>Feature sequence1 991 464 gene locus_tag LOCUS_00010 991 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1226 966 gene locus_tag LOCUS_00020 1226 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1510 1319 gene locus_tag LOCUS_00030 1510 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1601 1933 gene locus_tag LOCUS_00040 1601 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2070 3122 gene locus_tag LOCUS_00050 2070 3122 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_00050 4300 3665 gene locus_tag LOCUS_00060 4300 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4821 4297 gene locus_tag LOCUS_00070 4821 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5072 4818 gene locus_tag LOCUS_00080 5072 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 5499 6902 gene locus_tag LOCUS_00090 5499 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7075 7890 gene locus_tag LOCUS_00100 7075 7890 CDS product TnsA-like heteromeric transposase endonuclease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073792743.1 protein_id gnl|my_center|LOCUS_00100 7887 10022 gene locus_tag LOCUS_00110 7887 10022 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079184950.1 protein_id gnl|my_center|LOCUS_00110 10139 11107 gene locus_tag LOCUS_00120 10139 11107 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104311.1 protein_id gnl|my_center|LOCUS_00120 11238 12296 gene locus_tag LOCUS_00130 11238 12296 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104311.1 protein_id gnl|my_center|LOCUS_00130 12729 12361 gene locus_tag LOCUS_00140 12729 12361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14125 12845 gene locus_tag LOCUS_00150 14125 12845 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976770.1 protein_id gnl|my_center|LOCUS_00150 14742 14158 gene locus_tag LOCUS_00160 14742 14158 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976769.1 protein_id gnl|my_center|LOCUS_00160 14965 15285 gene locus_tag LOCUS_00170 14965 15285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 15272 16081 gene locus_tag LOCUS_00180 15272 16081 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031832.1 protein_id gnl|my_center|LOCUS_00180 16050 17045 gene locus_tag LOCUS_00190 16050 17045 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536275.1 protein_id gnl|my_center|LOCUS_00190 17052 18089 gene locus_tag LOCUS_00200 17052 18089 CDS product 2-ketoarginine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266204.1 protein_id gnl|my_center|LOCUS_00200 18086 18571 gene locus_tag LOCUS_00210 18086 18571 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226581.1 protein_id gnl|my_center|LOCUS_00210 18568 19821 gene locus_tag LOCUS_00220 18568 19821 CDS product methylaspartate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226582.1 protein_id gnl|my_center|LOCUS_00220 19838 20851 gene locus_tag LOCUS_00230 19838 20851 CDS product asparagine synthetase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226583.1 protein_id gnl|my_center|LOCUS_00230 20848 22137 gene locus_tag LOCUS_00240 20848 22137 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226584.1 protein_id gnl|my_center|LOCUS_00240 22134 23498 gene locus_tag LOCUS_00250 22134 23498 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030843.1 protein_id gnl|my_center|LOCUS_00250 23522 24595 gene locus_tag LOCUS_00260 23522 24595 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226587.1 protein_id gnl|my_center|LOCUS_00260 24592 29160 gene locus_tag LOCUS_00270 24592 29160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30371 29940 gene locus_tag LOCUS_00280 30371 29940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 31228 30827 gene locus_tag LOCUS_00290 31228 30827 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902225.1 protein_id gnl|my_center|LOCUS_00290 31440 31228 gene locus_tag LOCUS_00300 gene mbtH 31440 31228 CDS product mycobactin NRPS accessory protein MbtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412265.1 protein_id gnl|my_center|LOCUS_00300 32683 31478 gene locus_tag LOCUS_00310 32683 31478 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898584.1 protein_id gnl|my_center|LOCUS_00310 33450 32680 gene locus_tag LOCUS_00320 33450 32680 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026996.1 protein_id gnl|my_center|LOCUS_00320 44146 33500 gene locus_tag LOCUS_00330 44146 33500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 45240 44200 gene locus_tag LOCUS_00340 45240 44200 CDS product clavaminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975576.1 protein_id gnl|my_center|LOCUS_00340 45995 45240 gene locus_tag LOCUS_00350 45995 45240 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530269.1 protein_id gnl|my_center|LOCUS_00350 47375 46173 gene locus_tag LOCUS_00360 47375 46173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 47927 48238 gene locus_tag LOCUS_00370 47927 48238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 50062 48500 gene locus_tag LOCUS_00380 50062 48500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 50785 50994 gene locus_tag LOCUS_00390 50785 50994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00390 51040 51183 gene locus_tag LOCUS_00400 51040 51183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 51232 51606 gene locus_tag LOCUS_00410 51232 51606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00410 52088 52570 gene locus_tag LOCUS_00420 52088 52570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 52737 53267 gene locus_tag LOCUS_00430 52737 53267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222815.1 protein_id gnl|my_center|LOCUS_00430 53488 54414 gene locus_tag LOCUS_00440 53488 54414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 54434 55210 gene locus_tag LOCUS_00450 54434 55210 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_00450 55422 56114 gene locus_tag LOCUS_00460 55422 56114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00460 56352 56831 gene locus_tag LOCUS_00470 56352 56831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 57710 56802 gene locus_tag LOCUS_00480 57710 56802 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705854.1 protein_id gnl|my_center|LOCUS_00480 57951 57715 gene locus_tag LOCUS_00490 57951 57715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 58255 58043 gene locus_tag LOCUS_00500 58255 58043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 58389 58739 gene locus_tag LOCUS_00510 58389 58739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 59203 59024 gene locus_tag LOCUS_00520 59203 59024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 59949 59560 gene locus_tag LOCUS_00530 59949 59560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 60722 60141 gene locus_tag LOCUS_00540 60722 60141 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00540 61582 60719 gene locus_tag LOCUS_00550 61582 60719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 62297 61749 gene locus_tag LOCUS_00560 62297 61749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00560 62893 62204 gene locus_tag LOCUS_00570 62893 62204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00570 63280 64050 gene locus_tag LOCUS_00580 63280 64050 CDS product IS5-like element ISSco3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026846.1 protein_id gnl|my_center|LOCUS_00580 64358 64155 gene locus_tag LOCUS_00590 64358 64155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00590 65087 64371 gene locus_tag LOCUS_00600 65087 64371 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030017.1 protein_id gnl|my_center|LOCUS_00600 65621 65154 gene locus_tag LOCUS_00610 65621 65154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 65944 65786 gene locus_tag LOCUS_00620 65944 65786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 66752 65937 gene locus_tag LOCUS_00630 66752 65937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 67243 66749 gene locus_tag LOCUS_00640 67243 66749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 69792 68533 gene locus_tag LOCUS_00650 69792 68533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 71336 70431 gene locus_tag LOCUS_00660 71336 70431 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485278.1 protein_id gnl|my_center|LOCUS_00660 71764 72120 gene locus_tag LOCUS_00670 71764 72120 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728052.1 protein_id gnl|my_center|LOCUS_00670 73119 73328 gene locus_tag LOCUS_00680 73119 73328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 73777 73526 gene locus_tag LOCUS_00690 73777 73526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 74262 73825 gene locus_tag LOCUS_00700 74262 73825 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223560.1 protein_id gnl|my_center|LOCUS_00700 74851 76488 gene locus_tag LOCUS_00710 74851 76488 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 protein_id gnl|my_center|LOCUS_00710 77114 76506 gene locus_tag LOCUS_00720 77114 76506 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889051.1 protein_id gnl|my_center|LOCUS_00720 77473 77039 gene locus_tag LOCUS_00730 77473 77039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00730 78216 77821 gene locus_tag LOCUS_00740 78216 77821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 78447 78650 gene locus_tag LOCUS_00750 78447 78650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 78892 79089 gene locus_tag LOCUS_00760 78892 79089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 80159 79149 gene locus_tag LOCUS_00770 80159 79149 CDS product ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325132.1 protein_id gnl|my_center|LOCUS_00770 80635 82983 gene locus_tag LOCUS_00780 80635 82983 CDS product Orn/Lys/Arg decarboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229207.1 protein_id gnl|my_center|LOCUS_00780 83276 84148 gene locus_tag LOCUS_00790 83276 84148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 84982 85212 gene locus_tag LOCUS_00800 84982 85212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 85202 85414 gene locus_tag LOCUS_00810 85202 85414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 85767 86987 gene locus_tag LOCUS_00820 85767 86987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 87669 87388 gene locus_tag LOCUS_00830 87669 87388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 87626 90565 gene locus_tag LOCUS_00840 87626 90565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 90584 91096 gene locus_tag LOCUS_00850 90584 91096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 92396 91734 gene locus_tag LOCUS_00860 92396 91734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 92969 92592 gene locus_tag LOCUS_00870 92969 92592 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390276.1 protein_id gnl|my_center|LOCUS_00870 93046 93456 gene locus_tag LOCUS_00880 93046 93456 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031693.1 protein_id gnl|my_center|LOCUS_00880 94208 94014 gene locus_tag LOCUS_00890 94208 94014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 95388 95723 gene locus_tag LOCUS_00900 95388 95723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00900 95699 95851 gene locus_tag LOCUS_00910 95699 95851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 96534 96202 gene locus_tag LOCUS_00920 96534 96202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 97338 97952 gene locus_tag LOCUS_00930 97338 97952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 98002 98286 gene locus_tag LOCUS_00940 98002 98286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00940 98328 99167 gene locus_tag LOCUS_00950 98328 99167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00950 99718 99110 gene locus_tag LOCUS_00960 99718 99110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 99641 99946 gene locus_tag LOCUS_00970 99641 99946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 101718 99997 gene locus_tag LOCUS_00980 101718 99997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 103592 101781 gene locus_tag LOCUS_00990 103592 101781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 106183 103658 gene locus_tag LOCUS_01000 106183 103658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 107784 108146 gene locus_tag LOCUS_01010 107784 108146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 110208 108412 gene locus_tag LOCUS_01020 110208 108412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 110172 110603 gene locus_tag LOCUS_01030 110172 110603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 111277 112215 gene locus_tag LOCUS_01040 111277 112215 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225966.1 protein_id gnl|my_center|LOCUS_01040 112277 112534 gene locus_tag LOCUS_01050 112277 112534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 112524 113747 gene locus_tag LOCUS_01060 112524 113747 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030513.1 protein_id gnl|my_center|LOCUS_01060 113980 114930 gene locus_tag LOCUS_01070 113980 114930 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031130.1 protein_id gnl|my_center|LOCUS_01070 116560 115229 gene locus_tag LOCUS_01080 116560 115229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026864.1 protein_id gnl|my_center|LOCUS_01080 118077 116737 gene locus_tag LOCUS_01090 118077 116737 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392280.1 protein_id gnl|my_center|LOCUS_01090 117979 118212 gene locus_tag LOCUS_01100 117979 118212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 118248 119174 gene locus_tag LOCUS_01110 118248 119174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 119359 121461 gene locus_tag LOCUS_01120 119359 121461 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110054.1 protein_id gnl|my_center|LOCUS_01120 121678 122109 gene locus_tag LOCUS_01130 121678 122109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 122711 124054 gene locus_tag LOCUS_01140 122711 124054 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230482.1 protein_id gnl|my_center|LOCUS_01140 125030 124269 gene locus_tag LOCUS_01150 125030 124269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 125049 125360 gene locus_tag LOCUS_01160 125049 125360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01160 125285 125824 gene locus_tag LOCUS_01170 125285 125824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01170 125829 126143 gene locus_tag LOCUS_01180 125829 126143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 126484 126660 gene locus_tag LOCUS_01190 126484 126660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 127780 127196 gene locus_tag LOCUS_01200 127780 127196 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222749.1 protein_id gnl|my_center|LOCUS_01200 128609 127773 gene locus_tag LOCUS_01210 128609 127773 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027106.1 protein_id gnl|my_center|LOCUS_01210 129058 129762 gene locus_tag LOCUS_01220 129058 129762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 130389 129844 gene locus_tag LOCUS_01230 130389 129844 CDS product DUF1360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226138.1 protein_id gnl|my_center|LOCUS_01230 130926 130546 gene locus_tag LOCUS_01240 130926 130546 CDS product DUF4383 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466936.1 protein_id gnl|my_center|LOCUS_01240 132328 131381 gene locus_tag LOCUS_01250 132328 131381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 132825 132334 gene locus_tag LOCUS_01260 132825 132334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 133296 133847 gene locus_tag LOCUS_01270 133296 133847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01270 134211 134813 gene locus_tag LOCUS_01280 134211 134813 CDS product GPP34 family phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027096.1 protein_id gnl|my_center|LOCUS_01280 135992 135339 gene locus_tag LOCUS_01290 135992 135339 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227978.1 protein_id gnl|my_center|LOCUS_01290 137302 135989 gene locus_tag LOCUS_01300 137302 135989 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199888163.1 protein_id gnl|my_center|LOCUS_01300 137477 138088 gene locus_tag LOCUS_01310 137477 138088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 139736 138405 gene locus_tag LOCUS_01320 139736 138405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 141137 140079 gene locus_tag LOCUS_01330 141137 140079 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031381.1 protein_id gnl|my_center|LOCUS_01330 141946 141365 gene locus_tag LOCUS_01340 141946 141365 CDS product snapalysin family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971509.1 protein_id gnl|my_center|LOCUS_01340 142782 142411 gene locus_tag LOCUS_01350 142782 142411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978453.1 protein_id gnl|my_center|LOCUS_01350 143021 142785 gene locus_tag LOCUS_01360 143021 142785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 143805 143500 gene locus_tag LOCUS_01370 143805 143500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 143689 144696 gene locus_tag LOCUS_01380 143689 144696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 144693 146522 gene locus_tag LOCUS_01390 144693 146522 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975329.1 protein_id gnl|my_center|LOCUS_01390 146528 146647 gene locus_tag LOCUS_01400 146528 146647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 146834 148735 gene locus_tag LOCUS_01410 146834 148735 CDS product RiPP maturation radical SAM C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_01410 148769 149428 gene locus_tag LOCUS_01420 148769 149428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 150317 149478 gene locus_tag LOCUS_01430 150317 149478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 150641 151504 gene locus_tag LOCUS_01440 150641 151504 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727421.1 protein_id gnl|my_center|LOCUS_01440 152253 151624 gene locus_tag LOCUS_01450 152253 151624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 152435 152704 gene locus_tag LOCUS_01460 152435 152704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 153077 153676 gene locus_tag LOCUS_01470 153077 153676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 154038 153865 gene locus_tag LOCUS_01480 154038 153865 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027290.1 protein_id gnl|my_center|LOCUS_01480 154364 154858 gene locus_tag LOCUS_01490 154364 154858 CDS product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976346.1 protein_id gnl|my_center|LOCUS_01490 154855 155259 gene locus_tag LOCUS_01500 154855 155259 CDS product DUF4247 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976347.1 protein_id gnl|my_center|LOCUS_01500 155316 155753 gene locus_tag LOCUS_01510 155316 155753 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028363.1 protein_id gnl|my_center|LOCUS_01510 155762 157357 gene locus_tag LOCUS_01520 155762 157357 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976349.1 protein_id gnl|my_center|LOCUS_01520 157754 158938 gene locus_tag LOCUS_01530 157754 158938 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978774.1 protein_id gnl|my_center|LOCUS_01530 158935 159624 gene locus_tag LOCUS_01540 158935 159624 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978773.1 protein_id gnl|my_center|LOCUS_01540 160441 159815 gene locus_tag LOCUS_01550 160441 159815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 161272 160715 gene locus_tag LOCUS_01560 161272 160715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 161187 162920 gene locus_tag LOCUS_01570 gene ctaD 161187 162920 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_01570 164314 163148 gene locus_tag LOCUS_01580 164314 163148 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484495.1 protein_id gnl|my_center|LOCUS_01580 165128 164412 gene locus_tag LOCUS_01590 165128 164412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 166447 165125 gene locus_tag LOCUS_01600 166447 165125 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026916.1 protein_id gnl|my_center|LOCUS_01600 167489 166506 gene locus_tag LOCUS_01610 167489 166506 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978674.1 protein_id gnl|my_center|LOCUS_01610 167635 168294 gene locus_tag LOCUS_01620 167635 168294 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026917.1 protein_id gnl|my_center|LOCUS_01620 168884 168306 gene locus_tag LOCUS_01630 168884 168306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 168973 170157 gene locus_tag LOCUS_01640 168973 170157 CDS product spore photoproduct lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971741.1 protein_id gnl|my_center|LOCUS_01640 170265 170744 gene locus_tag LOCUS_01650 170265 170744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 171129 170746 gene locus_tag LOCUS_01660 171129 170746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 171274 172482 gene locus_tag LOCUS_01670 171274 172482 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029306.1 protein_id gnl|my_center|LOCUS_01670 173346 172681 gene locus_tag LOCUS_01680 173346 172681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 173669 173343 gene locus_tag LOCUS_01690 173669 173343 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 protein_id gnl|my_center|LOCUS_01690 173773 174306 gene locus_tag LOCUS_01700 173773 174306 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027303.1 protein_id gnl|my_center|LOCUS_01700 174419 177271 gene locus_tag LOCUS_01710 174419 177271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 178391 177351 gene locus_tag LOCUS_01720 178391 177351 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031126.1 protein_id gnl|my_center|LOCUS_01720 178705 178544 gene locus_tag LOCUS_01730 178705 178544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 180976 178898 gene locus_tag LOCUS_01740 180976 178898 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031409.1 protein_id gnl|my_center|LOCUS_01740 183436 181205 gene locus_tag LOCUS_01750 183436 181205 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029494.1 protein_id gnl|my_center|LOCUS_01750 183439 183879 gene locus_tag LOCUS_01760 183439 183879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 184489 183896 gene locus_tag LOCUS_01770 184489 183896 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226951.1 protein_id gnl|my_center|LOCUS_01770 184839 184669 gene locus_tag LOCUS_01780 184839 184669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972469.1 protein_id gnl|my_center|LOCUS_01780 185371 185838 gene locus_tag LOCUS_01790 185371 185838 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246884.1 protein_id gnl|my_center|LOCUS_01790 186003 186078 gene locus_tag LOCUS_t00010 186003 186078 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 186595 186431 gene locus_tag LOCUS_01800 186595 186431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 187218 187445 gene locus_tag LOCUS_01810 187218 187445 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978014.1 protein_id gnl|my_center|LOCUS_01810 187501 187983 gene locus_tag LOCUS_01820 187501 187983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027385.1 protein_id gnl|my_center|LOCUS_01820 188245 189903 gene locus_tag LOCUS_01830 188245 189903 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731142.1 protein_id gnl|my_center|LOCUS_01830 189990 190508 gene locus_tag LOCUS_01840 189990 190508 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027329.1 protein_id gnl|my_center|LOCUS_01840 190781 190590 gene locus_tag LOCUS_01850 190781 190590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 192303 190888 gene locus_tag LOCUS_01860 192303 190888 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027739.1 protein_id gnl|my_center|LOCUS_01860 192487 193470 gene locus_tag LOCUS_01870 192487 193470 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282906.1 protein_id gnl|my_center|LOCUS_01870 194112 193540 gene locus_tag LOCUS_01880 194112 193540 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486994.1 protein_id gnl|my_center|LOCUS_01880 194428 194973 gene locus_tag LOCUS_01890 194428 194973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 195602 195024 gene locus_tag LOCUS_01900 195602 195024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 196103 196681 gene locus_tag LOCUS_01910 196103 196681 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027232.1 protein_id gnl|my_center|LOCUS_01910 198646 196880 gene locus_tag LOCUS_01920 198646 196880 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031512.1 protein_id gnl|my_center|LOCUS_01920 201459 198643 gene locus_tag LOCUS_01930 201459 198643 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855351.1 protein_id gnl|my_center|LOCUS_01930 202966 201818 gene locus_tag LOCUS_01940 202966 201818 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971590.1 protein_id gnl|my_center|LOCUS_01940 203178 204491 gene locus_tag LOCUS_01950 203178 204491 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971589.1 protein_id gnl|my_center|LOCUS_01950 204884 205927 gene locus_tag LOCUS_01960 204884 205927 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971588.1 protein_id gnl|my_center|LOCUS_01960 205924 206853 gene locus_tag LOCUS_01970 205924 206853 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971587.1 protein_id gnl|my_center|LOCUS_01970 206911 208365 gene locus_tag LOCUS_01980 206911 208365 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_01980 208540 208992 gene locus_tag LOCUS_01990 208540 208992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 209124 210446 gene locus_tag LOCUS_02000 209124 210446 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226140.1 protein_id gnl|my_center|LOCUS_02000 210449 212539 gene locus_tag LOCUS_02010 210449 212539 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742782.1 protein_id gnl|my_center|LOCUS_02010 213307 212882 gene locus_tag LOCUS_02020 213307 212882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485933.1 protein_id gnl|my_center|LOCUS_02020 213701 213366 gene locus_tag LOCUS_02030 213701 213366 CDS product gas vesicle protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972470.1 protein_id gnl|my_center|LOCUS_02030 214354 214055 gene locus_tag LOCUS_02040 214354 214055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 214932 214516 gene locus_tag LOCUS_02050 214932 214516 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973766.1 protein_id gnl|my_center|LOCUS_02050 215231 217462 gene locus_tag LOCUS_02060 gene katG 215231 217462 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027206.1 protein_id gnl|my_center|LOCUS_02060 217834 217568 gene locus_tag LOCUS_02070 217834 217568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 218434 219240 gene locus_tag LOCUS_02080 218434 219240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 220366 219353 gene locus_tag LOCUS_02090 220366 219353 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229442.1 protein_id gnl|my_center|LOCUS_02090 220448 221431 gene locus_tag LOCUS_02100 220448 221431 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467673.1 protein_id gnl|my_center|LOCUS_02100 221435 221632 gene locus_tag LOCUS_02110 221435 221632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 221616 222047 gene locus_tag LOCUS_02120 221616 222047 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976576.1 protein_id gnl|my_center|LOCUS_02120 222116 222718 gene locus_tag LOCUS_02130 222116 222718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 222820 223251 gene locus_tag LOCUS_02140 222820 223251 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971919.1 protein_id gnl|my_center|LOCUS_02140 223255 224295 gene locus_tag LOCUS_02150 223255 224295 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866892.1 protein_id gnl|my_center|LOCUS_02150 224468 225997 gene locus_tag LOCUS_02160 224468 225997 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027383.1 protein_id gnl|my_center|LOCUS_02160 226071 227450 gene locus_tag LOCUS_02170 226071 227450 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027384.1 protein_id gnl|my_center|LOCUS_02170 227606 228862 gene locus_tag LOCUS_02180 227606 228862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 229090 228911 gene locus_tag LOCUS_02190 229090 228911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 229359 230144 gene locus_tag LOCUS_02200 229359 230144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 230249 230749 gene locus_tag LOCUS_02210 230249 230749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 231664 230810 gene locus_tag LOCUS_02220 231664 230810 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031661.1 protein_id gnl|my_center|LOCUS_02220 231851 232099 gene locus_tag LOCUS_02230 231851 232099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 232275 233036 gene locus_tag LOCUS_02240 232275 233036 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975619.1 protein_id gnl|my_center|LOCUS_02240 233033 233980 gene locus_tag LOCUS_02250 gene pfkB 233033 233980 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028823.1 protein_id gnl|my_center|LOCUS_02250 234066 236072 gene locus_tag LOCUS_02260 234066 236072 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028822.1 protein_id gnl|my_center|LOCUS_02260 236852 236172 gene locus_tag LOCUS_02270 236852 236172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 237214 236927 gene locus_tag LOCUS_02280 237214 236927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 237867 237358 gene locus_tag LOCUS_02290 237867 237358 CDS product DUF664 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224874.1 protein_id gnl|my_center|LOCUS_02290 238155 237922 gene locus_tag LOCUS_02300 238155 237922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 238828 238160 gene locus_tag LOCUS_02310 238828 238160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 239757 239158 gene locus_tag LOCUS_02320 239757 239158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 239909 240409 gene locus_tag LOCUS_02330 239909 240409 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400636.1 protein_id gnl|my_center|LOCUS_02330 240841 240677 gene locus_tag LOCUS_02340 gene rpmG 240841 240677 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975405.1 protein_id gnl|my_center|LOCUS_02340 241199 242632 gene locus_tag LOCUS_02350 241199 242632 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031544.1 protein_id gnl|my_center|LOCUS_02350 244149 242635 gene locus_tag LOCUS_02360 244149 242635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031543.1 protein_id gnl|my_center|LOCUS_02360 244576 245508 gene locus_tag LOCUS_02370 244576 245508 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971893.1 protein_id gnl|my_center|LOCUS_02370 245486 245731 gene locus_tag LOCUS_02380 245486 245731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 245845 248064 gene locus_tag LOCUS_02390 245845 248064 CDS product terpene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030632.1 protein_id gnl|my_center|LOCUS_02390 248723 248196 gene locus_tag LOCUS_02400 248723 248196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031540.1 protein_id gnl|my_center|LOCUS_02400 249244 248843 gene locus_tag LOCUS_02410 249244 248843 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112767.1 protein_id gnl|my_center|LOCUS_02410 249488 250771 gene locus_tag LOCUS_02420 gene paaF 249488 250771 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031681.1 protein_id gnl|my_center|LOCUS_02420 252287 250776 gene locus_tag LOCUS_02430 252287 250776 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031537.1 protein_id gnl|my_center|LOCUS_02430 252466 253692 gene locus_tag LOCUS_02440 252466 253692 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027238.1 protein_id gnl|my_center|LOCUS_02440 253930 255819 gene locus_tag LOCUS_02450 253930 255819 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971902.1 protein_id gnl|my_center|LOCUS_02450 256188 255946 gene locus_tag LOCUS_02460 256188 255946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 256087 256332 gene locus_tag LOCUS_02470 256087 256332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 256380 257483 gene locus_tag LOCUS_02480 256380 257483 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227054.1 protein_id gnl|my_center|LOCUS_02480 259190 257631 gene locus_tag LOCUS_02490 259190 257631 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483874.1 protein_id gnl|my_center|LOCUS_02490 261640 259241 gene locus_tag LOCUS_02500 261640 259241 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031533.1 protein_id gnl|my_center|LOCUS_02500 263104 261956 gene locus_tag LOCUS_02510 263104 261956 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270458.1 protein_id gnl|my_center|LOCUS_02510 263442 263230 gene locus_tag LOCUS_02520 263442 263230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 263701 264105 gene locus_tag LOCUS_02530 263701 264105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 266515 264149 gene locus_tag LOCUS_02540 266515 264149 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269956.1 protein_id gnl|my_center|LOCUS_02540 267964 266561 gene locus_tag LOCUS_02550 267964 266561 CDS product NADP-dependent succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027651.1 protein_id gnl|my_center|LOCUS_02550 268577 268116 gene locus_tag LOCUS_02560 268577 268116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971804.1 protein_id gnl|my_center|LOCUS_02560 270848 268752 gene locus_tag LOCUS_02570 270848 268752 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727118.1 protein_id gnl|my_center|LOCUS_02570 271876 270866 gene locus_tag LOCUS_02580 271876 270866 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027298.1 protein_id gnl|my_center|LOCUS_02580 272460 271873 gene locus_tag LOCUS_02590 272460 271873 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978174.1 protein_id gnl|my_center|LOCUS_02590 272858 272565 gene locus_tag LOCUS_02600 272858 272565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031411.1 protein_id gnl|my_center|LOCUS_02600 273152 273490 gene locus_tag LOCUS_02610 273152 273490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 273625 274449 gene locus_tag LOCUS_02620 273625 274449 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868693.1 protein_id gnl|my_center|LOCUS_02620 275024 274452 gene locus_tag LOCUS_02630 275024 274452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 275219 275605 gene locus_tag LOCUS_02640 275219 275605 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027430.1 protein_id gnl|my_center|LOCUS_02640 276108 275602 gene locus_tag LOCUS_02650 276108 275602 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978004.1 protein_id gnl|my_center|LOCUS_02650 277221 276298 gene locus_tag LOCUS_02660 277221 276298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027540.1 protein_id gnl|my_center|LOCUS_02660 278153 277350 gene locus_tag LOCUS_02670 278153 277350 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675028.1 protein_id gnl|my_center|LOCUS_02670 278386 280239 gene locus_tag LOCUS_02680 278386 280239 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742071.1 protein_id gnl|my_center|LOCUS_02680 280239 282476 gene locus_tag LOCUS_02690 gene scpA 280239 282476 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_02690 282489 283511 gene locus_tag LOCUS_02700 gene meaB 282489 283511 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222827.1 protein_id gnl|my_center|LOCUS_02700 285315 283669 gene locus_tag LOCUS_02710 gene pgm 285315 283669 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_02710 285578 285955 gene locus_tag LOCUS_02720 285578 285955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972272.1 protein_id gnl|my_center|LOCUS_02720 286233 286054 gene locus_tag LOCUS_02730 286233 286054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 287294 286293 gene locus_tag LOCUS_02740 287294 286293 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031568.1 protein_id gnl|my_center|LOCUS_02740 287469 287621 gene locus_tag LOCUS_02750 287469 287621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 287803 287952 gene locus_tag LOCUS_02760 287803 287952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 288321 288109 gene locus_tag LOCUS_02770 288321 288109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 288546 289721 gene locus_tag LOCUS_02780 288546 289721 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484184.1 protein_id gnl|my_center|LOCUS_02780 289709 291271 gene locus_tag LOCUS_02790 gene crtI 289709 291271 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026910.1 protein_id gnl|my_center|LOCUS_02790 291258 292253 gene locus_tag LOCUS_02800 291258 292253 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026911.1 protein_id gnl|my_center|LOCUS_02800 292250 293263 gene locus_tag LOCUS_02810 292250 293263 CDS product DUF5914 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026912.1 protein_id gnl|my_center|LOCUS_02810 294858 293317 gene locus_tag LOCUS_02820 294858 293317 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225919.1 protein_id gnl|my_center|LOCUS_02820 295589 294855 gene locus_tag LOCUS_02830 295589 294855 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026914.1 protein_id gnl|my_center|LOCUS_02830 296803 295589 gene locus_tag LOCUS_02840 296803 295589 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026915.1 protein_id gnl|my_center|LOCUS_02840 297163 297660 gene locus_tag LOCUS_02850 297163 297660 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978019.1 protein_id gnl|my_center|LOCUS_02850 297807 299936 gene locus_tag LOCUS_02860 297807 299936 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027382.1 protein_id gnl|my_center|LOCUS_02860 299983 300465 gene locus_tag LOCUS_02870 299983 300465 CDS product MSMEG_6728 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971750.1 protein_id gnl|my_center|LOCUS_02870 300865 300638 gene locus_tag LOCUS_02880 300865 300638 CDS product DUF5133 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971826.1 protein_id gnl|my_center|LOCUS_02880 301079 301297 gene locus_tag LOCUS_02890 301079 301297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 301414 302124 gene locus_tag LOCUS_02900 301414 302124 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938268.1 protein_id gnl|my_center|LOCUS_02900 302267 303259 gene locus_tag LOCUS_02910 gene dhaK 302267 303259 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972071.1 protein_id gnl|my_center|LOCUS_02910 303304 303927 gene locus_tag LOCUS_02920 gene dhaL 303304 303927 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031416.1 protein_id gnl|my_center|LOCUS_02920 303924 304337 gene locus_tag LOCUS_02930 303924 304337 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164277346.1 protein_id gnl|my_center|LOCUS_02930 307871 304410 gene locus_tag LOCUS_02940 307871 304410 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228485.1 protein_id gnl|my_center|LOCUS_02940 308092 308589 gene locus_tag LOCUS_02950 308092 308589 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229426.1 protein_id gnl|my_center|LOCUS_02950 309436 308687 gene locus_tag LOCUS_02960 309436 308687 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466913.1 protein_id gnl|my_center|LOCUS_02960 309882 309433 gene locus_tag LOCUS_02970 309882 309433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 309875 310174 gene locus_tag LOCUS_02980 309875 310174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 310363 311043 gene locus_tag LOCUS_02990 310363 311043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02990 311315 312280 gene locus_tag LOCUS_03000 311315 312280 CDS product PRC and DUF2382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027446.1 protein_id gnl|my_center|LOCUS_03000 313411 312443 gene locus_tag LOCUS_03010 313411 312443 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776299.1 protein_id gnl|my_center|LOCUS_03010 313831 313568 gene locus_tag LOCUS_03020 313831 313568 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027612.1 protein_id gnl|my_center|LOCUS_03020 315002 314106 gene locus_tag LOCUS_03030 315002 314106 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226859.1 protein_id gnl|my_center|LOCUS_03030 315343 316215 gene locus_tag LOCUS_03040 315343 316215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 316364 316774 gene locus_tag LOCUS_03050 316364 316774 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975554.1 protein_id gnl|my_center|LOCUS_03050 317045 316845 gene locus_tag LOCUS_03060 317045 316845 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973256.1 protein_id gnl|my_center|LOCUS_03060 317524 317276 gene locus_tag LOCUS_03070 317524 317276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 317412 317783 gene locus_tag LOCUS_03080 317412 317783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 318202 317879 gene locus_tag LOCUS_03090 318202 317879 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878426.1 protein_id gnl|my_center|LOCUS_03090 319464 318262 gene locus_tag LOCUS_03100 319464 318262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 320676 319567 gene locus_tag LOCUS_03110 320676 319567 CDS product 1,3,6,8-tetrahydroxynaphthalene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027653.1 protein_id gnl|my_center|LOCUS_03110 321916 320711 gene locus_tag LOCUS_03120 321916 320711 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977624.1 protein_id gnl|my_center|LOCUS_03120 322892 322014 gene locus_tag LOCUS_03130 322892 322014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 323026 323445 gene locus_tag LOCUS_03140 323026 323445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03140 323456 324127 gene locus_tag LOCUS_03150 323456 324127 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082850.1 protein_id gnl|my_center|LOCUS_03150 324595 324155 gene locus_tag LOCUS_03160 324595 324155 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030744.1 protein_id gnl|my_center|LOCUS_03160 325213 324608 gene locus_tag LOCUS_03170 325213 324608 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967669.1 protein_id gnl|my_center|LOCUS_03170 325390 327678 gene locus_tag LOCUS_03180 325390 327678 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872986.1 protein_id gnl|my_center|LOCUS_03180 327691 328386 gene locus_tag LOCUS_03190 327691 328386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 328393 329415 gene locus_tag LOCUS_03200 328393 329415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03200 330758 329391 gene locus_tag LOCUS_03210 330758 329391 CDS product streptophobe family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220451617.1 protein_id gnl|my_center|LOCUS_03210 331129 332133 gene locus_tag LOCUS_03220 331129 332133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 334074 332170 gene locus_tag LOCUS_03230 334074 332170 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030997.1 protein_id gnl|my_center|LOCUS_03230 334452 334111 gene locus_tag LOCUS_03240 334452 334111 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325219.1 protein_id gnl|my_center|LOCUS_03240 335611 334520 gene locus_tag LOCUS_03250 335611 334520 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326766.1 protein_id gnl|my_center|LOCUS_03250 336505 335669 gene locus_tag LOCUS_03260 336505 335669 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031781.1 protein_id gnl|my_center|LOCUS_03260 336684 337058 gene locus_tag LOCUS_03270 336684 337058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 337798 337115 gene locus_tag LOCUS_03280 337798 337115 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031564.1 protein_id gnl|my_center|LOCUS_03280 338444 337947 gene locus_tag LOCUS_03290 338444 337947 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971635.1 protein_id gnl|my_center|LOCUS_03290 338797 338441 gene locus_tag LOCUS_03300 338797 338441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 338715 340619 gene locus_tag LOCUS_03310 338715 340619 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_03310 340742 341752 gene locus_tag LOCUS_03320 340742 341752 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869314.1 protein_id gnl|my_center|LOCUS_03320 342196 341786 gene locus_tag LOCUS_03330 342196 341786 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975825.1 protein_id gnl|my_center|LOCUS_03330 342310 342792 gene locus_tag LOCUS_03340 342310 342792 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028699.1 protein_id gnl|my_center|LOCUS_03340 343854 342895 gene locus_tag LOCUS_03350 343854 342895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 345031 343892 gene locus_tag LOCUS_03360 345031 343892 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027695.1 protein_id gnl|my_center|LOCUS_03360 346105 345101 gene locus_tag LOCUS_03370 346105 345101 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086853184.1 protein_id gnl|my_center|LOCUS_03370 346805 346161 gene locus_tag LOCUS_03380 346805 346161 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222235.1 protein_id gnl|my_center|LOCUS_03380 348267 346888 gene locus_tag LOCUS_03390 348267 346888 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228605.1 protein_id gnl|my_center|LOCUS_03390 348790 351324 gene locus_tag LOCUS_03400 348790 351324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 352164 351469 gene locus_tag LOCUS_03410 352164 351469 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 protein_id gnl|my_center|LOCUS_03410 352378 352211 gene locus_tag LOCUS_03420 352378 352211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 352497 354005 gene locus_tag LOCUS_03430 352497 354005 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031070.1 protein_id gnl|my_center|LOCUS_03430 354002 355732 gene locus_tag LOCUS_03440 354002 355732 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031071.1 protein_id gnl|my_center|LOCUS_03440 355722 356660 gene locus_tag LOCUS_03450 355722 356660 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528136.1 protein_id gnl|my_center|LOCUS_03450 356657 357334 gene locus_tag LOCUS_03460 356657 357334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 357506 358909 gene locus_tag LOCUS_03470 gene lpdA 357506 358909 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283919.1 protein_id gnl|my_center|LOCUS_03470 359030 360067 gene locus_tag LOCUS_03480 359030 360067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 361628 360237 gene locus_tag LOCUS_03490 361628 360237 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031701.1 protein_id gnl|my_center|LOCUS_03490 361939 363345 gene locus_tag LOCUS_03500 361939 363345 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031698.1 protein_id gnl|my_center|LOCUS_03500 363401 364381 gene locus_tag LOCUS_03510 363401 364381 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031697.1 protein_id gnl|my_center|LOCUS_03510 364378 365277 gene locus_tag LOCUS_03520 364378 365277 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971654.1 protein_id gnl|my_center|LOCUS_03520 365331 366539 gene locus_tag LOCUS_03530 365331 366539 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868921.1 protein_id gnl|my_center|LOCUS_03530 367149 366601 gene locus_tag LOCUS_03540 367149 366601 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230723.1 protein_id gnl|my_center|LOCUS_03540 367430 368158 gene locus_tag LOCUS_03550 367430 368158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 368245 370551 gene locus_tag LOCUS_03560 368245 370551 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973559.1 protein_id gnl|my_center|LOCUS_03560 370706 372022 gene locus_tag LOCUS_03570 370706 372022 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928935.1 protein_id gnl|my_center|LOCUS_03570 373555 372281 gene locus_tag LOCUS_03580 373555 372281 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027355.1 protein_id gnl|my_center|LOCUS_03580 374328 373900 gene locus_tag LOCUS_03590 374328 373900 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974563.1 protein_id gnl|my_center|LOCUS_03590 374683 375354 gene locus_tag LOCUS_03600 374683 375354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 375504 376058 gene locus_tag LOCUS_03610 375504 376058 CDS product DM13 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978724.1 protein_id gnl|my_center|LOCUS_03610 377090 376068 