 gene locus_tag LOCUS_28270 gene flgB 83389 83799 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937623.1 protein_id gnl|my_center|LOCUS_28270 83799 84236 gene locus_tag LOCUS_28280 gene flgC 83799 84236 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937622.1 protein_id gnl|my_center|LOCUS_28280 84261 84590 gene locus_tag LOCUS_28290 gene fliE 84261 84590 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937621.1 protein_id gnl|my_center|LOCUS_28290 84671 86296 gene locus_tag LOCUS_28300 gene fliF 84671 86296 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937620.1 protein_id gnl|my_center|LOCUS_28300 86280 87281 gene locus_tag LOCUS_28310 gene fliG 86280 87281 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937619.1 protein_id gnl|my_center|LOCUS_28310 87262 87996 gene locus_tag LOCUS_28320 87262 87996 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937618.1 protein_id gnl|my_center|LOCUS_28320 87993 89309 gene locus_tag LOCUS_28330 87993 89309 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937617.1 protein_id gnl|my_center|LOCUS_28330 89996 89400 gene locus_tag LOCUS_28340 89996 89400 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249791.1 protein_id gnl|my_center|LOCUS_28340 90718 90218 gene locus_tag LOCUS_28350 90718 90218 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531005.1 protein_id gnl|my_center|LOCUS_28350 90900 90715 gene locus_tag LOCUS_28360 90900 90715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 90921 91592 gene locus_tag LOCUS_28370 90921 91592 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937452.1 protein_id gnl|my_center|LOCUS_28370 91627 92619 gene locus_tag LOCUS_28380 gene trpS 91627 92619 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937453.1 protein_id gnl|my_center|LOCUS_28380 92722 93519 gene locus_tag LOCUS_28390 92722 93519 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937454.1 protein_id gnl|my_center|LOCUS_28390 93578 94156 gene locus_tag LOCUS_28400 gene rfaE2 93578 94156 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937455.1 protein_id gnl|my_center|LOCUS_28400 95205 94300 gene locus_tag LOCUS_28410 95205 94300 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791421.1 protein_id gnl|my_center|LOCUS_28410 96043 95291 gene locus_tag LOCUS_28420 96043 95291 CDS product tRNA 2-thiocytidine biosynthesis TtcA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940499.1 protein_id gnl|my_center|LOCUS_28420 96330 97658 gene locus_tag LOCUS_28430 96330 97658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 97921 98151 gene locus_tag LOCUS_28440 gene rpoZ 97921 98151 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940500.1 protein_id gnl|my_center|LOCUS_28440 98161 99288 gene locus_tag LOCUS_28450 gene dnaJ 98161 99288 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940501.1 protein_id gnl|my_center|LOCUS_28450 99292 99789 gene locus_tag LOCUS_28460 gene moaC 99292 99789 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294688.1 protein_id gnl|my_center|LOCUS_28460 101632 100070 gene locus_tag LOCUS_28470 gene hflX 101632 100070 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940494.1 protein_id gnl|my_center|LOCUS_28470 102445 101846 gene locus_tag LOCUS_28480 102445 101846 CDS product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940493.1 protein_id gnl|my_center|LOCUS_28480 103150 102857 gene locus_tag LOCUS_28490 103150 102857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 103038 104387 gene locus_tag LOCUS_28500 103038 104387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 104522 104334 gene locus_tag LOCUS_28510 104522 104334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 104699 105490 gene locus_tag LOCUS_28520 gene fliR 104699 105490 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940492.1 protein_id gnl|my_center|LOCUS_28520 105502 106572 gene locus_tag LOCUS_28530 gene flhB 105502 106572 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940491.1 protein_id gnl|my_center|LOCUS_28530 106630 108735 gene locus_tag LOCUS_28540 gene flhA 106630 108735 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940490.1 protein_id gnl|my_center|LOCUS_28540 108735 109823 gene locus_tag LOCUS_28550 108735 109823 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940489.1 protein_id gnl|my_center|LOCUS_28550 109845 110660 gene locus_tag LOCUS_28560 109845 110660 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791427.1 protein_id gnl|my_center|LOCUS_28560 110725 111465 gene locus_tag LOCUS_28570 110725 111465 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940487.1 protein_id gnl|my_center|LOCUS_28570 111484 111864 gene locus_tag LOCUS_28580 111484 111864 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940486.1 protein_id gnl|my_center|LOCUS_28580 112198 112932 gene locus_tag LOCUS_28590 112198 112932 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940485.1 protein_id gnl|my_center|LOCUS_28590 112934 113266 gene locus_tag LOCUS_28600 112934 113266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940484.1 protein_id gnl|my_center|LOCUS_28600 113306 113725 gene locus_tag LOCUS_28610 113306 113725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940483.1 protein_id gnl|my_center|LOCUS_28610 113745 114746 gene locus_tag LOCUS_28620 113745 114746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 115087 116130 gene locus_tag LOCUS_28630 115087 116130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 116174 117019 gene locus_tag LOCUS_28640 gene ispH 116174 117019 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937366.1 protein_id gnl|my_center|LOCUS_28640 117130 118077 gene locus_tag LOCUS_28650 117130 118077 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937367.1 protein_id gnl|my_center|LOCUS_28650 119233 118136 gene locus_tag LOCUS_28660 119233 118136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943125.1 protein_id gnl|my_center|LOCUS_28660 119473 121284 gene locus_tag LOCUS_28670 119473 121284 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940347.1 protein_id gnl|my_center|LOCUS_28670 121336 121797 gene locus_tag LOCUS_28680 121336 121797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791514.1 protein_id gnl|my_center|LOCUS_28680 121839 122180 gene locus_tag LOCUS_28690 121839 122180 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937898.1 protein_id gnl|my_center|LOCUS_28690 122394 123101 gene locus_tag LOCUS_28700 122394 123101 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937605.1 protein_id gnl|my_center|LOCUS_28700 123950 123228 gene locus_tag LOCUS_28710 123950 123228 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940497.1 protein_id gnl|my_center|LOCUS_28710 124829 125008 gene locus_tag LOCUS_28720 124829 125008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940431.1 protein_id gnl|my_center|LOCUS_28720 125022 125801 gene locus_tag LOCUS_28730 125022 125801 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940432.1 protein_id gnl|my_center|LOCUS_28730 126036 125809 gene locus_tag LOCUS_28740 126036 125809 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940433.1 protein_id gnl|my_center|LOCUS_28740 126066 127379 gene locus_tag LOCUS_28750 126066 127379 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940434.1 protein_id gnl|my_center|LOCUS_28750 127434 127634 gene locus_tag LOCUS_28760 127434 127634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 127631 128473 gene locus_tag LOCUS_28770 gene mqnB 127631 128473 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791464.1 protein_id gnl|my_center|LOCUS_28770 128513 129481 gene locus_tag LOCUS_28780 128513 129481 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940437.1 protein_id gnl|my_center|LOCUS_28780 129685 132189 gene locus_tag LOCUS_28790 129685 132189 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940438.1 protein_id gnl|my_center|LOCUS_28790 132306 135287 gene locus_tag LOCUS_28800 132306 135287 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940439.1 protein_id gnl|my_center|LOCUS_28800 136649 135375 gene locus_tag LOCUS_28810 136649 135375 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176729.1 protein_id gnl|my_center|LOCUS_28810 136977 136630 gene locus_tag LOCUS_28820 136977 136630 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176728.1 protein_id gnl|my_center|LOCUS_28820 139489 137312 gene locus_tag LOCUS_28830 139489 137312 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938002.1 protein_id gnl|my_center|LOCUS_28830 139759 142797 gene locus_tag LOCUS_28840 139759 142797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 143086 145914 gene locus_tag LOCUS_28850 143086 145914 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937562.1 protein_id gnl|my_center|LOCUS_28850 146298 146077 gene locus_tag LOCUS_28860 146298 146077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 146759 147625 gene locus_tag LOCUS_28870 146759 147625 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942064.1 protein_id gnl|my_center|LOCUS_28870 148460 149512 gene locus_tag LOCUS_28880 148460 149512 