gene locus_tag LOCUS_03620 377090 376068 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031519.1 protein_id gnl|my_center|LOCUS_03620 377890 377117 gene locus_tag LOCUS_03630 377890 377117 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851039.1 protein_id gnl|my_center|LOCUS_03630 378999 377890 gene locus_tag LOCUS_03640 378999 377890 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031517.1 protein_id gnl|my_center|LOCUS_03640 379701 380858 gene locus_tag LOCUS_03650 379701 380858 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031678.1 protein_id gnl|my_center|LOCUS_03650 380855 381700 gene locus_tag LOCUS_03660 380855 381700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 381693 382076 gene locus_tag LOCUS_03670 381693 382076 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971677.1 protein_id gnl|my_center|LOCUS_03670 382080 382640 gene locus_tag LOCUS_03680 382080 382640 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971676.1 protein_id gnl|my_center|LOCUS_03680 382653 384023 gene locus_tag LOCUS_03690 382653 384023 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972616.1 protein_id gnl|my_center|LOCUS_03690 384116 385363 gene locus_tag LOCUS_03700 384116 385363 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226253.1 protein_id gnl|my_center|LOCUS_03700 385360 386163 gene locus_tag LOCUS_03710 385360 386163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 387190 386300 gene locus_tag LOCUS_03720 387190 386300 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466643.1 protein_id gnl|my_center|LOCUS_03720 387861 387292 gene locus_tag LOCUS_03730 387861 387292 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027066.1 protein_id gnl|my_center|LOCUS_03730 389313 387904 gene locus_tag LOCUS_03740 389313 387904 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027167.1 protein_id gnl|my_center|LOCUS_03740 389495 390091 gene locus_tag LOCUS_03750 gene thpR 389495 390091 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859391.1 protein_id gnl|my_center|LOCUS_03750 391596 390169 gene locus_tag LOCUS_03760 391596 390169 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027188.1 protein_id gnl|my_center|LOCUS_03760 393218 391596 gene locus_tag LOCUS_03770 393218 391596 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027187.1 protein_id gnl|my_center|LOCUS_03770 394119 393280 gene locus_tag LOCUS_03780 394119 393280 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027186.1 protein_id gnl|my_center|LOCUS_03780 395087 394116 gene locus_tag LOCUS_03790 395087 394116 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978331.1 protein_id gnl|my_center|LOCUS_03790 396357 395089 gene locus_tag LOCUS_03800 396357 395089 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027184.1 protein_id gnl|my_center|LOCUS_03800 396605 397465 gene locus_tag LOCUS_03810 396605 397465 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978333.1 protein_id gnl|my_center|LOCUS_03810 397605 399290 gene locus_tag LOCUS_03820 397605 399290 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_03820 399380 400102 gene locus_tag LOCUS_03830 399380 400102 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_03830 400866 400333 gene locus_tag LOCUS_03840 400866 400333 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245116.1 protein_id gnl|my_center|LOCUS_03840 401610 400975 gene locus_tag LOCUS_03850 401610 400975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 401926 410499 gene locus_tag LOCUS_03860 401926 410499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 410521 411138 gene locus_tag LOCUS_03870 410521 411138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 411439 411561 gene locus_tag LOCUS_03880 411439 411561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 413102 411564 gene locus_tag LOCUS_03890 413102 411564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 413967 413296 gene locus_tag LOCUS_03900 413967 413296 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027267.1 protein_id gnl|my_center|LOCUS_03900 436036 414278 gene locus_tag LOCUS_03910 436036 414278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 436489 436118 gene locus_tag LOCUS_03920 436489 436118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 436947 436492 gene locus_tag LOCUS_03930 436947 436492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 441062 437142 gene locus_tag LOCUS_03940 441062 437142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 441655 441191 gene locus_tag LOCUS_03950 441655 441191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 442101 441793 gene locus_tag LOCUS_03960 442101 441793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 442545 442210 gene locus_tag LOCUS_03970 442545 442210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 444536 442926 gene locus_tag LOCUS_03980 gene eccB 444536 442926 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224123.1 protein_id gnl|my_center|LOCUS_03980 445991 444582 gene locus_tag LOCUS_03990 gene eccD 445991 444582 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222634.1 protein_id gnl|my_center|LOCUS_03990 446398 450465 gene locus_tag LOCUS_04000 446398 450465 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030426.1 protein_id gnl|my_center|LOCUS_04000 451764 450529 gene locus_tag LOCUS_04010 451764 450529 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224105.1 protein_id gnl|my_center|LOCUS_04010 455072 451761 gene locus_tag LOCUS_04020 455072 451761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 456455 455211 gene locus_tag LOCUS_04030 456455 455211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 457267 456452 gene locus_tag LOCUS_04040 457267 456452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 457788 458792 gene locus_tag LOCUS_04050 457788 458792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 459389 459643 gene locus_tag LOCUS_04060 459389 459643 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975599.1 protein_id gnl|my_center|LOCUS_04060 460040 474502 gene locus_tag LOCUS_04070 460040 474502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 474499 482067 gene locus_tag LOCUS_04080 474499 482067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04080 482578 482240 gene locus_tag LOCUS_04090 482578 482240 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973104.1 protein_id gnl|my_center|LOCUS_04090 482992 482783 gene locus_tag LOCUS_04100 482992 482783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 483395 483784 gene locus_tag LOCUS_04110 483395 483784 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027404.1 protein_id gnl|my_center|LOCUS_04110 485351 484014 gene locus_tag LOCUS_04120 485351 484014 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777141.1 protein_id gnl|my_center|LOCUS_04120 485793 486797 gene locus_tag LOCUS_04130 gene ppk2 485793 486797 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062218.1 protein_id gnl|my_center|LOCUS_04130 487272 486988 gene locus_tag LOCUS_04140 487272 486988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 487690 487304 gene locus_tag LOCUS_04150 487690 487304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 488083 489585 gene locus_tag LOCUS_04160 488083 489585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 490400 489804 gene locus_tag LOCUS_04170 490400 489804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 491287 490571 gene locus_tag LOCUS_04180 491287 490571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 491850 492983 gene locus_tag LOCUS_04190 491850 492983 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027639.1 protein_id gnl|my_center|LOCUS_04190 493338 494135 gene locus_tag LOCUS_04200 493338 494135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 494614 495147 gene locus_tag LOCUS_04210 494614 495147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 495310 495732 gene locus_tag LOCUS_04220 495310 495732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225797.1 protein_id gnl|my_center|LOCUS_04220 495855 497555 gene locus_tag LOCUS_04230 495855 497555 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989371.1 protein_id gnl|my_center|LOCUS_04230 497598 498596 gene locus_tag LOCUS_04240 497598 498596 CDS product TIGR03885 family FMN-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975020.1 protein_id gnl|my_center|LOCUS_04240 498593 500287 gene locus_tag LOCUS_04250 498593 500287 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338607.1 protein_id gnl|my_center|LOCUS_04250 500831 501250 gene locus_tag LOCUS_04260 500831 501250 CDS product peptidase inhibitor family I36 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229909.1 protein_id gnl|my_center|LOCUS_04260 501410 502372 gene locus_tag LOCUS_04270 501410 502372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229910.1 protein_id gnl|my_center|LOCUS_04270 503248 503547 gene locus_tag LOCUS_04280 503248 503547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 503572 505854 gene locus_tag LOCUS_04290 gene catB 503572 505854 CDS product catalase CatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978196.1 protein_id gnl|my_center|LOCUS_04290 506541 506005 gene locus_tag LOCUS_04300 506541 506005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 506815 509661 gene locus_tag LOCUS_04310 506815 509661 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_04310 510209 509652 gene locus_tag LOCUS_04320 510209 509652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 512009 510687 gene locus_tag LOCUS_04330 512009 510687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 512406 512020 gene locus_tag LOCUS_04340 512406 512020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 513450 512692 gene locus_tag LOCUS_04350 513450 512692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 514148 513447 gene locus_tag LOCUS_04360 514148 513447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 514840 514325 gene locus_tag LOCUS_04370 514840 514325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04370 515156 515524 gene locus_tag LOCUS_04380 515156 515524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 515559 516542 gene locus_tag LOCUS_04390 515559 516542 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994395.1 protein_id gnl|my_center|LOCUS_04390 516908 518185 gene locus_tag LOCUS_04400 516908 518185 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976583.1 protein_id gnl|my_center|LOCUS_04400 518270 519277 gene locus_tag LOCUS_04410 518270 519277 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976584.1 protein_id gnl|my_center|LOCUS_04410 519274 520179 gene locus_tag LOCUS_04420 519274 520179 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_04420 520289 521989 gene locus_tag LOCUS_04430 520289 521989 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_04430 522108 525464 gene locus_tag LOCUS_04440 522108 525464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 525812 528391 gene locus_tag LOCUS_04450 525812 528391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 529888 528680 gene locus_tag LOCUS_04460 529888 528680 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029671.1 protein_id gnl|my_center|LOCUS_04460 529975 530553 gene locus_tag LOCUS_04470 529975 530553 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031718.1 protein_id gnl|my_center|LOCUS_04470 530577 531134 gene locus_tag LOCUS_04480 530577 531134 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031717.1 protein_id gnl|my_center|LOCUS_04480 531211 531522 gene locus_tag LOCUS_04490 531211 531522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 531706 531512 gene locus_tag LOCUS_04500 531706 531512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 532784 531789 gene locus_tag LOCUS_04510 532784 531789 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031566.1 protein_id gnl|my_center|LOCUS_04510 532998 534386 gene locus_tag LOCUS_04520 532998 534386 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484585.1 protein_id gnl|my_center|LOCUS_04520 534931 534458 gene locus_tag LOCUS_04530 534931 534458 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977815.1 protein_id gnl|my_center|LOCUS_04530 536584 534941 gene locus_tag LOCUS_04540 gene lnt 536584 534941 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027519.1 protein_id gnl|my_center|LOCUS_04540 537483 536917 gene locus_tag LOCUS_04550 537483 536917 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977812.1 protein_id gnl|my_center|LOCUS_04550 538339 537554 gene locus_tag LOCUS_04560 538339 537554 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873288.1 protein_id gnl|my_center|LOCUS_04560 538398 539579 gene locus_tag LOCUS_04570 538398 539579 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484591.1 protein_id gnl|my_center|LOCUS_04570 540878 539595 gene locus_tag LOCUS_04580 540878 539595 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027524.1 protein_id gnl|my_center|LOCUS_04580 541150 541611 gene locus_tag LOCUS_04590 541150 541611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977808.1 protein_id gnl|my_center|LOCUS_04590 541632 542480 gene locus_tag LOCUS_04600 541632 542480 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027526.1 protein_id gnl|my_center|LOCUS_04600 542776 545214 gene locus_tag LOCUS_04610 542776 545214 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666873.1 protein_id gnl|my_center|LOCUS_04610 547829 545184 gene locus_tag LOCUS_04620 547829 545184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027528.1 protein_id gnl|my_center|LOCUS_04620 547797 548633 gene locus_tag LOCUS_04630 547797 548633 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977803.1 protein_id gnl|my_center|LOCUS_04630 548705 549181 gene locus_tag LOCUS_04640 548705 549181 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030713.1 protein_id gnl|my_center|LOCUS_04640 549198 551270 gene locus_tag LOCUS_04650 549198 551270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028207.1 protein_id gnl|my_center|LOCUS_04650 552450 551317 gene locus_tag LOCUS_04660 552450 551317 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977801.1 protein_id gnl|my_center|LOCUS_04660 552635 552958 gene locus_tag LOCUS_04670 552635 552958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 553179 553661 gene locus_tag LOCUS_04680 553179 553661 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668703.1 protein_id gnl|my_center|LOCUS_04680 554932 553718 gene locus_tag LOCUS_04690 554932 553718 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027535.1 protein_id gnl|my_center|LOCUS_04690 555150 556280 gene locus_tag LOCUS_04700 555150 556280 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027555.1 protein_id gnl|my_center|LOCUS_04700 556326 557081 gene locus_tag LOCUS_04710 556326 557081 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027556.1 protein_id gnl|my_center|LOCUS_04710 557163 557459 gene locus_tag LOCUS_04720 557163 557459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 558802 557531 gene locus_tag LOCUS_04730 558802 557531 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977757.1 protein_id gnl|my_center|LOCUS_04730 558953 560317 gene locus_tag LOCUS_04740 558953 560317 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977756.1 protein_id gnl|my_center|LOCUS_04740 560436 561230 gene locus_tag LOCUS_04750 560436 561230 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897698.1 protein_id gnl|my_center|LOCUS_04750 562236 561199 gene locus_tag LOCUS_04760 562236 561199 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977755.1 protein_id gnl|my_center|LOCUS_04760 562457 562633 gene locus_tag LOCUS_04770 562457 562633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976837.1 protein_id gnl|my_center|LOCUS_04770 563684 562710 gene locus_tag LOCUS_04780 563684 562710 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027561.1 protein_id gnl|my_center|LOCUS_04780 563872 564900 gene locus_tag LOCUS_04790 563872 564900 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977752.1 protein_id gnl|my_center|LOCUS_04790 566248 564950 gene locus_tag LOCUS_04800 566248 564950 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_04800 567284 566412 gene locus_tag LOCUS_04810 567284 566412 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_04810 568278 567493 gene locus_tag LOCUS_04820 568278 567493 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027565.1 protein_id gnl|my_center|LOCUS_04820 568866 568477 gene locus_tag LOCUS_04830 568866 568477 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977747.1 protein_id gnl|my_center|LOCUS_04830 568754 569002 gene locus_tag LOCUS_04840 568754 569002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 569506 569180 gene locus_tag LOCUS_04850 569506 569180 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977746.1 protein_id gnl|my_center|LOCUS_04850 569725 570447 gene locus_tag LOCUS_04860 569725 570447 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977745.1 protein_id gnl|my_center|LOCUS_04860 571684 570605 gene locus_tag LOCUS_04870 571684 570605 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 protein_id gnl|my_center|LOCUS_04870 572430 571663 gene locus_tag LOCUS_04880 572430 571663 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325632.1 protein_id gnl|my_center|LOCUS_04880 573854 572457 gene locus_tag LOCUS_04890 573854 572457 CDS product DUF6421 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977741.1 protein_id gnl|my_center|LOCUS_04890 574135 574818 gene locus_tag LOCUS_04900 574135 574818 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027567.1 protein_id gnl|my_center|LOCUS_04900 575384 574779 gene locus_tag LOCUS_04910 575384 574779 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027568.1 protein_id gnl|my_center|LOCUS_04910 575564 576148 gene locus_tag LOCUS_04920 575564 576148 CDS product DUF5134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027575.1 protein_id gnl|my_center|LOCUS_04920 576234 577169 gene locus_tag LOCUS_04930 576234 577169 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027576.1 protein_id gnl|my_center|LOCUS_04930 577204 577950 gene locus_tag LOCUS_04940 577204 577950 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977730.1 protein_id gnl|my_center|LOCUS_04940 578033 578212 gene locus_tag LOCUS_04950 578033 578212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978128.1 protein_id gnl|my_center|LOCUS_04950 578170 578760 gene locus_tag LOCUS_04960 578170 578760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 580376 578886 gene locus_tag LOCUS_04970 580376 578886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977727.1 protein_id gnl|my_center|LOCUS_04970 580557 581222 gene locus_tag LOCUS_04980 580557 581222 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977726.1 protein_id gnl|my_center|LOCUS_04980 581845 581447 gene locus_tag LOCUS_04990 581845 581447 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977724.1 protein_id gnl|my_center|LOCUS_04990 582663 581923 gene locus_tag LOCUS_05000 582663 581923 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972089.1 protein_id gnl|my_center|LOCUS_05000 583820 582711 gene locus_tag LOCUS_05010 583820 582711 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977723.1 protein_id gnl|my_center|LOCUS_05010 584370 583978 gene locus_tag LOCUS_05020 584370 583978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 584653 585738 gene locus_tag LOCUS_05030 584653 585738 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484633.1 protein_id gnl|my_center|LOCUS_05030 585900 586496 gene locus_tag LOCUS_05040 585900 586496 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027583.1 protein_id gnl|my_center|LOCUS_05040 586493 587575 gene locus_tag LOCUS_05050 586493 587575 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027584.1 protein_id gnl|my_center|LOCUS_05050 587812 588657 gene locus_tag LOCUS_05060 587812 588657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027585.1 protein_id gnl|my_center|LOCUS_05060 589806 588745 gene locus_tag LOCUS_05070 589806 588745 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977714.1 protein_id gnl|my_center|LOCUS_05070 591396 589900 gene locus_tag LOCUS_05080 591396 589900 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027586.1 protein_id gnl|my_center|LOCUS_05080 591632 592114 gene locus_tag LOCUS_05090 591632 592114 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977712.1 protein_id gnl|my_center|LOCUS_05090 592139 592858 gene locus_tag LOCUS_05100 592139 592858 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977711.1 protein_id gnl|my_center|LOCUS_05100 593060 594403 gene locus_tag LOCUS_05110 593060 594403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 594554 595069 gene locus_tag LOCUS_05120 594554 595069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 595149 595751 gene locus_tag LOCUS_05130 595149 595751 CDS product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031607.1 protein_id gnl|my_center|LOCUS_05130 596133 596918 gene locus_tag LOCUS_05140 596133 596918 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868693.1 protein_id gnl|my_center|LOCUS_05140 597015 597203 gene locus_tag LOCUS_05150 597015 597203 CDS product DUF6381 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974757.1 protein_id gnl|my_center|LOCUS_05150 597399 598361 gene locus_tag LOCUS_05160 597399 598361 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_05160 598782 598399 gene locus_tag LOCUS_05170 598782 598399 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978132.1 protein_id gnl|my_center|LOCUS_05170 599632 598889 gene locus_tag LOCUS_05180 599632 598889 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027318.1 protein_id gnl|my_center|LOCUS_05180 599813 600598 gene locus_tag LOCUS_05190 599813 600598 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027565.1 protein_id gnl|my_center|LOCUS_05190 600807 601679 gene locus_tag LOCUS_05200 600807 601679 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_05200 602452 601724 gene locus_tag LOCUS_05210 602452 601724 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027589.1 protein_id gnl|my_center|LOCUS_05210 602541 602963 gene locus_tag LOCUS_05220 602541 602963 CDS product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977708.1 protein_id gnl|my_center|LOCUS_05220 603221 603583 gene locus_tag LOCUS_05230 603221 603583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 603794 604588 gene locus_tag LOCUS_05240 603794 604588 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030982.1 protein_id gnl|my_center|LOCUS_05240 604634 605107 gene locus_tag LOCUS_05250 604634 605107 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031629.1 protein_id gnl|my_center|LOCUS_05250 605145 606770 gene locus_tag LOCUS_05260 605145 606770 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031630.1 protein_id gnl|my_center|LOCUS_05260 607077 606928 gene locus_tag LOCUS_05270 607077 606928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 607040 608098 gene locus_tag LOCUS_05280 607040 608098 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036279.1 protein_id gnl|my_center|LOCUS_05280 608286 608657 gene locus_tag LOCUS_05290 608286 608657 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975755.1 protein_id gnl|my_center|LOCUS_05290 608996 608730 gene locus_tag LOCUS_05300 608996 608730 CDS product DUF4235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978083.1 protein_id gnl|my_center|LOCUS_05300 610074 609031 gene locus_tag LOCUS_05310 610074 609031 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027358.1 protein_id gnl|my_center|LOCUS_05310 610300 611844 gene locus_tag LOCUS_05320 610300 611844 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485437.1 protein_id gnl|my_center|LOCUS_05320 612659 613363 gene locus_tag LOCUS_05330 612659 613363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 613495 613863 gene locus_tag LOCUS_05340 613495 613863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 613939 614259 gene locus_tag LOCUS_05350 613939 614259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05350 614525 614334 gene locus_tag LOCUS_05360 614525 614334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 615351 614566 gene locus_tag LOCUS_05370 615351 614566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 616610 615426 gene locus_tag LOCUS_05380 616610 615426 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226129.1 protein_id gnl|my_center|LOCUS_05380 616754 617290 gene locus_tag LOCUS_05390 616754 617290 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971687.1 protein_id gnl|my_center|LOCUS_05390 617500 618363 gene locus_tag LOCUS_05400 617500 618363 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971753.1 protein_id gnl|my_center|LOCUS_05400 619448 618414 gene locus_tag LOCUS_05410 619448 618414 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027336.1 protein_id gnl|my_center|LOCUS_05410 619669 619445 gene locus_tag LOCUS_05420 619669 619445 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226142.1 protein_id gnl|my_center|LOCUS_05420 620369 619653 gene locus_tag LOCUS_05430 620369 619653 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037909261.1 protein_id gnl|my_center|LOCUS_05430 622707 620746 gene locus_tag LOCUS_05440 622707 620746 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229814.1 protein_id gnl|my_center|LOCUS_05440 622918 623088 gene locus_tag LOCUS_05450 622918 623088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971740.1 protein_id gnl|my_center|LOCUS_05450 623651 623229 gene locus_tag LOCUS_05460 623651 623229 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_05460 623770 624870 gene locus_tag LOCUS_05470 623770 624870 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027605.1 protein_id gnl|my_center|LOCUS_05470 625734 624886 gene locus_tag LOCUS_05480 gene mltG 625734 624886 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027606.1 protein_id gnl|my_center|LOCUS_05480 627702 625894 gene locus_tag LOCUS_05490 627702 625894 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977687.1 protein_id gnl|my_center|LOCUS_05490 627799 628242 gene locus_tag LOCUS_05500 627799 628242 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027607.1 protein_id gnl|my_center|LOCUS_05500 628804 628580 gene locus_tag LOCUS_05510 628804 628580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 628691 630382 gene locus_tag LOCUS_05520 628691 630382 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230756.1 protein_id gnl|my_center|LOCUS_05520 630379 632160 gene locus_tag LOCUS_05530 630379 632160 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027610.1 protein_id gnl|my_center|LOCUS_05530 632353 633714 gene locus_tag LOCUS_05540 632353 633714 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866777.1 protein_id gnl|my_center|LOCUS_05540 635304 633769 gene locus_tag LOCUS_05550 635304 633769 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027650.1 protein_id gnl|my_center|LOCUS_05550 636165 635374 gene locus_tag LOCUS_05560 636165 635374 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977680.1 protein_id gnl|my_center|LOCUS_05560 636303 638816 gene locus_tag LOCUS_05570 636303 638816 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_05570 638850 639722 gene locus_tag LOCUS_05580 638850 639722 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027614.1 protein_id gnl|my_center|LOCUS_05580 639994 639746 gene locus_tag LOCUS_05590 639994 639746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 640082 640663 gene locus_tag LOCUS_05600 640082 640663 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972196.1 protein_id gnl|my_center|LOCUS_05600 640708 641253 gene locus_tag LOCUS_05610 640708 641253 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031191.1 protein_id gnl|my_center|LOCUS_05610 641286 641774 gene locus_tag LOCUS_05620 641286 641774 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223545.1 protein_id gnl|my_center|LOCUS_05620 643077 641848 gene locus_tag LOCUS_05630 643077 641848 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_05630 643252 643902 gene locus_tag LOCUS_05640 643252 643902 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977621.1 protein_id gnl|my_center|LOCUS_05640 644407 643910 gene locus_tag LOCUS_05650 gene def 644407 643910 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325677.1 protein_id gnl|my_center|LOCUS_05650 644567 645805 gene locus_tag LOCUS_05660 644567 645805 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977619.1 protein_id gnl|my_center|LOCUS_05660 645840 646568 gene locus_tag LOCUS_05670 645840 646568 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977618.1 protein_id gnl|my_center|LOCUS_05670 646710 647735 gene locus_tag LOCUS_05680 646710 647735 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977617.1 protein_id gnl|my_center|LOCUS_05680 647847 648797 gene locus_tag LOCUS_05690 647847 648797 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977616.1 protein_id gnl|my_center|LOCUS_05690 648864 649022 gene locus_tag LOCUS_05700 648864 649022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325678.1 protein_id gnl|my_center|LOCUS_05700 649460 650983 gene locus_tag LOCUS_05710 649460 650983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 651078 653837 gene locus_tag LOCUS_05720 651078 653837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 653922 656042 gene locus_tag LOCUS_05730 653922 656042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 656173 656883 gene locus_tag LOCUS_05740 656173 656883 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977603.1 protein_id gnl|my_center|LOCUS_05740 656970 658040 gene locus_tag LOCUS_05750 656970 658040 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325683.1 protein_id gnl|my_center|LOCUS_05750 659607 658045 gene locus_tag LOCUS_05760 659607 658045 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027660.1 protein_id gnl|my_center|LOCUS_05760 660551 659769 gene locus_tag LOCUS_05770 660551 659769 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027661.1 protein_id gnl|my_center|LOCUS_05770 661225 660548 gene locus_tag LOCUS_05780 gene ureG 661225 660548 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977599.1 protein_id gnl|my_center|LOCUS_05780 661909 661247 gene locus_tag LOCUS_05790 661909 661247 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027662.1 protein_id gnl|my_center|LOCUS_05790 663662 661941 gene locus_tag LOCUS_05800 663662 661941 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977597.1 protein_id gnl|my_center|LOCUS_05800 663966 663655 gene locus_tag LOCUS_05810 663966 663655 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977596.1 protein_id gnl|my_center|LOCUS_05810 664284 663982 gene locus_tag LOCUS_05820 664284 663982 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977595.1 protein_id gnl|my_center|LOCUS_05820 665058 664759 gene locus_tag LOCUS_05830 665058 664759 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977594.1 protein_id gnl|my_center|LOCUS_05830 665103 665738 gene locus_tag LOCUS_05840 665103 665738 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977593.1 protein_id gnl|my_center|LOCUS_05840 665746 666066 gene locus_tag LOCUS_05850 665746 666066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977592.1 protein_id gnl|my_center|LOCUS_05850 666616 667086 gene locus_tag LOCUS_05860 666616 667086 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977591.1 protein_id gnl|my_center|LOCUS_05860 667258 667602 gene locus_tag LOCUS_05870 667258 667602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 668053 667622 gene locus_tag LOCUS_05880 668053 667622 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027663.1 protein_id gnl|my_center|LOCUS_05880 669420 668260 gene locus_tag LOCUS_05890 669420 668260 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977587.1 protein_id gnl|my_center|LOCUS_05890 669564 670730 gene locus_tag LOCUS_05900 gene bioB 669564 670730 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027664.1 protein_id gnl|my_center|LOCUS_05900 670723 672027 gene locus_tag LOCUS_05910 670723 672027 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027665.1 protein_id gnl|my_center|LOCUS_05910 672029 672715 gene locus_tag LOCUS_05920 gene bioD 672029 672715 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027666.1 protein_id gnl|my_center|LOCUS_05920 672785 673486 gene locus_tag LOCUS_05930 672785 673486 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027667.1 protein_id gnl|my_center|LOCUS_05930 674080 673709 gene locus_tag LOCUS_05940 674080 673709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027668.1 protein_id gnl|my_center|LOCUS_05940 674304 674077 gene locus_tag LOCUS_05950 674304 674077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977581.1 protein_id gnl|my_center|LOCUS_05950 674822 676159 gene locus_tag LOCUS_05960 674822 676159 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027670.1 protein_id gnl|my_center|LOCUS_05960 676156 677175 gene locus_tag LOCUS_05970 676156 677175 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977578.1 protein_id gnl|my_center|LOCUS_05970 677215 677988 gene locus_tag LOCUS_05980 677215 677988 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977577.1 protein_id gnl|my_center|LOCUS_05980 678131 679573 gene locus_tag LOCUS_05990 gene purB 678131 679573 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_05990 679602 680162 gene locus_tag LOCUS_06000 gene mug 679602 680162 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027672.1 protein_id gnl|my_center|LOCUS_06000 680728 680294 gene locus_tag LOCUS_06010 680728 680294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 681067 682224 gene locus_tag LOCUS_06020 681067 682224 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977569.1 protein_id gnl|my_center|LOCUS_06020 683197 682358 gene locus_tag LOCUS_06030 683197 682358 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027677.1 protein_id gnl|my_center|LOCUS_06030 684300 683398 gene locus_tag LOCUS_06040 684300 683398 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 protein_id gnl|my_center|LOCUS_06040 684647 686227 gene locus_tag LOCUS_06050 684647 686227 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027698.1 protein_id gnl|my_center|LOCUS_06050 686409 687740 gene locus_tag LOCUS_06060 686409 687740 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027701.1 protein_id gnl|my_center|LOCUS_06060 688887 687667 gene locus_tag LOCUS_06070 688887 687667 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027702.1 protein_id gnl|my_center|LOCUS_06070 688947 689459 gene locus_tag LOCUS_06080 688947 689459 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977536.1 protein_id gnl|my_center|LOCUS_06080 689509 691194 gene locus_tag LOCUS_06090 689509 691194 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027703.1 protein_id gnl|my_center|LOCUS_06090 691771 691283 gene locus_tag LOCUS_06100 691771 691283 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027704.1 protein_id gnl|my_center|LOCUS_06100 691866 692312 gene locus_tag LOCUS_06110 691866 692312 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977532.1 protein_id gnl|my_center|LOCUS_06110 695364 692302 gene locus_tag LOCUS_06120 695364 692302 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027705.1 protein_id gnl|my_center|LOCUS_06120 696527 695361 gene locus_tag LOCUS_06130 696527 695361 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977530.1 protein_id gnl|my_center|LOCUS_06130 697280 696642 gene locus_tag LOCUS_06140 697280 696642 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027706.1 protein_id gnl|my_center|LOCUS_06140 697375 697782 gene locus_tag LOCUS_06150 697375 697782 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027708.1 protein_id gnl|my_center|LOCUS_06150 698548 697976 gene locus_tag LOCUS_06160 698548 697976 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977517.1 protein_id gnl|my_center|LOCUS_06160 699520 698750 gene locus_tag LOCUS_06170 699520 698750 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977515.1 protein_id gnl|my_center|LOCUS_06170 699654 700184 gene locus_tag LOCUS_06180 699654 700184 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_06180 700787 700350 gene locus_tag LOCUS_06190 700787 700350 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977512.1 protein_id gnl|my_center|LOCUS_06190 700897 701928 gene locus_tag LOCUS_06200 700897 701928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 701984 703327 gene locus_tag LOCUS_06210 701984 703327 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816310.1 protein_id gnl|my_center|LOCUS_06210 704134 703289 gene locus_tag LOCUS_06220 704134 703289 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027718.1 protein_id gnl|my_center|LOCUS_06220 705385 704216 gene locus_tag LOCUS_06230 gene tuf 705385 704216 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977508.1 protein_id gnl|my_center|LOCUS_06230 705754 706464 gene locus_tag LOCUS_06240 705754 706464 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027720.1 protein_id gnl|my_center|LOCUS_06240 706668 707543 gene locus_tag LOCUS_06250 706668 707543 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977503.1 protein_id gnl|my_center|LOCUS_06250 708208 708780 gene locus_tag LOCUS_06260 708208 708780 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029739.1 protein_id gnl|my_center|LOCUS_06260 708864 710132 gene locus_tag LOCUS_06270 gene aldO 708864 710132 CDS product alditol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030685.1 protein_id gnl|my_center|LOCUS_06270 711686 710169 gene locus_tag LOCUS_06280 711686 710169 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976375.1 protein_id gnl|my_center|LOCUS_06280 711881 712285 gene locus_tag LOCUS_06290 711881 712285 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975235.1 protein_id gnl|my_center|LOCUS_06290 712334 713119 gene locus_tag LOCUS_06300 gene modA 712334 713119 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230240.1 protein_id gnl|my_center|LOCUS_06300 713170 715110 gene locus_tag LOCUS_06310 713170 715110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 715246 715986 gene locus_tag LOCUS_06320 715246 715986 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027504.1 protein_id gnl|my_center|LOCUS_06320 715983 717104 gene locus_tag LOCUS_06330 715983 717104 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027501.1 protein_id gnl|my_center|LOCUS_06330 717101 718324 gene locus_tag LOCUS_06340 717101 718324 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027502.1 protein_id gnl|my_center|LOCUS_06340 718314 719558 gene locus_tag LOCUS_06350 718314 719558 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027503.1 protein_id gnl|my_center|LOCUS_06350 720185 719562 gene locus_tag LOCUS_06360 720185 719562 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027402.1 protein_id gnl|my_center|LOCUS_06360 721057 720350 gene locus_tag LOCUS_06370 721057 720350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 721288 722262 gene locus_tag LOCUS_06380 721288 722262 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027499.1 protein_id gnl|my_center|LOCUS_06380 722347 722640 gene locus_tag LOCUS_06390 722347 722640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 723469 722564 gene locus_tag LOCUS_06400 723469 722564 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455728.1 protein_id gnl|my_center|LOCUS_06400 724706 723507 gene locus_tag LOCUS_06410 724706 723507 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027730.1 protein_id gnl|my_center|LOCUS_06410 724783 725397 gene locus_tag LOCUS_06420 724783 725397 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977488.1 protein_id gnl|my_center|LOCUS_06420 725431 725952 gene locus_tag LOCUS_06430 725431 725952 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977487.1 protein_id gnl|my_center|LOCUS_06430 726069 726548 gene locus_tag LOCUS_06440 726069 726548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247768.1 protein_id gnl|my_center|LOCUS_06440 727091 726618 gene locus_tag LOCUS_06450 727091 726618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027732.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06450 727908 727225 gene locus_tag LOCUS_06460 gene ung 727908 727225 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977484.1 protein_id gnl|my_center|LOCUS_06460 729565 727985 gene locus_tag LOCUS_06470 729565 727985 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325733.1 protein_id gnl|my_center|LOCUS_06470 730438 729683 gene locus_tag LOCUS_06480 730438 729683 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027733.1 protein_id gnl|my_center|LOCUS_06480 731215 730454 gene locus_tag LOCUS_06490 gene fabG 731215 730454 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_06490 731804 731421 gene locus_tag LOCUS_06500 731804 731421 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 protein_id gnl|my_center|LOCUS_06500 732655 731801 gene locus_tag LOCUS_06510 732655 731801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977478.1 protein_id gnl|my_center|LOCUS_06510 733524 732769 gene locus_tag LOCUS_06520 733524 732769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 733679 735043 gene locus_tag LOCUS_06530 733679 735043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 736367 735381 gene locus_tag LOCUS_06540 736367 735381 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029094.1 protein_id gnl|my_center|LOCUS_06540 736509 737231 gene locus_tag LOCUS_06550 736509 737231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 737268 737612 gene locus_tag LOCUS_06560 737268 737612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 737615 738070 gene locus_tag LOCUS_06570 737615 738070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 739216 738191 gene locus_tag LOCUS_06580 739216 738191 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027278.1 protein_id gnl|my_center|LOCUS_06580 740133 739213 gene locus_tag LOCUS_06590 740133 739213 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978200.1 protein_id gnl|my_center|LOCUS_06590 741035 740136 gene locus_tag LOCUS_06600 741035 740136 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227188.1 protein_id gnl|my_center|LOCUS_06600 742465 741137 gene locus_tag LOCUS_06610 742465 741137 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227189.1 protein_id gnl|my_center|LOCUS_06610 744403 742640 gene locus_tag LOCUS_06620 744403 742640 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030846.1 protein_id gnl|my_center|LOCUS_06620 745516 744431 gene locus_tag LOCUS_06630 745516 744431 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316201.1 protein_id gnl|my_center|LOCUS_06630 745719 748160 gene locus_tag LOCUS_06640 745719 748160 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030298.1 protein_id gnl|my_center|LOCUS_06640 749701 748214 gene locus_tag LOCUS_06650 749701 748214 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028880.1 protein_id gnl|my_center|LOCUS_06650 750006 750428 gene locus_tag LOCUS_06660 750006 750428 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487415.1 protein_id gnl|my_center|LOCUS_06660 750527 750970 gene locus_tag LOCUS_06670 750527 750970 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977470.1 protein_id gnl|my_center|LOCUS_06670 752566 751229 gene locus_tag LOCUS_06680 752566 751229 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027746.1 protein_id gnl|my_center|LOCUS_06680 752596 753306 gene locus_tag LOCUS_06690 752596 753306 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_06690 754319 753363 gene locus_tag LOCUS_06700 754319 753363 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027747.1 protein_id gnl|my_center|LOCUS_06700 755434 754478 gene locus_tag LOCUS_06710 755434 754478 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027748.1 protein_id gnl|my_center|LOCUS_06710 756098 755568 gene locus_tag LOCUS_06720 756098 755568 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977462.1 protein_id gnl|my_center|LOCUS_06720 756398 757228 gene locus_tag LOCUS_06730 756398 757228 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027752.1 protein_id gnl|my_center|LOCUS_06730 758064 757285 gene locus_tag LOCUS_06740 758064 757285 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027753.1 protein_id gnl|my_center|LOCUS_06740 759943 758438 gene locus_tag LOCUS_06750 759943 758438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977453.1 protein_id gnl|my_center|LOCUS_06750 760428 761012 gene locus_tag LOCUS_06760 760428 761012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325749.1 protein_id gnl|my_center|LOCUS_06760 761321 761524 gene locus_tag LOCUS_06770 761321 761524 CDS product DUF5999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977451.1 protein_id gnl|my_center|LOCUS_06770 764511 761626 gene locus_tag LOCUS_06780 gene gcvP 764511 761626 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_06780 764935 765303 gene locus_tag LOCUS_06790 764935 765303 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668708.1 protein_id gnl|my_center|LOCUS_06790 766685 765228 gene locus_tag LOCUS_06800 766685 765228 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027755.1 protein_id gnl|my_center|LOCUS_06800 767348 766761 gene locus_tag LOCUS_06810 767348 766761 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079363.1 protein_id gnl|my_center|LOCUS_06810 768015 767542 gene locus_tag LOCUS_06820 768015 767542 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_06820 768809 768069 gene locus_tag LOCUS_06830 768809 768069 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066949941.1 protein_id gnl|my_center|LOCUS_06830 769642 768851 gene locus_tag LOCUS_06840 769642 768851 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027757.1 protein_id gnl|my_center|LOCUS_06840 770627 769833 gene locus_tag LOCUS_06850 770627 769833 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027758.1 protein_id gnl|my_center|LOCUS_06850 770965 770633 gene locus_tag LOCUS_06860 770965 770633 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977440.1 protein_id gnl|my_center|LOCUS_06860 771882 770962 gene locus_tag LOCUS_06870 771882 770962 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977439.1 protein_id gnl|my_center|LOCUS_06870 774416 771981 gene locus_tag LOCUS_06880 774416 771981 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027759.1 protein_id gnl|my_center|LOCUS_06880 775196 774597 gene locus_tag LOCUS_06890 775196 774597 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 protein_id gnl|my_center|LOCUS_06890 775478 775368 gene locus_tag LOCUS_r00010 775478 775368 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 778682 775562 gene locus_tag LOCUS_r00020 778682 775562 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 780510 778988 gene locus_tag LOCUS_r00030 780510 778988 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 781196 781645 gene locus_tag LOCUS_06900 781196 781645 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977435.1 protein_id gnl|my_center|LOCUS_06900 781720 783390 gene locus_tag LOCUS_06910 gene ptsP 781720 783390 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977434.1 protein_id gnl|my_center|LOCUS_06910 784356 783457 gene locus_tag LOCUS_06920 784356 783457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977433.1 protein_id gnl|my_center|LOCUS_06920 786411 784435 gene locus_tag LOCUS_06930 786411 784435 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027760.1 protein_id gnl|my_center|LOCUS_06930 786628 788955 gene locus_tag LOCUS_06940 786628 788955 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027761.1 protein_id gnl|my_center|LOCUS_06940 789346 788960 gene locus_tag LOCUS_06950 789346 788960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 789375 790364 gene locus_tag LOCUS_06960 789375 790364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 790387 790839 gene locus_tag LOCUS_06970 790387 790839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 791493 790924 gene locus_tag LOCUS_06980 791493 790924 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977427.1 protein_id gnl|my_center|LOCUS_06980 791947 791510 gene locus_tag LOCUS_06990 791947 791510 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977426.1 protein_id gnl|my_center|LOCUS_06990 792400 791957 gene locus_tag LOCUS_07000 792400 791957 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977425.1 protein_id gnl|my_center|LOCUS_07000 795189 792397 gene locus_tag LOCUS_07010 795189 792397 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027766.1 protein_id gnl|my_center|LOCUS_07010 795176 795358 gene locus_tag LOCUS_07020 795176 795358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 795707 796147 gene locus_tag LOCUS_07030 795707 796147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 801082 796280 gene locus_tag LOCUS_07040 801082 796280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 802066 801161 gene locus_tag LOCUS_07050 802066 801161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027772.1 protein_id gnl|my_center|LOCUS_07050 803729 802203 gene locus_tag LOCUS_07060 803729 802203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977417.1 protein_id gnl|my_center|LOCUS_07060 805227 803809 gene locus_tag LOCUS_07070 805227 803809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977413.1 protein_id gnl|my_center|LOCUS_07070 805873 805481 gene locus_tag LOCUS_07080 805873 805481 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325767.1 protein_id gnl|my_center|LOCUS_07080 806205 806399 gene locus_tag LOCUS_07090 806205 806399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977410.1 protein_id gnl|my_center|LOCUS_07090 806436 808067 gene locus_tag LOCUS_07100 806436 808067 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027776.1 protein_id gnl|my_center|LOCUS_07100 809604 808105 gene locus_tag LOCUS_07110 809604 808105 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977408.1 protein_id gnl|my_center|LOCUS_07110 809707 810375 gene locus_tag LOCUS_07120 809707 810375 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027777.1 protein_id gnl|my_center|LOCUS_07120 810372 811136 gene locus_tag LOCUS_07130 810372 811136 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_07130 811183 812547 gene locus_tag LOCUS_07140 811183 812547 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027778.1 protein_id gnl|my_center|LOCUS_07140 812821 813195 gene locus_tag LOCUS_07150 812821 813195 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977404.1 protein_id gnl|my_center|LOCUS_07150 813886 813299 gene locus_tag LOCUS_07160 813886 813299 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977403.1 protein_id gnl|my_center|LOCUS_07160 814723 813956 gene locus_tag LOCUS_07170 814723 813956 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_07170 816893 815253 gene locus_tag LOCUS_07180 816893 815253 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866976.1 protein_id gnl|my_center|LOCUS_07180 817389 816940 gene locus_tag LOCUS_07190 817389 816940 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_07190 817583 817981 gene locus_tag LOCUS_07200 817583 817981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977399.1 protein_id gnl|my_center|LOCUS_07200 819301 818129 gene locus_tag LOCUS_07210 819301 818129 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027782.1 protein_id gnl|my_center|LOCUS_07210 819369 819656 gene locus_tag LOCUS_07220 819369 819656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 820915 819593 gene locus_tag LOCUS_07230 820915 819593 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495115.1 protein_id gnl|my_center|LOCUS_07230 820809 821120 gene locus_tag LOCUS_07240 820809 821120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 821117 821746 gene locus_tag LOCUS_07250 821117 821746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 822005 824023 gene locus_tag LOCUS_07260 822005 824023 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027787.1 protein_id gnl|my_center|LOCUS_07260 825256 824153 gene locus_tag LOCUS_07270 825256 824153 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977390.1 protein_id gnl|my_center|LOCUS_07270 826620 825253 gene locus_tag LOCUS_07280 826620 825253 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977389.1 protein_id gnl|my_center|LOCUS_07280 827302 826826 gene locus_tag LOCUS_07290 827302 826826 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977388.1 protein_id gnl|my_center|LOCUS_07290 828189 827341 gene locus_tag LOCUS_07300 gene hisG 828189 827341 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_07300 828526 828254 gene locus_tag LOCUS_07310 828526 828254 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027788.1 protein_id gnl|my_center|LOCUS_07310 829046 828561 gene locus_tag LOCUS_07320 gene ribH 829046 828561 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977385.1 protein_id gnl|my_center|LOCUS_07320 830372 829074 gene locus_tag LOCUS_07330 830372 829074 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977384.1 protein_id gnl|my_center|LOCUS_07330 831013 830369 gene locus_tag LOCUS_07340 831013 830369 CDS product nicotinamide mononucleotide transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977383.1 protein_id gnl|my_center|LOCUS_07340 831621 831010 gene locus_tag LOCUS_07350 831621 831010 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_07350 832722 831622 gene locus_tag LOCUS_07360 gene ribD 832722 831622 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976111.1 protein_id gnl|my_center|LOCUS_07360 834519 833323 gene locus_tag LOCUS_07370 834519 833323 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977378.1 protein_id gnl|my_center|LOCUS_07370 834658 835887 gene locus_tag LOCUS_07380 834658 835887 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977377.1 protein_id gnl|my_center|LOCUS_07380 836013 837407 gene locus_tag LOCUS_07390 836013 837407 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977375.1 protein_id gnl|my_center|LOCUS_07390 837492 838172 gene locus_tag LOCUS_07400 837492 838172 CDS product DUF5995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977373.1 protein_id gnl|my_center|LOCUS_07400 839990 838299 gene locus_tag LOCUS_07410 839990 838299 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027792.1 protein_id gnl|my_center|LOCUS_07410 840845 840048 gene locus_tag LOCUS_07420 840845 840048 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027793.1 protein_id gnl|my_center|LOCUS_07420 841630 841100 gene locus_tag LOCUS_07430 841630 841100 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977367.1 protein_id gnl|my_center|LOCUS_07430 843126 841669 gene locus_tag LOCUS_07440 843126 841669 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028965.1 protein_id gnl|my_center|LOCUS_07440 844777 843311 gene locus_tag LOCUS_07450 844777 843311 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279790.1 protein_id gnl|my_center|LOCUS_07450 845074 846135 gene locus_tag LOCUS_07460 845074 846135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 847194 846199 gene locus_tag LOCUS_07470 847194 846199 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977362.1 protein_id gnl|my_center|LOCUS_07470 848011 847328 gene locus_tag LOCUS_07480 gene rpe 848011 847328 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_07480 849559 848123 gene locus_tag LOCUS_07490 849559 848123 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_07490 850594 849662 gene locus_tag LOCUS_07500 gene fmt 850594 849662 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_07500 850776 851393 gene locus_tag LOCUS_07510 850776 851393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027806.1 protein_id gnl|my_center|LOCUS_07510 853597 851453 gene locus_tag LOCUS_07520 853597 851453 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027807.1 protein_id gnl|my_center|LOCUS_07520 854979 853756 gene locus_tag LOCUS_07530 gene metK 854979 853756 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_07530 856423 855221 gene locus_tag LOCUS_07540 gene coaBC 856423 855221 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_07540 856844 856542 gene locus_tag LOCUS_07550 gene rpoZ 856844 856542 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_07550 857516 856899 gene locus_tag LOCUS_07560 gene gmk 857516 856899 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977347.1 protein_id gnl|my_center|LOCUS_07560 857878 857555 gene locus_tag LOCUS_07570 857878 857555 CDS product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 protein_id gnl|my_center|LOCUS_07570 858961 858122 gene locus_tag LOCUS_07580 gene pyrF 858961 858122 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485777.1 protein_id gnl|my_center|LOCUS_07580 860067 858958 gene locus_tag LOCUS_07590 860067 858958 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977344.1 protein_id gnl|my_center|LOCUS_07590 863432 860124 gene locus_tag LOCUS_07600 gene carB 863432 860124 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_07600 864576 863425 gene locus_tag LOCUS_07610 gene carA 864576 863425 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_07610 865151 864573 gene locus_tag LOCUS_07620 865151 864573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977341.1 protein_id gnl|my_center|LOCUS_07620 866434 865148 gene locus_tag LOCUS_07630 866434 865148 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_07630 867504 866437 gene locus_tag LOCUS_07640 867504 866437 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_07640 868145 867561 gene locus_tag LOCUS_07650 gene pyrR 868145 867561 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_07650 868367 868867 gene locus_tag LOCUS_07660 gene bldD 868367 868867 CDS product transcriptional regulator BldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_07660 869476 869045 gene locus_tag LOCUS_07670 gene nusB 869476 869045 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977336.1 protein_id gnl|my_center|LOCUS_07670 870045 869479 gene locus_tag LOCUS_07680 gene efp 870045 869479 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977335.1 protein_id gnl|my_center|LOCUS_07680 871198 870095 gene locus_tag LOCUS_07690 871198 870095 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977334.1 protein_id gnl|my_center|LOCUS_07690 872093 871278 gene locus_tag LOCUS_07700 872093 871278 CDS product Pro-rich N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027812.1 protein_id gnl|my_center|LOCUS_07700 872659 872219 gene locus_tag LOCUS_07710 gene aroQ 872659 872219 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224605.1 protein_id gnl|my_center|LOCUS_07710 874305 872656 gene locus_tag LOCUS_07720 874305 872656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 875477 874302 gene locus_tag LOCUS_07730 gene aroC 875477 874302 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_07730 876461 875634 gene locus_tag LOCUS_07740 876461 875634 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_07740 878128 876458 gene locus_tag LOCUS_07750 gene mltG 878128 876458 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977327.1 protein_id gnl|my_center|LOCUS_07750 878699 878223 gene locus_tag LOCUS_07760 gene ruvX 878699 878223 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_07760 881368 878699 gene locus_tag LOCUS_07770 gene alaS 881368 878699 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 protein_id gnl|my_center|LOCUS_07770 881706 881368 gene locus_tag LOCUS_07780 881706 881368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977324.1 protein_id gnl|my_center|LOCUS_07780 882178 881714 gene locus_tag LOCUS_07790 882178 881714 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977323.1 protein_id gnl|my_center|LOCUS_07790 882497 884599 gene locus_tag LOCUS_07800 882497 884599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325800.1 protein_id gnl|my_center|LOCUS_07800 885228 884614 gene locus_tag LOCUS_07810 gene rpsD 885228 884614 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977321.1 protein_id gnl|my_center|LOCUS_07810 885500 886123 gene locus_tag LOCUS_07820 885500 886123 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027363.1 protein_id gnl|my_center|LOCUS_07820 887540 886152 gene locus_tag LOCUS_07830 887540 886152 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_07830 888220 887585 gene locus_tag LOCUS_07840 888220 887585 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871078.1 protein_id gnl|my_center|LOCUS_07840 889868 888594 gene locus_tag LOCUS_07850 gene hisS 889868 888594 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325801.1 protein_id gnl|my_center|LOCUS_07850 890570 889884 gene locus_tag LOCUS_07860 890570 889884 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_07860 890719 891519 gene locus_tag LOCUS_07870 890719 891519 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977316.1 protein_id gnl|my_center|LOCUS_07870 891708 892937 gene locus_tag LOCUS_07880 891708 892937 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_07880 895344 893017 gene locus_tag LOCUS_07890 gene relA 895344 893017 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_07890 895301 895831 gene locus_tag LOCUS_07900 895301 895831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 896432 895881 gene locus_tag LOCUS_07910 896432 895881 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 protein_id gnl|my_center|LOCUS_07910 897532 896429 gene locus_tag LOCUS_07920 gene secF 897532 896429 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_07920 899294 897534 gene locus_tag LOCUS_07930 gene secD 899294 897534 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027823.1 protein_id gnl|my_center|LOCUS_07930 899910 899443 gene locus_tag LOCUS_07940 gene yajC 899910 899443 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027824.1 protein_id gnl|my_center|LOCUS_07940 901167 900076 gene locus_tag LOCUS_07950 gene ruvB 901167 900076 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_07950 901862 901236 gene locus_tag LOCUS_07960 gene ruvA 901862 901236 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_07960 902392 901859 gene locus_tag LOCUS_07970 gene ruvC 902392 901859 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 protein_id gnl|my_center|LOCUS_07970 903285 902533 gene locus_tag LOCUS_07980 903285 902533 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_07980 903940 903347 gene locus_tag LOCUS_07990 gene pdxT 903940 903347 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977305.1 protein_id gnl|my_center|LOCUS_07990 904867 903947 gene locus_tag LOCUS_08000 gene pdxS 904867 903947 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977304.1 protein_id gnl|my_center|LOCUS_08000 905535 904981 gene locus_tag LOCUS_08010 905535 904981 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027827.1 protein_id gnl|my_center|LOCUS_08010 906839 905679 gene locus_tag LOCUS_08020 906839 905679 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_08020 907759 906836 gene locus_tag LOCUS_08030 907759 906836 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_08030 908427 907756 gene locus_tag LOCUS_08040 908427 907756 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_08040 908870 910540 gene locus_tag LOCUS_08050 908870 910540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027832.1 protein_id gnl|my_center|LOCUS_08050 911167 910607 gene locus_tag LOCUS_08060 911167 910607 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027833.1 protein_id gnl|my_center|LOCUS_08060 911234 911911 gene locus_tag LOCUS_08070 911234 911911 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270384.1 protein_id gnl|my_center|LOCUS_08070 913917 911941 gene locus_tag LOCUS_08080 gene thrS 913917 911941 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_08080 915287 914028 gene locus_tag LOCUS_08090 915287 914028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027834.1 protein_id gnl|my_center|LOCUS_08090 915883 915287 gene locus_tag LOCUS_08100 915883 915287 CDS product DUF4365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977294.1 protein_id gnl|my_center|LOCUS_08100 916080 916805 gene locus_tag LOCUS_08110 916080 916805 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977293.1 protein_id gnl|my_center|LOCUS_08110 916956 916883 gene locus_tag LOCUS_t00020 916956 916883 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 917442 916996 gene locus_tag LOCUS_08120 917442 916996 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027835.1 protein_id gnl|my_center|LOCUS_08120 917521 920007 gene locus_tag LOCUS_08130 917521 920007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031780.1 protein_id gnl|my_center|LOCUS_08130 920396 920323 gene locus_tag LOCUS_t00030 920396 920323 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 920912 920460 gene locus_tag LOCUS_08140 920912 920460 CDS product TIGR02611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027839.1 protein_id gnl|my_center|LOCUS_08140 921103 921516 gene locus_tag LOCUS_08150 921103 921516 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004002642.1 protein_id gnl|my_center|LOCUS_08150 921901 922473 gene locus_tag LOCUS_08160 921901 922473 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977284.1 protein_id gnl|my_center|LOCUS_08160 922693 922538 gene locus_tag LOCUS_08170 922693 922538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 923306 922857 gene locus_tag LOCUS_08180 923306 922857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977282.1 protein_id gnl|my_center|LOCUS_08180 923461 923976 gene locus_tag LOCUS_08190 923461 923976 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325815.1 protein_id gnl|my_center|LOCUS_08190 924843 924007 gene locus_tag LOCUS_08200 924843 924007 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485797.1 protein_id gnl|my_center|LOCUS_08200 925666 924893 gene locus_tag LOCUS_08210 925666 924893 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_08210 926748 925711 gene locus_tag LOCUS_08220 926748 925711 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027841.1 protein_id gnl|my_center|LOCUS_08220 926912 926985 gene locus_tag LOCUS_t00040 926912 926985 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 927022 927095 gene locus_tag LOCUS_t00050 927022 927095 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 927097 927170 gene locus_tag LOCUS_t00060 927097 927170 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 927188 927260 gene locus_tag LOCUS_t00070 927188 927260 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 927283 927357 gene locus_tag LOCUS_t00080 927283 927357 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 927772 927470 gene locus_tag LOCUS_08230 927772 927470 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033875.1 protein_id gnl|my_center|LOCUS_08230 928823 927837 gene locus_tag LOCUS_08240 928823 927837 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027843.1 protein_id gnl|my_center|LOCUS_08240 929263 929057 gene locus_tag LOCUS_08250 929263 929057 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977275.1 protein_id gnl|my_center|LOCUS_08250 929854 931194 gene locus_tag LOCUS_08260 929854 931194 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715246.1 protein_id gnl|my_center|LOCUS_08260 932023 931205 gene locus_tag LOCUS_08270 932023 931205 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977273.1 protein_id gnl|my_center|LOCUS_08270 933343 932090 gene locus_tag LOCUS_08280 gene cobA 933343 932090 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977272.1 protein_id gnl|my_center|LOCUS_08280 937350 933670 gene locus_tag LOCUS_08290 937350 933670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 938923 937685 gene locus_tag LOCUS_08300 gene cbiE 938923 937685 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977269.1 protein_id gnl|my_center|LOCUS_08300 939717 939031 gene locus_tag LOCUS_08310 939717 939031 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269997.1 protein_id gnl|my_center|LOCUS_08310 940686 939820 gene locus_tag LOCUS_08320 940686 939820 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977267.1 protein_id gnl|my_center|LOCUS_08320 941430 940759 gene locus_tag LOCUS_08330 941430 940759 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027847.1 protein_id gnl|my_center|LOCUS_08330 942488 941427 gene locus_tag LOCUS_08340 942488 941427 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325822.1 protein_id gnl|my_center|LOCUS_08340 943067 943426 gene locus_tag LOCUS_08350 943067 943426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977263.1 protein_id gnl|my_center|LOCUS_08350 943429 943860 gene locus_tag LOCUS_08360 943429 943860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977262.1 protein_id gnl|my_center|LOCUS_08360 944382 943882 gene locus_tag LOCUS_08370 944382 943882 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977261.1 protein_id gnl|my_center|LOCUS_08370 944968 944429 gene locus_tag LOCUS_08380 944968 944429 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027851.1 protein_id gnl|my_center|LOCUS_08380 946248 945088 gene locus_tag LOCUS_08390 946248 945088 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027852.1 protein_id gnl|my_center|LOCUS_08390 946385 947152 gene locus_tag LOCUS_08400 946385 947152 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007447704.1 protein_id gnl|my_center|LOCUS_08400 948773 947229 gene locus_tag LOCUS_08410 948773 947229 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977257.1 protein_id gnl|my_center|LOCUS_08410 949321 948770 gene locus_tag LOCUS_08420 949321 948770 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325826.1 protein_id gnl|my_center|LOCUS_08420 949480 950058 gene locus_tag LOCUS_08430 949480 950058 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328266.1 protein_id gnl|my_center|LOCUS_08430 951158 950187 gene locus_tag LOCUS_08440 951158 950187 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325827.1 protein_id gnl|my_center|LOCUS_08440 952678 951251 gene locus_tag LOCUS_08450 gene argH 952678 951251 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027854.1 protein_id gnl|my_center|LOCUS_08450 953961 952768 gene locus_tag LOCUS_08460 953961 952768 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776176.1 protein_id gnl|my_center|LOCUS_08460 954131 955411 gene locus_tag LOCUS_08470 954131 955411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 955419 956018 gene locus_tag LOCUS_08480 955419 956018 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977253.1 protein_id gnl|my_center|LOCUS_08480 956083 956784 gene locus_tag LOCUS_08490 956083 956784 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027855.1 protein_id gnl|my_center|LOCUS_08490 957324 956794 gene locus_tag LOCUS_08500 957324 956794 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_08500 958543 957347 gene locus_tag LOCUS_08510 958543 957347 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977247.1 protein_id gnl|my_center|LOCUS_08510 959457 958540 gene locus_tag LOCUS_08520 gene argB 959457 958540 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977246.1 protein_id gnl|my_center|LOCUS_08520 960608 959454 gene locus_tag LOCUS_08530 gene argJ 960608 959454 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_08530 961633 960605 gene locus_tag LOCUS_08540 gene argC 961633 960605 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 protein_id gnl|my_center|LOCUS_08540 963039 961888 gene locus_tag LOCUS_08550 963039 961888 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224733.1 protein_id gnl|my_center|LOCUS_08550 963746 963135 gene locus_tag LOCUS_08560 963746 963135 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027864.1 protein_id gnl|my_center|LOCUS_08560 965195 963819 gene locus_tag LOCUS_08570 965195 963819 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535091.1 protein_id gnl|my_center|LOCUS_08570 965543 965316 gene locus_tag LOCUS_08580 965543 965316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 965443 966282 gene locus_tag LOCUS_08590 965443 966282 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027867.1 protein_id gnl|my_center|LOCUS_08590 966325 966528 gene locus_tag LOCUS_08600 966325 966528 CDS product DUF1918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977235.1 protein_id gnl|my_center|LOCUS_08600 966744 967601 gene locus_tag LOCUS_08610 966744 967601 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_08610 968085 968177 gene locus_tag LOCUS_t00090 968085 968177 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 968283 969161 gene locus_tag LOCUS_08620 968283 969161 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_08620 969196 970308 gene locus_tag LOCUS_08630 969196 970308 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_08630 971781 970543 gene locus_tag LOCUS_08640 971781 970543 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030513.1 protein_id gnl|my_center|LOCUS_08640 972020 971781 gene locus_tag LOCUS_08650 972020 971781 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027681.1 protein_id gnl|my_center|LOCUS_08650 973090 972086 gene locus_tag LOCUS_08660 973090 972086 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078864641.1 protein_id gnl|my_center|LOCUS_08660 974166 973087 gene locus_tag LOCUS_08670 974166 973087 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224400.1 protein_id gnl|my_center|LOCUS_08670 975137 974163 gene locus_tag LOCUS_08680 975137 974163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 975709 975137 gene locus_tag LOCUS_08690 975709 975137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 976191 975706 gene locus_tag LOCUS_08700 976191 975706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075257.1 protein_id gnl|my_center|LOCUS_08700 976706 976191 gene locus_tag LOCUS_08710 976706 976191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 977991 976693 gene locus_tag LOCUS_08720 977991 976693 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110778.1 protein_id gnl|my_center|LOCUS_08720 979064 978000 gene locus_tag LOCUS_08730 979064 978000 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110776.1 protein_id gnl|my_center|LOCUS_08730 980848 979214 gene locus_tag LOCUS_08740 980848 979214 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110774.1 protein_id gnl|my_center|LOCUS_08740 981429 981082 gene locus_tag LOCUS_08750 981429 981082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 981373 982080 gene locus_tag LOCUS_08760 981373 982080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 982798 982112 gene locus_tag LOCUS_08770 982798 982112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 984690 983830 gene locus_tag LOCUS_08780 984690 983830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 985425 984766 gene locus_tag LOCUS_08790 985425 984766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 985396 985608 gene locus_tag LOCUS_08800 985396 985608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 986050 985535 gene locus_tag LOCUS_08810 986050 985535 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897102.1 protein_id gnl|my_center|LOCUS_08810 987540 986047 gene locus_tag LOCUS_08820 987540 986047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 988339 987638 gene locus_tag LOCUS_08830 988339 987638 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039537.1 protein_id gnl|my_center|LOCUS_08830 989546 988347 gene locus_tag LOCUS_08840 989546 988347 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222787.1 protein_id gnl|my_center|LOCUS_08840 991196 989610 gene locus_tag LOCUS_08850 991196 989610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 991510 991193 gene locus_tag LOCUS_08860 991510 991193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 993294 991507 gene locus_tag LOCUS_08870 993294 991507 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188100697.1 protein_id gnl|my_center|LOCUS_08870 993703 993428 gene locus_tag LOCUS_08880 993703 993428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 993645 994217 gene locus_tag LOCUS_08890 993645 994217 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181390343.1 protein_id gnl|my_center|LOCUS_08890 994334 995017 gene locus_tag LOCUS_08900 994334 995017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 995239 996057 gene locus_tag LOCUS_08910 995239 996057 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243725.1 protein_id gnl|my_center|LOCUS_08910 996871 997011 gene locus_tag LOCUS_08920 996871 997011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 997145 999016 gene locus_tag LOCUS_08930 997145 999016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 999045 999254 gene locus_tag LOCUS_08940 999045 999254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 999251 999664 gene locus_tag LOCUS_08950 999251 999664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 1002376 999863 gene locus_tag LOCUS_08960 gene pheT 1002376 999863 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027870.1 protein_id gnl|my_center|LOCUS_08960 1003515 1002376 gene locus_tag LOCUS_08970 gene pheS 1003515 1002376 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977229.1 protein_id gnl|my_center|LOCUS_08970 1004881 1003715 gene locus_tag LOCUS_08980 1004881 1003715 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027872.1 protein_id gnl|my_center|LOCUS_08980 1005846 1004938 gene locus_tag LOCUS_08990 1005846 1004938 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_08990 1006347 1005964 gene locus_tag LOCUS_09000 gene rplT 1006347 1005964 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_09000 1006648 1006454 gene locus_tag LOCUS_09010 gene rpmI 1006648 1006454 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 protein_id gnl|my_center|LOCUS_09010 1007597 1006773 gene locus_tag LOCUS_09020 1007597 1006773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1007838 1008200 gene locus_tag LOCUS_09030 1007838 1008200 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977223.1 protein_id gnl|my_center|LOCUS_09030 1009027 1008299 gene locus_tag LOCUS_09040 1009027 1008299 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027875.1 protein_id gnl|my_center|LOCUS_09040 1009156 1009938 gene locus_tag LOCUS_09050 1009156 1009938 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027879.1 protein_id gnl|my_center|LOCUS_09050 1011128 1009935 gene locus_tag LOCUS_09060 gene mycP 1011128 1009935 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977220.1 protein_id gnl|my_center|LOCUS_09060 1011913 1011125 gene locus_tag LOCUS_09070 1011913 1011125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283992.1 protein_id gnl|my_center|LOCUS_09070 1012196 1012585 gene locus_tag LOCUS_09080 1012196 1012585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1012582 1013784 gene locus_tag LOCUS_09090 1012582 1013784 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027880.1 protein_id gnl|my_center|LOCUS_09090 1014731 1013796 gene locus_tag LOCUS_09100 1014731 1013796 CDS product DUF2510 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027881.1 protein_id gnl|my_center|LOCUS_09100 1015722 1014799 gene locus_tag LOCUS_09110 1015722 1014799 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977210.1 protein_id gnl|my_center|LOCUS_09110 1015793 1016941 gene locus_tag LOCUS_09120 1015793 1016941 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027886.1 protein_id gnl|my_center|LOCUS_09120 1017509 1016964 gene locus_tag LOCUS_09130 1017509 1016964 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977207.1 protein_id gnl|my_center|LOCUS_09130 1020318 1017688 gene locus_tag LOCUS_09140 1020318 1017688 CDS product ABC transporter permease/substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027888.1 protein_id gnl|my_center|LOCUS_09140 1021417 1020311 gene locus_tag LOCUS_09150 1021417 1020311 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977205.1 protein_id gnl|my_center|LOCUS_09150 1021728 1022636 gene locus_tag LOCUS_09160 1021728 1022636 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_09160 1022684 1023526 gene locus_tag LOCUS_09170 1022684 1023526 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977203.1 protein_id gnl|my_center|LOCUS_09170 1023611 1024558 gene locus_tag LOCUS_09180 1023611 1024558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222822.1 protein_id gnl|my_center|LOCUS_09180 1024729 1025313 gene locus_tag LOCUS_09190 1024729 1025313 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027261.1 protein_id gnl|my_center|LOCUS_09190 1025310 1026062 gene locus_tag LOCUS_09200 1025310 1026062 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027262.1 protein_id gnl|my_center|LOCUS_09200 1026287 1027918 gene locus_tag LOCUS_09210 1026287 1027918 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027201.1 protein_id gnl|my_center|LOCUS_09210 1028025 1028669 gene locus_tag LOCUS_09220 1028025 1028669 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978224.1 protein_id gnl|my_center|LOCUS_09220 1028982 1029419 gene locus_tag LOCUS_09230 1028982 1029419 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971883.1 protein_id gnl|my_center|LOCUS_09230 1032435 1029601 gene locus_tag LOCUS_09240 1032435 1029601 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_09240 1033372 1032479 gene locus_tag LOCUS_09250 1033372 1032479 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729742.1 protein_id gnl|my_center|LOCUS_09250 1034338 1033391 gene locus_tag LOCUS_09260 gene tatC 1034338 1033391 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977194.1 protein_id gnl|my_center|LOCUS_09260 1034690 1034388 gene locus_tag LOCUS_09270 gene tatA 1034690 1034388 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977193.1 protein_id gnl|my_center|LOCUS_09270 1035104 1034907 gene locus_tag LOCUS_09280 1035104 1034907 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977192.1 protein_id gnl|my_center|LOCUS_09280 1035407 1035132 gene locus_tag LOCUS_09290 1035407 1035132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1036380 1035424 gene locus_tag LOCUS_09300 1036380 1035424 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027894.1 protein_id gnl|my_center|LOCUS_09300 1037343 1036396 gene locus_tag LOCUS_09310 1037343 1036396 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027895.1 protein_id gnl|my_center|LOCUS_09310 1037834 1037460 gene locus_tag LOCUS_09320 1037834 1037460 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977188.1 protein_id gnl|my_center|LOCUS_09320 1038813 1037878 gene locus_tag LOCUS_09330 1038813 1037878 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977187.1 protein_id gnl|my_center|LOCUS_09330 1040301 1038940 gene locus_tag LOCUS_09340 gene pafA 1040301 1038940 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_09340 1041570 1040311 gene locus_tag LOCUS_09350 1041570 1040311 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870809.1 protein_id gnl|my_center|LOCUS_09350 1041715 1042743 gene locus_tag LOCUS_09360 1041715 1042743 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977184.1 protein_id gnl|my_center|LOCUS_09360 1043677 1042838 gene locus_tag LOCUS_09370 gene prcA 1043677 1042838 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_09370 1044509 1043733 gene locus_tag LOCUS_09380 gene prcB 1044509 1043733 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_09380 1045238 1045011 gene locus_tag LOCUS_09390 1045238 1045011 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_09390 1046861 1045350 gene locus_tag LOCUS_09400 gene dop 1046861 1045350 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_09400 1048863 1047097 gene locus_tag LOCUS_09410 gene arc 1048863 1047097 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_09410 1049104 1049415 gene locus_tag LOCUS_09420 1049104 1049415 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977176.1 protein_id gnl|my_center|LOCUS_09420 1050012 1049443 gene locus_tag LOCUS_09430 1050012 1049443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977175.1 protein_id gnl|my_center|LOCUS_09430 1051101 1050202 gene locus_tag LOCUS_09440 1051101 1050202 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_09440 1052439 1051153 gene locus_tag LOCUS_09450 1052439 1051153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09450 1052575 1053417 gene locus_tag LOCUS_09460 1052575 1053417 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09460 1053427 1054098 gene locus_tag LOCUS_09470 1053427 1054098 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_09470 1055752 1054151 gene locus_tag LOCUS_09480 1055752 1054151 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977170.1 protein_id gnl|my_center|LOCUS_09480 1056832 1056131 gene locus_tag LOCUS_09490 1056832 1056131 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 protein_id gnl|my_center|LOCUS_09490 1060467 1056952 gene locus_tag LOCUS_09500 gene metH 1060467 1056952 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_09500 1060708 1061472 gene locus_tag LOCUS_09510 1060708 1061472 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977167.1 protein_id gnl|my_center|LOCUS_09510 1061788 1062579 gene locus_tag LOCUS_09520 1061788 1062579 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977166.1 protein_id gnl|my_center|LOCUS_09520 1062633 1064183 gene locus_tag LOCUS_09530 gene glpK 1062633 1064183 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977165.1 protein_id gnl|my_center|LOCUS_09530 1064189 1065799 gene locus_tag LOCUS_09540 1064189 1065799 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977164.1 protein_id gnl|my_center|LOCUS_09540 1065935 1066606 gene locus_tag LOCUS_09550 1065935 1066606 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223733.1 protein_id gnl|my_center|LOCUS_09550 1066857 1067954 gene locus_tag LOCUS_09560 gene parJ 1066857 1067954 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_09560 1069275 1068046 gene locus_tag LOCUS_09570 gene mshC 1069275 1068046 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_09570 1070536 1069604 gene locus_tag LOCUS_09580 1070536 1069604 CDS product anti-sigma factor RsbA family regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027235.1 protein_id gnl|my_center|LOCUS_09580 1070886 1070533 gene locus_tag LOCUS_09590 1070886 1070533 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978263.1 protein_id gnl|my_center|LOCUS_09590 1071430 1071068 gene locus_tag LOCUS_09600 1071430 1071068 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229185.1 protein_id gnl|my_center|LOCUS_09600 1072925 1071438 gene locus_tag LOCUS_09610 1072925 1071438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1073953 1073126 gene locus_tag LOCUS_09620 1073953 1073126 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270002.1 protein_id gnl|my_center|LOCUS_09620 1074540 1073950 gene locus_tag LOCUS_09630 1074540 1073950 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_09630 1075439 1074645 gene locus_tag LOCUS_09640 1075439 1074645 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977159.1 protein_id gnl|my_center|LOCUS_09640 1075420 1076412 gene locus_tag LOCUS_09650 gene corA 1075420 1076412 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027906.1 protein_id gnl|my_center|LOCUS_09650 1077744 1076695 gene locus_tag LOCUS_09660 1077744 1076695 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027908.1 protein_id gnl|my_center|LOCUS_09660 1077885 1078871 gene locus_tag LOCUS_09670 1077885 1078871 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977155.1 protein_id gnl|my_center|LOCUS_09670 1078868 1081132 gene locus_tag LOCUS_09680 1078868 1081132 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027909.1 protein_id gnl|my_center|LOCUS_09680 1081890 1081231 gene locus_tag LOCUS_09690 1081890 1081231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027910.1 protein_id gnl|my_center|LOCUS_09690 1081938 1082126 gene locus_tag LOCUS_09700 1081938 1082126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 1083019 1082198 gene locus_tag LOCUS_09710 gene chpC 1083019 1082198 CDS product LAXTG-anchored chaplin ChpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027911.1 protein_id gnl|my_center|LOCUS_09710 1083393 1083160 gene locus_tag LOCUS_09720 gene chpH 1083393 1083160 CDS product chaplin ChpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977150.1 protein_id gnl|my_center|LOCUS_09720 1084873 1083548 gene locus_tag LOCUS_09730 1084873 1083548 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_09730 1085021 1085108 gene locus_tag LOCUS_t00100 1085021 1085108 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1085284 1086222 gene locus_tag LOCUS_09740 1085284 1086222 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977201.1 protein_id gnl|my_center|LOCUS_09740 1086872 1086240 gene locus_tag LOCUS_09750 1086872 1086240 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978121.1 protein_id gnl|my_center|LOCUS_09750 1087954 1086869 gene locus_tag LOCUS_09760 1087954 1086869 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_09760 1088745 1088044 gene locus_tag LOCUS_09770 1088745 1088044 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027913.1 protein_id gnl|my_center|LOCUS_09770 1088876 1089385 gene locus_tag LOCUS_09780 1088876 1089385 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977146.1 protein_id gnl|my_center|LOCUS_09780 1089397 1090794 gene locus_tag LOCUS_09790 1089397 1090794 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223067.1 protein_id gnl|my_center|LOCUS_09790 1091325 1090795 gene locus_tag LOCUS_09800 1091325 1090795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1092130 1091405 gene locus_tag LOCUS_09810 1092130 1091405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1093764 1092232 gene locus_tag LOCUS_09820 1093764 1092232 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027916.1 protein_id gnl|my_center|LOCUS_09820 1094831 1093845 gene locus_tag LOCUS_09830 1094831 1093845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977141.1 protein_id gnl|my_center|LOCUS_09830 1095034 1095468 gene locus_tag LOCUS_09840 1095034 1095468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09840 1097203 1095548 gene locus_tag LOCUS_09850 1097203 1095548 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528300.1 protein_id gnl|my_center|LOCUS_09850 1097364 1097756 gene locus_tag LOCUS_09860 1097364 1097756 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977138.1 protein_id gnl|my_center|LOCUS_09860 1097756 1098067 gene locus_tag LOCUS_09870 1097756 1098067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1099039 1098104 gene locus_tag LOCUS_09880 1099039 1098104 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973903.1 protein_id gnl|my_center|LOCUS_09880 1100372 1099083 gene locus_tag LOCUS_09890 1100372 1099083 CDS product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028417.1 protein_id gnl|my_center|LOCUS_09890 1100488 1101549 gene locus_tag LOCUS_09900 1100488 1101549 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_09900 1101558 1102772 gene locus_tag LOCUS_09910 1101558 1102772 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027921.1 protein_id gnl|my_center|LOCUS_09910 1104155 1102821 gene locus_tag LOCUS_09920 1104155 1102821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1105005 1104412 gene locus_tag LOCUS_09930 1105005 1104412 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868049.1 protein_id gnl|my_center|LOCUS_09930 1106711 1105044 gene locus_tag LOCUS_09940 1106711 1105044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1107472 1106708 gene locus_tag LOCUS_09950 1107472 1106708 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977133.1 protein_id gnl|my_center|LOCUS_09950 1107647 1108912 gene locus_tag LOCUS_09960 1107647 1108912 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230529.1 protein_id gnl|my_center|LOCUS_09960 1109071 1109682 gene locus_tag LOCUS_09970 1109071 1109682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977130.1 protein_id gnl|my_center|LOCUS_09970 1110219 1109728 gene locus_tag LOCUS_09980 gene soxR 1110219 1109728 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977128.1 protein_id gnl|my_center|LOCUS_09980 1110336 1110797 gene locus_tag LOCUS_09990 1110336 1110797 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_09990 1111414 1110788 gene locus_tag LOCUS_10000 1111414 1110788 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977126.1 protein_id gnl|my_center|LOCUS_10000 1111772 1111482 gene locus_tag LOCUS_10010 1111772 1111482 CDS product YiaA/YiaB family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977125.1 protein_id gnl|my_center|LOCUS_10010 1113014 1111863 gene locus_tag LOCUS_10020 1113014 1111863 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027926.1 protein_id gnl|my_center|LOCUS_10020 1113070 1113756 gene locus_tag LOCUS_10030 1113070 1113756 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977123.1 protein_id gnl|my_center|LOCUS_10030 1114916 1113837 gene locus_tag LOCUS_10040 1114916 1113837 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027929.1 protein_id gnl|my_center|LOCUS_10040 1116384 1114990 gene locus_tag LOCUS_10050 1116384 1114990 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027930.1 protein_id gnl|my_center|LOCUS_10050 1116828 1116502 gene locus_tag LOCUS_10060 1116828 1116502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1118394 1117042 gene locus_tag LOCUS_10070 1118394 1117042 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977118.1 protein_id gnl|my_center|LOCUS_10070 1118393 1118956 gene locus_tag LOCUS_10080 1118393 1118956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1120568 1119126 gene locus_tag LOCUS_10090 1120568 1119126 CDS product citrate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027933.1 protein_id gnl|my_center|LOCUS_10090 1122883 1120703 gene locus_tag LOCUS_10100 1122883 1120703 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027934.1 protein_id gnl|my_center|LOCUS_10100 1123212 1124546 gene locus_tag LOCUS_10110 gene hmgA 1123212 1124546 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977111.1 protein_id gnl|my_center|LOCUS_10110 1124601 1125377 gene locus_tag LOCUS_10120 1124601 1125377 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977110.1 protein_id gnl|my_center|LOCUS_10120 1125461 1126702 gene locus_tag LOCUS_10130 1125461 1126702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325881.1 protein_id gnl|my_center|LOCUS_10130 1127427 1126717 gene locus_tag LOCUS_10140 1127427 1126717 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977108.1 protein_id gnl|my_center|LOCUS_10140 1127491 1128459 gene locus_tag LOCUS_10150 1127491 1128459 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027938.1 protein_id gnl|my_center|LOCUS_10150 1128456 1129283 gene locus_tag LOCUS_10160 1128456 1129283 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027939.1 protein_id gnl|my_center|LOCUS_10160 1129347 1130549 gene locus_tag LOCUS_10170 1129347 1130549 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975683.1 protein_id gnl|my_center|LOCUS_10170 1130766 1130596 gene locus_tag LOCUS_10180 1130766 1130596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1131892 1131086 gene locus_tag LOCUS_10190 1131892 1131086 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_10190 1132052 1133182 gene locus_tag LOCUS_10200 1132052 1133182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1133659 1133267 gene locus_tag LOCUS_10210 1133659 1133267 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027943.1 protein_id gnl|my_center|LOCUS_10210 1133775 1134695 gene locus_tag LOCUS_10220 1133775 1134695 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977097.1 protein_id gnl|my_center|LOCUS_10220 1134676 1135173 gene locus_tag LOCUS_10230 1134676 1135173 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027944.1 protein_id gnl|my_center|LOCUS_10230 1136318 1135170 gene locus_tag LOCUS_10240 1136318 1135170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1137875 1136379 gene locus_tag LOCUS_10250 1137875 1136379 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027604.1 protein_id gnl|my_center|LOCUS_10250 1138412 1137879 gene locus_tag LOCUS_10260 1138412 1137879 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027603.1 protein_id gnl|my_center|LOCUS_10260 1139392 1138409 gene locus_tag LOCUS_10270 1139392 1138409 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715268.1 protein_id gnl|my_center|LOCUS_10270 1139484 1140215 gene locus_tag LOCUS_10280 1139484 1140215 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977695.1 protein_id gnl|my_center|LOCUS_10280 1141174 1140281 gene locus_tag LOCUS_10290 1141174 1140281 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027946.1 protein_id gnl|my_center|LOCUS_10290 1142352 1141342 gene locus_tag LOCUS_10300 1142352 1141342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027947.1 protein_id gnl|my_center|LOCUS_10300 1145885 1142349 gene locus_tag LOCUS_10310 gene dnaE 1145885 1142349 