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 protein_id gnl|my_center|LOCUS_28880 149756 150268 gene locus_tag LOCUS_28890 149756 150268 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 protein_id gnl|my_center|LOCUS_28890 150265 151587 gene locus_tag LOCUS_28900 150265 151587 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 protein_id gnl|my_center|LOCUS_28900 151656 153014 gene locus_tag LOCUS_28910 151656 153014 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541772.1 protein_id gnl|my_center|LOCUS_28910 153040 153837 gene locus_tag LOCUS_28920 gene eutC 153040 153837 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266524.1 protein_id gnl|my_center|LOCUS_28920 154345 154482 gene locus_tag LOCUS_28930 154345 154482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 155875 154544 gene locus_tag LOCUS_28940 155875 154544 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940618.1 protein_id gnl|my_center|LOCUS_28940 156704 155925 gene locus_tag LOCUS_28950 gene hisF 156704 155925 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_28950 157335 156694 gene locus_tag LOCUS_28960 gene hisH 157335 156694 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937594.1 protein_id gnl|my_center|LOCUS_28960 158433 157543 gene locus_tag LOCUS_28970 158433 157543 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815043.1 protein_id gnl|my_center|LOCUS_28970 158627 158406 gene locus_tag LOCUS_28980 158627 158406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 158596 158802 gene locus_tag LOCUS_28990 158596 158802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 158810 162079 gene locus_tag LOCUS_29000 gene carB 158810 162079 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937473.1 protein_id gnl|my_center|LOCUS_29000 162076 163467 gene locus_tag LOCUS_29010 gene purF 162076 163467 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937472.1 protein_id gnl|my_center|LOCUS_29010 164546 163542 gene locus_tag LOCUS_29020 164546 163542 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938772.1 protein_id gnl|my_center|LOCUS_29020 165417 164548 gene locus_tag LOCUS_29030 165417 164548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 165843 165610 gene locus_tag LOCUS_29040 165843 165610 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943075.1 protein_id gnl|my_center|LOCUS_29040 166196 166014 gene locus_tag LOCUS_29050 166196 166014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 167019 166819 gene locus_tag LOCUS_29060 167019 166819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 167005 169317 gene locus_tag LOCUS_29070 167005 169317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 169320 171011 gene locus_tag LOCUS_29080 169320 171011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 171723 172349 gene locus_tag LOCUS_29090 171723 172349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 172354 172668 gene locus_tag LOCUS_29100 172354 172668 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370060.1 protein_id gnl|my_center|LOCUS_29100 172759 172938 gene locus_tag LOCUS_29110 172759 172938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 173044 173265 gene locus_tag LOCUS_29120 173044 173265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 173650 175791 gene locus_tag LOCUS_29130 173650 175791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 177441 176044 gene locus_tag LOCUS_29140 177441 176044 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933561.1 protein_id gnl|my_center|LOCUS_29140 178095 186854 gene locus_tag LOCUS_29150 178095 186854 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994041.1 protein_id gnl|my_center|LOCUS_29150 187493 187101 gene locus_tag LOCUS_29160 187493 187101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 188268 187627 gene locus_tag LOCUS_29170 188268 187627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 189250 188693 gene locus_tag LOCUS_29180 189250 188693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 188719 188728 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 189064 189073 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence36 190 792 gene locus_tag LOCUS_29190 190 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 809 1654 gene locus_tag LOCUS_29200 809 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 2650 1736 gene locus_tag LOCUS_29210 2650 1736 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938071.1 protein_id gnl|my_center|LOCUS_29210 2946 4028 gene locus_tag LOCUS_29220 2946 4028 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938072.1 protein_id gnl|my_center|LOCUS_29220 4800 4132 gene locus_tag LOCUS_29230 gene cmk 4800 4132 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938327.1 protein_id gnl|my_center|LOCUS_29230 5914 4790 gene locus_tag LOCUS_29240 gene hisC 5914 4790 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938328.1 protein_id gnl|my_center|LOCUS_29240 6507 6061 gene locus_tag LOCUS_29250 6507 6061 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938329.1 protein_id gnl|my_center|LOCUS_29250 6792 7283 gene locus_tag LOCUS_29260 6792 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938331.1 protein_id gnl|my_center|LOCUS_29260 7886 7389 gene locus_tag LOCUS_29270 7886 7389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 8202 9386 gene locus_tag LOCUS_29280 8202 9386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 9555 9905 gene locus_tag LOCUS_29290 9555 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 10709 9918 gene locus_tag LOCUS_29300 10709 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 11870 10869 gene locus_tag LOCUS_29310 gene gap 11870 10869 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939421.1 protein_id gnl|my_center|LOCUS_29310 12809 11886 gene locus_tag LOCUS_29320 gene fba 12809 11886 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_29320 13961 13200 gene locus_tag LOCUS_29330 gene surE 13961 13200 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939419.1 protein_id gnl|my_center|LOCUS_29330 14110 15150 gene locus_tag LOCUS_29340 14110 15150 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939418.1 protein_id gnl|my_center|LOCUS_29340 15135 15782 gene locus_tag LOCUS_29350 gene tmk 15135 15782 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939417.1 protein_id gnl|my_center|LOCUS_29350 15958 17277 gene locus_tag LOCUS_29360 15958 17277 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939416.1 protein_id gnl|my_center|LOCUS_29360 17336 18550 gene locus_tag LOCUS_29370 17336 18550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 18723 19565 gene locus_tag LOCUS_29380 18723 19565 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939415.1 protein_id gnl|my_center|LOCUS_29380 19709 21796 gene locus_tag LOCUS_29390 gene sucD 19709 21796 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792056.1 protein_id gnl|my_center|LOCUS_29390 23886 21877 gene locus_tag LOCUS_29400 23886 21877 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938510.1 protein_id gnl|my_center|LOCUS_29400 24266 23922 gene locus_tag LOCUS_29410 24266 23922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 24928 24308 gene locus_tag LOCUS_29420 24928 24308 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792502.1 protein_id gnl|my_center|LOCUS_29420 25082 26533 gene locus_tag LOCUS_29430 25082 26533 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_29430 26792 26508 gene locus_tag LOCUS_29440 26792 26508 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938514.1 protein_id gnl|my_center|LOCUS_29440 28627 26867 gene locus_tag LOCUS_29450 28627 26867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 29379 28822 gene locus_tag LOCUS_29460 29379 28822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 29628 31826 gene locus_tag LOCUS_29470 29628 31826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938515.1 protein_id gnl|my_center|LOCUS_29470 33682 31946 gene locus_tag LOCUS_29480 33682 31946 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792498.1 protein_id gnl|my_center|LOCUS_29480 34466 34017 gene locus_tag LOCUS_29490 34466 34017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 34759 35652 gene locus_tag LOCUS_29500 34759 35652 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_29500 35777 36226 gene locus_tag LOCUS_29510 35777 36226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 36326 36889 gene locus_tag LOCUS_29520 36326 36889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 40234 37031 gene locus_tag LOCUS_29530 40234 37031 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939362.1 protein_id gnl|my_center|LOCUS_29530 40528 42159 gene locus_tag LOCUS_29540 40528 42159 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_29540 42182 44332 gene locus_tag LOCUS_29550 42182 44332 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939360.1 protein_id gnl|my_center|LOCUS_29550 45198 44542 gene locus_tag LOCUS_29560 45198 44542 CDS product DUF799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211607.1 protein_id gnl|my_center|LOCUS_29560 45749 45210 gene locus_tag LOCUS_29570 45749 45210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 46066 45746 gene locus_tag LOCUS_29580 46066 45746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 47050 46070 gene locus_tag LOCUS_29590 47050 46070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 48488 47505 gene locus_tag LOCUS_29600 48488 47505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 48912 48583 gene locus_tag LOCUS_29610 48912 48583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 50419 49349 gene locus_tag LOCUS_29620 50419 49349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 50937 50623 gene locus_tag LOCUS_29630 50937 50623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 51132 50941 gene locus_tag LOCUS_29640 51132 50941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 51599 51129 gene locus_tag LOCUS_29650 51599 51129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 51820 51596 gene locus_tag LOCUS_29660 51820 51596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 52314 51829 gene locus_tag LOCUS_29670 52314 51829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 52496 52317 gene locus_tag LOCUS_29680 52496 52317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 53322 52561 gene locus_tag LOCUS_29690 53322 52561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475630.1 protein_id gnl|my_center|LOCUS_29690 53757 53350 gene locus_tag LOCUS_29700 53757 53350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 53750 53929 gene locus_tag LOCUS_29710 53750 53929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 54027 54269 gene locus_tag LOCUS_29720 54027 54269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 55063 54665 gene locus_tag LOCUS_29730 55063 54665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 55591 55073 gene locus_tag LOCUS_29740 55591 55073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 55914 55606 gene locus_tag LOCUS_29750 55914 55606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 56741 56196 gene locus_tag LOCUS_29760 56741 56196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 56819 57043 gene locus_tag LOCUS_29770 56819 57043 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939032.1 protein_id gnl|my_center|LOCUS_29770 57449 57153 gene locus_tag LOCUS_29780 57449 57153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 57586 57939 gene locus_tag LOCUS_29790 57586 57939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 58117 58464 gene locus_tag LOCUS_29800 58117 58464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 58689 58447 gene locus_tag LOCUS_29810 58689 58447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 58769 59224 gene locus_tag LOCUS_29820 58769 59224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051295088.1 protein_id gnl|my_center|LOCUS_29820 59228 59626 gene locus_tag LOCUS_29830 59228 59626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 59613 59840 gene locus_tag LOCUS_29840 59613 59840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 59912 60919 gene locus_tag LOCUS_29850 59912 60919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 60924 61607 gene locus_tag LOCUS_29860 60924 61607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 61611 61835 gene locus_tag LOCUS_29870 61611 61835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 61799 62278 gene locus_tag LOCUS_29880 61799 62278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 62682 62335 gene locus_tag LOCUS_29890 62682 62335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 63073 62885 gene locus_tag LOCUS_29900 63073 62885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 63126 63761 gene locus_tag LOCUS_29910 63126 63761 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939026.1 protein_id gnl|my_center|LOCUS_29910 63739 63933 gene locus_tag LOCUS_29920 63739 63933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 64259 64879 gene locus_tag LOCUS_29930 64259 64879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 64879 65091 gene locus_tag LOCUS_29940 64879 65091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 65076 65396 gene locus_tag LOCUS_29950 65076 65396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 65400 65753 gene locus_tag LOCUS_29960 65400 65753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 65976 66530 gene locus_tag LOCUS_29970 65976 66530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 66520 68445 gene locus_tag LOCUS_29980 66520 68445 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 protein_id gnl|my_center|LOCUS_29980 68445 68948 gene locus_tag LOCUS_29990 68445 68948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 68948 70507 gene locus_tag LOCUS_30000 68948 70507 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104536.1 protein_id gnl|my_center|LOCUS_30000 70581 72344 gene locus_tag LOCUS_30010 70581 72344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 72398 72589 gene locus_tag LOCUS_30020 72398 72589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 72592 72885 gene locus_tag LOCUS_30030 72592 72885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 72882 73406 gene locus_tag LOCUS_30040 72882 73406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 73385 73927 gene locus_tag LOCUS_30050 73385 73927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 73905 74576 gene locus_tag LOCUS_30060 73905 74576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 74628 74963 gene locus_tag LOCUS_30070 74628 74963 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244785.1 protein_id gnl|my_center|LOCUS_30070 74960 75874 gene locus_tag LOCUS_30080 74960 75874 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085151.1 protein_id gnl|my_center|LOCUS_30080 75867 76553 gene locus_tag LOCUS_30090 75867 76553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 76546 78768 gene locus_tag LOCUS_30100 76546 78768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 78778 79236 gene locus_tag LOCUS_30110 78778 79236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 79251 80459 gene locus_tag LOCUS_30120 79251 80459 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113197.1 protein_id gnl|my_center|LOCUS_30120 80459 80968 gene locus_tag LOCUS_30130 80459 80968 CDS product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085175.1 protein_id gnl|my_center|LOCUS_30130 80977 81219 gene locus_tag LOCUS_30140 80977 81219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 81346 83253 gene locus_tag LOCUS_30150 81346 83253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 83263 83658 gene locus_tag LOCUS_30160 83263 83658 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204753.1 protein_id gnl|my_center|LOCUS_30160 83658 83870 gene locus_tag LOCUS_30170 83658 83870 CDS product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868175.1 protein_id gnl|my_center|LOCUS_30170 83874 84869 gene locus_tag LOCUS_30180 83874 84869 CDS product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038112.1 protein_id gnl|my_center|LOCUS_30180 85077 84982 gene locus_tag LOCUS_t00510 85077 84982 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 85393 85989 gene locus_tag LOCUS_30190 85393 85989 CDS product rhodanese family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098411.1 protein_id gnl|my_center|LOCUS_30190 86882 86340 gene locus_tag LOCUS_30200 gene tadA 86882 86340 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092697.1 protein_id gnl|my_center|LOCUS_30200 87540 86884 gene locus_tag LOCUS_30210 87540 86884 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938821.1 protein_id gnl|my_center|LOCUS_30210 87760 89367 gene locus_tag LOCUS_30220 87760 89367 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_30220 89381 89953 gene locus_tag LOCUS_30230 gene rsmD 89381 89953 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938823.1 protein_id gnl|my_center|LOCUS_30230 89929 90441 gene locus_tag LOCUS_30240 gene coaD 89929 90441 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938824.1 protein_id gnl|my_center|LOCUS_30240 90454 91386 gene locus_tag LOCUS_30250 gene miaA 90454 91386 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938825.1 protein_id gnl|my_center|LOCUS_30250 91526 92707 gene locus_tag LOCUS_30260 gene mltC 91526 92707 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417550.1 protein_id gnl|my_center|LOCUS_30260 92834 93433 gene locus_tag LOCUS_30270 92834 93433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 93608 94684 gene locus_tag LOCUS_30280 gene glpX 93608 94684 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938831.1 protein_id gnl|my_center|LOCUS_30280 94839 95300 gene locus_tag LOCUS_30290 94839 95300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 95344 95578 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 95733 95657 gene locus_tag LOCUS_t00520 95733 95657 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 96247 95795 gene locus_tag LOCUS_30300 96247 95795 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792349.1 protein_id gnl|my_center|LOCUS_30300 96511 97218 gene locus_tag LOCUS_30310 96511 97218 