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027948.1 protein_id gnl|my_center|LOCUS_10310 1146042 1147106 gene locus_tag LOCUS_10320 1146042 1147106 CDS product DUF3533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977086.1 protein_id gnl|my_center|LOCUS_10320 1147998 1147162 gene locus_tag LOCUS_10330 1147998 1147162 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270384.1 protein_id gnl|my_center|LOCUS_10330 1148124 1148636 gene locus_tag LOCUS_10340 1148124 1148636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1148825 1149322 gene locus_tag LOCUS_10350 1148825 1149322 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977781.1 protein_id gnl|my_center|LOCUS_10350 1150430 1149633 gene locus_tag LOCUS_10360 1150430 1149633 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027953.1 protein_id gnl|my_center|LOCUS_10360 1151729 1150467 gene locus_tag LOCUS_10370 1151729 1150467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1152040 1152480 gene locus_tag LOCUS_10380 1152040 1152480 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977077.1 protein_id gnl|my_center|LOCUS_10380 1153740 1152520 gene locus_tag LOCUS_10390 1153740 1152520 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977076.1 protein_id gnl|my_center|LOCUS_10390 1155514 1153814 gene locus_tag LOCUS_10400 1155514 1153814 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027955.1 protein_id gnl|my_center|LOCUS_10400 1156050 1157042 gene locus_tag LOCUS_10410 1156050 1157042 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027956.1 protein_id gnl|my_center|LOCUS_10410 1156650 1156733 gene locus_tag LOCUS_t00110 1156650 1156733 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1157433 1157155 gene locus_tag LOCUS_10420 1157433 1157155 CDS product I78 family peptidase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977071.1 protein_id gnl|my_center|LOCUS_10420 1158724 1157768 gene locus_tag LOCUS_10430 1158724 1157768 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225042.1 protein_id gnl|my_center|LOCUS_10430 1160082 1158808 gene locus_tag LOCUS_10440 1160082 1158808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1160728 1160168 gene locus_tag LOCUS_10450 1160728 1160168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1160992 1161774 gene locus_tag LOCUS_10460 1160992 1161774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977068.1 protein_id gnl|my_center|LOCUS_10460 1161864 1162205 gene locus_tag LOCUS_10470 1161864 1162205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977067.1 protein_id gnl|my_center|LOCUS_10470 1163746 1162277 gene locus_tag LOCUS_10480 gene der 1163746 1162277 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_10480 1164470 1163799 gene locus_tag LOCUS_10490 1164470 1163799 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977065.1 protein_id gnl|my_center|LOCUS_10490 1165171 1164467 gene locus_tag LOCUS_10500 gene cmk 1165171 1164467 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027958.1 protein_id gnl|my_center|LOCUS_10500 1166369 1165284 gene locus_tag LOCUS_10510 1166369 1165284 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 protein_id gnl|my_center|LOCUS_10510 1166671 1166366 gene locus_tag LOCUS_10520 gene aroH 1166671 1166366 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_10520 1166567 1166827 gene locus_tag LOCUS_10530 1166567 1166827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1167461 1166847 gene locus_tag LOCUS_10540 1167461 1166847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1168483 1167461 gene locus_tag LOCUS_10550 1168483 1167461 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977058.1 protein_id gnl|my_center|LOCUS_10550 1169211 1168480 gene locus_tag LOCUS_10560 1169211 1168480 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027962.1 protein_id gnl|my_center|LOCUS_10560 1170287 1169208 gene locus_tag LOCUS_10570 1170287 1169208 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401213.1 protein_id gnl|my_center|LOCUS_10570 1170937 1170284 gene locus_tag LOCUS_10580 gene pnuC 1170937 1170284 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088340.1 protein_id gnl|my_center|LOCUS_10580 1172344 1171067 gene locus_tag LOCUS_10590 1172344 1171067 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027963.1 protein_id gnl|my_center|LOCUS_10590 1173000 1172344 gene locus_tag LOCUS_10600 gene scpB 1173000 1172344 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_10600 1174061 1172997 gene locus_tag LOCUS_10610 1174061 1172997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10610 1174749 1174165 gene locus_tag LOCUS_10620 1174749 1174165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495132.1 protein_id gnl|my_center|LOCUS_10620 1175864 1174746 gene locus_tag LOCUS_10630 1175864 1174746 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977053.1 protein_id gnl|my_center|LOCUS_10630 1175992 1176210 gene locus_tag LOCUS_10640 1175992 1176210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1177347 1176232 gene locus_tag LOCUS_10650 gene ald 1177347 1176232 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_10650 1179596 1177491 gene locus_tag LOCUS_10660 1179596 1177491 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868162.1 protein_id gnl|my_center|LOCUS_10660 1180405 1179779 gene locus_tag LOCUS_10670 1180405 1179779 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_10670 1182136 1180487 gene locus_tag LOCUS_10680 1182136 1180487 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027968.1 protein_id gnl|my_center|LOCUS_10680 1182566 1184368 gene locus_tag LOCUS_10690 1182566 1184368 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027969.1 protein_id gnl|my_center|LOCUS_10690 1184505 1186130 gene locus_tag LOCUS_10700 1184505 1186130 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027970.1 protein_id gnl|my_center|LOCUS_10700 1187239 1186151 gene locus_tag LOCUS_10710 1187239 1186151 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666770.1 protein_id gnl|my_center|LOCUS_10710 1189188 1187449 gene locus_tag LOCUS_10720 gene recN 1189188 1187449 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_10720 1190196 1189291 gene locus_tag LOCUS_10730 1190196 1189291 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_10730 1191008 1190193 gene locus_tag LOCUS_10740 1191008 1190193 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 protein_id gnl|my_center|LOCUS_10740 1191318 1191016 gene locus_tag LOCUS_10750 1191318 1191016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977039.1 protein_id gnl|my_center|LOCUS_10750 1191363 1191710 gene locus_tag LOCUS_10760 1191363 1191710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977038.1 protein_id gnl|my_center|LOCUS_10760 1192547 1191744 gene locus_tag LOCUS_10770 1192547 1191744 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027975.1 protein_id gnl|my_center|LOCUS_10770 1193711 1192683 gene locus_tag LOCUS_10780 1193711 1192683 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027978.1 protein_id gnl|my_center|LOCUS_10780 1193783 1195060 gene locus_tag LOCUS_10790 1193783 1195060 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027979.1 protein_id gnl|my_center|LOCUS_10790 1195883 1195122 gene locus_tag LOCUS_10800 1195883 1195122 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977032.1 protein_id gnl|my_center|LOCUS_10800 1197127 1195883 gene locus_tag LOCUS_10810 1197127 1195883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1197509 1197399 gene locus_tag LOCUS_r00040 1197509 1197399 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1200747 1197625 gene locus_tag LOCUS_r00050 1200747 1197625 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1202577 1201055 gene locus_tag LOCUS_r00060 1202577 1201055 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1203879 1203238 gene locus_tag LOCUS_10820 1203879 1203238 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_10820 1203967 1204749 gene locus_tag LOCUS_10830 1203967 1204749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 1204804 1205337 gene locus_tag LOCUS_10840 1204804 1205337 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977028.1 protein_id gnl|my_center|LOCUS_10840 1205480 1205986 gene locus_tag LOCUS_10850 1205480 1205986 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977027.1 protein_id gnl|my_center|LOCUS_10850 1206815 1206048 gene locus_tag LOCUS_10860 1206815 1206048 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943926.1 protein_id gnl|my_center|LOCUS_10860 1207847 1206900 gene locus_tag LOCUS_10870 1207847 1206900 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027982.1 protein_id gnl|my_center|LOCUS_10870 1208403 1207975 gene locus_tag LOCUS_10880 1208403 1207975 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977025.1 protein_id gnl|my_center|LOCUS_10880 1209397 1208471 gene locus_tag LOCUS_10890 1209397 1208471 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977024.1 protein_id gnl|my_center|LOCUS_10890 1209414 1210202 gene locus_tag LOCUS_10900 1209414 1210202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027983.1 protein_id gnl|my_center|LOCUS_10900 1211021 1210377 gene locus_tag LOCUS_10910 1211021 1210377 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 protein_id gnl|my_center|LOCUS_10910 1212159 1211014 gene locus_tag LOCUS_10920 1212159 1211014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1212667 1213422 gene locus_tag LOCUS_10930 1212667 1213422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1215950 1213512 gene locus_tag LOCUS_10940 1215950 1213512 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872986.1 protein_id gnl|my_center|LOCUS_10940 1216385 1217641 gene locus_tag LOCUS_10950 gene serB 1216385 1217641 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_10950 1218232 1217714 gene locus_tag LOCUS_10960 1218232 1217714 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977013.1 protein_id gnl|my_center|LOCUS_10960 1218535 1218329 gene locus_tag LOCUS_10970 1218535 1218329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1218826 1218683 gene locus_tag LOCUS_10980 1218826 1218683 CDS product SGM_5486 family transporter-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027990.1 protein_id gnl|my_center|LOCUS_10980 1220115 1218820 gene locus_tag LOCUS_10990 1220115 1218820 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486041.1 protein_id gnl|my_center|LOCUS_10990 1220164 1220838 gene locus_tag LOCUS_11000 1220164 1220838 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977010.1 protein_id gnl|my_center|LOCUS_11000 1221233 1220847 gene locus_tag LOCUS_11010 1221233 1220847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1222160 1221393 gene locus_tag LOCUS_11020 gene fabI 1222160 1221393 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_11020 1222885 1222166 gene locus_tag LOCUS_11030 gene fabG 1222885 1222166 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_11030 1223108 1224631 gene locus_tag LOCUS_11040 1223108 1224631 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110223.1 protein_id gnl|my_center|LOCUS_11040 1224628 1226022 gene locus_tag LOCUS_11050 1224628 1226022 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_11050 1226102 1227370 gene locus_tag LOCUS_11060 gene tyrS 1226102 1227370 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_11060 1227744 1227466 gene locus_tag LOCUS_11070 1227744 1227466 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977004.1 protein_id gnl|my_center|LOCUS_11070 1227954 1228331 gene locus_tag LOCUS_11080 1227954 1228331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1228554 1228802 gene locus_tag LOCUS_11090 1228554 1228802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1229774 1228785 gene locus_tag LOCUS_11100 gene moaA 1229774 1228785 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106977887.1 protein_id gnl|my_center|LOCUS_11100 1231599 1229959 gene locus_tag LOCUS_11110 1231599 1229959 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977000.1 protein_id gnl|my_center|LOCUS_11110 1231955 1231596 gene locus_tag LOCUS_11120 1231955 1231596 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976999.1 protein_id gnl|my_center|LOCUS_11120 1232264 1233802 gene locus_tag LOCUS_11130 1232264 1233802 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027994.1 protein_id gnl|my_center|LOCUS_11130 1234907 1233864 gene locus_tag LOCUS_11140 1234907 1233864 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467337.1 protein_id gnl|my_center|LOCUS_11140 1235965 1235063 gene locus_tag LOCUS_11150 1235965 1235063 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224651.1 protein_id gnl|my_center|LOCUS_11150 1236309 1237283 gene locus_tag LOCUS_11160 1236309 1237283 CDS product DEDDh family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027997.1 protein_id gnl|my_center|LOCUS_11160 1237326 1237580 gene locus_tag LOCUS_11170 1237326 1237580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976994.1 protein_id gnl|my_center|LOCUS_11170 1237649 1238458 gene locus_tag LOCUS_11180 1237649 1238458 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872966.1 protein_id gnl|my_center|LOCUS_11180 1238514 1240307 gene locus_tag LOCUS_11190 1238514 1240307 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027999.1 protein_id gnl|my_center|LOCUS_11190 1240312 1241067 gene locus_tag LOCUS_11200 1240312 1241067 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 protein_id gnl|my_center|LOCUS_11200 1241677 1241090 gene locus_tag LOCUS_11210 gene amaP 1241677 1241090 CDS product alkaline shock response membrane anchor protein AmaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028000.1 protein_id gnl|my_center|LOCUS_11210 1242384 1241674 gene locus_tag LOCUS_11220 1242384 1241674 CDS product DUF6286 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486046.1 protein_id gnl|my_center|LOCUS_11220 1242734 1242381 gene locus_tag LOCUS_11230 1242734 1242381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976988.1 protein_id gnl|my_center|LOCUS_11230 1242922 1242731 gene locus_tag LOCUS_11240 1242922 1242731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1243434 1242955 gene locus_tag LOCUS_11250 1243434 1242955 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976986.1 protein_id gnl|my_center|LOCUS_11250 1243528 1244238 gene locus_tag LOCUS_11260 1243528 1244238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028002.1 protein_id gnl|my_center|LOCUS_11260 1245043 1244252 gene locus_tag LOCUS_11270 1245043 1244252 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 protein_id gnl|my_center|LOCUS_11270 1245418 1245197 gene locus_tag LOCUS_11280 1245418 1245197 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976983.1 protein_id gnl|my_center|LOCUS_11280 1247389 1245791 gene locus_tag LOCUS_11290 1247389 1245791 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_11290 1247606 1248019 gene locus_tag LOCUS_11300 1247606 1248019 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872956.1 protein_id gnl|my_center|LOCUS_11300 1249477 1248056 gene locus_tag LOCUS_11310 1249477 1248056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976980.1 protein_id gnl|my_center|LOCUS_11310 1250677 1249550 gene locus_tag LOCUS_11320 1250677 1249550 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976978.1 protein_id gnl|my_center|LOCUS_11320 1251413 1250754 gene locus_tag LOCUS_11330 1251413 1250754 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028005.1 protein_id gnl|my_center|LOCUS_11330 1251689 1252945 gene locus_tag LOCUS_11340 gene pitH 1251689 1252945 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976976.1 protein_id gnl|my_center|LOCUS_11340 1252964 1253191 gene locus_tag LOCUS_11350 1252964 1253191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976975.1 protein_id gnl|my_center|LOCUS_11350 1253590 1254534 gene locus_tag LOCUS_11360 1253590 1254534 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028006.1 protein_id gnl|my_center|LOCUS_11360 1254531 1256249 gene locus_tag LOCUS_11370 1254531 1256249 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028007.1 protein_id gnl|my_center|LOCUS_11370 1256246 1258279 gene locus_tag LOCUS_11380 1256246 1258279 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976970.1 protein_id gnl|my_center|LOCUS_11380 1258279 1258878 gene locus_tag LOCUS_11390 gene cobO 1258279 1258878 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976969.1 protein_id gnl|my_center|LOCUS_11390 1258872 1260230 gene locus_tag LOCUS_11400 1258872 1260230 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228815.1 protein_id gnl|my_center|LOCUS_11400 1260996 1260274 gene locus_tag LOCUS_11410 1260996 1260274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1261107 1262648 gene locus_tag LOCUS_11420 1261107 1262648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1263601 1262705 gene locus_tag LOCUS_11430 1263601 1262705 CDS product SCO1860 family LAETG-anchored protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486091.1 protein_id gnl|my_center|LOCUS_11430 1265025 1263925 gene locus_tag LOCUS_11440 1265025 1263925 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976959.1 protein_id gnl|my_center|LOCUS_11440 1265130 1266236 gene locus_tag LOCUS_11450 1265130 1266236 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972854.1 protein_id gnl|my_center|LOCUS_11450 1266617 1267081 gene locus_tag LOCUS_11460 gene ectA 1266617 1267081 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976956.1 protein_id gnl|my_center|LOCUS_11460 1267116 1268384 gene locus_tag LOCUS_11470 gene ectB 1267116 1268384 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976955.1 protein_id gnl|my_center|LOCUS_11470 1268448 1268846 gene locus_tag LOCUS_11480 1268448 1268846 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976954.1 protein_id gnl|my_center|LOCUS_11480 1268850 1269743 gene locus_tag LOCUS_11490 gene thpD 1268850 1269743 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976953.1 protein_id gnl|my_center|LOCUS_11490 1269829 1270839 gene locus_tag LOCUS_11500 1269829 1270839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1271078 1270845 gene locus_tag LOCUS_11510 1271078 1270845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1272160 1271093 gene locus_tag LOCUS_11520 1272160 1271093 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966730.1 protein_id gnl|my_center|LOCUS_11520 1272338 1272847 gene locus_tag LOCUS_11530 1272338 1272847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1273936 1272866 gene locus_tag LOCUS_11540 1273936 1272866 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028020.1 protein_id gnl|my_center|LOCUS_11540 1276197 1274677 gene locus_tag LOCUS_11550 1276197 1274677 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028022.1 protein_id gnl|my_center|LOCUS_11550 1276356 1277126 gene locus_tag LOCUS_11560 1276356 1277126 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976948.1 protein_id gnl|my_center|LOCUS_11560 1277130 1277603 gene locus_tag LOCUS_11570 1277130 1277603 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976947.1 protein_id gnl|my_center|LOCUS_11570 1277777 1278349 gene locus_tag LOCUS_11580 1277777 1278349 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028024.1 protein_id gnl|my_center|LOCUS_11580 1278349 1279062 gene locus_tag LOCUS_11590 1278349 1279062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028025.1 protein_id gnl|my_center|LOCUS_11590 1280184 1279081 gene locus_tag LOCUS_11600 1280184 1279081 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028027.1 protein_id gnl|my_center|LOCUS_11600 1281579 1280278 gene locus_tag LOCUS_11610 1281579 1280278 CDS product polysaccharide lyase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028028.1 protein_id gnl|my_center|LOCUS_11610 1282411 1281614 gene locus_tag LOCUS_11620 1282411 1281614 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028029.1 protein_id gnl|my_center|LOCUS_11620 1283859 1282525 gene locus_tag LOCUS_11630 1283859 1282525 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325939.1 protein_id gnl|my_center|LOCUS_11630 1285479 1283923 gene locus_tag LOCUS_11640 1285479 1283923 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055228983.1 protein_id gnl|my_center|LOCUS_11640 1286303 1285476 gene locus_tag LOCUS_11650 1286303 1285476 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976936.1 protein_id gnl|my_center|LOCUS_11650 1287475 1286300 gene locus_tag LOCUS_11660 1287475 1286300 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028031.1 protein_id gnl|my_center|LOCUS_11660 1288392 1287481 gene locus_tag LOCUS_11670 1288392 1287481 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976934.1 protein_id gnl|my_center|LOCUS_11670 1289318 1288389 gene locus_tag LOCUS_11680 1289318 1288389 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976933.1 protein_id gnl|my_center|LOCUS_11680 1291160 1289433 gene locus_tag LOCUS_11690 gene araD 1291160 1289433 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028032.1 protein_id gnl|my_center|LOCUS_11690 1292095 1291157 gene locus_tag LOCUS_11700 1292095 1291157 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976931.1 protein_id gnl|my_center|LOCUS_11700 1292748 1292092 gene locus_tag LOCUS_11710 1292748 1292092 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028033.1 protein_id gnl|my_center|LOCUS_11710 1294483 1293305 gene locus_tag LOCUS_11720 1294483 1293305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028037.1 protein_id gnl|my_center|LOCUS_11720 1295454 1294480 gene locus_tag LOCUS_11730 1295454 1294480 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976924.1 protein_id gnl|my_center|LOCUS_11730 1295711 1296520 gene locus_tag LOCUS_11740 1295711 1296520 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976923.1 protein_id gnl|my_center|LOCUS_11740 1296652 1297857 gene locus_tag LOCUS_11750 1296652 1297857 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028040.1 protein_id gnl|my_center|LOCUS_11750 1298197 1297967 gene locus_tag LOCUS_11760 1298197 1297967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1299979 1298465 gene locus_tag LOCUS_11770 1299979 1298465 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028042.1 protein_id gnl|my_center|LOCUS_11770 1301632 1300115 gene locus_tag LOCUS_11780 1301632 1300115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976912.1 protein_id gnl|my_center|LOCUS_11780 1303079 1302081 gene locus_tag LOCUS_11790 gene dapD 1303079 1302081 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976903.1 protein_id gnl|my_center|LOCUS_11790 1303623 1303288 gene locus_tag LOCUS_11800 1303623 1303288 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224702.1 protein_id gnl|my_center|LOCUS_11800 1304075 1303620 gene locus_tag LOCUS_11810 1304075 1303620 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976899.1 protein_id gnl|my_center|LOCUS_11810 1305369 1304101 gene locus_tag LOCUS_11820 1305369 1304101 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 protein_id gnl|my_center|LOCUS_11820 1306130 1305366 gene locus_tag LOCUS_11830 gene sufC 1306130 1305366 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976897.1 protein_id gnl|my_center|LOCUS_11830 1306398 1306138 gene locus_tag LOCUS_11840 1306398 1306138 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_11840 1307672 1306455 gene locus_tag LOCUS_11850 gene sufD 1307672 1306455 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_11850 1309152 1307731 gene locus_tag LOCUS_11860 gene sufB 1309152 1307731 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_11860 1309886 1309149 gene locus_tag LOCUS_11870 1309886 1309149 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976893.1 protein_id gnl|my_center|LOCUS_11870 1309987 1310997 gene locus_tag LOCUS_11880 1309987 1310997 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_11880 1310994 1311761 gene locus_tag LOCUS_11890 1310994 1311761 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_11890 1311772 1312806 gene locus_tag LOCUS_11900 1311772 1312806 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_11900 1313388 1312930 gene locus_tag LOCUS_11910 1313388 1312930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1314242 1313385 gene locus_tag LOCUS_11920 1314242 1313385 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 protein_id gnl|my_center|LOCUS_11920 1314621 1316708 gene locus_tag LOCUS_11930 gene tkt 1314621 1316708 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976883.1 protein_id gnl|my_center|LOCUS_11930 1316743 1317861 gene locus_tag LOCUS_11940 gene tal 1316743 1317861 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976882.1 protein_id gnl|my_center|LOCUS_11940 1317867 1319399 gene locus_tag LOCUS_11950 gene zwf 1317867 1319399 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976881.1 protein_id gnl|my_center|LOCUS_11950 1319396 1320439 gene locus_tag LOCUS_11960 gene opcA 1319396 1320439 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976880.1 protein_id gnl|my_center|LOCUS_11960 1320436 1321218 gene locus_tag LOCUS_11970 gene pgl 1320436 1321218 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_11970 1321297 1321662 gene locus_tag LOCUS_11980 1321297 1321662 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864690.1 protein_id gnl|my_center|LOCUS_11980 1323230 1321701 gene locus_tag LOCUS_11990 1323230 1321701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1323730 1323227 gene locus_tag LOCUS_12000 1323730 1323227 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 protein_id gnl|my_center|LOCUS_12000 1325388 1323736 gene locus_tag LOCUS_12010 gene pgi 1325388 1323736 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028056.1 protein_id gnl|my_center|LOCUS_12010 1325875 1325540 gene locus_tag LOCUS_12020 1325875 1325540 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976875.1 protein_id gnl|my_center|LOCUS_12020 1326221 1325985 gene locus_tag LOCUS_12030 gene secG 1326221 1325985 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325957.1 protein_id gnl|my_center|LOCUS_12030 1327111 1326335 gene locus_tag LOCUS_12040 gene tpiA 1327111 1326335 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_12040 1328329 1327118 gene locus_tag LOCUS_12050 1328329 1327118 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028057.1 protein_id gnl|my_center|LOCUS_12050 1329453 1328443 gene locus_tag LOCUS_12060 gene gap 1329453 1328443 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_12060 1330898 1329909 gene locus_tag LOCUS_12070 gene whiA 1330898 1329909 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 protein_id gnl|my_center|LOCUS_12070 1331923 1330889 gene locus_tag LOCUS_12080 gene yvcK 1331923 1330889 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 protein_id gnl|my_center|LOCUS_12080 1332825 1331920 gene locus_tag LOCUS_12090 gene rapZ 1332825 1331920 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_12090 1334933 1332903 gene locus_tag LOCUS_12100 gene uvrC 1334933 1332903 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028063.1 protein_id gnl|my_center|LOCUS_12100 1335474 1335046 gene locus_tag LOCUS_12110 1335474 1335046 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976864.1 protein_id gnl|my_center|LOCUS_12110 1338738 1335736 gene locus_tag LOCUS_12120 gene uvrA 1338738 1335736 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_12120 1338914 1339600 gene locus_tag LOCUS_12130 1338914 1339600 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028067.1 protein_id gnl|my_center|LOCUS_12130 1339611 1340267 gene locus_tag LOCUS_12140 1339611 1340267 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_12140 1341367 1340351 gene locus_tag LOCUS_12150 1341367 1340351 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976856.1 protein_id gnl|my_center|LOCUS_12150 1343566 1341629 gene locus_tag LOCUS_12160 1343566 1341629 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028068.1 protein_id gnl|my_center|LOCUS_12160 1344336 1343722 gene locus_tag LOCUS_12170 1344336 1343722 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976854.1 protein_id gnl|my_center|LOCUS_12170 1346601 1344472 gene locus_tag LOCUS_12180 gene uvrB 1346601 1344472 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_12180 1347504 1346641 gene locus_tag LOCUS_12190 1347504 1346641 CDS product MHYT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028070.1 protein_id gnl|my_center|LOCUS_12190 1347719 1348597 gene locus_tag LOCUS_12200 1347719 1348597 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028071.1 protein_id gnl|my_center|LOCUS_12200 1348688 1349215 gene locus_tag LOCUS_12210 1348688 1349215 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028072.1 protein_id gnl|my_center|LOCUS_12210 1349291 1350637 gene locus_tag LOCUS_12220 1349291 1350637 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234253.1 protein_id gnl|my_center|LOCUS_12220 1350794 1351744 gene locus_tag LOCUS_12230 1350794 1351744 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976848.1 protein_id gnl|my_center|LOCUS_12230 1351741 1352634 gene locus_tag LOCUS_12240 1351741 1352634 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976847.1 protein_id gnl|my_center|LOCUS_12240 1353275 1352631 gene locus_tag LOCUS_12250 1353275 1352631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976844.1 protein_id gnl|my_center|LOCUS_12250 1353776 1353315 gene locus_tag LOCUS_12260 1353776 1353315 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224026.1 protein_id gnl|my_center|LOCUS_12260 1354541 1353855 gene locus_tag LOCUS_12270 1354541 1353855 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972704.1 protein_id gnl|my_center|LOCUS_12270 1354610 1355821 gene locus_tag LOCUS_12280 1354610 1355821 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972705.1 protein_id gnl|my_center|LOCUS_12280 1357168 1355828 gene locus_tag LOCUS_12290 1357168 1355828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1360146 1357165 gene locus_tag LOCUS_12300 1360146 1357165 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030777.1 protein_id gnl|my_center|LOCUS_12300 1360517 1360870 gene locus_tag LOCUS_12310 1360517 1360870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1360953 1361237 gene locus_tag LOCUS_12320 1360953 1361237 CDS product DUF6343 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325978.1 protein_id gnl|my_center|LOCUS_12320 1361669 1361301 gene locus_tag LOCUS_12330 1361669 1361301 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976823.1 protein_id gnl|my_center|LOCUS_12330 1362383 1361781 gene locus_tag LOCUS_12340 gene coaE 1362383 1361781 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_12340 1363365 1362427 gene locus_tag LOCUS_12350 1363365 1362427 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976821.1 protein_id gnl|my_center|LOCUS_12350 1363699 1364658 gene locus_tag LOCUS_12360 1363699 1364658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1366282 1364768 gene locus_tag LOCUS_12370 gene rpsA 1366282 1364768 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 protein_id gnl|my_center|LOCUS_12370 1366676 1367488 gene locus_tag LOCUS_12380 1366676 1367488 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976818.1 protein_id gnl|my_center|LOCUS_12380 1367570 1370071 gene locus_tag LOCUS_12390 gene hrpB 1367570 1370071 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223186.1 protein_id gnl|my_center|LOCUS_12390 1371896 1370157 gene locus_tag LOCUS_12400 1371896 1370157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1372095 1372964 gene locus_tag LOCUS_12410 1372095 1372964 CDS product DUF4184 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227782.1 protein_id gnl|my_center|LOCUS_12410 1375745 1373034 gene locus_tag LOCUS_12420 gene polA 1375745 1373034 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_12420 1375912 1378185 gene locus_tag LOCUS_12430 1375912 1378185 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028088.1 protein_id gnl|my_center|LOCUS_12430 1378298 1378768 gene locus_tag LOCUS_12440 1378298 1378768 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976812.1 protein_id gnl|my_center|LOCUS_12440 1379151 1378765 gene locus_tag LOCUS_12450 1379151 1378765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1379359 1380582 gene locus_tag LOCUS_12460 1379359 1380582 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976809.1 protein_id gnl|my_center|LOCUS_12460 1380686 1381615 gene locus_tag LOCUS_12470 1380686 1381615 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028093.1 protein_id gnl|my_center|LOCUS_12470 1381621 1383402 gene locus_tag LOCUS_12480 1381621 1383402 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028094.1 protein_id gnl|my_center|LOCUS_12480 1383399 1384307 gene locus_tag LOCUS_12490 1383399 1384307 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976806.1 protein_id gnl|my_center|LOCUS_12490 1384304 1385020 gene locus_tag LOCUS_12500 1384304 1385020 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028095.1 protein_id gnl|my_center|LOCUS_12500 1385766 1385110 gene locus_tag LOCUS_12510 1385766 1385110 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_12510 1385860 1385943 gene locus_tag LOCUS_t00120 1385860 1385943 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1386029 1386817 gene locus_tag LOCUS_12520 1386029 1386817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1388247 1386826 gene locus_tag LOCUS_12530 gene pyk 1388247 1386826 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028096.1 protein_id gnl|my_center|LOCUS_12530 1389075 1388368 gene locus_tag LOCUS_12540 1389075 1388368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1389059 1389256 gene locus_tag LOCUS_12550 1389059 1389256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1389240 1391045 gene locus_tag LOCUS_12560 1389240 1391045 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028097.1 protein_id gnl|my_center|LOCUS_12560 1392544 1391114 gene locus_tag LOCUS_12570 1392544 1391114 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976800.1 protein_id gnl|my_center|LOCUS_12570 1393941 1392541 gene locus_tag LOCUS_12580 1393941 1392541 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028098.1 protein_id gnl|my_center|LOCUS_12580 1396654 1394150 gene locus_tag LOCUS_12590 gene pepN 1396654 1394150 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283751.1 protein_id gnl|my_center|LOCUS_12590 1397069 1396743 gene locus_tag LOCUS_12600 1397069 1396743 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976797.1 protein_id gnl|my_center|LOCUS_12600 1397053 1397271 gene locus_tag LOCUS_12610 1397053 1397271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1398087 1397314 gene locus_tag LOCUS_12620 1398087 1397314 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224432.1 protein_id gnl|my_center|LOCUS_12620 1398318 1399211 gene locus_tag LOCUS_12630 1398318 1399211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028100.1 protein_id gnl|my_center|LOCUS_12630 1401002 1399350 gene locus_tag LOCUS_12640 1401002 1399350 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029195.1 protein_id gnl|my_center|LOCUS_12640 1401372 1401169 gene locus_tag LOCUS_12650 1401372 1401169 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975194.1 protein_id gnl|my_center|LOCUS_12650 1402097 1401669 gene locus_tag LOCUS_12660 1402097 1401669 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486580.1 protein_id gnl|my_center|LOCUS_12660 1402771 1402223 gene locus_tag LOCUS_12670 1402771 1402223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1403061 1402807 gene locus_tag LOCUS_12680 1403061 1402807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1404723 1403263 gene locus_tag LOCUS_12690 1404723 1403263 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976791.1 protein_id gnl|my_center|LOCUS_12690 1409284 1404716 gene locus_tag LOCUS_12700 gene gltB 1409284 1404716 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_12700 1410388 1409654 gene locus_tag LOCUS_12710 1410388 1409654 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_12710 1410675 1411817 gene locus_tag LOCUS_12720 1410675 1411817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12720 1411850 1413094 gene locus_tag LOCUS_12730 1411850 1413094 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028106.1 protein_id gnl|my_center|LOCUS_12730 1413006 1414223 gene locus_tag LOCUS_12740 1413006 1414223 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028107.1 protein_id gnl|my_center|LOCUS_12740 1414226 1415587 gene locus_tag LOCUS_12750 1414226 1415587 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 protein_id gnl|my_center|LOCUS_12750 1415584 1416468 gene locus_tag LOCUS_12760 1415584 1416468 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889314.1 protein_id gnl|my_center|LOCUS_12760 1416465 1417664 gene locus_tag LOCUS_12770 1416465 1417664 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041861981.1 protein_id gnl|my_center|LOCUS_12770 1417661 1418470 gene locus_tag LOCUS_12780 1417661 1418470 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028109.1 protein_id gnl|my_center|LOCUS_12780 1419525 1418545 gene locus_tag LOCUS_12790 gene lgt 1419525 1418545 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976782.1 protein_id gnl|my_center|LOCUS_12790 1420500 1419625 gene locus_tag LOCUS_12800 1420500 1419625 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715374.1 protein_id gnl|my_center|LOCUS_12800 1421334 1420522 gene locus_tag LOCUS_12810 gene trpA 1421334 1420522 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976780.1 protein_id gnl|my_center|LOCUS_12810 1422611 1421331 gene locus_tag LOCUS_12820 gene trpB 1422611 1421331 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976779.1 protein_id gnl|my_center|LOCUS_12820 1422969 1422754 gene locus_tag LOCUS_12830 1422969 1422754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1423787 1422978 gene locus_tag LOCUS_12840 gene trpC 1423787 1422978 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_12840 1424400 1423912 gene locus_tag LOCUS_12850 1424400 1423912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1424828 1424481 gene locus_tag LOCUS_12860 1424828 1424481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1425484 1424825 gene locus_tag LOCUS_12870 1425484 1424825 CDS product TIGR02234 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028113.1 protein_id gnl|my_center|LOCUS_12870 1426992 1425499 gene locus_tag LOCUS_12880 1426992 1425499 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976773.1 protein_id gnl|my_center|LOCUS_12880 1427396 1427004 gene locus_tag LOCUS_12890 gene hisI 1427396 1427004 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976772.1 protein_id gnl|my_center|LOCUS_12890 1427329 1428114 gene locus_tag LOCUS_12900 1427329 1428114 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_12900 1429637 1428321 gene locus_tag LOCUS_12910 1429637 1428321 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027309.1 protein_id gnl|my_center|LOCUS_12910 1432659 1429846 gene locus_tag LOCUS_12920 1432659 1429846 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027310.1 protein_id gnl|my_center|LOCUS_12920 1433772 1432840 gene locus_tag LOCUS_12930 1433772 1432840 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978149.1 protein_id gnl|my_center|LOCUS_12930 1434740 1433985 gene locus_tag LOCUS_12940 gene hisF 1434740 1433985 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976768.1 protein_id gnl|my_center|LOCUS_12940 1435135 1434737 gene locus_tag LOCUS_12950 1435135 1434737 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976767.1 protein_id gnl|my_center|LOCUS_12950 1435857 1435132 gene locus_tag LOCUS_12960 gene priA 1435857 1435132 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976766.1 protein_id gnl|my_center|LOCUS_12960 1436498 1435857 gene locus_tag LOCUS_12970 gene hisH 1436498 1435857 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976765.1 protein_id gnl|my_center|LOCUS_12970 1436675 1436508 gene locus_tag LOCUS_12980 1436675 1436508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1437268 1436672 gene locus_tag LOCUS_12990 gene hisB 1437268 1436672 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 protein_id gnl|my_center|LOCUS_12990 1438407 1437265 gene locus_tag LOCUS_13000 1438407 1437265 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976762.1 protein_id gnl|my_center|LOCUS_13000 1439726 1438404 gene locus_tag LOCUS_13010 gene hisD 1439726 1438404 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028117.1 protein_id gnl|my_center|LOCUS_13010 1439873 1441477 gene locus_tag LOCUS_13020 1439873 1441477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028118.1 protein_id gnl|my_center|LOCUS_13020 1441736 1442728 gene locus_tag LOCUS_13030 1441736 1442728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028119.1 protein_id gnl|my_center|LOCUS_13030 1442734 1443513 gene locus_tag LOCUS_13040 1442734 1443513 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028120.1 protein_id gnl|my_center|LOCUS_13040 1443531 1444028 gene locus_tag LOCUS_13050 gene ybaK 1443531 1444028 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 protein_id gnl|my_center|LOCUS_13050 1444904 1444194 gene locus_tag LOCUS_13060 1444904 1444194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028121.1 protein_id gnl|my_center|LOCUS_13060 1445847 1445008 gene locus_tag LOCUS_13070 1445847 1445008 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109031846.1 protein_id gnl|my_center|LOCUS_13070 1446976 1445906 gene locus_tag LOCUS_13080 1446976 1445906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028123.1 protein_id gnl|my_center|LOCUS_13080 1448232 1446988 gene locus_tag LOCUS_13090 1448232 1446988 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028124.1 protein_id gnl|my_center|LOCUS_13090 1448498 1448680 gene locus_tag LOCUS_13100 1448498 1448680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1452311 1448772 gene locus_tag LOCUS_13110 gene dnaE 1452311 1448772 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976751.1 protein_id gnl|my_center|LOCUS_13110 1452469 1453794 gene locus_tag LOCUS_13120 1452469 1453794 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 protein_id gnl|my_center|LOCUS_13120 1453836 1454576 gene locus_tag LOCUS_13130 1453836 1454576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976749.1 protein_id gnl|my_center|LOCUS_13130 1454625 1455440 gene locus_tag LOCUS_13140 1454625 1455440 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976748.1 protein_id gnl|my_center|LOCUS_13140 1455576 1457225 gene locus_tag LOCUS_13150 1455576 1457225 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014996.1 protein_id gnl|my_center|LOCUS_13150 1457512 1458510 gene locus_tag LOCUS_13160 1457512 1458510 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229676.1 protein_id gnl|my_center|LOCUS_13160 1459140 1458571 gene locus_tag LOCUS_13170 1459140 1458571 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976746.1 protein_id gnl|my_center|LOCUS_13170 1459186 1460322 gene locus_tag LOCUS_13180 1459186 1460322 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976745.1 protein_id gnl|my_center|LOCUS_13180 1460902 1460426 gene locus_tag LOCUS_13190 1460902 1460426 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283762.1 protein_id gnl|my_center|LOCUS_13190 1461840 1460899 gene locus_tag LOCUS_13200 1461840 1460899 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 protein_id gnl|my_center|LOCUS_13200 1462469 1461864 gene locus_tag LOCUS_13210 gene lspA 1462469 1461864 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028127.1 protein_id gnl|my_center|LOCUS_13210 1463199 1462528 gene locus_tag LOCUS_13220 1463199 1462528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1463793 1466939 gene locus_tag LOCUS_13230 gene ileS 1463793 1466939 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_13230 1468281 1467145 gene locus_tag LOCUS_13240 1468281 1467145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1468627 1468331 gene locus_tag LOCUS_13250 1468627 1468331 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976737.1 protein_id gnl|my_center|LOCUS_13250 1469322 1468699 gene locus_tag LOCUS_13260 gene sepF 1469322 1468699 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976736.1 protein_id gnl|my_center|LOCUS_13260 1470167 1469448 gene locus_tag LOCUS_13270 1470167 1469448 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 protein_id gnl|my_center|LOCUS_13270 1470926 1470174 gene locus_tag LOCUS_13280 gene pgeF 1470926 1470174 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028130.1 protein_id gnl|my_center|LOCUS_13280 1472137 1470923 gene locus_tag LOCUS_13290 gene ftsZ 1472137 1470923 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_13290 1473208 1472414 gene locus_tag LOCUS_13300 gene ftsQ 1473208 1472414 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976732.1 protein_id gnl|my_center|LOCUS_13300 1474353 1473259 gene locus_tag LOCUS_13310 gene murG 1474353 1473259 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_13310 1475811 1474360 gene locus_tag LOCUS_13320 gene ftsW 1475811 1474360 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976730.1 protein_id gnl|my_center|LOCUS_13320 1477285 1475867 gene locus_tag LOCUS_13330 gene murD 1477285 1475867 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_13330 1478361 1477291 gene locus_tag LOCUS_13340 gene mraY 1478361 1477291 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 protein_id gnl|my_center|LOCUS_13340 1479788 1478358 gene locus_tag LOCUS_13350 1479788 1478358 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_13350 1481532 1479793 gene locus_tag LOCUS_13360 1481532 1479793 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_13360 1483453 1481597 gene locus_tag LOCUS_13370 gene ftsI 1483453 1481597 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_13370 1484248 1483577 gene locus_tag LOCUS_13380 1484248 1483577 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270016.1 protein_id gnl|my_center|LOCUS_13380 1485263 1484298 gene locus_tag LOCUS_13390 gene rsmH 1485263 1484298 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976723.1 protein_id gnl|my_center|LOCUS_13390 1485663 1486226 gene locus_tag LOCUS_13400 1485663 1486226 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976722.1 protein_id gnl|my_center|LOCUS_13400 1486441 1487493 gene locus_tag LOCUS_13410 1486441 1487493 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_13410 1487493 1488866 gene locus_tag LOCUS_13420 1487493 1488866 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 protein_id gnl|my_center|LOCUS_13420 1488863 1491286 gene locus_tag LOCUS_13430 1488863 1491286 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_13430 1491849 1491451 gene locus_tag LOCUS_13440 1491849 1491451 CDS product spore wall synthesis complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 protein_id gnl|my_center|LOCUS_13440 1492856 1492098 gene locus_tag LOCUS_13450 1492856 1492098 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028138.1 protein_id gnl|my_center|LOCUS_13450 1493396 1492959 gene locus_tag LOCUS_13460 1493396 1492959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1493653 1494396 gene locus_tag LOCUS_13470 1493653 1494396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1494368 1496455 gene locus_tag LOCUS_13480 1494368 1496455 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878409.1 protein_id gnl|my_center|LOCUS_13480 1496485 1497096 gene locus_tag LOCUS_13490 1496485 1497096 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028140.1 protein_id gnl|my_center|LOCUS_13490 1497540 1499054 gene locus_tag LOCUS_13500 1497540 1499054 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028141.1 protein_id gnl|my_center|LOCUS_13500 1499971 1499102 gene locus_tag LOCUS_13510 1499971 1499102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028142.1 protein_id gnl|my_center|LOCUS_13510 1500975 1500058 gene locus_tag LOCUS_13520 gene metF 1500975 1500058 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 protein_id gnl|my_center|LOCUS_13520 1501761 1501111 gene locus_tag LOCUS_13530 gene thiE 1501761 1501111 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976712.1 protein_id gnl|my_center|LOCUS_13530 1502208 1501843 gene locus_tag LOCUS_13540 1502208 1501843 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805032.1 protein_id gnl|my_center|LOCUS_13540 1503489 1502290 gene locus_tag LOCUS_13550 