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792348.1 protein_id gnl|my_center|LOCUS_30310 97529 97320 gene locus_tag LOCUS_30320 97529 97320 CDS product dual CXXC motif small (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938858.1 protein_id gnl|my_center|LOCUS_30320 97902 98411 gene locus_tag LOCUS_30330 97902 98411 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938859.1 protein_id gnl|my_center|LOCUS_30330 98549 100234 gene locus_tag LOCUS_30340 98549 100234 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938860.1 protein_id gnl|my_center|LOCUS_30340 100249 101100 gene locus_tag LOCUS_30350 100249 101100 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938861.1 protein_id gnl|my_center|LOCUS_30350 101160 101522 gene locus_tag LOCUS_30360 101160 101522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 102911 101676 gene locus_tag LOCUS_30370 gene ispD 102911 101676 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938747.1 protein_id gnl|my_center|LOCUS_30370 104164 103370 gene locus_tag LOCUS_30380 104164 103370 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938748.1 protein_id gnl|my_center|LOCUS_30380 105265 104225 gene locus_tag LOCUS_30390 105265 104225 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938749.1 protein_id gnl|my_center|LOCUS_30390 105456 105381 gene locus_tag LOCUS_t00530 105456 105381 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 106444 105542 gene locus_tag LOCUS_30400 106444 105542 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938750.1 protein_id gnl|my_center|LOCUS_30400 107337 106600 gene locus_tag LOCUS_30410 107337 106600 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938751.1 protein_id gnl|my_center|LOCUS_30410 107904 107425 gene locus_tag LOCUS_30420 107904 107425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 108412 107978 gene locus_tag LOCUS_30430 108412 107978 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939217.1 protein_id gnl|my_center|LOCUS_30430 109495 108449 gene locus_tag LOCUS_30440 gene ybgF 109495 108449 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939216.1 protein_id gnl|my_center|LOCUS_30440 109818 109549 gene locus_tag LOCUS_30450 109818 109549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 110416 109862 gene locus_tag LOCUS_30460 gene lspA 110416 109862 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939214.1 protein_id gnl|my_center|LOCUS_30460 113252 110424 gene locus_tag LOCUS_30470 gene ileS 113252 110424 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939213.1 protein_id gnl|my_center|LOCUS_30470 113300 113680 gene locus_tag LOCUS_30480 113300 113680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 114398 113829 gene locus_tag LOCUS_30490 114398 113829 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 protein_id gnl|my_center|LOCUS_30490 114680 114429 gene locus_tag LOCUS_30500 114680 114429 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939210.1 protein_id gnl|my_center|LOCUS_30500 115217 114723 gene locus_tag LOCUS_30510 115217 114723 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939209.1 protein_id gnl|my_center|LOCUS_30510 116992 115289 gene locus_tag LOCUS_30520 116992 115289 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939208.1 protein_id gnl|my_center|LOCUS_30520 117993 117040 gene locus_tag LOCUS_30530 117993 117040 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939207.1 protein_id gnl|my_center|LOCUS_30530 118498 118710 gene locus_tag LOCUS_30540 118498 118710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 119247 118756 gene locus_tag LOCUS_30550 119247 118756 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939205.1 protein_id gnl|my_center|LOCUS_30550 121077 119605 gene locus_tag LOCUS_30560 121077 119605 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939204.1 protein_id gnl|my_center|LOCUS_30560 122069 121116 gene locus_tag LOCUS_30570 122069 121116 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939203.1 protein_id gnl|my_center|LOCUS_30570 123976 122507 gene locus_tag LOCUS_30580 gene rho 123976 122507 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049758073.1 protein_id gnl|my_center|LOCUS_30580 124738 124223 gene locus_tag LOCUS_30590 124738 124223 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_30590 125446 124838 gene locus_tag LOCUS_30600 gene pth 125446 124838 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938864.1 protein_id gnl|my_center|LOCUS_30600 126180 125575 gene locus_tag LOCUS_30610 126180 125575 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938865.1 protein_id gnl|my_center|LOCUS_30610 127174 126236 gene locus_tag LOCUS_30620 127174 126236 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938866.1 protein_id gnl|my_center|LOCUS_30620 127301 127226 gene locus_tag LOCUS_t00540 127301 127226 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 128226 127306 gene locus_tag LOCUS_30630 gene ispE 128226 127306 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938867.1 protein_id gnl|my_center|LOCUS_30630 128776 128237 gene locus_tag LOCUS_30640 gene hslV 128776 128237 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938868.1 protein_id gnl|my_center|LOCUS_30640 130273 128789 gene locus_tag LOCUS_30650 130273 128789 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938869.1 protein_id gnl|my_center|LOCUS_30650 131739 130282 gene locus_tag LOCUS_30660 gene cysS 131739 130282 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938870.1 protein_id gnl|my_center|LOCUS_30660 132183 131749 gene locus_tag LOCUS_30670 gene rpiB 132183 131749 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938871.1 protein_id gnl|my_center|LOCUS_30670 132594 132235 gene locus_tag LOCUS_30680 132594 132235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 133436 132627 gene locus_tag LOCUS_30690 133436 132627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938873.1 protein_id gnl|my_center|LOCUS_30690 135165 133528 gene locus_tag LOCUS_30700 135165 133528 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938874.1 protein_id gnl|my_center|LOCUS_30700 136346 135285 gene locus_tag LOCUS_30710 136346 135285 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_30710 136553 138970 gene locus_tag LOCUS_30720 136553 138970 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938876.1 protein_id gnl|my_center|LOCUS_30720 138983 139522 gene locus_tag LOCUS_30730 138983 139522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 139523 139990 gene locus_tag LOCUS_30740 139523 139990 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938878.1 protein_id gnl|my_center|LOCUS_30740 140014 140541 gene locus_tag LOCUS_30750 gene hpt 140014 140541 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938879.1 protein_id gnl|my_center|LOCUS_30750 140637 141371 gene locus_tag LOCUS_30760 140637 141371 CDS product zinc-ribbon and DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938880.1 protein_id gnl|my_center|LOCUS_30760 141384 142724 gene locus_tag LOCUS_30770 gene radA 141384 142724 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938881.1 protein_id gnl|my_center|LOCUS_30770 142725 143261 gene locus_tag LOCUS_30780 142725 143261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 143419 145158 gene locus_tag LOCUS_30790 143419 145158 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938883.1 protein_id gnl|my_center|LOCUS_30790 145343 145705 gene locus_tag LOCUS_30800 145343 145705 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938884.1 protein_id gnl|my_center|LOCUS_30800 145773 147878 gene locus_tag LOCUS_30810 145773 147878 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938885.1 protein_id gnl|my_center|LOCUS_30810 147888 148769 gene locus_tag LOCUS_30820 147888 148769 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938886.1 protein_id gnl|my_center|LOCUS_30820 148774 149841 gene locus_tag LOCUS_30830 148774 149841 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938887.1 protein_id gnl|my_center|LOCUS_30830 150025 150678 gene locus_tag LOCUS_30840 150025 150678 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938888.1 protein_id gnl|my_center|LOCUS_30840 151158 150805 gene locus_tag LOCUS_30850 151158 150805 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_30850 151591 151217 gene locus_tag LOCUS_30860 gene crcB 151591 151217 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938890.1 protein_id gnl|my_center|LOCUS_30860 151722 152321 gene locus_tag LOCUS_30870 151722 152321 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938891.1 protein_id gnl|my_center|LOCUS_30870 152479 152793 gene locus_tag LOCUS_30880 152479 152793 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938892.1 protein_id gnl|my_center|LOCUS_30880 152796 155054 gene locus_tag LOCUS_30890 gene clpA 152796 155054 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938893.1 protein_id gnl|my_center|LOCUS_30890 155079 155783 gene locus_tag LOCUS_30900 gene aat 155079 155783 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_30900 156471 155962 gene locus_tag LOCUS_30910 156471 155962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792331.1 protein_id gnl|my_center|LOCUS_30910 156659 158686 gene locus_tag LOCUS_30920 gene uvrB 156659 158686 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938896.1 protein_id gnl|my_center|LOCUS_30920 158713 159468 gene locus_tag LOCUS_30930 158713 159468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938898.1 protein_id gnl|my_center|LOCUS_30930 159514 161823 gene locus_tag LOCUS_30940 gene ligA 159514 161823 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938899.1 protein_id gnl|my_center|LOCUS_30940 161854 162633 gene locus_tag LOCUS_30950 gene dapB 161854 162633 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938900.1 protein_id gnl|my_center|LOCUS_30950 162633 164342 gene locus_tag LOCUS_30960 162633 164342 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_30960 165857 164583 gene locus_tag LOCUS_30970 165857 164583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 167766 165862 gene locus_tag LOCUS_30980 167766 165862 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938902.1 protein_id gnl|my_center|LOCUS_30980 169133 167769 gene locus_tag LOCUS_30990 169133 167769 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356999.1 protein_id gnl|my_center|LOCUS_30990 169732 169301 gene locus_tag LOCUS_31000 169732 169301 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938903.1 protein_id gnl|my_center|LOCUS_31000 170128 171210 gene locus_tag LOCUS_31010 170128 171210 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938904.1 protein_id gnl|my_center|LOCUS_31010 171327 171881 gene locus_tag LOCUS_31020 171327 171881 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938905.1 protein_id gnl|my_center|LOCUS_31020 172066 173049 gene locus_tag LOCUS_31030 172066 173049 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 protein_id gnl|my_center|LOCUS_31030 173067 174401 gene locus_tag LOCUS_31040 173067 174401 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338025.1 protein_id gnl|my_center|LOCUS_31040 174420 174881 gene locus_tag LOCUS_31050 174420 174881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 176555 174972 gene locus_tag LOCUS_31060 gene nadB 176555 174972 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939096.1 protein_id gnl|my_center|LOCUS_31060 177698 176664 gene locus_tag LOCUS_31070 gene nadA 177698 176664 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939095.1 protein_id gnl|my_center|LOCUS_31070 178599 177715 gene locus_tag LOCUS_31080 gene nadC 178599 177715 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939094.1 protein_id gnl|my_center|LOCUS_31080 178849 180234 gene locus_tag LOCUS_31090 gene mgtE 178849 180234 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939093.1 protein_id gnl|my_center|LOCUS_31090 181162 180476 gene locus_tag LOCUS_31100 181162 180476 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879601.1 protein_id gnl|my_center|LOCUS_31100 183148 181556 gene locus_tag LOCUS_31110 183148 181556 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939092.1 protein_id gnl|my_center|LOCUS_31110 183559 185259 gene locus_tag LOCUS_31120 183559 185259 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939091.1 protein_id gnl|my_center|LOCUS_31120 185259 186497 gene locus_tag LOCUS_31130 185259 186497 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939090.1 protein_id gnl|my_center|LOCUS_31130 187502 186555 gene locus_tag LOCUS_31140 187502 186555 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939089.1 protein_id gnl|my_center|LOCUS_31140 187947 187738 gene locus_tag LOCUS_31150 187947 187738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 188238 189431 gene locus_tag LOCUS_31160 188238 189431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792214.1 protein_id gnl|my_center|LOCUS_31160 190290 189691 gene locus_tag LOCUS_31170 190290 189691 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939073.1 protein_id gnl|my_center|LOCUS_31170 190717 191469 gene locus_tag LOCUS_31180 190717 191469 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939071.1 protein_id gnl|my_center|LOCUS_31180 191462 192892 gene locus_tag LOCUS_31190 191462 192892 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939070.1 protein_id gnl|my_center|LOCUS_31190 192885 193553 gene locus_tag LOCUS_31200 192885 193553 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939069.1 protein_id gnl|my_center|LOCUS_31200 193817 194107 gene locus_tag LOCUS_31210 193817 194107 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792221.1 protein_id gnl|my_center|LOCUS_31210 194299 195123 gene locus_tag LOCUS_31220 194299 195123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938326.1 protein_id gnl|my_center|LOCUS_31220 196129 195194 gene locus_tag LOCUS_31230 196129 195194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932890.1 protein_id gnl|my_center|LOCUS_31230 196596 197348 gene locus_tag LOCUS_31240 196596 197348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 197797 197594 gene locus_tag LOCUS_31250 197797 197594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 198436 198113 gene locus_tag LOCUS_31260 198436 198113 CDS product IscA/HesB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937666.1 protein_id gnl|my_center|LOCUS_31260 198945 199484 gene locus_tag LOCUS_31270 gene pyrR 198945 199484 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938679.1 protein_id gnl|my_center|LOCUS_31270 201200 199497 gene locus_tag LOCUS_31280 201200 199497 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804353.1 protein_id gnl|my_center|LOCUS_31280 202421 201441 gene locus_tag LOCUS_31290 202421 201441 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_31290 204992 202608 gene locus_tag LOCUS_31300 204992 202608 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940320.1 protein_id gnl|my_center|LOCUS_31300 206179 204989 gene locus_tag LOCUS_31310 206179 204989 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_31310 208639 206480 gene locus_tag LOCUS_31320 208639 206480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 208952 210106 gene locus_tag LOCUS_31330 208952 210106 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 protein_id gnl|my_center|LOCUS_31330 210147 210953 gene locus_tag LOCUS_31340 210147 210953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 210999 212624 gene locus_tag LOCUS_31350 210999 212624 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940251.1 protein_id gnl|my_center|LOCUS_31350 212793 217949 gene locus_tag LOCUS_31360 212793 217949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 217936 218976 gene locus_tag LOCUS_31370 217936 218976 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706078.1 protein_id gnl|my_center|LOCUS_31370 219213 220289 gene locus_tag LOCUS_31380 219213 220289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 221399 220332 gene locus_tag LOCUS_31390 221399 220332 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939569.1 protein_id gnl|my_center|LOCUS_31390 221954 221742 gene locus_tag LOCUS_31400 221954 221742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 222252 222494 gene locus_tag LOCUS_31410 222252 222494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 222660 223208 gene locus_tag LOCUS_31420 222660 223208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 223240 224823 gene locus_tag LOCUS_31430 223240 224823 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938736.1 protein_id gnl|my_center|LOCUS_31430 225002 227098 gene locus_tag LOCUS_31440 gene flgK 225002 227098 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937825.1 protein_id gnl|my_center|LOCUS_31440 227112 228605 gene locus_tag LOCUS_31450 gene flgL 227112 228605 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937826.1 protein_id gnl|my_center|LOCUS_31450 228617 230314 gene locus_tag LOCUS_31460 gene fliD 228617 230314 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938162.1 protein_id gnl|my_center|LOCUS_31460 231388 230498 gene locus_tag LOCUS_31470 231388 230498 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939715.1 protein_id gnl|my_center|LOCUS_31470 232219 231566 gene locus_tag LOCUS_31480 232219 231566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 232504 233271 gene locus_tag LOCUS_31490 232504 233271 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947167.1 protein_id gnl|my_center|LOCUS_31490 233271 234848 gene locus_tag LOCUS_31500 233271 234848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 234969 235045 gene locus_tag LOCUS_t00550 234969 235045 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 235896 235165 gene locus_tag LOCUS_31510 235896 235165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 236344 236132 gene locus_tag LOCUS_31520 236344 236132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 >Feature sequence37 >Feature sequence38 >Feature sequence39 >Feature sequence40 >Feature sequence41 328 615 gene locus_tag LOCUS_31530 328 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 612 917 gene locus_tag LOCUS_31540 612 917 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114441661.1 