1503489 1502290 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486236.1 protein_id gnl|my_center|LOCUS_13550 1503766 1504956 gene locus_tag LOCUS_13560 gene thiO 1503766 1504956 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_13560 1504953 1505177 gene locus_tag LOCUS_13570 gene thiS 1504953 1505177 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976708.1 protein_id gnl|my_center|LOCUS_13570 1505182 1505976 gene locus_tag LOCUS_13580 1505182 1505976 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976707.1 protein_id gnl|my_center|LOCUS_13580 1506065 1507987 gene locus_tag LOCUS_13590 gene pknB 1506065 1507987 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 protein_id gnl|my_center|LOCUS_13590 1507994 1508857 gene locus_tag LOCUS_13600 1507994 1508857 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976705.1 protein_id gnl|my_center|LOCUS_13600 1508926 1509432 gene locus_tag LOCUS_13610 1508926 1509432 CDS product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487417.1 protein_id gnl|my_center|LOCUS_13610 1510083 1509451 gene locus_tag LOCUS_13620 1510083 1509451 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976704.1 protein_id gnl|my_center|LOCUS_13620 1510238 1510717 gene locus_tag LOCUS_13630 gene bfr 1510238 1510717 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976703.1 protein_id gnl|my_center|LOCUS_13630 1510995 1510726 gene locus_tag LOCUS_13640 1510995 1510726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1512512 1511157 gene locus_tag LOCUS_13650 1512512 1511157 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_13650 1512807 1514693 gene locus_tag LOCUS_13660 1512807 1514693 CDS product phenazine-specific anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028148.1 protein_id gnl|my_center|LOCUS_13660 1515734 1514730 gene locus_tag LOCUS_13670 1515734 1514730 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976697.1 protein_id gnl|my_center|LOCUS_13670 1516506 1515811 gene locus_tag LOCUS_13680 1516506 1515811 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976695.1 protein_id gnl|my_center|LOCUS_13680 1517741 1516503 gene locus_tag LOCUS_13690 1517741 1516503 CDS product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976694.1 protein_id gnl|my_center|LOCUS_13690 1518553 1517774 gene locus_tag LOCUS_13700 1518553 1517774 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 protein_id gnl|my_center|LOCUS_13700 1518780 1519559 gene locus_tag LOCUS_13710 1518780 1519559 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_13710 1519552 1520217 gene locus_tag LOCUS_13720 1519552 1520217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976691.1 protein_id gnl|my_center|LOCUS_13720 1521022 1520249 gene locus_tag LOCUS_13730 1521022 1520249 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976690.1 protein_id gnl|my_center|LOCUS_13730 1522034 1521093 gene locus_tag LOCUS_13740 1522034 1521093 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976689.1 protein_id gnl|my_center|LOCUS_13740 1522589 1522122 gene locus_tag LOCUS_13750 1522589 1522122 CDS product carbon catabolit repression protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028152.1 protein_id gnl|my_center|LOCUS_13750 1523858 1522650 gene locus_tag LOCUS_13760 1523858 1522650 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976687.1 protein_id gnl|my_center|LOCUS_13760 1524306 1523863 gene locus_tag LOCUS_13770 1524306 1523863 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 protein_id gnl|my_center|LOCUS_13770 1525215 1524406 gene locus_tag LOCUS_13780 1525215 1524406 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028154.1 protein_id gnl|my_center|LOCUS_13780 1525494 1527290 gene locus_tag LOCUS_13790 1525494 1527290 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028155.1 protein_id gnl|my_center|LOCUS_13790 1528512 1527370 gene locus_tag LOCUS_13800 1528512 1527370 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_13800 1528614 1529864 gene locus_tag LOCUS_13810 1528614 1529864 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326026.1 protein_id gnl|my_center|LOCUS_13810 1531099 1529840 gene locus_tag LOCUS_13820 1531099 1529840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869422.1 protein_id gnl|my_center|LOCUS_13820 1532144 1531116 gene locus_tag LOCUS_13830 1532144 1531116 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976680.1 protein_id gnl|my_center|LOCUS_13830 1533421 1532393 gene locus_tag LOCUS_13840 1533421 1532393 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028159.1 protein_id gnl|my_center|LOCUS_13840 1535080 1533716 gene locus_tag LOCUS_13850 1535080 1533716 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028160.1 protein_id gnl|my_center|LOCUS_13850 1535355 1535113 gene locus_tag LOCUS_13860 1535355 1535113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976677.1 protein_id gnl|my_center|LOCUS_13860 1535567 1535848 gene locus_tag LOCUS_13870 1535567 1535848 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_13870 1537235 1535859 gene locus_tag LOCUS_13880 1537235 1535859 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028165.1 protein_id gnl|my_center|LOCUS_13880 1538689 1537625 gene locus_tag LOCUS_13890 gene trpD 1538689 1537625 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_13890 1540436 1538811 gene locus_tag LOCUS_13900 1540436 1538811 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 protein_id gnl|my_center|LOCUS_13900 1541485 1540433 gene locus_tag LOCUS_13910 1541485 1540433 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_13910 1542291 1541482 gene locus_tag LOCUS_13920 1542291 1541482 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976665.1 protein_id gnl|my_center|LOCUS_13920 1542856 1542347 gene locus_tag LOCUS_13930 1542856 1542347 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_13930 1543257 1543556 gene locus_tag LOCUS_13940 1543257 1543556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1544871 1543612 gene locus_tag LOCUS_13950 1544871 1543612 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156694785.1 protein_id gnl|my_center|LOCUS_13950 1545403 1545005 gene locus_tag LOCUS_13960 1545403 1545005 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 protein_id gnl|my_center|LOCUS_13960 1547136 1545400 gene locus_tag LOCUS_13970 gene ctaD 1547136 1545400 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_13970 1548101 1547133 gene locus_tag LOCUS_13980 gene coxB 1548101 1547133 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028168.1 protein_id gnl|my_center|LOCUS_13980 1548371 1549774 gene locus_tag LOCUS_13990 1548371 1549774 CDS product cysteine desulfurase/sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028169.1 protein_id gnl|my_center|LOCUS_13990 1550756 1549782 gene locus_tag LOCUS_14000 1550756 1549782 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_14000 1550916 1551113 gene locus_tag LOCUS_14010 1550916 1551113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976656.1 protein_id gnl|my_center|LOCUS_14010 1551229 1552656 gene locus_tag LOCUS_14020 1551229 1552656 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028170.1 protein_id gnl|my_center|LOCUS_14020 1553092 1552736 gene locus_tag LOCUS_14030 1553092 1552736 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_14030 1553025 1553273 gene locus_tag LOCUS_14040 1553025 1553273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 1553327 1554523 gene locus_tag LOCUS_14050 gene nadA 1553327 1554523 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_14050 1555299 1554610 gene locus_tag LOCUS_14060 1555299 1554610 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976651.1 protein_id gnl|my_center|LOCUS_14060 1556588 1555296 gene locus_tag LOCUS_14070 1556588 1555296 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976650.1 protein_id gnl|my_center|LOCUS_14070 1556984 1556706 gene locus_tag LOCUS_14080 1556984 1556706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976649.1 protein_id gnl|my_center|LOCUS_14080 1557789 1556995 gene locus_tag LOCUS_14090 1557789 1556995 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_14090 1558074 1558673 gene locus_tag LOCUS_14100 1558074 1558673 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028173.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14100 1558712 1559464 gene locus_tag LOCUS_14110 1558712 1559464 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028174.1 protein_id gnl|my_center|LOCUS_14110 1559568 1560647 gene locus_tag LOCUS_14120 1559568 1560647 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028175.1 protein_id gnl|my_center|LOCUS_14120 1561024 1560815 gene locus_tag LOCUS_14130 1561024 1560815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976644.1 protein_id gnl|my_center|LOCUS_14130 1561111 1562313 gene locus_tag LOCUS_14140 1561111 1562313 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869456.1 protein_id gnl|my_center|LOCUS_14140 1562457 1563572 gene locus_tag LOCUS_14150 gene cobT 1562457 1563572 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028178.1 protein_id gnl|my_center|LOCUS_14150 1564198 1563980 gene locus_tag LOCUS_14160 1564198 1563980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14160 1564178 1564954 gene locus_tag LOCUS_14170 1564178 1564954 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028180.1 protein_id gnl|my_center|LOCUS_14170 1565806 1564967 gene locus_tag LOCUS_14180 1565806 1564967 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028181.1 protein_id gnl|my_center|LOCUS_14180 1566032 1567585 gene locus_tag LOCUS_14190 1566032 1567585 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_14190 1567901 1569289 gene locus_tag LOCUS_14200 gene lpdA 1567901 1569289 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873385.1 protein_id gnl|my_center|LOCUS_14200 1569350 1571221 gene locus_tag LOCUS_14210 1569350 1571221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14210 1571370 1571993 gene locus_tag LOCUS_14220 1571370 1571993 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976633.1 protein_id gnl|my_center|LOCUS_14220 1572252 1574921 gene locus_tag LOCUS_14230 gene aceE 1572252 1574921 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976632.1 protein_id gnl|my_center|LOCUS_14230 1575029 1576000 gene locus_tag LOCUS_14240 1575029 1576000 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976631.1 protein_id gnl|my_center|LOCUS_14240 1576062 1576583 gene locus_tag LOCUS_14250 1576062 1576583 CDS product DUF4240 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870944.1 protein_id gnl|my_center|LOCUS_14250 1577276 1576650 gene locus_tag LOCUS_14260 1577276 1576650 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667418.1 protein_id gnl|my_center|LOCUS_14260 1577275 1578174 gene locus_tag LOCUS_14270 1577275 1578174 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_14270 1578326 1579645 gene locus_tag LOCUS_14280 1578326 1579645 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028190.1 protein_id gnl|my_center|LOCUS_14280 1581335 1579683 gene locus_tag LOCUS_14290 1581335 1579683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1581603 1582418 gene locus_tag LOCUS_14300 gene lipB 1581603 1582418 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976622.1 protein_id gnl|my_center|LOCUS_14300 1582532 1583512 gene locus_tag LOCUS_14310 gene lipA 1582532 1583512 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976621.1 protein_id gnl|my_center|LOCUS_14310 1583786 1583986 gene locus_tag LOCUS_14320 1583786 1583986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028192.1 protein_id gnl|my_center|LOCUS_14320 1584006 1584713 gene locus_tag LOCUS_14330 1584006 1584713 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_14330 1585377 1584856 gene locus_tag LOCUS_14340 1585377 1584856 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976618.1 protein_id gnl|my_center|LOCUS_14340 1585546 1586955 gene locus_tag LOCUS_14350 gene glnA 1585546 1586955 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976617.1 protein_id gnl|my_center|LOCUS_14350 1588068 1586986 gene locus_tag LOCUS_14360 1588068 1586986 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_14360 1588570 1588052 gene locus_tag LOCUS_14370 1588570 1588052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1588698 1588892 gene locus_tag LOCUS_14380 1588698 1588892 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227709.1 protein_id gnl|my_center|LOCUS_14380 1588889 1589440 gene locus_tag LOCUS_14390 1588889 1589440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 1589437 1590789 gene locus_tag LOCUS_14400 1589437 1590789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1590807 1591055 gene locus_tag LOCUS_14410 1590807 1591055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1591036 1591263 gene locus_tag LOCUS_14420 1591036 1591263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1591440 1592768 gene locus_tag LOCUS_14430 1591440 1592768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1592765 1592992 gene locus_tag LOCUS_14440 1592765 1592992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1593441 1593644 gene locus_tag LOCUS_14450 1593441 1593644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 1593647 1594183 gene locus_tag LOCUS_14460 1593647 1594183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1594180 1595022 gene locus_tag LOCUS_14470 1594180 1595022 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028635.1 protein_id gnl|my_center|LOCUS_14470 1595110 1595292 gene locus_tag LOCUS_14480 1595110 1595292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1595770 1595525 gene locus_tag LOCUS_14490 1595770 1595525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 1596132 1595767 gene locus_tag LOCUS_14500 1596132 1595767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1596683 1596129 gene locus_tag LOCUS_14510 1596683 1596129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1597170 1598615 gene locus_tag LOCUS_14520 1597170 1598615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1598826 1600031 gene locus_tag LOCUS_14530 1598826 1600031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 1600419 1600138 gene locus_tag LOCUS_14540 1600419 1600138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976610.1 protein_id gnl|my_center|LOCUS_14540 1600552 1600911 gene locus_tag LOCUS_14550 1600552 1600911 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223911.1 protein_id gnl|my_center|LOCUS_14550 1601433 1600927 gene locus_tag LOCUS_14560 1601433 1600927 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229298.1 protein_id gnl|my_center|LOCUS_14560 1601481 1602887 gene locus_tag LOCUS_14570 1601481 1602887 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229297.1 protein_id gnl|my_center|LOCUS_14570 1603896 1602937 gene locus_tag LOCUS_14580 1603896 1602937 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129251257.1 protein_id gnl|my_center|LOCUS_14580 1604102 1605136 gene locus_tag LOCUS_14590 1604102 1605136 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028199.1 protein_id gnl|my_center|LOCUS_14590 1605458 1605988 gene locus_tag LOCUS_14600 1605458 1605988 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028201.1 protein_id gnl|my_center|LOCUS_14600 1606614 1606141 gene locus_tag LOCUS_14610 1606614 1606141 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224025.1 protein_id gnl|my_center|LOCUS_14610 1606772 1608700 gene locus_tag LOCUS_14620 1606772 1608700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028207.1 protein_id gnl|my_center|LOCUS_14620 1608940 1609653 gene locus_tag LOCUS_14630 1608940 1609653 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976592.1 protein_id gnl|my_center|LOCUS_14630 1610017 1609667 gene locus_tag LOCUS_14640 1610017 1609667 CDS product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976590.1 protein_id gnl|my_center|LOCUS_14640 1615472 1610154 gene locus_tag LOCUS_14650 gene pulA 1615472 1610154 CDS product pullulanase-type alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486784.1 protein_id gnl|my_center|LOCUS_14650 1617291 1615576 gene locus_tag LOCUS_14660 1617291 1615576 CDS product carbohydrate-binding module family 20 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486988.1 protein_id gnl|my_center|LOCUS_14660 1618756 1617710 gene locus_tag LOCUS_14670 1618756 1617710 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_14670 1620429 1618753 gene locus_tag LOCUS_14680 1620429 1618753 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_14680 1621409 1620531 gene locus_tag LOCUS_14690 1621409 1620531 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_14690 1622422 1621406 gene locus_tag LOCUS_14700 1622422 1621406 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976584.1 protein_id gnl|my_center|LOCUS_14700 1623715 1622444 gene locus_tag LOCUS_14710 1623715 1622444 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976583.1 protein_id gnl|my_center|LOCUS_14710 1623967 1625130 gene locus_tag LOCUS_14720 1623967 1625130 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_14720 1625207 1626118 gene locus_tag LOCUS_14730 1625207 1626118 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028214.1 protein_id gnl|my_center|LOCUS_14730 1629206 1626207 gene locus_tag LOCUS_14740 1629206 1626207 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_14740 1630128 1629337 gene locus_tag LOCUS_14750 1630128 1629337 CDS product putative protein N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031408.1 protein_id gnl|my_center|LOCUS_14750 1631873 1630335 gene locus_tag LOCUS_14760 1631873 1630335 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227193.1 protein_id gnl|my_center|LOCUS_14760 1631997 1632587 gene locus_tag LOCUS_14770 1631997 1632587 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027253.1 protein_id gnl|my_center|LOCUS_14770 1632621 1632944 gene locus_tag LOCUS_14780 1632621 1632944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1632941 1633627 gene locus_tag LOCUS_14790 1632941 1633627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1634996 1633635 gene locus_tag LOCUS_14800 gene glnA 1634996 1633635 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_14800 1635250 1635927 gene locus_tag LOCUS_14810 1635250 1635927 CDS product DUF3105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028218.1 protein_id gnl|my_center|LOCUS_14810 1635927 1636769 gene locus_tag LOCUS_14820 1635927 1636769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1636890 1637315 gene locus_tag LOCUS_14830 gene hrp1 1636890 1637315 CDS product hypoxic response protein Hrp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413598.1 protein_id gnl|my_center|LOCUS_14830 1638756 1637524 gene locus_tag LOCUS_14840 1638756 1637524 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028228.1 protein_id gnl|my_center|LOCUS_14840 1639930 1638908 gene locus_tag LOCUS_14850 1639930 1638908 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226238.1 protein_id gnl|my_center|LOCUS_14850 1640262 1641146 gene locus_tag LOCUS_14860 gene panB 1640262 1641146 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976556.1 protein_id gnl|my_center|LOCUS_14860 1641277 1642290 gene locus_tag LOCUS_14870 1641277 1642290 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976555.1 protein_id gnl|my_center|LOCUS_14870 1642287 1643135 gene locus_tag LOCUS_14880 1642287 1643135 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976554.1 protein_id gnl|my_center|LOCUS_14880 1646618 1643229 gene locus_tag LOCUS_14890 1646618 1643229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14890 1646765 1647586 gene locus_tag LOCUS_14900 1646765 1647586 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976552.1 protein_id gnl|my_center|LOCUS_14900 1647765 1647583 gene locus_tag LOCUS_14910 1647765 1647583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326075.1 protein_id gnl|my_center|LOCUS_14910 1648617 1647907 gene locus_tag LOCUS_14920 gene npdG 1648617 1647907 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_14920 1648759 1649361 gene locus_tag LOCUS_14930 1648759 1649361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028233.1 protein_id gnl|my_center|LOCUS_14930 1649405 1650703 gene locus_tag LOCUS_14940 1649405 1650703 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030908.1 protein_id gnl|my_center|LOCUS_14940 1650974 1650744 gene locus_tag LOCUS_14950 1650974 1650744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976547.1 protein_id gnl|my_center|LOCUS_14950 1651032 1651889 gene locus_tag LOCUS_14960 gene map 1651032 1651889 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_14960 1651953 1652222 gene locus_tag LOCUS_14970 1651953 1652222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1652933 1652238 gene locus_tag LOCUS_14980 1652933 1652238 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028237.1 protein_id gnl|my_center|LOCUS_14980 1653063 1654043 gene locus_tag LOCUS_14990 1653063 1654043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270025.1 protein_id gnl|my_center|LOCUS_14990 1654801 1654055 gene locus_tag LOCUS_15000 1654801 1654055 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976534.1 protein_id gnl|my_center|LOCUS_15000 1655555 1654941 gene locus_tag LOCUS_15010 1655555 1654941 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976533.1 protein_id gnl|my_center|LOCUS_15010 1655737 1656606 gene locus_tag LOCUS_15020 1655737 1656606 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222475.1 protein_id gnl|my_center|LOCUS_15020 1657668 1656595 gene locus_tag LOCUS_15030 1657668 1656595 CDS product small ribosomal subunit Rsm22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028248.1 protein_id gnl|my_center|LOCUS_15030 1657759 1659054 gene locus_tag LOCUS_15040 1657759 1659054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1660384 1659071 gene locus_tag LOCUS_15050 1660384 1659071 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028249.1 protein_id gnl|my_center|LOCUS_15050 1660541 1661470 gene locus_tag LOCUS_15060 1660541 1661470 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_15060 1663152 1661494 gene locus_tag LOCUS_15070 1663152 1661494 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028251.1 protein_id gnl|my_center|LOCUS_15070 1663294 1664049 gene locus_tag LOCUS_15080 1663294 1664049 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028252.1 protein_id gnl|my_center|LOCUS_15080 1664116 1664997 gene locus_tag LOCUS_15090 1664116 1664997 CDS product PhzF family phenazine biosynthesis isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668695.1 protein_id gnl|my_center|LOCUS_15090 1665671 1665045 gene locus_tag LOCUS_15100 1665671 1665045 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030557.1 protein_id gnl|my_center|LOCUS_15100 1665776 1667233 gene locus_tag LOCUS_15110 1665776 1667233 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030556.1 protein_id gnl|my_center|LOCUS_15110 1667307 1667888 gene locus_tag LOCUS_15120 1667307 1667888 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888435.1 protein_id gnl|my_center|LOCUS_15120 1667904 1668134 gene locus_tag LOCUS_15130 1667904 1668134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1669251 1668232 gene locus_tag LOCUS_15140 1669251 1668232 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014237.1 protein_id gnl|my_center|LOCUS_15140 1670198 1669302 gene locus_tag LOCUS_15150 1670198 1669302 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 protein_id gnl|my_center|LOCUS_15150 1671273 1670200 gene locus_tag LOCUS_15160 1671273 1670200 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455028.1 protein_id gnl|my_center|LOCUS_15160 1672346 1671270 gene locus_tag LOCUS_15170 1672346 1671270 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 protein_id gnl|my_center|LOCUS_15170 1672690 1672343 gene locus_tag LOCUS_15180 1672690 1672343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1672819 1673169 gene locus_tag LOCUS_15190 1672819 1673169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1673166 1673738 gene locus_tag LOCUS_15200 1673166 1673738 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813668.1 protein_id gnl|my_center|LOCUS_15200 1674331 1673843 gene locus_tag LOCUS_15210 gene tsaA 1674331 1673843 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762181.1 protein_id gnl|my_center|LOCUS_15210 1675149 1675898 gene locus_tag LOCUS_15220 1675149 1675898 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028258.1 protein_id gnl|my_center|LOCUS_15220 1675895 1676752 gene locus_tag LOCUS_15230 1675895 1676752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1677010 1677810 gene locus_tag LOCUS_15240 gene yaaA 1677010 1677810 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_15240 1677871 1678509 gene locus_tag LOCUS_15250 gene eda 1677871 1678509 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_15250 1679787 1678525 gene locus_tag LOCUS_15260 1679787 1678525 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223079.1 protein_id gnl|my_center|LOCUS_15260 1680605 1679787 gene locus_tag LOCUS_15270 1680605 1679787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1681363 1680527 gene locus_tag LOCUS_15280 1681363 1680527 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_15280 1681690 1683033 gene locus_tag LOCUS_15290 1681690 1683033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107098776.1 protein_id gnl|my_center|LOCUS_15290 1684468 1683041 gene locus_tag LOCUS_15300 1684468 1683041 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976504.1 protein_id gnl|my_center|LOCUS_15300 1684493 1684732 gene locus_tag LOCUS_15310 1684493 1684732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1684752 1685447 gene locus_tag LOCUS_15320 1684752 1685447 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976501.1 protein_id gnl|my_center|LOCUS_15320 1685470 1686330 gene locus_tag LOCUS_15330 1685470 1686330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1686506 1687366 gene locus_tag LOCUS_15340 1686506 1687366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1687509 1687748 gene locus_tag LOCUS_15350 1687509 1687748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976498.1 protein_id gnl|my_center|LOCUS_15350 1688868 1687795 gene locus_tag LOCUS_15360 1688868 1687795 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028275.1 protein_id gnl|my_center|LOCUS_15360 1689605 1688865 gene locus_tag LOCUS_15370 1689605 1688865 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_15370 1690965 1689655 gene locus_tag LOCUS_15380 1690965 1689655 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_15380 1691194 1691814 gene locus_tag LOCUS_15390 1691194 1691814 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976494.1 protein_id gnl|my_center|LOCUS_15390 1691953 1693188 gene locus_tag LOCUS_15400 1691953 1693188 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259470.1 protein_id gnl|my_center|LOCUS_15400 1693192 1693983 gene locus_tag LOCUS_15410 1693192 1693983 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083708.1 protein_id gnl|my_center|LOCUS_15410 1693980 1694756 gene locus_tag LOCUS_15420 1693980 1694756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259472.1 protein_id gnl|my_center|LOCUS_15420 1694756 1695643 gene locus_tag LOCUS_15430 1694756 1695643 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083706.1 protein_id gnl|my_center|LOCUS_15430 1695640 1696776 gene locus_tag LOCUS_15440 1695640 1696776 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259474.1 protein_id gnl|my_center|LOCUS_15440 1696773 1697660 gene locus_tag LOCUS_15450 1696773 1697660 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_15450 1699694 1697694 gene locus_tag LOCUS_15460 1699694 1697694 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227746.1 protein_id gnl|my_center|LOCUS_15460 1700625 1699807 gene locus_tag LOCUS_15470 1700625 1699807 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227748.1 protein_id gnl|my_center|LOCUS_15470 1700900 1702384 gene locus_tag LOCUS_15480 1700900 1702384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 1702842 1702354 gene locus_tag LOCUS_15490 1702842 1702354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1703364 1704620 gene locus_tag LOCUS_15500 1703364 1704620 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976492.1 protein_id gnl|my_center|LOCUS_15500 1704617 1705303 gene locus_tag LOCUS_15510 1704617 1705303 CDS product SCO2322 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028279.1 protein_id gnl|my_center|LOCUS_15510 1705300 1706445 gene locus_tag LOCUS_15520 1705300 1706445 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028280.1 protein_id gnl|my_center|LOCUS_15520 1706442 1708202 gene locus_tag LOCUS_15530 1706442 1708202 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028281.1 protein_id gnl|my_center|LOCUS_15530 1708199 1709029 gene locus_tag LOCUS_15540 1708199 1709029 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028282.1 protein_id gnl|my_center|LOCUS_15540 1711298 1709148 gene locus_tag LOCUS_15550 1711298 1709148 CDS product bifunctional glycosyltransferase 87/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270029.1 protein_id gnl|my_center|LOCUS_15550 1713515 1711473 gene locus_tag LOCUS_15560 1713515 1711473 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028294.1 protein_id gnl|my_center|LOCUS_15560 1713654 1714688 gene locus_tag LOCUS_15570 1713654 1714688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1714694 1715533 gene locus_tag LOCUS_15580 1714694 1715533 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028296.1 protein_id gnl|my_center|LOCUS_15580 1716357 1715593 gene locus_tag LOCUS_15590 1716357 1715593 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227890.1 protein_id gnl|my_center|LOCUS_15590 1716582 1717226 gene locus_tag LOCUS_15600 1716582 1717226 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976456.1 protein_id gnl|my_center|LOCUS_15600 1717353 1719038 gene locus_tag LOCUS_15610 1717353 1719038 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028298.1 protein_id gnl|my_center|LOCUS_15610 1719158 1719601 gene locus_tag LOCUS_15620 1719158 1719601 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976454.1 protein_id gnl|my_center|LOCUS_15620 1720436 1719705 gene locus_tag LOCUS_15630 1720436 1719705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1720520 1721176 gene locus_tag LOCUS_15640 1720520 1721176 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976453.1 protein_id gnl|my_center|LOCUS_15640 1721529 1721203 gene locus_tag LOCUS_15650 1721529 1721203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1722082 1721645 gene locus_tag LOCUS_15660 1722082 1721645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973057.1 protein_id gnl|my_center|LOCUS_15660 1722505 1722290 gene locus_tag LOCUS_15670 1722505 1722290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1723090 1722944 gene locus_tag LOCUS_15680 1723090 1722944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1723883 1723284 gene locus_tag LOCUS_15690 1723883 1723284 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093863.1 protein_id gnl|my_center|LOCUS_15690 1724055 1725416 gene locus_tag LOCUS_15700 1724055 1725416 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976304.1 protein_id gnl|my_center|LOCUS_15700 1725784 1725443 gene locus_tag LOCUS_15710 1725784 1725443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1725824 1726264 gene locus_tag LOCUS_15720 1725824 1726264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1727625 1726507 gene locus_tag LOCUS_15730 1727625 1726507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 1727830 1727663 gene locus_tag LOCUS_15740 1727830 1727663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1728206 1729198 gene locus_tag LOCUS_15750 1728206 1729198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1730480 1730274 gene locus_tag LOCUS_15760 1730480 1730274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 1731315 1730659 gene locus_tag LOCUS_15770 1731315 1730659 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029778.1 protein_id gnl|my_center|LOCUS_15770 1732103 1731312 gene locus_tag LOCUS_15780 1732103 1731312 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029777.1 protein_id gnl|my_center|LOCUS_15780 1732262 1732594 gene locus_tag LOCUS_15790 1732262 1732594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028865.1 protein_id gnl|my_center|LOCUS_15790 1732597 1733946 gene locus_tag LOCUS_15800 1732597 1733946 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193449360.1 protein_id gnl|my_center|LOCUS_15800 1734034 1734231 gene locus_tag LOCUS_15810 1734034 1734231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 1734311 1734997 gene locus_tag LOCUS_15820 1734311 1734997 CDS product DUF2637 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028863.1 protein_id gnl|my_center|LOCUS_15820 1735018 1735206 gene locus_tag LOCUS_15830 1735018 1735206 CDS product mobile element transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226027129.1 protein_id gnl|my_center|LOCUS_15830 1735221 1735562 gene locus_tag LOCUS_15840 1735221 1735562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030193.1 protein_id gnl|my_center|LOCUS_15840 1735654 1735836 gene locus_tag LOCUS_15850 1735654 1735836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030195.1 protein_id gnl|my_center|LOCUS_15850 1735842 1736042 gene locus_tag LOCUS_15860 1735842 1736042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 1736039 1736857 gene locus_tag LOCUS_15870 1736039 1736857 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227943.1 protein_id gnl|my_center|LOCUS_15870 1736854 1738266 gene locus_tag LOCUS_15880 gene repSA 1736854 1738266 CDS product replication initiator protein RepSA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030196.1 protein_id gnl|my_center|LOCUS_15880 1738263 1738451 gene locus_tag LOCUS_15890 1738263 1738451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1738451 1739608 gene locus_tag LOCUS_15900 1738451 1739608 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028858.1 protein_id gnl|my_center|LOCUS_15900 1739751 1739677 gene locus_tag LOCUS_t00130 1739751 1739677 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1739960 1740736 gene locus_tag LOCUS_15910 1739960 1740736 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976449.1 protein_id gnl|my_center|LOCUS_15910 1740807 1742198 gene locus_tag LOCUS_15920 1740807 1742198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028302.1 protein_id gnl|my_center|LOCUS_15920 1742407 1742991 gene locus_tag LOCUS_15930 1742407 1742991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1743164 1743424 gene locus_tag LOCUS_15940 1743164 1743424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1744308 1743454 gene locus_tag LOCUS_15950 1744308 1743454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028306.1 protein_id gnl|my_center|LOCUS_15950 1746761 1744305 gene locus_tag LOCUS_15960 1746761 1744305 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028307.1 protein_id gnl|my_center|LOCUS_15960 1747967 1746807 gene locus_tag LOCUS_15970 1747967 1746807 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 protein_id gnl|my_center|LOCUS_15970 1748197 1749054 gene locus_tag LOCUS_15980 1748197 1749054 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976440.1 protein_id gnl|my_center|LOCUS_15980 1749823 1749089 gene locus_tag LOCUS_15990 1749823 1749089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976439.1 protein_id gnl|my_center|LOCUS_15990 1751147 1749996 gene locus_tag LOCUS_16000 1751147 1749996 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028309.1 protein_id gnl|my_center|LOCUS_16000 1751788 1751213 gene locus_tag LOCUS_16010 1751788 1751213 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976437.1 protein_id gnl|my_center|LOCUS_16010 1752444 1751869 gene locus_tag LOCUS_16020 1752444 1751869 CDS product calcium homeostasis/redox stress adaptation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 protein_id gnl|my_center|LOCUS_16020 1753066 1752608 gene locus_tag LOCUS_16030 1753066 1752608 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 protein_id gnl|my_center|LOCUS_16030 1753647 1753210 gene locus_tag LOCUS_16040 1753647 1753210 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202437260.1 protein_id gnl|my_center|LOCUS_16040 1754129 1756870 gene locus_tag LOCUS_16050 gene aceE 1754129 1756870 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976432.1 protein_id gnl|my_center|LOCUS_16050 1757308 1756946 gene locus_tag LOCUS_16060 1757308 1756946 CDS product peptidase inhibitor family I36 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228604.1 protein_id gnl|my_center|LOCUS_16060 1757661 1757894 gene locus_tag LOCUS_16070 1757661 1757894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1757980 1758927 gene locus_tag LOCUS_16080 1757980 1758927 CDS product DUF4429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976427.1 protein_id gnl|my_center|LOCUS_16080 1760027 1759011 gene locus_tag LOCUS_16090 1760027 1759011 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028313.1 protein_id gnl|my_center|LOCUS_16090 1760497 1760027 gene locus_tag LOCUS_16100 1760497 1760027 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326123.1 protein_id gnl|my_center|LOCUS_16100 1760541 1761383 gene locus_tag LOCUS_16110 1760541 1761383 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028315.1 protein_id gnl|my_center|LOCUS_16110 1762064 1761396 gene locus_tag LOCUS_16120 1762064 1761396 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028320.1 protein_id gnl|my_center|LOCUS_16120 1762131 1763336 gene locus_tag LOCUS_16130 gene fasR 1762131 1763336 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_16130 1763426 1764364 gene locus_tag LOCUS_16140 1763426 1764364 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_16140 1764378 1765379 gene locus_tag LOCUS_16150 1764378 1765379 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976418.1 protein_id gnl|my_center|LOCUS_16150 1765441 1765689 gene locus_tag LOCUS_16160 1765441 1765689 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976417.1 protein_id gnl|my_center|LOCUS_16160 1765769 1767031 gene locus_tag LOCUS_16170 1765769 1767031 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_16170 1767634 1767164 gene locus_tag LOCUS_16180 1767634 1767164 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_16180 1768051 1768968 gene locus_tag LOCUS_16190 1768051 1768968 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976414.1 protein_id gnl|my_center|LOCUS_16190 1768979 1770001 gene locus_tag LOCUS_16200 1768979 1770001 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028324.1 protein_id gnl|my_center|LOCUS_16200 1772534 1770060 gene locus_tag LOCUS_16210 1772534 1770060 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156722191.1 protein_id gnl|my_center|LOCUS_16210 1772712 1773314 gene locus_tag LOCUS_16220 1772712 1773314 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230338.1 protein_id gnl|my_center|LOCUS_16220 1773900 1773292 gene locus_tag LOCUS_16230 1773900 1773292 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114008.1 protein_id gnl|my_center|LOCUS_16230 1774705 1773914 gene locus_tag LOCUS_16240 1774705 1773914 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028326.1 protein_id gnl|my_center|LOCUS_16240 1774817 1775971 gene locus_tag LOCUS_16250 1774817 1775971 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_16250 1775968 1776987 gene locus_tag LOCUS_16260 1775968 1776987 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976404.1 protein_id gnl|my_center|LOCUS_16260 1777106 1778107 gene locus_tag LOCUS_16270 1777106 1778107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028332.1 protein_id gnl|my_center|LOCUS_16270 1778123 1779226 gene locus_tag LOCUS_16280 gene chvE 1778123 1779226 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976402.1 protein_id gnl|my_center|LOCUS_16280 1779223 1780785 gene locus_tag LOCUS_16290 gene gguA 1779223 1780785 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976401.1 protein_id gnl|my_center|LOCUS_16290 1780793 1782019 gene locus_tag LOCUS_16300 gene gguB 1780793 1782019 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976400.1 protein_id gnl|my_center|LOCUS_16300 1782513 1782085 gene locus_tag LOCUS_16310 1782513 1782085 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976410.1 protein_id gnl|my_center|LOCUS_16310 1783631 1782612 gene locus_tag LOCUS_16320 1783631 1782612 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976409.1 protein_id gnl|my_center|LOCUS_16320 1783743 1784180 gene locus_tag LOCUS_16330 1783743 1784180 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028328.1 protein_id gnl|my_center|LOCUS_16330 1785030 1784206 gene locus_tag LOCUS_16340 1785030 1784206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028330.1 protein_id gnl|my_center|LOCUS_16340 1785175 1785741 gene locus_tag LOCUS_16350 1785175 1785741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976365.1 protein_id gnl|my_center|LOCUS_16350 1785873 1786910 gene locus_tag LOCUS_16360 1785873 1786910 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976353.1 protein_id gnl|my_center|LOCUS_16360 1786937 1788598 gene locus_tag LOCUS_16370 1786937 1788598 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029333.1 protein_id gnl|my_center|LOCUS_16370 1789007 1788576 gene locus_tag LOCUS_16380 1789007 1788576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1789167 1790378 gene locus_tag LOCUS_16390 1789167 1790378 CDS product NarK/NasA family nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026930.1 protein_id gnl|my_center|LOCUS_16390 1790437 1791900 gene locus_tag LOCUS_16400 1790437 1791900 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028356.1 protein_id gnl|my_center|LOCUS_16400 1792020 1792817 gene locus_tag LOCUS_16410 1792020 1792817 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031563.1 protein_id gnl|my_center|LOCUS_16410 1793465 1792932 gene locus_tag LOCUS_16420 1793465 1792932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1793509 1794729 gene locus_tag LOCUS_16430 1793509 1794729 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031879.1 protein_id gnl|my_center|LOCUS_16430 1794933 1796597 gene locus_tag LOCUS_16440 1794933 1796597 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850187.1 protein_id gnl|my_center|LOCUS_16440 1796594 1797676 gene locus_tag LOCUS_16450 1796594 1797676 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031881.1 protein_id gnl|my_center|LOCUS_16450 1797673 1798023 gene locus_tag LOCUS_16460 1797673 1798023 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897958.1 protein_id gnl|my_center|LOCUS_16460 1798951 1798070 gene locus_tag LOCUS_16470 1798951 1798070 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228493.1 protein_id gnl|my_center|LOCUS_16470 1799405 1800838 gene locus_tag LOCUS_16480 1799405 1800838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1800948 1801466 gene locus_tag LOCUS_16490 1800948 1801466 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971855.1 protein_id gnl|my_center|LOCUS_16490 1803987 1801516 gene locus_tag LOCUS_16500 1803987 1801516 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031588.1 protein_id gnl|my_center|LOCUS_16500 1808381 1804074 gene locus_tag LOCUS_16510 1808381 1804074 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226365.1 protein_id gnl|my_center|LOCUS_16510 1809497 1808520 gene locus_tag LOCUS_16520 1809497 1808520 CDS product anti-sigma factor RsbA family regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027235.1 protein_id gnl|my_center|LOCUS_16520 1809715 1809957 gene locus_tag LOCUS_16530 1809715 1809957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1810059 1810766 gene locus_tag LOCUS_16540 1810059 1810766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1811150 1810812 gene locus_tag LOCUS_16550 1811150 1810812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1811269 1811664 gene locus_tag LOCUS_16560 1811269 1811664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1812070 1811741 gene locus_tag LOCUS_16570 1812070 1811741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1812863 1812090 gene locus_tag LOCUS_16580 1812863 1812090 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225296.1 protein_id gnl|my_center|LOCUS_16580 1813065 1814603 gene locus_tag LOCUS_16590 1813065 1814603 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083889.1 protein_id gnl|my_center|LOCUS_16590 1815316 1814630 gene locus_tag LOCUS_16600 1815316 1814630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 1816132 1817388 gene locus_tag LOCUS_16610 1816132 1817388 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897679.1 protein_id gnl|my_center|LOCUS_16610 1817415 1818725 gene locus_tag LOCUS_16620 1817415 1818725 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_16620 1819004 1819918 gene locus_tag LOCUS_16630 1819004 1819918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_16630 1820072 1820545 gene locus_tag LOCUS_16640 1820072 1820545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1821395 1820763 gene locus_tag LOCUS_16650 1821395 1820763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1823567 1822344 gene locus_tag LOCUS_16660 1823567 1822344 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030513.1 protein_id gnl|my_center|LOCUS_16660 1823821 1823564 gene locus_tag LOCUS_16670 1823821 1823564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 1824911 1823916 gene locus_tag LOCUS_16680 1824911 1823916 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225858.1 protein_id gnl|my_center|LOCUS_16680 1825006 1825947 gene locus_tag LOCUS_16690 1825006 1825947 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030161.1 protein_id gnl|my_center|LOCUS_16690 1826425 1826180 gene locus_tag LOCUS_16700 1826425 1826180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1827417 1826449 gene locus_tag LOCUS_16710 1827417 1826449 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222216.1 protein_id gnl|my_center|LOCUS_16710 1829845 1828223 gene locus_tag LOCUS_16720 1829845 1828223 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977553.1 protein_id gnl|my_center|LOCUS_16720 1830171 1829764 gene locus_tag LOCUS_16730 1830171 1829764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1830202 1830369 gene locus_tag LOCUS_16740 1830202 1830369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1830729 1830418 gene locus_tag LOCUS_16750 1830729 1830418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1831796 1830726 gene locus_tag LOCUS_16760 1831796 1830726 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275143.1 protein_id gnl|my_center|LOCUS_16760 1833487 1831793 gene locus_tag LOCUS_16770 gene oleC 1833487 1831793 CDS product olefin beta-lactone synthetase OleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035474.1 protein_id gnl|my_center|LOCUS_16770 1834494 1833481 gene locus_tag LOCUS_16780 1834494 1833481 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225858.1 protein_id gnl|my_center|LOCUS_16780 1835525 1834512 gene locus_tag LOCUS_16790 1835525 1834512 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259370.1 protein_id gnl|my_center|LOCUS_16790 1836287 1836544 gene locus_tag LOCUS_16800 1836287 1836544 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978314.1 protein_id gnl|my_center|LOCUS_16800 1836588 1837862 gene locus_tag LOCUS_16810 1836588 1837862 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027195.1 protein_id gnl|my_center|LOCUS_16810 1837949 1838920 gene locus_tag LOCUS_16820 1837949 1838920 CDS product acyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978316.1 protein_id gnl|my_center|LOCUS_16820 1840601 1839609 gene locus_tag LOCUS_16830 1840601 1839609 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027638.1 protein_id gnl|my_center|LOCUS_16830 1840927 1842015 gene locus_tag LOCUS_16840 1840927 1842015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1842025 1843395 gene locus_tag LOCUS_16850 1842025 1843395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1843371 1844024 gene locus_tag LOCUS_16860 1843371 1844024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 1844531 1844301 gene locus_tag LOCUS_16870 1844531 1844301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 1845025 1846032 gene locus_tag