protein_id gnl|my_center|LOCUS_31540 2191 932 gene locus_tag LOCUS_31550 2191 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939313.1 protein_id gnl|my_center|LOCUS_31550 3033 2272 gene locus_tag LOCUS_31560 3033 2272 CDS product ERF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939312.1 protein_id gnl|my_center|LOCUS_31560 >Feature sequence42 >Feature sequence43 <1 1164 gene locus_tag LOCUS_31570 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_187820211.1:S-layer family protein 1177 1500 gene locus_tag LOCUS_31580 1177 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 1781 2110 gene locus_tag LOCUS_31590 1781 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 2091 2459 gene locus_tag LOCUS_31600 2091 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 2613 3218 gene locus_tag LOCUS_31610 2613 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 3252 3572 gene locus_tag LOCUS_31620 3252 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 3911 5140 gene locus_tag LOCUS_31630 3911 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 5996 5583 gene locus_tag LOCUS_31640 5996 5583 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090036.1 protein_id gnl|my_center|LOCUS_31640 6363 6288 gene locus_tag LOCUS_t00560 6363 6288 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8547 6484 gene locus_tag LOCUS_31650 8547 6484 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937662.1 protein_id gnl|my_center|LOCUS_31650 8893 9471 gene locus_tag LOCUS_31660 8893 9471 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789736.1 protein_id gnl|my_center|LOCUS_31660 9898 9698 gene locus_tag LOCUS_31670 9898 9698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937346.1 protein_id gnl|my_center|LOCUS_31670 11413 10988 gene locus_tag LOCUS_31680 11413 10988 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937348.1 protein_id gnl|my_center|LOCUS_31680 11591 12832 gene locus_tag LOCUS_31690 gene dinB 11591 12832 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_31690 13774 12992 gene locus_tag LOCUS_31700 13774 12992 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937669.1 protein_id gnl|my_center|LOCUS_31700 15351 13771 gene locus_tag LOCUS_31710 15351 13771 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792979.1 protein_id gnl|my_center|LOCUS_31710 16351 15407 gene locus_tag LOCUS_31720 16351 15407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 17108 16356 gene locus_tag LOCUS_31730 17108 16356 CDS product polyphenol oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937672.1 protein_id gnl|my_center|LOCUS_31730 17683 17099 gene locus_tag LOCUS_31740 17683 17099 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792977.1 protein_id gnl|my_center|LOCUS_31740 18045 18716 gene locus_tag LOCUS_31750 18045 18716 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629591.1 protein_id gnl|my_center|LOCUS_31750 18829 18905 gene locus_tag LOCUS_t00570 18829 18905 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19027 19245 gene locus_tag LOCUS_31760 gene infA 19027 19245 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937325.1 protein_id gnl|my_center|LOCUS_31760 20751 19381 gene locus_tag LOCUS_31770 20751 19381 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021695.1 protein_id gnl|my_center|LOCUS_31770 21433 20870 gene locus_tag LOCUS_31780 21433 20870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 23874 21625 gene locus_tag LOCUS_31790 23874 21625 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205309.1 protein_id gnl|my_center|LOCUS_31790 24508 25080 gene locus_tag LOCUS_31800 24508 25080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 25084 25356 gene locus_tag LOCUS_31810 25084 25356 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_31810 26662 25415 gene locus_tag LOCUS_31820 26662 25415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 27024 26656 gene locus_tag LOCUS_31830 27024 26656 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635217.1 protein_id gnl|my_center|LOCUS_31830 27509 29836 gene locus_tag LOCUS_31840 27509 29836 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088793.1 protein_id gnl|my_center|LOCUS_31840 30091 31422 gene locus_tag LOCUS_31850 30091 31422 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597478.1 protein_id gnl|my_center|LOCUS_31850 31470 32582 gene locus_tag LOCUS_31860 31470 32582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 32607 33566 gene locus_tag LOCUS_31870 32607 33566 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115566.1 protein_id gnl|my_center|LOCUS_31870 33615 34598 gene locus_tag LOCUS_31880 33615 34598 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968517.1 protein_id gnl|my_center|LOCUS_31880 35443 35156 gene locus_tag LOCUS_31890 35443 35156 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940445.1 protein_id gnl|my_center|LOCUS_31890 35707 36411 gene locus_tag LOCUS_31900 35707 36411 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791459.1 protein_id gnl|my_center|LOCUS_31900 36821 36420 gene locus_tag LOCUS_31910 36821 36420 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939797.1 protein_id gnl|my_center|LOCUS_31910 38073 37450 gene locus_tag LOCUS_31920 38073 37450 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940338.1 protein_id gnl|my_center|LOCUS_31920 38687 38082 gene locus_tag LOCUS_31930 38687 38082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 39410 38826 gene locus_tag LOCUS_31940 39410 38826 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940335.1 protein_id gnl|my_center|LOCUS_31940 41188 40436 gene locus_tag LOCUS_31950 41188 40436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 41491 43611 gene locus_tag LOCUS_31960 41491 43611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 43602 44957 gene locus_tag LOCUS_31970 43602 44957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 45351 47060 gene locus_tag LOCUS_31980 45351 47060 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940470.1 protein_id gnl|my_center|LOCUS_31980 47647 47270 gene locus_tag LOCUS_31990 47647 47270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 48200 47820 gene locus_tag LOCUS_32000 48200 47820 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940617.1 protein_id gnl|my_center|LOCUS_32000 48721 48197 gene locus_tag LOCUS_32010 48721 48197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 50441 49479 gene locus_tag LOCUS_32020 50441 49479 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337787.1 protein_id gnl|my_center|LOCUS_32020 51282 50503 gene locus_tag LOCUS_32030 51282 50503 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938541.1 protein_id gnl|my_center|LOCUS_32030 52258 51506 gene locus_tag LOCUS_32040 52258 51506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 52789 52481 gene locus_tag LOCUS_32050 52789 52481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 54093 52816 gene locus_tag LOCUS_32060 54093 52816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 55139 54108 gene locus_tag LOCUS_32070 55139 54108 CDS product bifunctional ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940616.1 protein_id gnl|my_center|LOCUS_32070 56068 55145 gene locus_tag LOCUS_32080 56068 55145 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940615.1 protein_id gnl|my_center|LOCUS_32080 56153 56602 gene locus_tag LOCUS_32090 56153 56602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940614.1 protein_id gnl|my_center|LOCUS_32090 57395 56622 gene locus_tag LOCUS_32100 57395 56622 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791341.1 protein_id gnl|my_center|LOCUS_32100 58936 57929 gene locus_tag LOCUS_32110 58936 57929 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_32110 60306 59425 gene locus_tag LOCUS_32120 60306 59425 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940619.1 protein_id gnl|my_center|LOCUS_32120 61365 60400 gene locus_tag LOCUS_32130 gene fmt 61365 60400 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940620.1 protein_id gnl|my_center|LOCUS_32130 61883 61383 gene locus_tag LOCUS_32140 gene def 61883 61383 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940621.1 protein_id gnl|my_center|LOCUS_32140 63021 62110 gene locus_tag LOCUS_32150 63021 62110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 65463 63022 gene locus_tag LOCUS_32160 gene gyrA 65463 63022 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524181.1 protein_id gnl|my_center|LOCUS_32160 67882 65477 gene locus_tag LOCUS_32170 gene gyrB 67882 65477 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937314.1 protein_id gnl|my_center|LOCUS_32170 69036 67882 gene locus_tag LOCUS_32180 gene dnaN 69036 67882 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937313.1 protein_id gnl|my_center|LOCUS_32180 70492 69173 gene locus_tag LOCUS_32190 70492 69173 CDS product DnaA/Hda family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937312.1 protein_id gnl|my_center|LOCUS_32190 71124 72323 gene locus_tag LOCUS_32200 71124 72323 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940649.1 protein_id gnl|my_center|LOCUS_32200 73500 72448 gene locus_tag LOCUS_32210 gene mtnA 73500 72448 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937395.1 protein_id gnl|my_center|LOCUS_32210 74450 75934 gene locus_tag LOCUS_32220 74450 75934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 75953 77044 gene locus_tag LOCUS_32230 gene wecB 75953 77044 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012895956.1 protein_id gnl|my_center|LOCUS_32230 77041 79947 gene locus_tag LOCUS_32240 77041 79947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 80050 80616 gene locus_tag LOCUS_32250 80050 80616 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_32250 80619 81788 gene locus_tag LOCUS_32260 80619 81788 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967037.1 protein_id gnl|my_center|LOCUS_32260 81801 82856 gene locus_tag LOCUS_32270 gene wlbA 81801 82856 CDS product O-antigen biosynthesis protein WlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_32270 82973 85252 gene locus_tag LOCUS_32280 82973 85252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 86434 85283 gene locus_tag LOCUS_32290 86434 85283 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807055.1 protein_id gnl|my_center|LOCUS_32290 87390 86437 gene locus_tag LOCUS_32300 87390 86437 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_32300 88777 87398 gene locus_tag LOCUS_32310 88777 87398 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022166.1 protein_id gnl|my_center|LOCUS_32310 90608 88803 gene locus_tag LOCUS_32320 90608 88803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 91836 90661 gene locus_tag LOCUS_32330 91836 90661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 93158 91845 gene locus_tag LOCUS_32340 93158 91845 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546519.1 protein_id gnl|my_center|LOCUS_32340 94252 93173 gene locus_tag LOCUS_32350 94252 93173 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536050.1 protein_id gnl|my_center|LOCUS_32350 94953 94249 gene locus_tag LOCUS_32360 94953 94249 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_32360 95840 95151 gene locus_tag LOCUS_32370 95840 95151 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876008.1 protein_id gnl|my_center|LOCUS_32370 97075 95900 gene locus_tag LOCUS_32380 97075 95900 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107919.1 protein_id gnl|my_center|LOCUS_32380 97414 98658 gene locus_tag LOCUS_32390 97414 98658 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943270.1 protein_id gnl|my_center|LOCUS_32390 99385 98831 gene locus_tag LOCUS_32400 99385 98831 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940603.1 protein_id gnl|my_center|LOCUS_32400 100206 99385 gene locus_tag LOCUS_32410 100206 99385 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940604.1 protein_id gnl|my_center|LOCUS_32410 101277 100210 gene locus_tag LOCUS_32420 101277 100210 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940605.1 protein_id gnl|my_center|LOCUS_32420 101506 101279 gene locus_tag LOCUS_32430 101506 101279 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940606.1 protein_id gnl|my_center|LOCUS_32430 102929 101733 gene locus_tag LOCUS_32440 gene queA 102929 101733 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940607.1 protein_id gnl|my_center|LOCUS_32440 102898 103239 gene locus_tag LOCUS_32450 102898 103239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 103440 104003 gene locus_tag LOCUS_32460 103440 104003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 104003 105226 gene locus_tag LOCUS_32470 gene coaBC 104003 105226 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940609.1 protein_id gnl|my_center|LOCUS_32470 105208 106191 gene locus_tag LOCUS_32480 105208 106191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940671.1 protein_id gnl|my_center|LOCUS_32480 106229 106711 gene locus_tag LOCUS_32490 106229 106711 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525946.1 protein_id gnl|my_center|LOCUS_32490 106721 106870 gene locus_tag LOCUS_32500 106721 106870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 106897 107262 gene locus_tag LOCUS_32510 106897 107262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 108311 107883 gene locus_tag LOCUS_32520 gene arfB 108311 107883 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635526.1 protein_id gnl|my_center|LOCUS_32520 109068 108661 gene locus_tag LOCUS_32530 109068 108661 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793049.1 protein_id gnl|my_center|LOCUS_32530 109606 109974 gene locus_tag LOCUS_32540 109606 109974 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937551.1 protein_id gnl|my_center|LOCUS_32540 109987 110472 gene locus_tag LOCUS_32550 109987 110472 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937552.1 protein_id gnl|my_center|LOCUS_32550 110774 111130 gene locus_tag LOCUS_32560 110774 111130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 111280 111795 gene locus_tag LOCUS_32570 111280 111795 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_32570 112155 112466 gene locus_tag LOCUS_32580 112155 112466 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391577.1 protein_id gnl|my_center|LOCUS_32580 112488 113093 gene locus_tag LOCUS_32590 gene recR 112488 113093 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940458.1 protein_id gnl|my_center|LOCUS_32590 114688 113387 gene locus_tag LOCUS_32600 114688 113387 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937320.1 protein_id gnl|my_center|LOCUS_32600 115362 114685 gene locus_tag LOCUS_32610 115362 114685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 116692 115712 gene locus_tag LOCUS_32620 116692 115712 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937322.1 protein_id gnl|my_center|LOCUS_32620 116904 118322 gene locus_tag LOCUS_32630 116904 118322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 118616 118801 gene locus_tag LOCUS_32640 118616 118801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 118804 119682 gene locus_tag LOCUS_32650 118804 119682 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940340.1 protein_id gnl|my_center|LOCUS_32650 119896 120798 gene locus_tag LOCUS_32660 119896 120798 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940539.1 protein_id gnl|my_center|LOCUS_32660 121204 121956 gene locus_tag LOCUS_32670 121204 121956 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940624.1 protein_id gnl|my_center|LOCUS_32670 122144 123382 gene locus_tag LOCUS_32680 gene hisS 122144 123382 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940623.1 protein_id gnl|my_center|LOCUS_32680 123685 125505 gene locus_tag LOCUS_32690 gene aspS 123685 125505 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940622.1 protein_id gnl|my_center|LOCUS_32690 125614 127191 gene locus_tag LOCUS_32700 125614 127191 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 protein_id gnl|my_center|LOCUS_32700 127755 128753 gene locus_tag LOCUS_32710 127755 128753 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937471.1 protein_id gnl|my_center|LOCUS_32710 129863 128784 gene locus_tag LOCUS_32720 129863 128784 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937603.1 protein_id gnl|my_center|LOCUS_32720 129958 131502 gene locus_tag LOCUS_32730 gene cls 129958 131502 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937731.1 protein_id gnl|my_center|LOCUS_32730 131787 132704 gene locus_tag LOCUS_32740 131787 132704 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792899.1 protein_id gnl|my_center|LOCUS_32740 133013 134029 gene locus_tag LOCUS_32750 133013 134029 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_32750 134353 134853 gene locus_tag LOCUS_32760 134353 134853 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942698.1 protein_id gnl|my_center|LOCUS_32760 134857 136158 gene locus_tag LOCUS_32770 134857 136158 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942699.1 protein_id gnl|my_center|LOCUS_32770 137161 136256 gene locus_tag LOCUS_32780 137161 136256 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937446.1 protein_id gnl|my_center|LOCUS_32780 137382 137227 gene locus_tag LOCUS_32790 137382 137227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 137778 138149 gene locus_tag LOCUS_32800 137778 138149 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937449.1 protein_id gnl|my_center|LOCUS_32800 141402 138250 gene locus_tag LOCUS_32810 141402 138250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 142738 141479 gene locus_tag LOCUS_32820 gene murA 142738 141479 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940516.1 protein_id gnl|my_center|LOCUS_32820 142948 143023 gene locus_tag LOCUS_t00580 142948 143023 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 146106 143107 gene locus_tag LOCUS_32830 146106 143107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 147951 146272 gene locus_tag LOCUS_32840 147951 146272 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294639.1 protein_id gnl|my_center|LOCUS_32840 148499 147951 gene locus_tag LOCUS_32850 