LOCUS_16880 1845025 1846032 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 protein_id gnl|my_center|LOCUS_16880 1846157 1847512 gene locus_tag LOCUS_16890 1846157 1847512 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228682.1 protein_id gnl|my_center|LOCUS_16890 1847514 1848467 gene locus_tag LOCUS_16900 1847514 1848467 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_16900 1848478 1849365 gene locus_tag LOCUS_16910 1848478 1849365 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228684.1 protein_id gnl|my_center|LOCUS_16910 1849582 1852146 gene locus_tag LOCUS_16920 1849582 1852146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1852239 1853858 gene locus_tag LOCUS_16930 1852239 1853858 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972134.1 protein_id gnl|my_center|LOCUS_16930 1855470 1854076 gene locus_tag LOCUS_16940 1855470 1854076 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038534689.1 protein_id gnl|my_center|LOCUS_16940 1855723 1856967 gene locus_tag LOCUS_16950 1855723 1856967 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849057.1 protein_id gnl|my_center|LOCUS_16950 1856973 1857449 gene locus_tag LOCUS_16960 1856973 1857449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159394617.1 protein_id gnl|my_center|LOCUS_16960 1857467 1857907 gene locus_tag LOCUS_16970 1857467 1857907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 1858791 1858114 gene locus_tag LOCUS_16980 1858791 1858114 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870668.1 protein_id gnl|my_center|LOCUS_16980 1859492 1858788 gene locus_tag LOCUS_16990 1859492 1858788 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029202.1 protein_id gnl|my_center|LOCUS_16990 1859740 1860504 gene locus_tag LOCUS_17000 1859740 1860504 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_17000 1860501 1861607 gene locus_tag LOCUS_17010 1860501 1861607 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029200.1 protein_id gnl|my_center|LOCUS_17010 1862687 1861611 gene locus_tag LOCUS_17020 1862687 1861611 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029199.1 protein_id gnl|my_center|LOCUS_17020 1862954 1863241 gene locus_tag LOCUS_17030 1862954 1863241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 1863291 1863452 gene locus_tag LOCUS_17040 1863291 1863452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 1864134 1863622 gene locus_tag LOCUS_17050 1864134 1863622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 1864439 1864131 gene locus_tag LOCUS_17060 1864439 1864131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1865361 1864546 gene locus_tag LOCUS_17070 1865361 1864546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1866032 1865721 gene locus_tag LOCUS_17080 1866032 1865721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 1866193 1866390 gene locus_tag LOCUS_17090 1866193 1866390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1867336 1866419 gene locus_tag LOCUS_17100 1867336 1866419 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001363732.1 protein_id gnl|my_center|LOCUS_17100 1867515 1867333 gene locus_tag LOCUS_17110 1867515 1867333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1867640 1867461 gene locus_tag LOCUS_17120 1867640 1867461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1867760 1868113 gene locus_tag LOCUS_17130 1867760 1868113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1868398 1868162 gene locus_tag LOCUS_17140 1868398 1868162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1875209 1868481 gene locus_tag LOCUS_17150 1875209 1868481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1875551 1877815 gene locus_tag LOCUS_17160 1875551 1877815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 1878814 1878050 gene locus_tag LOCUS_17170 1878814 1878050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1880063 1880302 gene locus_tag LOCUS_17180 1880063 1880302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1880533 1880321 gene locus_tag LOCUS_17190 1880533 1880321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 1880718 1880530 gene locus_tag LOCUS_17200 1880718 1880530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 1880833 1882098 gene locus_tag LOCUS_17210 1880833 1882098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1882101 1882418 gene locus_tag LOCUS_17220 1882101 1882418 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972439.1 protein_id gnl|my_center|LOCUS_17220 1883118 1882480 gene locus_tag LOCUS_17230 1883118 1882480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 1883411 1883118 gene locus_tag LOCUS_17240 1883411 1883118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1883689 1883432 gene locus_tag LOCUS_17250 1883689 1883432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1884644 1883727 gene locus_tag LOCUS_17260 1884644 1883727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1884980 1884717 gene locus_tag LOCUS_17270 1884980 1884717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 1885445 1884984 gene locus_tag LOCUS_17280 1885445 1884984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 1888814 1885461 gene locus_tag LOCUS_17290 1888814 1885461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1890920 1888818 gene locus_tag LOCUS_17300 1890920 1888818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 1891208 1890927 gene locus_tag LOCUS_17310 1891208 1890927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1891636 1891232 gene locus_tag LOCUS_17320 1891636 1891232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1892062 1891649 gene locus_tag LOCUS_17330 1892062 1891649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1892531 1892115 gene locus_tag LOCUS_17340 1892531 1892115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1892911 1892528 gene locus_tag LOCUS_17350 1892911 1892528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1893075 1892911 gene locus_tag LOCUS_17360 1893075 1892911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 1893406 1893077 gene locus_tag LOCUS_17370 1893406 1893077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1893958 1893410 gene locus_tag LOCUS_17380 1893958 1893410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1894277 1893972 gene locus_tag LOCUS_17390 1894277 1893972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1895485 1894277 gene locus_tag LOCUS_17400 1895485 1894277 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975494.1 protein_id gnl|my_center|LOCUS_17400 1896281 1895541 gene locus_tag LOCUS_17410 1896281 1895541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 1898218 1896281 gene locus_tag LOCUS_17420 1898218 1896281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 1898385 1898218 gene locus_tag LOCUS_17430 1898385 1898218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 1900200 1898404 gene locus_tag LOCUS_17440 1900200 1898404 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443313.1 protein_id gnl|my_center|LOCUS_17440 1900627 1900166 gene locus_tag LOCUS_17450 1900627 1900166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1901567 1900797 gene locus_tag LOCUS_17460 1901567 1900797 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337212.1 protein_id gnl|my_center|LOCUS_17460 1901784 1901569 gene locus_tag LOCUS_17470 1901784 1901569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1902068 1901799 gene locus_tag LOCUS_17480 1902068 1901799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1902525 1902094 gene locus_tag LOCUS_17490 1902525 1902094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1902831 1902652 gene locus_tag LOCUS_17500 1902831 1902652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 1902865 1903122 gene locus_tag LOCUS_17510 1902865 1903122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 1903510 1903358 gene locus_tag LOCUS_17520 1903510 1903358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 1903649 1903512 gene locus_tag LOCUS_17530 1903649 1903512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1904339 1903740 gene locus_tag LOCUS_17540 1904339 1903740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1904848 1904336 gene locus_tag LOCUS_17550 1904848 1904336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 1905408 1904845 gene locus_tag LOCUS_17560 1905408 1904845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1906394 1905405 gene locus_tag LOCUS_17570 1906394 1905405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1906695 1906465 gene locus_tag LOCUS_17580 1906695 1906465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 1906988 1906695 gene locus_tag LOCUS_17590 1906988 1906695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1907308 1906988 gene locus_tag LOCUS_17600 1907308 1906988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1907560 1907390 gene locus_tag LOCUS_17610 1907560 1907390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 1907641 1907817 gene locus_tag LOCUS_17620 1907641 1907817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 1908439 1907762 gene locus_tag LOCUS_17630 1908439 1907762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 1908775 1908527 gene locus_tag LOCUS_17640 1908775 1908527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1908912 1908772 gene locus_tag LOCUS_17650 1908912 1908772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 1909882 1909037 gene locus_tag LOCUS_17660 1909882 1909037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 1910169 1909966 gene locus_tag LOCUS_17670 1910169 1909966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 1910580 1910272 gene locus_tag LOCUS_17680 1910580 1910272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 1912254 1910641 gene locus_tag LOCUS_17690 1912254 1910641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 1915270 1912616 gene locus_tag LOCUS_17700 1915270 1912616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 1915533 1915267 gene locus_tag LOCUS_17710 1915533 1915267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1915763 1915530 gene locus_tag LOCUS_17720 1915763 1915530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1916074 1915760 gene locus_tag LOCUS_17730 1916074 1915760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1916316 1916768 gene locus_tag LOCUS_17740 1916316 1916768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 1916867 1917367 gene locus_tag LOCUS_17750 1916867 1917367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 1917451 1919013 gene locus_tag LOCUS_17760 1917451 1919013 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183125562.1 protein_id gnl|my_center|LOCUS_17760 1919170 1919094 gene locus_tag LOCUS_t00140 1919170 1919094 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1919476 1919403 gene locus_tag LOCUS_t00150 1919476 1919403 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1919554 1919481 gene locus_tag LOCUS_t00160 1919554 1919481 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1919744 1920055 gene locus_tag LOCUS_17770 1919744 1920055 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326153.1 protein_id gnl|my_center|LOCUS_17770 1920133 1921578 gene locus_tag LOCUS_17780 1920133 1921578 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976342.1 protein_id gnl|my_center|LOCUS_17780 1921726 1923459 gene locus_tag LOCUS_17790 1921726 1923459 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067016493.1 protein_id gnl|my_center|LOCUS_17790 1923513 1925393 gene locus_tag LOCUS_17800 1923513 1925393 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976340.1 protein_id gnl|my_center|LOCUS_17800 1926502 1925414 gene locus_tag LOCUS_17810 1926502 1925414 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976339.1 protein_id gnl|my_center|LOCUS_17810 1928603 1926726 gene locus_tag LOCUS_17820 gene dnaG 1928603 1926726 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976336.1 protein_id gnl|my_center|LOCUS_17820 1930000 1928741 gene locus_tag LOCUS_17830 1930000 1928741 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976335.1 protein_id gnl|my_center|LOCUS_17830 1931569 1930259 gene locus_tag LOCUS_17840 1931569 1930259 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028369.1 protein_id gnl|my_center|LOCUS_17840 1932559 1931627 gene locus_tag LOCUS_17850 1932559 1931627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 1932820 1933428 gene locus_tag LOCUS_17860 1932820 1933428 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976332.1 protein_id gnl|my_center|LOCUS_17860 1934655 1933501 gene locus_tag LOCUS_17870 1934655 1933501 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228559.1 protein_id gnl|my_center|LOCUS_17870 1935599 1934652 gene locus_tag LOCUS_17880 gene tgmB 1935599 1934652 CDS product ATP-grasp ribosomal peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228560.1 protein_id gnl|my_center|LOCUS_17880 1935909 1935601 gene locus_tag LOCUS_17890 1935909 1935601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 1936300 1935860 gene locus_tag LOCUS_17900 1936300 1935860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 1936554 1936297 gene locus_tag LOCUS_17910 1936554 1936297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1936811 1936551 gene locus_tag LOCUS_17920 1936811 1936551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028395.1 protein_id gnl|my_center|LOCUS_17920 1936888 1937745 gene locus_tag LOCUS_17930 1936888 1937745 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029566.1 protein_id gnl|my_center|LOCUS_17930 1937742 1937948 gene locus_tag LOCUS_17940 1937742 1937948 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_17940 1937990 1938196 gene locus_tag LOCUS_17950 1937990 1938196 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_17950 1938312 1940387 gene locus_tag LOCUS_17960 1938312 1940387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 1940790 1940353 gene locus_tag LOCUS_17970 1940790 1940353 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259144.1 protein_id gnl|my_center|LOCUS_17970 1941125 1940787 gene locus_tag LOCUS_17980 1941125 1940787 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226991.1 protein_id gnl|my_center|LOCUS_17980 1941811 1941188 gene locus_tag LOCUS_17990 1941811 1941188 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976326.1 protein_id gnl|my_center|LOCUS_17990 1941889 1942680 gene locus_tag LOCUS_18000 1941889 1942680 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036395.1 protein_id gnl|my_center|LOCUS_18000 1942708 1943181 gene locus_tag LOCUS_18010 1942708 1943181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 1943568 1944143 gene locus_tag LOCUS_18020 1943568 1944143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028375.1 protein_id gnl|my_center|LOCUS_18020 1944232 1944855 gene locus_tag LOCUS_18030 1944232 1944855 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976324.1 protein_id gnl|my_center|LOCUS_18030 1945662 1944865 gene locus_tag LOCUS_18040 1945662 1944865 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028380.1 protein_id gnl|my_center|LOCUS_18040 1945825 1947039 gene locus_tag LOCUS_18050 1945825 1947039 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028381.1 protein_id gnl|my_center|LOCUS_18050 1947092 1949626 gene locus_tag LOCUS_18060 gene nirB 1947092 1949626 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028382.1 protein_id gnl|my_center|LOCUS_18060 1949626 1949994 gene locus_tag LOCUS_18070 gene nirD 1949626 1949994 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976316.1 protein_id gnl|my_center|LOCUS_18070 1950115 1951281 gene locus_tag LOCUS_18080 1950115 1951281 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030620.1 protein_id gnl|my_center|LOCUS_18080 1951718 1951308 gene locus_tag LOCUS_18090 1951718 1951308 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976191.1 protein_id gnl|my_center|LOCUS_18090 1952839 1951838 gene locus_tag LOCUS_18100 1952839 1951838 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229227.1 protein_id gnl|my_center|LOCUS_18100 1956157 1953344 gene locus_tag LOCUS_18110 gene ppdK 1956157 1953344 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_18110 1956332 1956646 gene locus_tag LOCUS_18120 1956332 1956646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 1957740 1956592 gene locus_tag LOCUS_18130 gene dusB 1957740 1956592 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028387.1 protein_id gnl|my_center|LOCUS_18130 1958088 1957873 gene locus_tag LOCUS_18140 1958088 1957873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 1958454 1958251 gene locus_tag LOCUS_18150 1958454 1958251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 1959938 1958556 gene locus_tag LOCUS_18160 1959938 1958556 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976298.1 protein_id gnl|my_center|LOCUS_18160 1960160 1961206 gene locus_tag LOCUS_18170 1960160 1961206 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_18170 1961203 1962027 gene locus_tag LOCUS_18180 1961203 1962027 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028392.1 protein_id gnl|my_center|LOCUS_18180 1962033 1962935 gene locus_tag LOCUS_18190 1962033 1962935 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_18190 1963001 1963435 gene locus_tag LOCUS_18200 1963001 1963435 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_18200 1964329 1963502 gene locus_tag LOCUS_18210 1964329 1963502 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976293.1 protein_id gnl|my_center|LOCUS_18210 1965092 1964352 gene locus_tag LOCUS_18220 gene recO 1965092 1964352 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 protein_id gnl|my_center|LOCUS_18220 1965827 1965138 gene locus_tag LOCUS_18230 1965827 1965138 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863748.1 protein_id gnl|my_center|LOCUS_18230 1967131 1965824 gene locus_tag LOCUS_18240 1967131 1965824 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863745.1 protein_id gnl|my_center|LOCUS_18240 1969266 1967164 gene locus_tag LOCUS_18250 1969266 1967164 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028402.1 protein_id gnl|my_center|LOCUS_18250 1970118 1969414 gene locus_tag LOCUS_18260 1970118 1969414 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028407.1 protein_id gnl|my_center|LOCUS_18260 1972110 1970329 gene locus_tag LOCUS_18270 gene leuA 1972110 1970329 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976275.1 protein_id gnl|my_center|LOCUS_18270 1972406 1973515 gene locus_tag LOCUS_18280 1972406 1973515 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028408.1 protein_id gnl|my_center|LOCUS_18280 1973619 1973882 gene locus_tag LOCUS_18290 1973619 1973882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976273.1 protein_id gnl|my_center|LOCUS_18290 1974861 1973911 gene locus_tag LOCUS_18300 gene era 1974861 1973911 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 protein_id gnl|my_center|LOCUS_18300 1975440 1975048 gene locus_tag LOCUS_18310 1975440 1975048 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456125.1 protein_id gnl|my_center|LOCUS_18310 1975811 1975458 gene locus_tag LOCUS_18320 1975811 1975458 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028411.1 protein_id gnl|my_center|LOCUS_18320 1977091 1975808 gene locus_tag LOCUS_18330 1977091 1975808 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412229.1 protein_id gnl|my_center|LOCUS_18330 1977585 1977088 gene locus_tag LOCUS_18340 gene ybeY 1977585 1977088 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976270.1 protein_id gnl|my_center|LOCUS_18340 1978635 1977598 gene locus_tag LOCUS_18350 1978635 1977598 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_18350 1979913 1978741 gene locus_tag LOCUS_18360 1979913 1978741 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485041.1 protein_id gnl|my_center|LOCUS_18360 1980982 1979990 gene locus_tag LOCUS_18370 1980982 1979990 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270038.1 protein_id gnl|my_center|LOCUS_18370 1981927 1981019 gene locus_tag LOCUS_18380 1981927 1981019 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028422.1 protein_id gnl|my_center|LOCUS_18380 1982303 1981944 gene locus_tag LOCUS_18390 1982303 1981944 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_18390 1983171 1982425 gene locus_tag LOCUS_18400 1983171 1982425 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 protein_id gnl|my_center|LOCUS_18400 1984241 1983168 gene locus_tag LOCUS_18410 1984241 1983168 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976251.1 protein_id gnl|my_center|LOCUS_18410 1985534 1984398 gene locus_tag LOCUS_18420 gene dnaJ 1985534 1984398 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_18420 1986551 1985535 gene locus_tag LOCUS_18430 gene hrcA 1986551 1985535 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_18430 1986715 1987437 gene locus_tag LOCUS_18440 1986715 1987437 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028425.1 protein_id gnl|my_center|LOCUS_18440 1987463 1988281 gene locus_tag LOCUS_18450 1987463 1988281 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976247.1 protein_id gnl|my_center|LOCUS_18450 1989680 1988439 gene locus_tag LOCUS_18460 gene hemW 1989680 1988439 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_18460 1991692 1989719 gene locus_tag LOCUS_18470 1991692 1989719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1993816 1991927 gene locus_tag LOCUS_18480 1993816 1991927 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156206934.1 protein_id gnl|my_center|LOCUS_18480 1996015 1994141 gene locus_tag LOCUS_18490 gene lepA 1996015 1994141 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976242.1 protein_id gnl|my_center|LOCUS_18490 1996232 1996498 gene locus_tag LOCUS_18500 gene rpsT 1996232 1996498 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_18500 1997761 1996775 gene locus_tag LOCUS_18510 gene holA 1997761 1996775 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485035.1 protein_id gnl|my_center|LOCUS_18510 1997845 1998090 gene locus_tag LOCUS_18520 1997845 1998090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666679.1 protein_id gnl|my_center|LOCUS_18520 1999273 1998413 gene locus_tag LOCUS_18530 1999273 1998413 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467786.1 protein_id gnl|my_center|LOCUS_18530 2001901 1999382 gene locus_tag LOCUS_18540 2001901 1999382 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028431.1 protein_id gnl|my_center|LOCUS_18540 2002848 2001898 gene locus_tag LOCUS_18550 2002848 2001898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 2004143 2003298 gene locus_tag LOCUS_18560 2004143 2003298 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_18560 2005064 2004306 gene locus_tag LOCUS_18570 2005064 2004306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028433.1 protein_id gnl|my_center|LOCUS_18570 2008064 2005191 gene locus_tag LOCUS_18580 gene leuS 2008064 2005191 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976232.1 protein_id gnl|my_center|LOCUS_18580 2008529 2008456 gene locus_tag LOCUS_t00170 2008529 2008456 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2008870 2008637 gene locus_tag LOCUS_18590 2008870 2008637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976229.1 protein_id gnl|my_center|LOCUS_18590 2009183 2009110 gene locus_tag LOCUS_t00180 2009183 2009110 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2009775 2009299 gene locus_tag LOCUS_18600 2009775 2009299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 2010380 2009949 gene locus_tag LOCUS_18610 gene rsfS 2010380 2009949 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_18610 2012207 2010471 gene locus_tag LOCUS_18620 gene pdtA 2012207 2010471 CDS product polydiglycosylphosphate transferase PdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976225.1 protein_id gnl|my_center|LOCUS_18620 2012844 2012227 gene locus_tag LOCUS_18630 gene nadD 2012844 2012227 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_18630 2013125 2012883 gene locus_tag LOCUS_18640 2013125 2012883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 2013311 2013132 gene locus_tag LOCUS_18650 2013311 2013132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 2013398 2014516 gene locus_tag LOCUS_18660 2013398 2014516 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028434.1 protein_id gnl|my_center|LOCUS_18660 2015567 2014449 gene locus_tag LOCUS_18670 2015567 2014449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028435.1 protein_id gnl|my_center|LOCUS_18670 2016430 2015798 gene locus_tag LOCUS_18680 2016430 2015798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326198.1 protein_id gnl|my_center|LOCUS_18680 2017737 2016454 gene locus_tag LOCUS_18690 2017737 2016454 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_18690 2018333 2017821 gene locus_tag LOCUS_18700 2018333 2017821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 2019603 2018455 gene locus_tag LOCUS_18710 gene proB 2019603 2018455 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_18710 2022537 2019820 gene locus_tag LOCUS_18720 2022537 2019820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 2024032 2022734 gene locus_tag LOCUS_18730 2024032 2022734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 2026367 2024202 gene locus_tag LOCUS_18740 2026367 2024202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109032946.1 protein_id gnl|my_center|LOCUS_18740 2028071 2026503 gene locus_tag LOCUS_18750 2028071 2026503 CDS product bifunctional cytidylyltransferase/SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107920.1 protein_id gnl|my_center|LOCUS_18750 2029821 2028385 gene locus_tag LOCUS_18760 gene obgE 2029821 2028385 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 protein_id gnl|my_center|LOCUS_18760 2030221 2029964 gene locus_tag LOCUS_18770 gene rpmA 2030221 2029964 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_18770 2030556 2030236 gene locus_tag LOCUS_18780 gene rplU 2030556 2030236 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976204.1 protein_id gnl|my_center|LOCUS_18780 2030840 2031451 gene locus_tag LOCUS_18790 2030840 2031451 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776120.1 protein_id gnl|my_center|LOCUS_18790 2031662 2032840 gene locus_tag LOCUS_18800 2031662 2032840 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028385.1 protein_id gnl|my_center|LOCUS_18800 2034190 2032907 gene locus_tag LOCUS_18810 2034190 2032907 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776106.1 protein_id gnl|my_center|LOCUS_18810 2035815 2034187 gene locus_tag LOCUS_18820 2035815 2034187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2037395 2035812 gene locus_tag LOCUS_18830 2037395 2035812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 2040007 2037419 gene locus_tag LOCUS_18840 2040007 2037419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2041117 2040107 gene locus_tag LOCUS_18850 2041117 2040107 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776118.1 protein_id gnl|my_center|LOCUS_18850 2042232 2041114 gene locus_tag LOCUS_18860 2042232 2041114 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776119.1 protein_id gnl|my_center|LOCUS_18860 2046747 2042566 gene locus_tag LOCUS_18870 2046747 2042566 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028446.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18870 2047652 2046978 gene locus_tag LOCUS_18880 2047652 2046978 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_18880 2049046 2047883 gene locus_tag LOCUS_18890 2049046 2047883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028447.1 protein_id gnl|my_center|LOCUS_18890 2049736 2049239 gene locus_tag LOCUS_18900 2049736 2049239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 2051870 2049750 gene locus_tag LOCUS_18910 2051870 2049750 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207707612.1 protein_id gnl|my_center|LOCUS_18910 2052664 2051867 gene locus_tag LOCUS_18920 2052664 2051867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2052916 2053239 gene locus_tag LOCUS_18930 2052916 2053239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 2053468 2053983 gene locus_tag LOCUS_18940 2053468 2053983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18940 2053932 2054204 gene locus_tag LOCUS_18950 2053932 2054204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18950 2054733 2054257 gene locus_tag LOCUS_18960 2054733 2054257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 2055038 2054814 gene locus_tag LOCUS_18970 2055038 2054814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 2055529 2055311 gene locus_tag LOCUS_18980 2055529 2055311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 2055822 2055529 gene locus_tag LOCUS_18990 2055822 2055529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 2056630 2055827 gene locus_tag LOCUS_19000 2056630 2055827 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199889868.1 protein_id gnl|my_center|LOCUS_19000 2057209 2056694 gene locus_tag LOCUS_19010 2057209 2056694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143647548.1 protein_id gnl|my_center|LOCUS_19010 2059512 2057587 gene locus_tag LOCUS_19020 2059512 2057587 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_19020 2061108 2059564 gene locus_tag LOCUS_19030 2061108 2059564 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978319.1 protein_id gnl|my_center|LOCUS_19030 2062360 2061170 gene locus_tag LOCUS_19040 gene rodA 2062360 2061170 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_19040 2064531 2062360 gene locus_tag LOCUS_19050 gene mrdA 2064531 2062360 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_19050 2065228 2064569 gene locus_tag LOCUS_19060 gene mreD 2065228 2064569 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976190.1 protein_id gnl|my_center|LOCUS_19060 2066352 2065240 gene locus_tag LOCUS_19070 gene mreC 2066352 2065240 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976189.1 protein_id gnl|my_center|LOCUS_19070 2067496 2066477 gene locus_tag LOCUS_19080 2067496 2066477 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_19080 2068201 2067788 gene locus_tag LOCUS_19090 gene ndk 2068201 2067788 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976187.1 protein_id gnl|my_center|LOCUS_19090 2068669 2068313 gene locus_tag LOCUS_19100 2068669 2068313 CDS product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976186.1 protein_id gnl|my_center|LOCUS_19100 2070175 2068673 gene locus_tag LOCUS_19110 2070175 2068673 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_19110 2072944 2070290 gene locus_tag LOCUS_19120 2072944 2070290 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028455.1 protein_id gnl|my_center|LOCUS_19120 2073048 2074046 gene locus_tag LOCUS_19130 2073048 2074046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2074619 2074125 gene locus_tag LOCUS_19140 2074619 2074125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 2074897 2076027 gene locus_tag LOCUS_19150 2074897 2076027 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150490919.1 protein_id gnl|my_center|LOCUS_19150 2076661 2077029 gene locus_tag LOCUS_19160 2076661 2077029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 2077418 2077113 gene locus_tag LOCUS_19170 2077418 2077113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 2077801 2077418 gene locus_tag LOCUS_19180 2077801 2077418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 2079202 2077904 gene locus_tag LOCUS_19190 gene clpX 2079202 2077904 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_19190 2080041 2079358 gene locus_tag LOCUS_19200 2080041 2079358 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668811.1 protein_id gnl|my_center|LOCUS_19200 2080735 2080118 gene locus_tag LOCUS_19210 2080735 2080118 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030186848.1 protein_id gnl|my_center|LOCUS_19210 2082379 2080985 gene locus_tag LOCUS_19220 gene tig 2082379 2080985 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_19220 2082605 2082529 gene locus_tag LOCUS_t00190 2082605 2082529 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2082784 2082857 gene locus_tag LOCUS_t00200 2082784 2082857 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2083115 2082921 gene locus_tag LOCUS_19230 2083115 2082921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976178.1 protein_id gnl|my_center|LOCUS_19230 2083690 2084772 gene locus_tag LOCUS_19240 2083690 2084772 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028459.1 protein_id gnl|my_center|LOCUS_19240 2085292 2084774 gene locus_tag LOCUS_19250 2085292 2084774 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028460.1 protein_id gnl|my_center|LOCUS_19250 2086451 2085393 gene locus_tag LOCUS_19260 2086451 2085393 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976175.1 protein_id gnl|my_center|LOCUS_19260 2087480 2086671 gene locus_tag LOCUS_19270 2087480 2086671 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_19270 2088060 2087572 gene locus_tag LOCUS_19280 2088060 2087572 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 protein_id gnl|my_center|LOCUS_19280 2088307 2089776 gene locus_tag LOCUS_19290 2088307 2089776 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869905.1 protein_id gnl|my_center|LOCUS_19290 2090476 2089883 gene locus_tag LOCUS_19300 2090476 2089883 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469637.1 protein_id gnl|my_center|LOCUS_19300 2090736 2092139 gene locus_tag LOCUS_19310 2090736 2092139 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976169.1 protein_id gnl|my_center|LOCUS_19310 2092257 2093675 gene locus_tag LOCUS_19320 2092257 2093675 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976169.1 protein_id gnl|my_center|LOCUS_19320 2093834 2094898 gene locus_tag LOCUS_19330 2093834 2094898 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230795.1 protein_id gnl|my_center|LOCUS_19330 2094994 2095659 gene locus_tag LOCUS_19340 2094994 2095659 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270136.1 protein_id gnl|my_center|LOCUS_19340 2095656 2096246 gene locus_tag LOCUS_19350 2095656 2096246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2096967 2096320 gene locus_tag LOCUS_19360 2096967 2096320 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_19360 2097098 2099707 gene locus_tag LOCUS_19370 gene pepN 2097098 2099707 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326219.1 protein_id gnl|my_center|LOCUS_19370 2099967 2100935 gene locus_tag LOCUS_19380 2099967 2100935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270042.1 protein_id gnl|my_center|LOCUS_19380 2101106 2104402 gene locus_tag LOCUS_19390 2101106 2104402 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028469.1 protein_id gnl|my_center|LOCUS_19390 2104698 2105726 gene locus_tag LOCUS_19400 2104698 2105726 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028472.1 protein_id gnl|my_center|LOCUS_19400 2106293 2105784 gene locus_tag LOCUS_19410 2106293 2105784 CDS product DUF1203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028474.1 protein_id gnl|my_center|LOCUS_19410 2106406 2108982 gene locus_tag LOCUS_19420 gene pepN 2106406 2108982 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028475.1 protein_id gnl|my_center|LOCUS_19420 2109436 2109047 gene locus_tag LOCUS_19430 2109436 2109047 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866702.1 protein_id gnl|my_center|LOCUS_19430 2110699 2109551 gene locus_tag LOCUS_19440 gene alc 2110699 2109551 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030765.1 protein_id gnl|my_center|LOCUS_19440 2111685 2110759 gene locus_tag LOCUS_19450 2111685 2110759 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028476.1 protein_id gnl|my_center|LOCUS_19450 2111988 2111776 gene locus_tag LOCUS_19460 2111988 2111776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 2114213 2112027 gene locus_tag LOCUS_19470 gene malQ 2114213 2112027 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028481.1 protein_id gnl|my_center|LOCUS_19470 2114528 2114214 gene locus_tag LOCUS_19480 2114528 2114214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2114837 2117812 gene locus_tag LOCUS_19490 2114837 2117812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2118454 2117918 gene locus_tag LOCUS_19500 2118454 2117918 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028487.1 protein_id gnl|my_center|LOCUS_19500 2118775 2119833 gene locus_tag LOCUS_19510 2118775 2119833 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283001.1 protein_id gnl|my_center|LOCUS_19510 2120054 2121268 gene locus_tag LOCUS_19520 2120054 2121268 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208195.1 protein_id gnl|my_center|LOCUS_19520 2121468 2122733 gene locus_tag LOCUS_19530 2121468 2122733 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028492.1 protein_id gnl|my_center|LOCUS_19530 2122724 2123698 gene locus_tag LOCUS_19540 2122724 2123698 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866323.1 protein_id gnl|my_center|LOCUS_19540 2124081 2124779 gene locus_tag LOCUS_19550 2124081 2124779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 2124825 2126171 gene locus_tag LOCUS_19560 2124825 2126171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028496.1 protein_id gnl|my_center|LOCUS_19560 2126228 2126479 gene locus_tag LOCUS_19570 2126228 2126479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2126482 2127810 gene locus_tag LOCUS_19580 2126482 2127810 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028498.1 protein_id gnl|my_center|LOCUS_19580 2127930 2128199 gene locus_tag LOCUS_19590 2127930 2128199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 2128275 2129489 gene locus_tag LOCUS_19600 2128275 2129489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 2129588 2129992 gene locus_tag LOCUS_19610 2129588 2129992 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_19610 2130757 2130074 gene locus_tag LOCUS_19620 2130757 2130074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866307.1 protein_id gnl|my_center|LOCUS_19620 2131176 2130754 gene locus_tag LOCUS_19630 2131176 2130754 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028505.1 protein_id gnl|my_center|LOCUS_19630 2132846 2131182 gene locus_tag LOCUS_19640 gene ettA 2132846 2131182 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976122.1 protein_id gnl|my_center|LOCUS_19640 2134479 2133004 gene locus_tag LOCUS_19650 2134479 2133004 CDS product TQXA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028511.1 protein_id gnl|my_center|LOCUS_19650 2135218 2134757 gene locus_tag LOCUS_19660 2135218 2134757 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976116.1 protein_id gnl|my_center|LOCUS_19660 2135208 2135393 gene locus_tag LOCUS_19670 2135208 2135393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2137303 2135333 gene locus_tag LOCUS_19680 2137303 2135333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19680 2138943 2137300 gene locus_tag LOCUS_19690 2138943 2137300 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028513.1 protein_id gnl|my_center|LOCUS_19690 2139261 2139336 gene locus_tag LOCUS_t00210 2139261 2139336 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2139670 2139455 gene locus_tag LOCUS_19700 2139670 2139455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2140858 2139773 gene locus_tag LOCUS_19710 gene arsB 2140858 2139773 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031222.1 protein_id gnl|my_center|LOCUS_19710 2141163 2140855 gene locus_tag LOCUS_19720 2141163 2140855 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975238.1 protein_id gnl|my_center|LOCUS_19720 2141277 2141690 gene locus_tag LOCUS_19730 2141277 2141690 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029173.1 protein_id gnl|my_center|LOCUS_19730 2143330 2141843 gene locus_tag LOCUS_19740 2143330 2141843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 2144073 2143615 gene locus_tag LOCUS_19750 2144073 2143615 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226533.1 protein_id gnl|my_center|LOCUS_19750 2145722 2144148 gene locus_tag LOCUS_19760 2145722 2144148 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028539.1 protein_id gnl|my_center|LOCUS_19760 2146766 2145888 gene locus_tag LOCUS_19770 2146766 2145888 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028540.1 protein_id gnl|my_center|LOCUS_19770 2149426 2146763 gene locus_tag LOCUS_19780 2149426 2146763 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484949.1 protein_id gnl|my_center|LOCUS_19780 2149774 2150715 gene locus_tag LOCUS_19790 gene hemC 2149774 2150715 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971798.1 protein_id gnl|my_center|LOCUS_19790 2151853 2150819 gene locus_tag LOCUS_19800 2151853 2150819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2153455 2151953 gene locus_tag LOCUS_19810 gene mmsA 2153455 2151953 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 protein_id gnl|my_center|LOCUS_19810 2155377 2153470 gene locus_tag LOCUS_19820 gene iolD 2155377 2153470 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_19820 2156282 2155374 gene locus_tag LOCUS_19830 gene iolB 2156282 2155374 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031348.1 protein_id gnl|my_center|LOCUS_19830 2157187 2156300 gene locus_tag LOCUS_19840 2157187 2156300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031349.1 protein_id gnl|my_center|LOCUS_19840 2158230 2157184 gene locus_tag LOCUS_19850 gene iolC 2158230 2157184 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972167.1 protein_id gnl|my_center|LOCUS_19850 2158373 2159317 gene locus_tag LOCUS_19860 2158373 2159317 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031353.1 protein_id gnl|my_center|LOCUS_19860 2159515 2159712 gene locus_tag LOCUS_19870 2159515 2159712 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326277.1 protein_id gnl|my_center|LOCUS_19870 2160845 2159787 gene locus_tag LOCUS_19880 2160845 2159787 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531254.1 protein_id gnl|my_center|LOCUS_19880 2161210 2161515 gene locus_tag LOCUS_19890 2161210 2161515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 2163593 2162283 gene locus_tag LOCUS_19900 2163593 2162283 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976064.1 protein_id gnl|my_center|LOCUS_19900 2166011 2163780 gene locus_tag LOCUS_19910 2166011 2163780 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028552.1 protein_id gnl|my_center|LOCUS_19910 2167131 2166301 gene locus_tag LOCUS_19920 2167131 2166301 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028560.1 protein_id gnl|my_center|LOCUS_19920 2168270 2167128 gene locus_tag LOCUS_19930 2168270 2167128 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028561.1 protein_id gnl|my_center|LOCUS_19930 2169418 2168267 gene locus_tag LOCUS_19940 2169418 2168267 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456192.1 protein_id gnl|my_center|LOCUS_19940 2169530 2170624 gene locus_tag LOCUS_19950 2169530 2170624 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976047.1 protein_id gnl|my_center|LOCUS_19950 2170704 2171495 gene locus_tag LOCUS_19960 2170704 2171495 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976046.1 protein_id gnl|my_center|LOCUS_19960 2171762 2173591 gene locus_tag LOCUS_19970 2171762 2173591 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028566.1 protein_id gnl|my_center|LOCUS_19970 2175164 2173686 gene locus_tag LOCUS_19980 2175164 2173686 CDS product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028568.1 protein_id gnl|my_center|LOCUS_19980 2175711 2175259 gene locus_tag LOCUS_19990 2175711 2175259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 2179505 2175789 gene locus_tag LOCUS_20000 2179505 2175789 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028569.1 protein_id gnl|my_center|LOCUS_20000 2180107 2179634 gene locus_tag LOCUS_20010 2180107 2179634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 2182279 2181311 gene locus_tag LOCUS_20020 gene speB 2182279 2181311 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 protein_id gnl|my_center|LOCUS_20020 2182463 2183944 gene locus_tag LOCUS_20030 2182463 2183944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 2184951 2184346 gene locus_tag LOCUS_20040 2184951 2184346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486010.1 protein_id gnl|my_center|LOCUS_20040 2185115 2186299 gene locus_tag LOCUS_20050 2185115 2186299 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850204.1 protein_id gnl|my_center|LOCUS_20050 2186392 2187549 gene locus_tag LOCUS_20060 2186392 2187549 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028577.1 protein_id gnl|my_center|LOCUS_20060 2187568 2188443 gene locus_tag LOCUS_20070 2187568 2188443 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028576.1 protein_id gnl|my_center|LOCUS_20070 2188480 2189448 gene locus_tag LOCUS_20080 2188480 2189448 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028575.1 protein_id gnl|my_center|LOCUS_20080 2190265 2189486 gene locus_tag LOCUS_20090 2190265 2189486 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976029.1 protein_id gnl|my_center|LOCUS_20090 2190905 2190393 gene locus_tag LOCUS_20100 2190905 2190393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2191685 2191062 gene locus_tag LOCUS_20110 2191685 2191062 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028578.1 protein_id gnl|my_center|LOCUS_20110 2191783 2193390 gene locus_tag LOCUS_20120 2191783 2193390 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028579.1 protein_id gnl|my_center|LOCUS_20120 2193404 2195467 gene locus_tag LOCUS_20130 2193404 2195467 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028580.1 protein_id gnl|my_center|LOCUS_20130 2195464 2196438 gene locus_tag LOCUS_20140 2195464 2196438 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028581.1 protein_id gnl|my_center|LOCUS_20140 2196445 2197611 gene locus_tag LOCUS_20150 2196445 2197611 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976021.1 protein_id gnl|my_center|LOCUS_20150 2198024 2197815 gene locus_tag LOCUS_20160 2198024 2197815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 2198311 2198111 gene locus_tag LOCUS_20170 2198311 2198111 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_20170 2198763 2198308 gene locus_tag LOCUS_20180 2198763 2198308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 2199701 2199231 gene locus_tag LOCUS_20190 2199701 2199231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180053.1 protein_id gnl|my_center|LOCUS_20190 2200002 2199730 gene locus_tag LOCUS_20200 2200002 2199730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 2200796 2200323 gene locus_tag LOCUS_20210 2200796 2200323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 2209910 2200845 gene locus_tag LOCUS_20220 2209910 2200845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2210289 2211140 gene locus_tag LOCUS_20230 2210289 2211140 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028582.1 protein_id gnl|my_center|LOCUS_20230 2211260 2212741 gene locus_tag LOCUS_20240 gene desA 2211260 2212741 CDS product lysine decarboxylase DesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028583.1 protein_id gnl|my_center|LOCUS_20240 2212725 2213999 gene locus_tag LOCUS_20250 2212725 2213999 CDS product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326291.1 protein_id gnl|my_center|LOCUS_20250 2213996 2214541 gene locus_tag LOCUS_20260 2213996 2214541 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976016.1 protein_id gnl|my_center|LOCUS_20260 2214541 2216316 gene locus_tag LOCUS_20270 gene desD 2214541 2216316 CDS product desferrioxamine E synthetase DesD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028585.1 protein_id gnl|my_center|LOCUS_20270 2216488 2216763 gene locus_tag LOCUS_20280 2216488 2216763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976012.1 protein_id gnl|my_center|LOCUS_20280 2216801 2218630 gene locus_tag LOCUS_20290 gene glmS 2216801 2218630 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976011.1 protein_id gnl|my_center|LOCUS_20290 2219145 2218744 gene locus_tag LOCUS_20300 2219145 2218744 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976010.1 protein_id gnl|my_center|LOCUS_20300 2219459 2220004 gene locus_tag LOCUS_20310 2219459 2220004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2220414 2221622 gene locus_tag LOCUS_20320 2220414 2221622 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028588.1 