148499 147951 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_32850 148758 150968 gene locus_tag LOCUS_32860 148758 150968 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814145.1 protein_id gnl|my_center|LOCUS_32860 151839 151033 gene locus_tag LOCUS_32870 151839 151033 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294674.1 protein_id gnl|my_center|LOCUS_32870 152780 151836 gene locus_tag LOCUS_32880 152780 151836 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948769.1 protein_id gnl|my_center|LOCUS_32880 153060 153965 gene locus_tag LOCUS_32890 153060 153965 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940332.1 protein_id gnl|my_center|LOCUS_32890 154496 154921 gene locus_tag LOCUS_32900 154496 154921 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629761.1 protein_id gnl|my_center|LOCUS_32900 156404 155046 gene locus_tag LOCUS_32910 156404 155046 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_32910 158388 156460 gene locus_tag LOCUS_32920 158388 156460 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940637.1 protein_id gnl|my_center|LOCUS_32920 158659 159222 gene locus_tag LOCUS_32930 158659 159222 CDS product periplasmic heavy metal sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940639.1 protein_id gnl|my_center|LOCUS_32930 159519 159746 gene locus_tag LOCUS_32940 159519 159746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 160046 161593 gene locus_tag LOCUS_32950 160046 161593 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937614.1 protein_id gnl|my_center|LOCUS_32950 161870 162631 gene locus_tag LOCUS_32960 gene kdsB 161870 162631 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940373.1 protein_id gnl|my_center|LOCUS_32960 162631 163755 gene locus_tag LOCUS_32970 gene carA 162631 163755 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940372.1 protein_id gnl|my_center|LOCUS_32970 163987 164790 gene locus_tag LOCUS_32980 163987 164790 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940371.1 protein_id gnl|my_center|LOCUS_32980 166555 164891 gene locus_tag LOCUS_32990 gene ilvD 166555 164891 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940628.1 protein_id gnl|my_center|LOCUS_32990 167663 166761 gene locus_tag LOCUS_33000 167663 166761 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791332.1 protein_id gnl|my_center|LOCUS_33000 168433 167660 gene locus_tag LOCUS_33010 gene ftsE 168433 167660 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940630.1 protein_id gnl|my_center|LOCUS_33010 170865 168610 gene locus_tag LOCUS_33020 170865 168610 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164561900.1 protein_id gnl|my_center|LOCUS_33020 171333 171569 gene locus_tag LOCUS_33030 171333 171569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 171691 172860 gene locus_tag LOCUS_33040 171691 172860 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533371.1 protein_id gnl|my_center|LOCUS_33040 173839 172841 gene locus_tag LOCUS_33050 173839 172841 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939376.1 protein_id gnl|my_center|LOCUS_33050 175967 174072 gene locus_tag LOCUS_33060 gene cooS 175967 174072 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939375.1 protein_id gnl|my_center|LOCUS_33060 177293 176505 gene locus_tag LOCUS_33070 177293 176505 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939374.1 protein_id gnl|my_center|LOCUS_33070 179529 177523 gene locus_tag LOCUS_33080 179529 177523 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937349.1 protein_id gnl|my_center|LOCUS_33080 179793 180170 gene locus_tag LOCUS_33090 179793 180170 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524184.1 protein_id gnl|my_center|LOCUS_33090 180738 181805 gene locus_tag LOCUS_33100 180738 181805 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924795.1 protein_id gnl|my_center|LOCUS_33100 181826 185029 gene locus_tag LOCUS_33110 181826 185029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 185530 185063 gene locus_tag LOCUS_33120 185530 185063 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294635.1 protein_id gnl|my_center|LOCUS_33120 185815 186678 gene locus_tag LOCUS_33130 gene cysQ 185815 186678 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818748.1 protein_id gnl|my_center|LOCUS_33130 186693 187940 gene locus_tag LOCUS_33140 186693 187940 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338556.1 protein_id gnl|my_center|LOCUS_33140 187992 188330 gene locus_tag LOCUS_33150 187992 188330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 188540 190090 gene locus_tag LOCUS_33160 188540 190090 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937480.1 protein_id gnl|my_center|LOCUS_33160 190386 190063 gene locus_tag LOCUS_33170 190386 190063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 190373 191350 gene locus_tag LOCUS_33180 190373 191350 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937479.1 protein_id gnl|my_center|LOCUS_33180 191354 192262 gene locus_tag LOCUS_33190 191354 192262 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937478.1 protein_id gnl|my_center|LOCUS_33190 192269 193228 gene locus_tag LOCUS_33200 192269 193228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937477.1 protein_id gnl|my_center|LOCUS_33200 193231 194241 gene locus_tag LOCUS_33210 193231 194241 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937476.1 protein_id gnl|my_center|LOCUS_33210 195582 194314 gene locus_tag LOCUS_33220 195582 194314 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142523.1 protein_id gnl|my_center|LOCUS_33220 196646 195705 gene locus_tag LOCUS_33230 196646 195705 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402896.1 protein_id gnl|my_center|LOCUS_33230 197694 196651 gene locus_tag LOCUS_33240 197694 196651 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390596.1 protein_id gnl|my_center|LOCUS_33240 199229 197697 gene locus_tag LOCUS_33250 199229 197697 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402890.1 protein_id gnl|my_center|LOCUS_33250 200419 199430 gene locus_tag LOCUS_33260 200419 199430 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390594.1 protein_id gnl|my_center|LOCUS_33260 202313 200949 gene locus_tag LOCUS_33270 202313 200949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933801.1 protein_id gnl|my_center|LOCUS_33270 202533 202844 gene locus_tag LOCUS_33280 202533 202844 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925448.1 protein_id gnl|my_center|LOCUS_33280 202899 204200 gene locus_tag LOCUS_33290 202899 204200 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_33290 204352 204585 gene locus_tag LOCUS_33300 204352 204585 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868932.1 protein_id gnl|my_center|LOCUS_33300 204608 204982 gene locus_tag LOCUS_33310 204608 204982 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065848.1 protein_id gnl|my_center|LOCUS_33310 205037 205399 gene locus_tag LOCUS_33320 205037 205399 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943588.1 protein_id gnl|my_center|LOCUS_33320 205535 206236 gene locus_tag LOCUS_33330 205535 206236 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943589.1 protein_id gnl|my_center|LOCUS_33330 206411 207898 gene locus_tag LOCUS_33340 206411 207898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 208603 209112 gene locus_tag LOCUS_33350 208603 209112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 209530 210822 gene locus_tag LOCUS_33360 gene serS 209530 210822 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937547.1 protein_id gnl|my_center|LOCUS_33360 210890 210965 gene locus_tag LOCUS_t00590 210890 210965 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 212568 211099 gene locus_tag LOCUS_33370 212568 211099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 212808 213053 gene locus_tag LOCUS_33380 212808 213053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 213047 213373 gene locus_tag LOCUS_33390 213047 213373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 214444 213746 gene locus_tag LOCUS_33400 214444 213746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 214355 215851 gene locus_tag LOCUS_33410 214355 215851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 216359 217123 gene locus_tag LOCUS_33420 216359 217123 CDS product ERF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939312.1 protein_id gnl|my_center|LOCUS_33420 217204 218463 gene locus_tag LOCUS_33430 217204 218463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939313.1 protein_id gnl|my_center|LOCUS_33430 218783 218478 gene locus_tag LOCUS_33440 218783 218478 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550171.1 protein_id gnl|my_center|LOCUS_33440 219067 218780 gene locus_tag LOCUS_33450 219067 218780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 >Feature sequence44 >Feature sequence45 123 15 gene locus_tag LOCUS_r00020 123 15 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3172 250 gene locus_tag LOCUS_r00030 3172 250 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence46 >Feature sequence47