protein_id gnl|my_center|LOCUS_20320 2221633 2222235 gene locus_tag LOCUS_20330 gene orn 2221633 2222235 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_20330 2222361 2222434 gene locus_tag LOCUS_t00220 2222361 2222434 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2223536 2222508 gene locus_tag LOCUS_20340 2223536 2222508 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976006.1 protein_id gnl|my_center|LOCUS_20340 2223738 2223935 gene locus_tag LOCUS_20350 2223738 2223935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2224129 2225493 gene locus_tag LOCUS_20360 2224129 2225493 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028589.1 protein_id gnl|my_center|LOCUS_20360 2225500 2226510 gene locus_tag LOCUS_20370 2225500 2226510 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028590.1 protein_id gnl|my_center|LOCUS_20370 2226522 2227436 gene locus_tag LOCUS_20380 2226522 2227436 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028591.1 protein_id gnl|my_center|LOCUS_20380 2227494 2228903 gene locus_tag LOCUS_20390 2227494 2228903 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976002.1 protein_id gnl|my_center|LOCUS_20390 2229873 2228983 gene locus_tag LOCUS_20400 2229873 2228983 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 protein_id gnl|my_center|LOCUS_20400 2230412 2229957 gene locus_tag LOCUS_20410 2230412 2229957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975996.1 protein_id gnl|my_center|LOCUS_20410 2230598 2232070 gene locus_tag LOCUS_20420 2230598 2232070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028595.1 protein_id gnl|my_center|LOCUS_20420 2232728 2232132 gene locus_tag LOCUS_20430 2232728 2232132 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028596.1 protein_id gnl|my_center|LOCUS_20430 2233002 2233946 gene locus_tag LOCUS_20440 2233002 2233946 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028597.1 protein_id gnl|my_center|LOCUS_20440 2233831 2235018 gene locus_tag LOCUS_20450 2233831 2235018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485125.1 protein_id gnl|my_center|LOCUS_20450 2235009 2236616 gene locus_tag LOCUS_20460 2235009 2236616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484926.1 protein_id gnl|my_center|LOCUS_20460 2236613 2237956 gene locus_tag LOCUS_20470 2236613 2237956 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975990.1 protein_id gnl|my_center|LOCUS_20470 2238086 2238427 gene locus_tag LOCUS_20480 2238086 2238427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975980.1 protein_id gnl|my_center|LOCUS_20480 2238564 2239253 gene locus_tag LOCUS_20490 2238564 2239253 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028603.1 protein_id gnl|my_center|LOCUS_20490 2239244 2239318 gene locus_tag LOCUS_t00230 2239244 2239318 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2240593 2239403 gene locus_tag LOCUS_20500 2240593 2239403 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028602.1 protein_id gnl|my_center|LOCUS_20500 2241109 2242896 gene locus_tag LOCUS_20510 2241109 2242896 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975983.1 protein_id gnl|my_center|LOCUS_20510 2244034 2242940 gene locus_tag LOCUS_20520 2244034 2242940 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028601.1 protein_id gnl|my_center|LOCUS_20520 2244860 2244096 gene locus_tag LOCUS_20530 2244860 2244096 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975978.1 protein_id gnl|my_center|LOCUS_20530 2245150 2246052 gene locus_tag LOCUS_20540 2245150 2246052 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804356.1 protein_id gnl|my_center|LOCUS_20540 2246072 2246797 gene locus_tag LOCUS_20550 gene ehuC 2246072 2246797 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804357.1 protein_id gnl|my_center|LOCUS_20550 2246794 2247435 gene locus_tag LOCUS_20560 gene ehuD 2246794 2247435 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804358.1 protein_id gnl|my_center|LOCUS_20560 2247425 2248258 gene locus_tag LOCUS_20570 gene ehuA 2247425 2248258 CDS product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975969.1 protein_id gnl|my_center|LOCUS_20570 2248426 2249184 gene locus_tag LOCUS_20580 2248426 2249184 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866451.1 protein_id gnl|my_center|LOCUS_20580 2249289 2249363 gene locus_tag LOCUS_t00240 2249289 2249363 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2250077 2249487 gene locus_tag LOCUS_20590 2250077 2249487 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975967.1 protein_id gnl|my_center|LOCUS_20590 2252000 2250237 gene locus_tag LOCUS_20600 2252000 2250237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 2253300 2252011 gene locus_tag LOCUS_20610 2253300 2252011 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028607.1 protein_id gnl|my_center|LOCUS_20610 2253452 2253526 gene locus_tag LOCUS_t00250 2253452 2253526 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2254284 2253598 gene locus_tag LOCUS_20620 2254284 2253598 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028613.1 protein_id gnl|my_center|LOCUS_20620 2254837 2254286 gene locus_tag LOCUS_20630 2254837 2254286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 2255731 2254943 gene locus_tag LOCUS_20640 2255731 2254943 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_20640 2256851 2255979 gene locus_tag LOCUS_20650 2256851 2255979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 2258075 2257026 gene locus_tag LOCUS_20660 2258075 2257026 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975954.1 protein_id gnl|my_center|LOCUS_20660 2258204 2259316 gene locus_tag LOCUS_20670 2258204 2259316 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975953.1 protein_id gnl|my_center|LOCUS_20670 2259313 2259792 gene locus_tag LOCUS_20680 2259313 2259792 CDS product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028617.1 protein_id gnl|my_center|LOCUS_20680 2260932 2260075 gene locus_tag LOCUS_20690 2260932 2260075 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028618.1 protein_id gnl|my_center|LOCUS_20690 2261853 2261083 gene locus_tag LOCUS_20700 2261853 2261083 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028619.1 protein_id gnl|my_center|LOCUS_20700 2262292 2261963 gene locus_tag LOCUS_20710 2262292 2261963 CDS product DUF6412 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866423.1 protein_id gnl|my_center|LOCUS_20710 2262421 2263440 gene locus_tag LOCUS_20720 2262421 2263440 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972380.1 protein_id gnl|my_center|LOCUS_20720 2264832 2263477 gene locus_tag LOCUS_20730 2264832 2263477 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457391.1 protein_id gnl|my_center|LOCUS_20730 2265763 2264888 gene locus_tag LOCUS_20740 2265763 2264888 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972375.1 protein_id gnl|my_center|LOCUS_20740 2266772 2265756 gene locus_tag LOCUS_20750 2266772 2265756 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031035.1 protein_id gnl|my_center|LOCUS_20750 2268085 2266769 gene locus_tag LOCUS_20760 2268085 2266769 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972377.1 protein_id gnl|my_center|LOCUS_20760 2268270 2269592 gene locus_tag LOCUS_20770 2268270 2269592 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027360.1 protein_id gnl|my_center|LOCUS_20770 2270762 2269668 gene locus_tag LOCUS_20780 2270762 2269668 CDS product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031031.1 protein_id gnl|my_center|LOCUS_20780 2272945 2270798 gene locus_tag LOCUS_20790 2272945 2270798 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031032.1 protein_id gnl|my_center|LOCUS_20790 2272911 2273153 gene locus_tag LOCUS_20800 2272911 2273153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 2275264 2273066 gene locus_tag LOCUS_20810 2275264 2273066 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027193.1 protein_id gnl|my_center|LOCUS_20810 2275781 2276854 gene locus_tag LOCUS_20820 2275781 2276854 CDS product SEC-C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028623.1 protein_id gnl|my_center|LOCUS_20820 2278375 2276906 gene locus_tag LOCUS_20830 2278375 2276906 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013850.1 protein_id gnl|my_center|LOCUS_20830 2281269 2278372 gene locus_tag LOCUS_20840 2281269 2278372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 2281799 2281275 gene locus_tag LOCUS_20850 2281799 2281275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 2282989 2282009 gene locus_tag LOCUS_20860 2282989 2282009 CDS product YDG/SRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030182.1 protein_id gnl|my_center|LOCUS_20860 2284026 2283094 gene locus_tag LOCUS_20870 2284026 2283094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2286682 2284031 gene locus_tag LOCUS_20880 2286682 2284031 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749483.1 protein_id gnl|my_center|LOCUS_20880 2287450 2286812 gene locus_tag LOCUS_20890 2287450 2286812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2287700 2288023 gene locus_tag LOCUS_20900 2287700 2288023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028647.1 protein_id gnl|my_center|LOCUS_20900 2289608 2288166 gene locus_tag LOCUS_20910 2289608 2288166 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_20910 2289751 2290995 gene locus_tag LOCUS_20920 2289751 2290995 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028649.1 protein_id gnl|my_center|LOCUS_20920 2291715 2291080 gene locus_tag LOCUS_20930 2291715 2291080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 2292061 2294412 gene locus_tag LOCUS_20940 2292061 2294412 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943963.1 protein_id gnl|my_center|LOCUS_20940 2294753 2294433 gene locus_tag LOCUS_20950 2294753 2294433 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975912.1 protein_id gnl|my_center|LOCUS_20950 2295284 2294943 gene locus_tag LOCUS_20960 2295284 2294943 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 protein_id gnl|my_center|LOCUS_20960 2295656 2295339 gene locus_tag LOCUS_20970 2295656 2295339 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028653.1 protein_id gnl|my_center|LOCUS_20970 2295785 2296252 gene locus_tag LOCUS_20980 gene bcp 2295785 2296252 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229449.1 protein_id gnl|my_center|LOCUS_20980 2296387 2297883 gene locus_tag LOCUS_20990 2296387 2297883 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977606.1 protein_id gnl|my_center|LOCUS_20990 2298042 2298671 gene locus_tag LOCUS_21000 2298042 2298671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2299165 2299380 gene locus_tag LOCUS_21010 2299165 2299380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2299393 2299468 gene locus_tag LOCUS_t00260 2299393 2299468 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2300122 2299520 gene locus_tag LOCUS_21020 gene rdgB 2300122 2299520 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_21020 2300528 2300130 gene locus_tag LOCUS_21030 2300528 2300130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975907.1 protein_id gnl|my_center|LOCUS_21030 2301368 2300631 gene locus_tag LOCUS_21040 gene rph 2301368 2300631 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_21040 2301704 2301471 gene locus_tag LOCUS_21050 2301704 2301471 CDS product PTS glucose/sucrose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975905.1 protein_id gnl|my_center|LOCUS_21050 2302062 2301874 gene locus_tag LOCUS_21060 2302062 2301874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 2301986 2303185 gene locus_tag LOCUS_21070 2301986 2303185 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028656.1 protein_id gnl|my_center|LOCUS_21070 2303447 2304751 gene locus_tag LOCUS_21080 2303447 2304751 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028657.1 protein_id gnl|my_center|LOCUS_21080 2305604 2304852 gene locus_tag LOCUS_21090 2305604 2304852 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_21090 2305798 2306259 gene locus_tag LOCUS_21100 2305798 2306259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 2307293 2306343 gene locus_tag LOCUS_21110 2307293 2306343 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975900.1 protein_id gnl|my_center|LOCUS_21110 2307571 2307293 gene locus_tag LOCUS_21120 2307571 2307293 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975899.1 protein_id gnl|my_center|LOCUS_21120 2308384 2307962 gene locus_tag LOCUS_21130 2308384 2307962 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028660.1 protein_id gnl|my_center|LOCUS_21130 2309929 2308499 gene locus_tag LOCUS_21140 2309929 2308499 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028661.1 protein_id gnl|my_center|LOCUS_21140 2310832 2310248 gene locus_tag LOCUS_21150 2310832 2310248 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 protein_id gnl|my_center|LOCUS_21150 2311193 2310885 gene locus_tag LOCUS_21160 gene clpS 2311193 2310885 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180153.1 protein_id gnl|my_center|LOCUS_21160 2311283 2312611 gene locus_tag LOCUS_21170 2311283 2312611 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_21170 2312758 2313354 gene locus_tag LOCUS_21180 2312758 2313354 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 protein_id gnl|my_center|LOCUS_21180 2313707 2313384 gene locus_tag LOCUS_21190 2313707 2313384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975892.1 protein_id gnl|my_center|LOCUS_21190 2316212 2313852 gene locus_tag LOCUS_21200 2316212 2313852 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028663.1 protein_id gnl|my_center|LOCUS_21200 2316623 2316937 gene locus_tag LOCUS_21210 2316623 2316937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 2317615 2316950 gene locus_tag LOCUS_21220 2317615 2316950 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279138.1 protein_id gnl|my_center|LOCUS_21220 2319451 2317718 gene locus_tag LOCUS_21230 2319451 2317718 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484871.1 protein_id gnl|my_center|LOCUS_21230 2319678 2320160 gene locus_tag LOCUS_21240 2319678 2320160 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975886.1 protein_id gnl|my_center|LOCUS_21240 2321560 2320193 gene locus_tag LOCUS_21250 2321560 2320193 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975885.1 protein_id gnl|my_center|LOCUS_21250 2321667 2323337 gene locus_tag LOCUS_21260 2321667 2323337 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270060.1 protein_id gnl|my_center|LOCUS_21260 2324552 2323407 gene locus_tag LOCUS_21270 gene hppD 2324552 2323407 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975883.1 protein_id gnl|my_center|LOCUS_21270 2324690 2325163 gene locus_tag LOCUS_21280 2324690 2325163 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028667.1 protein_id gnl|my_center|LOCUS_21280 2325179 2325826 gene locus_tag LOCUS_21290 2325179 2325826 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975880.1 protein_id gnl|my_center|LOCUS_21290 2325819 2327078 gene locus_tag LOCUS_21300 2325819 2327078 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975879.1 protein_id gnl|my_center|LOCUS_21300 2327075 2327941 gene locus_tag LOCUS_21310 2327075 2327941 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975878.1 protein_id gnl|my_center|LOCUS_21310 2327938 2328924 gene locus_tag LOCUS_21320 2327938 2328924 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028669.1 protein_id gnl|my_center|LOCUS_21320 2329755 2328967 gene locus_tag LOCUS_21330 2329755 2328967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028670.1 protein_id gnl|my_center|LOCUS_21330 2330576 2329878 gene locus_tag LOCUS_21340 2330576 2329878 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975875.1 protein_id gnl|my_center|LOCUS_21340 2332683 2330998 gene locus_tag LOCUS_21350 2332683 2330998 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975874.1 protein_id gnl|my_center|LOCUS_21350 2334545 2333058 gene locus_tag LOCUS_21360 2334545 2333058 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054423.1 protein_id gnl|my_center|LOCUS_21360 2334749 2334823 gene locus_tag LOCUS_t00270 2334749 2334823 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2335669 2335022 gene locus_tag LOCUS_21370 2335669 2335022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2337990 2335669 gene locus_tag LOCUS_21380 2337990 2335669 CDS product PPE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030421.1 protein_id gnl|my_center|LOCUS_21380 2338434 2338009 gene locus_tag LOCUS_21390 2338434 2338009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 2340173 2338824 gene locus_tag LOCUS_21400 gene mycP 2340173 2338824 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030423.1 protein_id gnl|my_center|LOCUS_21400 2341681 2340194 gene locus_tag LOCUS_21410 2341681 2340194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030424.1 protein_id gnl|my_center|LOCUS_21410 2342260 2341745 gene locus_tag LOCUS_21420 2342260 2341745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030425.1 protein_id gnl|my_center|LOCUS_21420 2344730 2342379 gene locus_tag LOCUS_21430 2344730 2342379 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028673.1 protein_id gnl|my_center|LOCUS_21430 2346390 2344822 gene locus_tag LOCUS_21440 2346390 2344822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 2347283 2346387 gene locus_tag LOCUS_21450 2347283 2346387 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865474.1 protein_id gnl|my_center|LOCUS_21450 2349194 2347530 gene locus_tag LOCUS_21460 2349194 2347530 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028675.1 protein_id gnl|my_center|LOCUS_21460 2350047 2349196 gene locus_tag LOCUS_21470 2350047 2349196 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028676.1 protein_id gnl|my_center|LOCUS_21470 2351027 2350044 gene locus_tag LOCUS_21480 2351027 2350044 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270062.1 protein_id gnl|my_center|LOCUS_21480 2352334 2351030 gene locus_tag LOCUS_21490 2352334 2351030 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975864.1 protein_id gnl|my_center|LOCUS_21490 2352890 2352597 gene locus_tag LOCUS_21500 2352890 2352597 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030402030.1 protein_id gnl|my_center|LOCUS_21500 2353558 2352998 gene locus_tag LOCUS_21510 2353558 2352998 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_21510 2353858 2355198 gene locus_tag LOCUS_21520 gene murA 2353858 2355198 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975861.1 protein_id gnl|my_center|LOCUS_21520 2355641 2355360 gene locus_tag LOCUS_21530 2355641 2355360 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950507.1 protein_id gnl|my_center|LOCUS_21530 2357468 2356032 gene locus_tag LOCUS_21540 2357468 2356032 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975860.1 protein_id gnl|my_center|LOCUS_21540 2357353 2357646 gene locus_tag LOCUS_21550 2357353 2357646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 2360318 2357937 gene locus_tag LOCUS_21560 2360318 2357937 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975859.1 protein_id gnl|my_center|LOCUS_21560 2361076 2360483 gene locus_tag LOCUS_21570 2361076 2360483 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028679.1 protein_id gnl|my_center|LOCUS_21570 2361802 2361242 gene locus_tag LOCUS_21580 2361802 2361242 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921226.1 protein_id gnl|my_center|LOCUS_21580 2362916 2361825 gene locus_tag LOCUS_21590 2362916 2361825 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028682.1 protein_id gnl|my_center|LOCUS_21590 2362848 2363036 gene locus_tag LOCUS_21600 2362848 2363036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 2364429 2363098 gene locus_tag LOCUS_21610 2364429 2363098 CDS product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028683.1 protein_id gnl|my_center|LOCUS_21610 2365859 2364564 gene locus_tag LOCUS_21620 2365859 2364564 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975851.1 protein_id gnl|my_center|LOCUS_21620 2368048 2365856 gene locus_tag LOCUS_21630 2368048 2365856 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028686.1 protein_id gnl|my_center|LOCUS_21630 2368522 2368049 gene locus_tag LOCUS_21640 2368522 2368049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21640 2369648 2368677 gene locus_tag LOCUS_21650 gene stgR 2369648 2368677 CDS product LysR family transcriptional regulator StgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028688.1 protein_id gnl|my_center|LOCUS_21650 2369732 2370997 gene locus_tag LOCUS_21660 2369732 2370997 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484859.1 protein_id gnl|my_center|LOCUS_21660 2371455 2371070 gene locus_tag LOCUS_tm00010 2371455 2371070 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2372033 2371545 gene locus_tag LOCUS_21670 gene smpB 2372033 2371545 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975846.1 protein_id gnl|my_center|LOCUS_21670 2373236 2372052 gene locus_tag LOCUS_21680 2373236 2372052 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668732.1 protein_id gnl|my_center|LOCUS_21680 2374222 2373305 gene locus_tag LOCUS_21690 gene ftsX 2374222 2373305 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_21690 2374944 2374255 gene locus_tag LOCUS_21700 gene ftsE 2374944 2374255 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_21700 2375222 2375410 gene locus_tag LOCUS_21710 2375222 2375410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2376511 2375522 gene locus_tag LOCUS_21720 2376511 2375522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2377976 2376870 gene locus_tag LOCUS_21730 gene prfB 2377976 2376870 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975840.1 protein_id gnl|my_center|LOCUS_21730 2379286 2378048 gene locus_tag LOCUS_21740 2379286 2378048 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028691.1 protein_id gnl|my_center|LOCUS_21740 2381135 2379441 gene locus_tag LOCUS_21750 2381135 2379441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2381609 2385181 gene locus_tag LOCUS_21760 2381609 2385181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2385412 2386776 gene locus_tag LOCUS_21770 2385412 2386776 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975833.1 protein_id gnl|my_center|LOCUS_21770 2386781 2388142 gene locus_tag LOCUS_21780 2386781 2388142 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865510.1 protein_id gnl|my_center|LOCUS_21780 2388139 2389017 gene locus_tag LOCUS_21790 2388139 2389017 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975831.1 protein_id gnl|my_center|LOCUS_21790 2389186 2391432 gene locus_tag LOCUS_21800 2389186 2391432 CDS product bifunctional glycosyltransferase family 2 protein/CDP-glycerol:glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975830.1 protein_id gnl|my_center|LOCUS_21800 2392652 2391504 gene locus_tag LOCUS_21810 2392652 2391504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 2395477 2392649 gene locus_tag LOCUS_21820 2395477 2392649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 2398965 2395498 gene locus_tag LOCUS_21830 2398965 2395498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 2400060 2399185 gene locus_tag LOCUS_21840 2400060 2399185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 2400801 2400088 gene locus_tag LOCUS_21850 2400801 2400088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2402911 2400911 gene locus_tag LOCUS_21860 2402911 2400911 CDS product bifunctional glycosyltransferase/CDP-glycerol:glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028440.1 protein_id gnl|my_center|LOCUS_21860 2403014 2406412 gene locus_tag LOCUS_21870 2403014 2406412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 2407172 2406564 gene locus_tag LOCUS_21880 2407172 2406564 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896738.1 protein_id gnl|my_center|LOCUS_21880 2407359 2408267 gene locus_tag LOCUS_21890 2407359 2408267 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975816.1 protein_id gnl|my_center|LOCUS_21890 2408260 2409120 gene locus_tag LOCUS_21900 2408260 2409120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972238.1 protein_id gnl|my_center|LOCUS_21900 2414257 2409236 gene locus_tag LOCUS_21910 2414257 2409236 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_21910 2414407 2414742 gene locus_tag LOCUS_21920 2414407 2414742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2415308 2414637 gene locus_tag LOCUS_21930 2415308 2414637 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_21930 2415844 2415338 gene locus_tag LOCUS_21940 2415844 2415338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028709.1 protein_id gnl|my_center|LOCUS_21940 2416115 2416567 gene locus_tag LOCUS_21950 2416115 2416567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 2419532 2416695 gene locus_tag LOCUS_21960 gene secA 2419532 2416695 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_21960 2419722 2420348 gene locus_tag LOCUS_21970 2419722 2420348 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028711.1 protein_id gnl|my_center|LOCUS_21970 2420428 2421603 gene locus_tag LOCUS_21980 2420428 2421603 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028712.1 protein_id gnl|my_center|LOCUS_21980 2422401 2421643 gene locus_tag LOCUS_21990 2422401 2421643 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_21990 2423279 2422587 gene locus_tag LOCUS_22000 gene raiA 2423279 2422587 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975803.1 protein_id gnl|my_center|LOCUS_22000 2424385 2423609 gene locus_tag LOCUS_22010 2424385 2423609 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028713.1 protein_id gnl|my_center|LOCUS_22010 2426276 2424411 gene locus_tag LOCUS_22020 2426276 2424411 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028714.1 protein_id gnl|my_center|LOCUS_22020 2428158 2426266 gene locus_tag LOCUS_22030 gene mtrB 2428158 2426266 CDS product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028715.1 protein_id gnl|my_center|LOCUS_22030 2428963 2428274 gene locus_tag LOCUS_22040 gene mtrA 2428963 2428274 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_22040 2430224 2428968 gene locus_tag LOCUS_22050 gene mtnA 2430224 2428968 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028716.1 protein_id gnl|my_center|LOCUS_22050 2430494 2431459 gene locus_tag LOCUS_22060 2430494 2431459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22060 2431464 2432156 gene locus_tag LOCUS_22070 2431464 2432156 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247888.1 protein_id gnl|my_center|LOCUS_22070 2432153 2433388 gene locus_tag LOCUS_22080 2432153 2433388 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484831.1 protein_id gnl|my_center|LOCUS_22080 2433385 2434422 gene locus_tag LOCUS_22090 2433385 2434422 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897409.1 protein_id gnl|my_center|LOCUS_22090 2434433 2435746 gene locus_tag LOCUS_22100 2434433 2435746 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028719.1 protein_id gnl|my_center|LOCUS_22100 2435971 2435861 gene locus_tag LOCUS_r00070 2435971 2435861 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2439175 2436055 gene locus_tag LOCUS_r00080 2439175 2436055 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2441003 2439481 gene locus_tag LOCUS_r00090 2441003 2439481 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2442710 2441703 gene locus_tag LOCUS_22110 2442710 2441703 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975791.1 protein_id gnl|my_center|LOCUS_22110 2442830 2443729 gene locus_tag LOCUS_22120 2442830 2443729 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975790.1 protein_id gnl|my_center|LOCUS_22120 2444343 2443726 gene locus_tag LOCUS_22130 2444343 2443726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975789.1 protein_id gnl|my_center|LOCUS_22130 2445946 2444489 gene locus_tag LOCUS_22140 gene ahcY 2445946 2444489 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_22140 2447187 2446207 gene locus_tag LOCUS_22150 2447187 2446207 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_22150 2448438 2447275 gene locus_tag LOCUS_22160 gene manA 2448438 2447275 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975786.1 protein_id gnl|my_center|LOCUS_22160 2449618 2448485 gene locus_tag LOCUS_22170 2449618 2448485 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975785.1 protein_id gnl|my_center|LOCUS_22170 2450150 2449728 gene locus_tag LOCUS_22180 2450150 2449728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2451592 2450225 gene locus_tag LOCUS_22190 2451592 2450225 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_22190 2452204 2451776 gene locus_tag LOCUS_22200 2452204 2451776 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975781.1 protein_id gnl|my_center|LOCUS_22200 2452474 2452902 gene locus_tag LOCUS_22210 2452474 2452902 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063628643.1 protein_id gnl|my_center|LOCUS_22210 2454447 2452927 gene locus_tag LOCUS_22220 2454447 2452927 CDS product DUF5719 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028724.1 protein_id gnl|my_center|LOCUS_22220 2458343 2454444 gene locus_tag LOCUS_22230 2458343 2454444 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028725.1 protein_id gnl|my_center|LOCUS_22230 2458876 2458613 gene locus_tag LOCUS_22240 2458876 2458613 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975777.1 protein_id gnl|my_center|LOCUS_22240 2459633 2460133 gene locus_tag LOCUS_22250 2459633 2460133 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028726.1 protein_id gnl|my_center|LOCUS_22250 2460117 2461103 gene locus_tag LOCUS_22260 gene cofD 2460117 2461103 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975775.1 protein_id gnl|my_center|LOCUS_22260 2461100 2462449 gene locus_tag LOCUS_22270 2461100 2462449 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028727.1 protein_id gnl|my_center|LOCUS_22270 2463484 2462528 gene locus_tag LOCUS_22280 2463484 2462528 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028728.1 protein_id gnl|my_center|LOCUS_22280 2464716 2463625 gene locus_tag LOCUS_22290 2464716 2463625 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028729.1 protein_id gnl|my_center|LOCUS_22290 2466134 2464794 gene locus_tag LOCUS_22300 2466134 2464794 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028730.1 protein_id gnl|my_center|LOCUS_22300 2466273 2467025 gene locus_tag LOCUS_22310 2466273 2467025 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975771.1 protein_id gnl|my_center|LOCUS_22310 2467213 2468706 gene locus_tag LOCUS_22320 2467213 2468706 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028731.1 protein_id gnl|my_center|LOCUS_22320 2468930 2470678 gene locus_tag LOCUS_22330 2468930 2470678 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486660.1 protein_id gnl|my_center|LOCUS_22330 2470724 2472457 gene locus_tag LOCUS_22340 2470724 2472457 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486658.1 protein_id gnl|my_center|LOCUS_22340 2473558 2472539 gene locus_tag LOCUS_22350 2473558 2472539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2473682 2475232 gene locus_tag LOCUS_22360 2473682 2475232 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326400.1 protein_id gnl|my_center|LOCUS_22360 2475796 2475248 gene locus_tag LOCUS_22370 2475796 2475248 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873063.1 protein_id gnl|my_center|LOCUS_22370 2475996 2477195 gene locus_tag LOCUS_22380 2475996 2477195 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284299.1 protein_id gnl|my_center|LOCUS_22380 2477745 2477269 gene locus_tag LOCUS_22390 2477745 2477269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 2478544 2477960 gene locus_tag LOCUS_22400 2478544 2477960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2479776 2478541 gene locus_tag LOCUS_22410 2479776 2478541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 2480522 2479773 gene locus_tag LOCUS_22420 2480522 2479773 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229941.1 protein_id gnl|my_center|LOCUS_22420 2481120 2480596 gene locus_tag LOCUS_22430 2481120 2480596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 2482313 2482104 gene locus_tag LOCUS_22440 2482313 2482104 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029810.1 protein_id gnl|my_center|LOCUS_22440 2483188 2482310 gene locus_tag LOCUS_22450 2483188 2482310 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028227.1 protein_id gnl|my_center|LOCUS_22450 2483191 2483790 gene locus_tag LOCUS_22460 2483191 2483790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 2483986 2485011 gene locus_tag LOCUS_22470 2483986 2485011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2485531 2485142 gene locus_tag LOCUS_22480 2485531 2485142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22480 2486740 2485634 gene locus_tag LOCUS_22490 2486740 2485634 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_22490 2487068 2488411 gene locus_tag LOCUS_22500 2487068 2488411 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 protein_id gnl|my_center|LOCUS_22500 2489725 2488532 gene locus_tag LOCUS_22510 2489725 2488532 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_22510 2490268 2489732 gene locus_tag LOCUS_22520 gene purE 2490268 2489732 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_22520 2491383 2490265 gene locus_tag LOCUS_22530 2491383 2490265 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975751.1 protein_id gnl|my_center|LOCUS_22530 2491624 2492223 gene locus_tag LOCUS_22540 2491624 2492223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 2493508 2492243 gene locus_tag LOCUS_22550 gene draK 2493508 2492243 CDS product two-component system sensor histidine kinase DraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028744.1 protein_id gnl|my_center|LOCUS_22550 2494201 2493524 gene locus_tag LOCUS_22560 2494201 2493524 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975748.1 protein_id gnl|my_center|LOCUS_22560 2494689 2496173 gene locus_tag LOCUS_22570 2494689 2496173 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975747.1 protein_id gnl|my_center|LOCUS_22570 2496880 2496389 gene locus_tag LOCUS_22580 2496880 2496389 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028746.1 protein_id gnl|my_center|LOCUS_22580 2497443 2497075 gene locus_tag LOCUS_22590 2497443 2497075 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975744.1 protein_id gnl|my_center|LOCUS_22590 2497726 2498685 gene locus_tag LOCUS_22600 2497726 2498685 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975743.1 protein_id gnl|my_center|LOCUS_22600 2500046 2498874 gene locus_tag LOCUS_22610 gene hutI 2500046 2498874 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028748.1 protein_id gnl|my_center|LOCUS_22610 2501467 2500091 gene locus_tag LOCUS_22620 2501467 2500091 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 protein_id gnl|my_center|LOCUS_22620 2502906 2501458 gene locus_tag LOCUS_22630 2502906 2501458 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028750.1 protein_id gnl|my_center|LOCUS_22630 2504561 2502903 gene locus_tag LOCUS_22640 2504561 2502903 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028751.1 protein_id gnl|my_center|LOCUS_22640 2504742 2506100 gene locus_tag LOCUS_22650 2504742 2506100 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777010.1 protein_id gnl|my_center|LOCUS_22650 2506142 2506642 gene locus_tag LOCUS_22660 2506142 2506642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027293.1 protein_id gnl|my_center|LOCUS_22660 2506639 2507436 gene locus_tag LOCUS_22670 2506639 2507436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978179.1 protein_id gnl|my_center|LOCUS_22670 2507478 2507945 gene locus_tag LOCUS_22680 2507478 2507945 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978180.1 protein_id gnl|my_center|LOCUS_22680 2508028 2508402 gene locus_tag LOCUS_22690 2508028 2508402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 protein_id gnl|my_center|LOCUS_22690 2509412 2508459 gene locus_tag LOCUS_22700 2509412 2508459 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028753.1 protein_id gnl|my_center|LOCUS_22700 2509786 2509553 gene locus_tag LOCUS_22710 2509786 2509553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2510806 2510054 gene locus_tag LOCUS_22720 2510806 2510054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 2511261 2510803 gene locus_tag LOCUS_22730 2511261 2510803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 2512807 2511272 gene locus_tag LOCUS_22740 2512807 2511272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22740 2513508 2512867 gene locus_tag LOCUS_22750 2513508 2512867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22750 2514615 2514292 gene locus_tag LOCUS_22760 2514615 2514292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 2514874 2515461 gene locus_tag LOCUS_22770 2514874 2515461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 2516925 2515522 gene locus_tag LOCUS_22780 2516925 2515522 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028755.1 protein_id gnl|my_center|LOCUS_22780 2517080 2518255 gene locus_tag LOCUS_22790 2517080 2518255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 2518379 2519599 gene locus_tag LOCUS_22800 2518379 2519599 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975732.1 protein_id gnl|my_center|LOCUS_22800 2519855 2520730 gene locus_tag LOCUS_22810 2519855 2520730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028756.1 protein_id gnl|my_center|LOCUS_22810 2521065 2520748 gene locus_tag LOCUS_22820 2521065 2520748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975730.1 protein_id gnl|my_center|LOCUS_22820 2522083 2521196 gene locus_tag LOCUS_22830 2522083 2521196 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975728.1 protein_id gnl|my_center|LOCUS_22830 2522386 2522301 gene locus_tag LOCUS_t00280 2522386 2522301 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2522621 2522896 gene locus_tag LOCUS_22840 2522621 2522896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 2523844 2522948 gene locus_tag LOCUS_22850 2523844 2522948 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080075.1 protein_id gnl|my_center|LOCUS_22850 2524788 2523844 gene locus_tag LOCUS_22860 2524788 2523844 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080073.1 protein_id gnl|my_center|LOCUS_22860 2525692 2524793 gene locus_tag LOCUS_22870 2525692 2524793 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080070.1 protein_id gnl|my_center|LOCUS_22870 2526684 2525689 gene locus_tag LOCUS_22880 2526684 2525689 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080068.1 protein_id gnl|my_center|LOCUS_22880 2528506 2526776 gene locus_tag LOCUS_22890 2528506 2526776 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080060.1 protein_id gnl|my_center|LOCUS_22890 2528729 2529748 gene locus_tag LOCUS_22900 2528729 2529748 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972694.1 protein_id gnl|my_center|LOCUS_22900 2529914 2530684 gene locus_tag LOCUS_22910 2529914 2530684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_22910 2530740 2533265 gene locus_tag LOCUS_22920 2530740 2533265 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_22920 2534638 2533334 gene locus_tag LOCUS_22930 2534638 2533334 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028761.1 protein_id gnl|my_center|LOCUS_22930 2536209 2534908 gene locus_tag LOCUS_22940 2536209 2534908 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486678.1 protein_id gnl|my_center|LOCUS_22940 2537670 2536705 gene locus_tag LOCUS_22950 2537670 2536705 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_22950 2538333 2537797 gene locus_tag LOCUS_22960 2538333 2537797 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_22960 2538848 2538378 gene locus_tag LOCUS_22970 gene divIC 2538848 2538378 CDS product cell division protein DivIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975716.1 protein_id gnl|my_center|LOCUS_22970 2540230 2538950 gene locus_tag LOCUS_22980 gene eno 2540230 2538950 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_22980 2541302 2540580 gene locus_tag LOCUS_22990 gene rpfA 2541302 2540580 CDS product resuscitation-promoting factor protein RpfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028764.1 protein_id gnl|my_center|LOCUS_22990 2542806 2541766 gene locus_tag LOCUS_23000 gene rpfC 2542806 2541766 CDS product resuscitation-promoting factor protein RpfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028765.1 protein_id gnl|my_center|LOCUS_23000 2544259 2542916 gene locus_tag LOCUS_23010 2544259 2542916 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 protein_id gnl|my_center|LOCUS_23010 2545410 2544433 gene locus_tag LOCUS_23020 2545410 2544433 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975711.1 protein_id gnl|my_center|LOCUS_23020 2546101 2545445 gene locus_tag LOCUS_23030 2546101 2545445 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975710.1 protein_id gnl|my_center|LOCUS_23030 2547847 2546285 gene locus_tag LOCUS_23040 gene pkaE 2547847 2546285 CDS product serine/threonine protein kinase PkaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028766.1 protein_id gnl|my_center|LOCUS_23040 2548428 2547844 gene locus_tag LOCUS_23050 2548428 2547844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028767.1 protein_id gnl|my_center|LOCUS_23050 2549321 2548563 gene locus_tag LOCUS_23060 2549321 2548563 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028771.1 protein_id gnl|my_center|LOCUS_23060 2550224 2549445 gene locus_tag LOCUS_23070 2550224 2549445 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213089169.1 protein_id gnl|my_center|LOCUS_23070 2550757 2550221 gene locus_tag LOCUS_23080 2550757 2550221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 2550909 2551301 gene locus_tag LOCUS_23090 2550909 2551301 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457988.1 protein_id gnl|my_center|LOCUS_23090 2554893 2551363 gene locus_tag LOCUS_23100 gene mfd 2554893 2551363 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_23100 2557776 2555194 gene locus_tag LOCUS_23110 2557776 2555194 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028773.1 protein_id gnl|my_center|LOCUS_23110 2558561 2557773 gene locus_tag LOCUS_23120 2558561 2557773 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028774.1 protein_id gnl|my_center|LOCUS_23120 2558940 2560604 gene locus_tag LOCUS_23130 2558940 2560604 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_23130 2561558 2560659 gene locus_tag LOCUS_23140 2561558 2560659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028777.1 protein_id gnl|my_center|LOCUS_23140 2564209 2561756 gene locus_tag LOCUS_23150 2564209 2561756 CDS product SUKH-4 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028778.1 protein_id gnl|my_center|LOCUS_23150 2565192 2564215 gene locus_tag LOCUS_23160 2565192 2564215 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028779.1 protein_id gnl|my_center|LOCUS_23160 2565453 2565977 gene locus_tag LOCUS_23170 2565453 2565977 CDS product YwqJ-related putative deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028780.1 protein_id gnl|my_center|LOCUS_23170 2565988 2566506 gene locus_tag LOCUS_23180 2565988 2566506 CDS product SUKH-3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975695.1 protein_id gnl|my_center|LOCUS_23180 2567873 2566554 gene locus_tag LOCUS_23190 2567873 2566554 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975694.1 protein_id gnl|my_center|LOCUS_23190 2568019 2568091 gene locus_tag LOCUS_t00290 2568019 2568091 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2568257 2569648 gene locus_tag LOCUS_23200 gene glmU 2568257 2569648 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_23200 2569768 2570751 gene locus_tag LOCUS_23210 2569768 2570751 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_23210 2570951 2571538 gene locus_tag LOCUS_23220 2570951 2571538 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975690.1 protein_id gnl|my_center|LOCUS_23220 2571672 2572265 gene locus_tag LOCUS_23230 gene pth 2571672 2572265 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975689.1 protein_id gnl|my_center|LOCUS_23230 2572341 2572811 gene locus_tag LOCUS_23240 2572341 2572811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028783.1 protein_id gnl|my_center|LOCUS_23240 2575581 2572852 gene locus_tag LOCUS_23250 gene ppc 2575581 2572852 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975687.1 protein_id gnl|my_center|LOCUS_23250 2575927 2576889 gene locus_tag LOCUS_23260 2575927 2576889 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975685.1 protein_id gnl|my_center|LOCUS_23260 2576886 2577572 gene locus_tag LOCUS_23270 2576886 2577572 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 protein_id gnl|my_center|LOCUS_23270 2577657 2578154 gene locus_tag LOCUS_23280 gene tamR 2577657 2578154 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_23280 2578913 2578113 gene locus_tag LOCUS_23290 2578913 2578113 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326434.1 protein_id gnl|my_center|LOCUS_23290 2579154 2579600 gene locus_tag LOCUS_23300 2579154 2579600 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975678.1 protein_id gnl|my_center|LOCUS_23300 2580762 2579593 gene locus_tag LOCUS_23310 gene galK 2580762 2579593 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_23310 2581745 2580759 gene locus_tag LOCUS_23320 gene galE 2581745 2580759 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975676.1 protein_id gnl|my_center|LOCUS_23320 2582785 2581742 gene locus_tag LOCUS_23330 gene galT 2582785 2581742 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028787.1 protein_id gnl|my_center|LOCUS_23330 2582998 2584668 gene locus_tag LOCUS_23340 2582998 2584668 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_23340 2584684 2584971 gene locus_tag LOCUS_23350 2584684 2584971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975673.1 protein_id gnl|my_center|LOCUS_23350 2585704 2585009 gene locus_tag LOCUS_23360 2585704 2585009 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028791.1 protein_id gnl|my_center|LOCUS_23360 2587672 2585945 gene locus_tag LOCUS_23370 2587672 2585945 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486695.1 protein_id gnl|my_center|LOCUS_23370 2589542 2587728 gene locus_tag LOCUS_23380 2589542 2587728 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456319.1 protein_id gnl|my_center|LOCUS_23380 2591635 2589818 gene locus_tag LOCUS_23390 2591635 2589818 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_23390 2592673 2591768 gene locus_tag LOCUS_23400 2592673 2591768 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028794.1 protein_id gnl|my_center|LOCUS_23400 2593554 2592670 gene locus_tag LOCUS_23410 gene rsmA 2593554 2592670 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_23410 2594906 2593551 gene locus_tag LOCUS_23420 2594906 2593551 CDS product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896836.1 protein_id gnl|my_center|LOCUS_23420 2595903 2595037 gene locus_tag LOCUS_23430 2595903 2595037 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_23430 2596314 2595958 gene locus_tag LOCUS_23440 2596314 2595958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028797.1 protein_id gnl|my_center|LOCUS_23440 2597365 2596493 gene locus_tag LOCUS_23450 gene rsmI 2597365 2596493 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_23450 2597428 2599194 gene locus_tag LOCUS_23460 2597428 2599194 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_23460 2600114 2599314 gene locus_tag LOCUS_23470 2600114 2599314 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027324.1 protein_id gnl|my_center|LOCUS_23470 2601256 2600111 gene locus_tag LOCUS_23480 2601256 2600111 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486733.1 protein_id gnl|my_center|LOCUS_23480 2601846 2601361 gene locus_tag LOCUS_23490 2601846 2601361 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224812.1 protein_id gnl|my_center|LOCUS_23490 2602613 2601843 gene locus_tag LOCUS_23500 2602613 2601843 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_23500 2603371 2602610 gene locus_tag LOCUS_23510 gene cbiQ 2603371 2602610 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_23510 2604434 2603373 gene locus_tag LOCUS_23520 2604434 2603373 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028801.1 protein_id gnl|my_center|LOCUS_23520 2604614 2604976 gene locus_tag LOCUS_23530 2604614 2604976 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975658.1 protein_id gnl|my_center|LOCUS_23530 2607377 2605140 gene locus_tag LOCUS_23540 2607377 2605140 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028805.1 protein_id gnl|my_center|LOCUS_23540 2608063 2607494 gene locus_tag LOCUS_23550 2608063 2607494 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975649.1 protein_id gnl|my_center|LOCUS_23550 2607947 2608255 gene locus_tag LOCUS_23560 2607947 2608255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 2608248 2611631 gene locus_tag LOCUS_23570 2608248 2611631 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486705.1 protein_id gnl|my_center|LOCUS_23570 2611928 2611731 gene locus_tag LOCUS_23580 2611928 2611731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 2612905 2612021 gene locus_tag LOCUS_23590 2612905 2612021 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028807.1 protein_id gnl|my_center|LOCUS_23590 2613831 2612902 gene locus_tag LOCUS_23600 2613831 2612902 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028808.1 protein_id gnl|my_center|LOCUS_23600 2615354 2613828 gene locus_tag LOCUS_23610 2615354 2613828 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028809.1 protein_id gnl|my_center|LOCUS_23610 2615490 2616167 gene locus_tag LOCUS_23620 2615490 2616167 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975643.1 protein_id gnl|my_center|LOCUS_23620 2617049 2616198 gene locus_tag LOCUS_23630 2617049 2616198 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456342.1 protein_id gnl|my_center|LOCUS_23630 2617064 2617543 gene locus_tag LOCUS_23640 2617064 2617543 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975641.1 protein_id gnl|my_center|LOCUS_23640 2618362 2617562 gene locus_tag LOCUS_23650 2618362 2617562 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228665.1 protein_id gnl|my_center|LOCUS_23650 2618626 2618551 gene locus_tag LOCUS_t00300 2618626 2618551 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2619902 2618712 gene locus_tag LOCUS_23660 2619902 2618712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975639.1 protein_id gnl|my_center|LOCUS_23660 2620680 2620060 gene locus_tag LOCUS_23670 2620680 2620060 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_23670 2621222 2620698 gene locus_tag LOCUS_23680 2621222 2620698 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_23680 2621719 2621219 gene locus_tag LOCUS_23690 gene moaC 2621719 2621219 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_23690 2623154 2621844 gene locus_tag LOCUS_23700 2623154 2621844 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_23700 2624061 2623159 gene locus_tag LOCUS_23710 gene galU 2624061 2623159 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_23710 2624197 2624754 gene locus_tag LOCUS_23720 2624197 2624754 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028815.1 protein_id gnl|my_center|LOCUS_23720 2627556 2624800 gene locus_tag LOCUS_23730 2627556 2624800 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_23730 2627818 2629524 gene locus_tag LOCUS_23740 2627818 2629524 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975632.1 protein_id gnl|my_center|LOCUS_23740 2629818 2631098 gene locus_tag LOCUS_23750 2629818 2631098 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975631.1 protein_id gnl|my_center|LOCUS_23750 2631592 2631320 gene locus_tag LOCUS_23760 2631592 2631320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2631613 2632503 gene locus_tag LOCUS_23770 2631613 2632503 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_23770 2632834 2633385 gene locus_tag LOCUS_23780 2632834 2633385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 2633499 2634017 gene locus_tag LOCUS_23790 gene mscL 2633499 2634017 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975627.1 protein_id gnl|my_center|LOCUS_23790 2634310 2634077 gene locus_tag LOCUS_23800 2634310 2634077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 2634754 2634332 gene locus_tag LOCUS_23810 2634754 2634332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 2635578 2634751 gene locus_tag LOCUS_23820 2635578 2634751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 2636177 2635575 gene locus_tag LOCUS_23830 2636177 2635575 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868595.1 protein_id gnl|my_center|LOCUS_23830 2638512 2636185 gene locus_tag LOCUS_23840 gene nasC 2638512 2636185 CDS product assimilatory nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246484.1 protein_id gnl|my_center|LOCUS_23840 2639657 2638509 gene locus_tag LOCUS_23850 2639657 2638509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2639949 2640695 gene locus_tag LOCUS_23860 2639949 2640695 CDS product DUF6227 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975622.1 protein_id gnl|my_center|LOCUS_23860 2642333 2640777 gene locus_tag LOCUS_23870 2642333 2640777 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_23870 2642401 2643441 gene locus_tag LOCUS_23880 2642401 2643441 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028824.1 protein_id gnl|my_center|LOCUS_23880 2644574 2643648 gene locus_tag LOCUS_23890 2644574 2643648 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975615.1 protein_id gnl|my_center|LOCUS_23890 2645004 2644780 gene locus_tag LOCUS_23900 2645004 2644780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2645813 2645034 gene locus_tag LOCUS_23910 2645813 2645034 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975613.1 protein_id gnl|my_center|LOCUS_23910 2645929 2646441 gene locus_tag LOCUS_23920 2645929 2646441 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028826.1 protein_id gnl|my_center|LOCUS_23920 2648063 2646540 gene locus_tag LOCUS_23930 2648063 2646540 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975611.1 protein_id gnl|my_center|LOCUS_23930 2648910 2648242 gene locus_tag LOCUS_23940 2648910 2648242 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029222.1 protein_id gnl|my_center|LOCUS_23940 2649187 2650464 gene locus_tag LOCUS_23950 2649187 2650464 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975609.1 protein_id gnl|my_center|LOCUS_23950 2652198 2650477 gene locus_tag LOCUS_23960 2652198 2650477 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_23960 2653407 2652235 gene locus_tag LOCUS_23970 2653407 2652235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107661203.1 protein_id gnl|my_center|LOCUS_23970 2653901 2653404 gene locus_tag LOCUS_23980 2653901 2653404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 2654757 2654320 gene locus_tag LOCUS_23990 2654757 2654320 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223693.1 protein_id gnl|my_center|LOCUS_23990 2655005 2655796 gene locus_tag LOCUS_24000 2655005 2655796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 2655921 2657081 gene locus_tag LOCUS_24010 gene argJ 2655921 2657081 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123874.1 protein_id gnl|my_center|LOCUS_24010 2657253 2658281 gene locus_tag LOCUS_24020 2657253 2658281 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026838.1 protein_id gnl|my_center|LOCUS_24020 2659983 2658316 gene locus_tag LOCUS_24030 2659983 2658316 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029224.1 protein_id gnl|my_center|LOCUS_24030 2660260 2661552 gene locus_tag LOCUS_24040 2660260 2661552 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027502.1 protein_id gnl|my_center|LOCUS_24040 2661549 2662697 gene locus_tag LOCUS_24050 2661549 2662697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 2662694 2664409 gene locus_tag LOCUS_24060 2662694 2664409 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973521.1 protein_id gnl|my_center|LOCUS_24060 2664406 2665428 gene locus_tag LOCUS_24070 2664406 2665428 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349826.1 protein_id gnl|my_center|LOCUS_24070 2666363 2665380 gene locus_tag LOCUS_24080 2666363 2665380 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230608.1 protein_id gnl|my_center|LOCUS_24080 2667673 2666360 gene locus_tag LOCUS_24090 2667673 2666360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 2667906 2667691 gene locus_tag LOCUS_24100 2667906 2667691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 2669144 2667903 gene locus_tag LOCUS_24110 2669144 2667903 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225435.1 protein_id gnl|my_center|LOCUS_24110 2669384 2670127 gene locus_tag LOCUS_24120 2669384 2670127 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896974.1 protein_id gnl|my_center|LOCUS_24120 2670252 2671931 gene locus_tag LOCUS_24130 2670252 2671931 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973521.1 protein_id gnl|my_center|LOCUS_24130 2673849 2672485 gene locus_tag LOCUS_24140 2673849 2672485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 2674060 2675778 gene locus_tag LOCUS_24150 gene alsS 2674060 2675778 CDS product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130149.1 protein_id gnl|my_center|LOCUS_24150 2675781 2677397 gene locus_tag LOCUS_24160 2675781 2677397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 2677402 2678361 gene locus_tag LOCUS_24170 gene speB 2677402 2678361 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 protein_id gnl|my_center|LOCUS_24170 2678358 2679338 gene locus_tag LOCUS_24180 2678358 2679338 CDS product clavaminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975576.1 protein_id gnl|my_center|LOCUS_24180 2679537 2680550 gene locus_tag LOCUS_24190 2679537 2680550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223664.1 protein_id gnl|my_center|LOCUS_24190 2680729 2680802 gene locus_tag LOCUS_t00310 2680729 2680802 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2680854 2681141 gene locus_tag LOCUS_24200 2680854 2681141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 2681138 2681380 gene locus_tag LOCUS_24210 2681138 2681380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 2683319 2681604 gene locus_tag LOCUS_24220 2683319 2681604 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929046.1 protein_id gnl|my_center|LOCUS_24220 2684348 2684914 gene locus_tag LOCUS_24230 2684348 2684914 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230158.1 protein_id gnl|my_center|LOCUS_24230 2685053 2685116 gene locus_tag LOCUS_t00320 2685053 2685116 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2685939 2685394 gene locus_tag LOCUS_24240 2685939 2685394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 2687309 2685936 gene locus_tag LOCUS_24250 2687309 2685936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 2687449 2687865 gene locus_tag LOCUS_24260 2687449 2687865 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189999469.1 protein_id gnl|my_center|LOCUS_24260 2687865 2688254 gene locus_tag LOCUS_24270 2687865 2688254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 2688437 2688604 gene locus_tag LOCUS_24280 2688437 2688604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 2688704 2688919 gene locus_tag LOCUS_24290 2688704 2688919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 2688919 2689884 gene locus_tag LOCUS_24300 gene tgmB 2688919 2689884 CDS product ATP-grasp ribosomal peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028637.1 protein_id gnl|my_center|LOCUS_24300 2689881 2691050 gene locus_tag LOCUS_24310 2689881 2691050 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228559.1 protein_id gnl|my_center|LOCUS_24310 2691116 2691493 gene locus_tag LOCUS_24320 2691116 2691493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 2692263 2691394 gene locus_tag LOCUS_24330 2692263 2691394 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030696.1 protein_id gnl|my_center|LOCUS_24330 2692491 2693531 gene locus_tag LOCUS_24340 2692491 2693531 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537421.1 protein_id gnl|my_center|LOCUS_24340 2693528 2694595 gene locus_tag LOCUS_24350 2693528 2694595 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776629.1 protein_id gnl|my_center|LOCUS_24350 2694592 2695419 gene locus_tag LOCUS_24360 2694592 2695419 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 protein_id gnl|my_center|LOCUS_24360 2695482 2696495 gene locus_tag LOCUS_24370 2695482 2696495 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015613.1 protein_id gnl|my_center|LOCUS_24370 2696612 2697799 gene locus_tag LOCUS_24380 2696612 2697799 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054234.1 protein_id gnl|my_center|LOCUS_24380 2697796 2699568 gene locus_tag LOCUS_24390 2697796 2699568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 2699575 2700855 gene locus_tag LOCUS_24400 2699575 2700855 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477388.1 protein_id gnl|my_center|LOCUS_24400 2700855 2702615 gene locus_tag LOCUS_24410 2700855 2702615 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030750.1 protein_id gnl|my_center|LOCUS_24410 2702619 2703821 gene locus_tag LOCUS_24420 2702619 2703821 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038170.1 protein_id gnl|my_center|LOCUS_24420 2704150 2703896 gene locus_tag LOCUS_24430 2704150 2703896 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978728.1 protein_id gnl|my_center|LOCUS_24430 2704647 2704150 gene locus_tag LOCUS_24440 2704647 2704150 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026883.1 protein_id gnl|my_center|LOCUS_24440 2706685 2704814 gene locus_tag LOCUS_24450 2706685 2704814 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029653.1 protein_id gnl|my_center|LOCUS_24450 2709355 2706836 gene locus_tag LOCUS_24460 2709355 2706836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 2709550 2710269 gene locus_tag LOCUS_24470 2709550 2710269 CDS product GPP34 family phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974541.1 protein_id gnl|my_center|LOCUS_24470 2710479 2711336 gene locus_tag LOCUS_24480 2710479 2711336 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_24480 2711559 2711765 gene locus_tag LOCUS_24490 2711559 2711765 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974539.1 protein_id gnl|my_center|LOCUS_24490 2712484 2714064 gene locus_tag LOCUS_24500 2712484 2714064 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029652.1 protein_id gnl|my_center|LOCUS_24500 2715255 2714140 gene locus_tag LOCUS_24510 2715255 2714140 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974547.1 protein_id gnl|my_center|LOCUS_24510 2715952 2715479 gene locus_tag LOCUS_24520 2715952 2715479 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028645.1 protein_id gnl|my_center|LOCUS_24520 2718713 2716170 gene locus_tag LOCUS_24530 2718713 2716170 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029648.1 protein_id gnl|my_center|LOCUS_24530 2718874 2719560 gene locus_tag LOCUS_24540 2718874 2719560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 2721082 2719598 gene locus_tag LOCUS_24550 2721082 2719598 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974950.1 protein_id gnl|my_center|LOCUS_24550 2722168 2721287 gene locus_tag LOCUS_24560 2722168 2721287 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031039612.1 protein_id gnl|my_center|LOCUS_24560 2722323 2723180 gene locus_tag LOCUS_24570 2722323 2723180 CDS product DUF4344 domain-containing metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726965.1 protein_id gnl|my_center|LOCUS_24570 2725983 2723200 gene locus_tag LOCUS_24580 2725983 2723200 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029405.1 protein_id gnl|my_center|LOCUS_24580 2726097 2726828 gene locus_tag LOCUS_24590 2726097 2726828 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029404.1 protein_id gnl|my_center|LOCUS_24590 2728421 2726856 gene locus_tag LOCUS_24600 2728421 2726856 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727782.1 protein_id gnl|my_center|LOCUS_24600 2730676 2728763 gene locus_tag LOCUS_24610 2730676 2728763 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029698.1 protein_id gnl|my_center|LOCUS_24610 2730557 2730832 gene locus_tag LOCUS_24620 2730557 2730832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 2730887 2731255 gene locus_tag LOCUS_24630 2730887 2731255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 2731261 2732094 gene locus_tag LOCUS_24640 2731261 2732094 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029696.1 protein_id gnl|my_center|LOCUS_24640 2732779 2732102 gene locus_tag LOCUS_24650 2732779 2732102 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029695.1 protein_id gnl|my_center|LOCUS_24650 2734249 2732873 gene locus_tag LOCUS_24660 2734249 2732873 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974451.1 protein_id gnl|my_center|LOCUS_24660 2734149 2734448 gene locus_tag LOCUS_24670 2734149 2734448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 2735003 2734710 gene locus_tag LOCUS_24680 2735003 2734710 CDS product DUF4229 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974452.1 protein_id gnl|my_center|LOCUS_24680 2735643 2735041 gene locus_tag LOCUS_24690 2735643 2735041 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029694.1 protein_id gnl|my_center|LOCUS_24690 2736973 2735795 gene locus_tag LOCUS_24700 gene mqnE 2736973 2735795 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974455.1 protein_id gnl|my_center|LOCUS_24700 2737462 2737007 gene locus_tag LOCUS_24710 2737462 2737007 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974456.1 protein_id gnl|my_center|LOCUS_24710 2738208 2737564 gene locus_tag LOCUS_24720 2738208 2737564 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974457.1 protein_id gnl|my_center|LOCUS_24720 2738367 2738963 gene locus_tag LOCUS_24730 2738367 2738963 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084689.1 protein_id gnl|my_center|LOCUS_24730 2739894 2738953 gene locus_tag LOCUS_24740 2739894 2738953 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029692.1 protein_id gnl|my_center|LOCUS_24740 2741348 2739891 gene locus_tag LOCUS_24750 2741348 2739891 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974459.1 protein_id gnl|my_center|LOCUS_24750 2741681 2742088 gene locus_tag LOCUS_24760 2741681 2742088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 2743241 2742156 gene locus_tag LOCUS_24770 gene ccsB 2743241 2742156 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029680.1 protein_id gnl|my_center|LOCUS_24770 2744956 2743238 gene locus_tag LOCUS_24780 2744956 2743238 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029679.1 protein_id gnl|my_center|LOCUS_24780 2745716 2744961 gene locus_tag LOCUS_24790 2745716 2744961 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974477.1 protein_id gnl|my_center|LOCUS_24790 2746323 2745721 gene locus_tag LOCUS_24800 2746323 2745721 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029677.1 protein_id gnl|my_center|LOCUS_24800 2747644 2746391 gene locus_tag LOCUS_24810 2747644 2746391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029676.1 protein_id gnl|my_center|LOCUS_24810 2748543 2747851 gene locus_tag LOCUS_24820 2748543 2747851 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974480.1 protein_id gnl|my_center|LOCUS_24820 2749913 2748540 gene locus_tag LOCUS_24830 gene hemL 2749913 2748540 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029675.1 protein_id gnl|my_center|LOCUS_24830 2750122 2750289 gene locus_tag LOCUS_24840 2750122 2750289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 2750280 2750717 gene locus_tag LOCUS_24850 2750280 2750717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974483.1 protein_id gnl|my_center|LOCUS_24850 2750999 2750790 gene locus_tag LOCUS_24860 2750999 2750790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 2750911 2751159 gene locus_tag LOCUS_24870 2750911 2751159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 2751381 2751770 gene locus_tag LOCUS_24880 2751381 2751770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 2751665 2752234 gene locus_tag LOCUS_24890 2751665 2752234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 2752268 2752648 gene locus_tag LOCUS_24900 2752268 2752648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 2753183 2752701 gene locus_tag LOCUS_24910 2753183 2752701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 2753321 2753671 gene locus_tag LOCUS_24920 2753321 2753671 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028891.1 protein_id gnl|my_center|LOCUS_24920 2753777 2754535 gene locus_tag LOCUS_24930 2753777 2754535 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975536.1 protein_id gnl|my_center|LOCUS_24930 2755800 2754607 gene locus_tag LOCUS_24940 2755800 2754607 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028892.1 protein_id gnl|my_center|LOCUS_24940 2755963 2756787 gene locus_tag LOCUS_24950 2755963 2756787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975534.1 protein_id gnl|my_center|LOCUS_24950 2757025 2757867 gene locus_tag LOCUS_24960 2757025 2757867 CDS product DUF3558 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668737.1 protein_id gnl|my_center|LOCUS_24960 2758067 2759437 gene locus_tag LOCUS_24970 2758067 2759437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 2761272 2759518 gene locus_tag LOCUS_24980 gene lysS 2761272 2759518 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975532.1 protein_id gnl|my_center|LOCUS_24980 2761375 2763189 gene locus_tag LOCUS_24990 gene argS 2761375 2763189 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028896.1 protein_id gnl|my_center|LOCUS_24990 2763684 2763259 gene locus_tag LOCUS_25000 2763684 2763259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 2764971 2763811 gene locus_tag LOCUS_25010 2764971 2763811 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972063.1 protein_id gnl|my_center|LOCUS_25010 2765611 2765093 gene locus_tag LOCUS_25020 2765611 2765093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 2765736 2766560 gene locus_tag LOCUS_25030 2765736 2766560 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226025318.1 protein_id gnl|my_center|LOCUS_25030 2766557 2766808 gene locus_tag LOCUS_25040 2766557 2766808 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030672.1 protein_id gnl|my_center|LOCUS_25040 2766834 2767493 gene locus_tag LOCUS_25050 2766834 2767493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805165.1 protein_id gnl|my_center|LOCUS_25050 2768561 2767569 gene locus_tag LOCUS_25060 gene hemB 2768561 2767569 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028903.1 protein_id gnl|my_center|LOCUS_25060 2770110 2768683 gene locus_tag LOCUS_25070 2770110 2768683 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975519.1 protein_id gnl|my_center|LOCUS_25070 2771333 2770347 gene locus_tag LOCUS_25080 gene hemC 2771333 2770347 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975518.1 protein_id gnl|my_center|LOCUS_25080 2772808 2771330 gene locus_tag LOCUS_25090 2772808 2771330 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028907.1 protein_id gnl|my_center|LOCUS_25090 2773500 2772805 gene locus_tag LOCUS_25100 2773500 2772805 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_25100 2774171 2773848 gene locus_tag LOCUS_25110 2774171 2773848 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030145241.1 protein_id gnl|my_center|LOCUS_25110 2774258 2775190 gene locus_tag LOCUS_25120 2774258 2775190 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666589.1 protein_id gnl|my_center|LOCUS_25120 2775782 2776561 gene locus_tag LOCUS_25130 2775782 2776561 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975513.1 protein_id gnl|my_center|LOCUS_25130 2776780 2777976 gene locus_tag LOCUS_25140 2776780 2777976 CDS product DUF5667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495181.1 protein_id gnl|my_center|LOCUS_25140 2779123 2778056 gene locus_tag LOCUS_25150 2779123 2778056 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975511.1 protein_id gnl|my_center|LOCUS_25150 2780197 2779139 gene locus_tag LOCUS_25160 2780197 2779139 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_25160 2780809 2780597 gene locus_tag LOCUS_25170 2780809 2780597 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004984898.1 protein_id gnl|my_center|LOCUS_25170 2781771 2780938 gene locus_tag LOCUS_25180 2781771 2780938 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028912.1 protein_id gnl|my_center|LOCUS_25180 2783047 2781875 gene locus_tag LOCUS_25190 2783047 2781875 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326515.1 protein_id gnl|my_center|LOCUS_25190 2783789 2783145 gene locus_tag LOCUS_25200 2783789 2783145 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975504.1 protein_id gnl|my_center|LOCUS_25200 2783976 2783866 gene locus_tag LOCUS_r00100 2783976 2783866 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2787180 2784060 gene locus_tag LOCUS_r00110 2787180 2784060 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2789008 2787486 gene locus_tag LOCUS_r00120 2789008 2787486 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2790645 2789644 gene locus_tag LOCUS_25210 2790645 2789644 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975498.1 protein_id gnl|my_center|LOCUS_25210 2790692 2791303 gene locus_tag LOCUS_25220 2790692 2791303 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028916.1 protein_id gnl|my_center|LOCUS_25220 2792116 2791307 gene locus_tag LOCUS_25230 gene proC 2792116 2791307 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 protein_id gnl|my_center|LOCUS_25230 2792940 2792179 gene locus_tag LOCUS_25240 2792940 2792179 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028918.1 protein_id gnl|my_center|LOCUS_25240 2793563 2792937 gene locus_tag LOCUS_25250 2793563 2792937 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028919.1 protein_id gnl|my_center|LOCUS_25250 2793456 2793773 gene locus_tag LOCUS_25260 2793456 2793773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 2794925 2794389 gene locus_tag LOCUS_25270 2794925 2794389 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028921.1 protein_id gnl|my_center|LOCUS_25270 2795259 2794957 gene locus_tag LOCUS_25280 2795259 2794957 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326518.1 protein_id gnl|my_center|LOCUS_25280 2795479 2797557 gene locus_tag LOCUS_25290 2795479 2797557 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028924.1 protein_id gnl|my_center|LOCUS_25290 2799471 2797621 gene locus_tag LOCUS_25300 gene ilvD 2799471 2797621 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028925.1 protein_id gnl|my_center|LOCUS_25300 2800219 2799602 gene locus_tag LOCUS_25310 2800219 2799602 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 protein_id gnl|my_center|LOCUS_25310 2801028 2800216 gene locus_tag LOCUS_25320 2801028 2800216 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 protein_id gnl|my_center|LOCUS_25320 2802078 2801152 gene locus_tag LOCUS_25330 2802078 2801152 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 protein_id gnl|my_center|LOCUS_25330 2802191 2803003 gene locus_tag LOCUS_25340 2802191 2803003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_25340 2804837 2803014 gene locus_tag LOCUS_25350 2804837 2803014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172595308.1 protein_id gnl|my_center|LOCUS_25350 2804983 2806395 gene locus_tag LOCUS_25360 gene radA 2804983 2806395 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_25360 2806539 2807663 gene locus_tag LOCUS_25370 gene disA 2806539 2807663 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_25370 2808662 2807823 gene locus_tag LOCUS_25380 2808662 2807823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851224.1 protein_id gnl|my_center|LOCUS_25380 2808892 2809794 gene locus_tag LOCUS_25390 2808892 2809794 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_25390 2809935 2810555 gene locus_tag LOCUS_25400 2809935 2810555 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975479.1 protein_id gnl|my_center|LOCUS_25400 2810543 2811268 gene locus_tag LOCUS_25410 2810543 2811268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943984.1 protein_id gnl|my_center|LOCUS_25410 2811310 2812023 gene locus_tag LOCUS_25420 gene cseB 2811310 2812023 CDS product two-component system response regulator CseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975477.1 protein_id gnl|my_center|LOCUS_25420 2812020 2813381 gene locus_tag LOCUS_25430 2812020 2813381 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028932.1 protein_id gnl|my_center|LOCUS_25430 2814193 2813462 gene locus_tag LOCUS_25440 2814193 2813462 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028939.1 protein_id gnl|my_center|LOCUS_25440 2814650 2815015 gene locus_tag LOCUS_25450 2814650 2815015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227275.1 protein_id gnl|my_center|LOCUS_25450 2815012 2818257 gene locus_tag LOCUS_25460 2815012 2818257 CDS product NACHT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028942.1 protein_id gnl|my_center|LOCUS_25460 2820875 2818347 gene locus_tag LOCUS_25470 2820875 2818347 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_25470 2821317 2821907 gene locus_tag LOCUS_25480 2821317 2821907 CDS product SCO3374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028943.1 protein_id gnl|my_center|LOCUS_25480 2822221 2821886 gene locus_tag LOCUS_25490 2822221 2821886 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975458.1 protein_id gnl|my_center|LOCUS_25490 2822935 2822366 gene locus_tag LOCUS_25500 2822935 2822366 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975457.1 protein_id gnl|my_center|LOCUS_25500 2823379 2822945 gene locus_tag LOCUS_25510 2823379 2822945 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975456.1 protein_id gnl|my_center|LOCUS_25510 2823669 2823490 gene locus_tag LOCUS_25520 2823669 2823490 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028944.1 protein_id gnl|my_center|LOCUS_25520 2824319 2823738 gene locus_tag LOCUS_25530 2824319 2823738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185034146.1 protein_id gnl|my_center|LOCUS_25530 2825254 2824457 gene locus_tag LOCUS_25540 2825254 2824457 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_25540 2826291 2825254 gene locus_tag LOCUS_25550 gene nadC 2826291 2825254 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975452.1 protein_id gnl|my_center|LOCUS_25550 2828030 2826288 gene locus_tag LOCUS_25560 2828030 2826288 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 protein_id gnl|my_center|LOCUS_25560 2829064 2828027 gene locus_tag LOCUS_25570 gene panC 2829064 2828027 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975450.1 protein_id gnl|my_center|LOCUS_25570 2830026 2829061 gene locus_tag LOCUS_25580 2830026 2829061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25580 2830193 2831356 gene locus_tag LOCUS_25590 2830193 2831356 CDS product beta-eliminating lyase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028948.1 protein_id gnl|my_center|LOCUS_25590 2831636 2831463 gene locus_tag LOCUS_25600 2831636 2831463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 2831740 2832852 gene locus_tag LOCUS_25610 2831740 2832852 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028949.1 protein_id gnl|my_center|LOCUS_25610 2833553 2832879 gene locus_tag LOCUS_25620 2833553 2832879 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975444.1 protein_id gnl|my_center|LOCUS_25620 2834817 2833615 gene locus_tag LOCUS_25630 2834817 2833615 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_25630 2834914 2835891 gene locus_tag LOCUS_25640 2834914 2835891 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028950.1 protein_id gnl|my_center|LOCUS_25640 2836034 2837176 gene locus_tag LOCUS_25650 2836034 2837176 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_25650 2838181 2837210 gene locus_tag LOCUS_25660 2838181 2837210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 2839376 2838354 gene locus_tag LOCUS_25670 2839376 2838354 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776965.1 protein_id gnl|my_center|LOCUS_25670 2840055 2839381 gene locus_tag LOCUS_25680 2840055 2839381 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092015.1 protein_id gnl|my_center|LOCUS_25680 2840778 2840059 gene locus_tag LOCUS_25690 2840778 2840059 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972858.1 protein_id gnl|my_center|LOCUS_25690 2840920 2842107 gene locus_tag LOCUS_25700 2840920 2842107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969992.1 protein_id gnl|my_center|LOCUS_25700 2842200 2843051 gene locus_tag LOCUS_25710 gene folP 2842200 2843051 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_25710 2843048 2843530 gene locus_tag LOCUS_25720 2843048 2843530 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975434.1 protein_id gnl|my_center|LOCUS_25720 2843720 2844079 gene locus_tag LOCUS_25730 gene folB 2843720 2844079 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028954.1 protein_id gnl|my_center|LOCUS_25730 2844076 2844687 gene locus_tag LOCUS_25740 gene folK 2844076 2844687 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975432.1 protein_id gnl|my_center|LOCUS_25740 2844770 2845264 gene locus_tag LOCUS_25750 2844770 2845264 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975431.1 protein_id gnl|my_center|LOCUS_25750 2845930 2845325 gene locus_tag LOCUS_25760 gene folE 2845930 2845325 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_25760 2848154 2846094 gene locus_tag LOCUS_25770 gene ftsH 2848154 2846094 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_25770 2848928 2848374 gene locus_tag LOCUS_25780 gene hpt 2848928 2848374 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_25780 2850086 2848998 gene locus_tag LOCUS_25790 gene tilS 2850086 2848998 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 protein_id gnl|my_center|LOCUS_25790 2851384 2850275 gene locus_tag LOCUS_25800 2851384 2850275 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_25800 2852942 2851458 gene locus_tag LOCUS_25810 gene dacB 2852942 2851458 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485148.1 protein_id gnl|my_center|LOCUS_25810 2853029 2853523 gene locus_tag LOCUS_25820 2853029 2853523 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_25820 2853701 2855401 gene locus_tag LOCUS_25830 2853701 2855401 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975423.1 protein_id gnl|my_center|LOCUS_25830 2856191 2855421 gene locus_tag LOCUS_25840 2856191 2855421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 2857153 2856395 gene locus_tag LOCUS_25850 2857153 2856395 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975420.1 protein_id gnl|my_center|LOCUS_25850 2858112 2857294 gene locus_tag LOCUS_25860 2858112 2857294 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975416.1 protein_id gnl|my_center|LOCUS_25860 2859029 2858109 gene locus_tag LOCUS_25870 2859029 2858109 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028963.1 protein_id gnl|my_center|LOCUS_25870 2859778 2859137 gene locus_tag LOCUS_25880 2859778 2859137 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028964.1 protein_id gnl|my_center|LOCUS_25880 2860359 2859796 gene locus_tag LOCUS_25890 2860359 2859796 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223116.1 protein_id gnl|my_center|LOCUS_25890 2861921 2860464 gene locus_tag LOCUS_25900 2861921 2860464 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028965.1 protein_id gnl|my_center|LOCUS_25900 2862821 2861985 gene locus_tag LOCUS_25910 2862821 2861985 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_25910 2863208 2863735 gene locus_tag LOCUS_25920 2863208 2863735 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028967.1 protein_id gnl|my_center|LOCUS_25920 2864099 2863839 gene locus_tag LOCUS_25930 2864099 2863839 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028968.1 protein_id gnl|my_center|LOCUS_25930 2864330 2864902 gene locus_tag LOCUS_25940 2864330 2864902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 2866239 2865052 gene locus_tag LOCUS_25950 2866239 2865052 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028973.1 protein_id gnl|my_center|LOCUS_25950 2866362 2868059 gene locus_tag LOCUS_25960 2866362 2868059 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228747.1 protein_id gnl|my_center|LOCUS_25960 2869029 2868166 gene locus_tag LOCUS_25970 2869029 2868166 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029265.1 protein_id gnl|my_center|LOCUS_25970 2870440 2869064 gene locus_tag LOCUS_25980 2870440 2869064 CDS product alpha-lytic protease prodomain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029803.1 protein_id gnl|my_center|LOCUS_25980 2870680 2871387 gene locus_tag LOCUS_25990 2870680 2871387 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976493.1 protein_id gnl|my_center|LOCUS_25990 2871668 2871594 gene locus_tag LOCUS_t00330 2871668 2871594 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2873355 2871778 gene locus_tag LOCUS_26000 2873355 2871778 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 protein_id gnl|my_center|LOCUS_26000 2874665 2873460 gene locus_tag LOCUS_26010 2874665 2873460 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 protein_id gnl|my_center|LOCUS_26010 2878330 2874971 gene locus_tag LOCUS_26020 2878330 2874971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 2881352 2878482 gene locus_tag LOCUS_26030 gene topA 2881352 2878482 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029075.1 protein_id gnl|my_center|LOCUS_26030 2881841 2881644 gene locus_tag LOCUS_26040 2881841 2881644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485159.1 protein_id gnl|my_center|LOCUS_26040 2883806 2882301 gene locus_tag LOCUS_26050 2883806 2882301 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975390.1 protein_id gnl|my_center|LOCUS_26050 2884558 2883944 gene locus_tag LOCUS_26060 2884558 2883944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975389.1 protein_id gnl|my_center|LOCUS_26060 2887194 2884804 gene locus_tag LOCUS_26070 2887194 2884804 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029076.1 protein_id gnl|my_center|LOCUS_26070 2887898 2887431 gene locus_tag LOCUS_26080 2887898 2887431 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975387.1 protein_id gnl|my_center|LOCUS_26080 2888456 2888103 gene locus_tag LOCUS_26090 gene bldG 2888456 2888103 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_26090 2888679 2891009 gene locus_tag LOCUS_26100 2888679 2891009 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_26100 2891749 2891390 gene locus_tag LOCUS_26110 2891749 2891390 CDS product TadE family type IV pilus minor pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181825002.1 protein_id gnl|my_center|LOCUS_26110 2892011 2891790 gene locus_tag LOCUS_26120 2892011 2891790 CDS product DUF4244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029080.1 protein_id gnl|my_center|LOCUS_26120 2892718 2892113 gene locus_tag LOCUS_26130 2892718 2892113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26130 2893767 2892904 gene locus_tag LOCUS_26140 2893767 2892904 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867821.1 protein_id gnl|my_center|LOCUS_26140 2894912 2893764 gene locus_tag LOCUS_26150 2894912 2893764 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_26150 2895985 2894909 gene locus_tag LOCUS_26160 2895985 2894909 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029084.1 protein_id gnl|my_center|LOCUS_26160 2896544 2897383 gene locus_tag LOCUS_26170 2896544 2897383 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 protein_id gnl|my_center|LOCUS_26170 2898663 2897812 gene locus_tag LOCUS_26180 2898663 2897812 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975377.1 protein_id gnl|my_center|LOCUS_26180 2898732 2899733 gene locus_tag LOCUS_26190 2898732 2899733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326561.1 protein_id gnl|my_center|LOCUS_26190 2901163 2899832 gene locus_tag LOCUS_26200 2901163 2899832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029086.1 protein_id gnl|my_center|LOCUS_26200 2901448 2903985 gene locus_tag LOCUS_26210 2901448 2903985 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029087.1 protein_id gnl|my_center|LOCUS_26210 2904280 2906235 gene locus_tag LOCUS_26220 gene acs 2904280 2906235 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_26220 2906487 2907887 gene locus_tag LOCUS_26230 gene nhaA 2906487 2907887 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029088.1 protein_id gnl|my_center|LOCUS_26230 2907927 2908457 gene locus_tag LOCUS_26240 2907927 2908457 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975371.1 protein_id gnl|my_center|LOCUS_26240 2908559 2909431 gene locus_tag LOCUS_26250 2908559 2909431 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029089.1 protein_id gnl|my_center|LOCUS_26250 2909537 2909740 gene locus_tag LOCUS_26260 2909537 2909740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 2911021 2909822 gene locus_tag LOCUS_26270 2911021 2909822 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 protein_id gnl|my_center|LOCUS_26270 2911936 2911121 gene locus_tag LOCUS_26280 2911936 2911121 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_26280 2912806 2911991 gene locus_tag LOCUS_26290 2912806 2911991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26290 2913173 2913847 gene locus_tag LOCUS_26300 2913173 2913847 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_26300 2914739 2913909 gene locus_tag LOCUS_26310 2914739 2913909 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_26310 2915629 2914736 gene locus_tag LOCUS_26320 2915629 2914736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_26320 2916238 2915825 gene locus_tag LOCUS_26330 2916238 2915825 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_26330 2916477 2916295 gene locus_tag LOCUS_26340 2916477 2916295 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975360.1 protein_id gnl|my_center|LOCUS_26340 2916525 2917499 gene locus_tag LOCUS_26350 2916525 2917499 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029095.1 protein_id gnl|my_center|LOCUS_26350 2917496 2918890 gene locus_tag LOCUS_26360 2917496 2918890 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029096.1 protein_id gnl|my_center|LOCUS_26360 2919293 2918943 gene locus_tag LOCUS_26370 gene wblA 2919293 2918943 CDS product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 protein_id gnl|my_center|LOCUS_26370 2919700 2921952 gene locus_tag LOCUS_26380 2919700 2921952 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_26380 2922760 2922269 gene locus_tag LOCUS_26390 2922760 2922269 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_26390 2922813 2923751 gene locus_tag LOCUS_26400 2922813 2923751 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975354.1 protein_id gnl|my_center|LOCUS_26400 2923882 2923956 gene locus_tag LOCUS_t00340 2923882 2923956 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2924407 2924051 gene locus_tag LOCUS_26410 2924407 2924051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26410 2925699 2924755 gene locus_tag LOCUS_26420 2925699 2924755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 2926326 2926171 gene locus_tag LOCUS_26430 2926326 2926171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 2926561 2927193 gene locus_tag LOCUS_26440 2926561 2927193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 2927498 2928484 gene locus_tag LOCUS_26450 2927498 2928484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 2928604 2928404 gene locus_tag LOCUS_26460 2928604 2928404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 2929167 2928901 gene locus_tag LOCUS_26470 2929167 2928901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 2929296 2930696 gene locus_tag LOCUS_26480 2929296 2930696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 2932461 2930740 gene locus_tag LOCUS_26490 gene metG 2932461 2930740 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338224.1 protein_id gnl|my_center|LOCUS_26490 2933463 2933188 gene locus_tag LOCUS_26500 2933463 2933188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 2934292 2933519 gene locus_tag LOCUS_26510 2934292 2933519 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409545.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26510 2934754 2935485 gene locus_tag LOCUS_26520 2934754 2935485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 2935515 2936039 gene locus_tag LOCUS_26530 2935515 2936039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 2937533 2936526 gene locus_tag LOCUS_26540 2937533 2936526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 2938227 2937562 gene locus_tag LOCUS_26550 2938227 2937562 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029186.1 protein_id gnl|my_center|LOCUS_26550 2940369 2938234 gene locus_tag LOCUS_26560 gene kdpB 2940369 2938234 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029187.1 protein_id gnl|my_center|LOCUS_26560 2942030 2940366 gene locus_tag LOCUS_26570 gene kdpA 2942030 2940366 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029188.1 protein_id gnl|my_center|LOCUS_26570 2942667 2943461 gene locus_tag LOCUS_26580 2942667 2943461 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_26580 2944400 2943564 gene locus_tag LOCUS_26590 2944400 2943564 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_26590 2944489 2946330 gene locus_tag LOCUS_26600 2944489 2946330 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975329.1 protein_id gnl|my_center|LOCUS_26600 2947605 2946460 gene locus_tag LOCUS_26610 2947605 2946460 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029664.1 protein_id gnl|my_center|LOCUS_26610 2948021 2947614 gene locus_tag LOCUS_26620 2948021 2947614 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974528.1 protein_id gnl|my_center|LOCUS_26620 2948166 2948969 gene locus_tag LOCUS_26630 2948166 2948969 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943910.1 protein_id gnl|my_center|LOCUS_26630 2950413 2949022 gene locus_tag LOCUS_26640 2950413 2949022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029120.1 protein_id gnl|my_center|LOCUS_26640 2950961 2950461 gene locus_tag LOCUS_26650 2950961 2950461 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975326.1 protein_id gnl|my_center|LOCUS_26650 2952458 2951394 gene locus_tag LOCUS_26660 2952458 2951394 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 protein_id gnl|my_center|LOCUS_26660 2953726 2952455 gene locus_tag LOCUS_26670 2953726 2952455 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_26670 2954924 2953944 gene locus_tag LOCUS_26680 2954924 2953944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 2955923 2955264 gene locus_tag LOCUS_26690 2955923 2955264 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975322.1 protein_id gnl|my_center|LOCUS_26690 2956588 2955989 gene locus_tag LOCUS_26700 gene recR 2956588 2955989 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_26700 2957051 2956716 gene locus_tag LOCUS_26710 2957051 2956716 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975320.1 protein_id gnl|my_center|LOCUS_26710 2957364 2958146 gene locus_tag LOCUS_26720 2957364 2958146 CDS product SLATT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029121.1 protein_id gnl|my_center|LOCUS_26720 2958910 2958194 gene locus_tag LOCUS_26730 2958910 2958194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975315.1 protein_id gnl|my_center|LOCUS_26730 2959663 2958926 gene locus_tag LOCUS_26740 2959663 2958926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 2961110 2959791 gene locus_tag LOCUS_26750 2961110 2959791 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029123.1 protein_id gnl|my_center|LOCUS_26750 2961309 2961926 gene locus_tag LOCUS_26760 2961309 2961926 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903504.1 protein_id gnl|my_center|LOCUS_26760 2961923 2962411 gene locus_tag LOCUS_26770 2961923 2962411 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394231.1 protein_id gnl|my_center|LOCUS_26770 2962903 2962436 gene locus_tag LOCUS_26780 2962903 2962436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 2962998 2963834 gene locus_tag LOCUS_26790 2962998 2963834 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486778.1 protein_id gnl|my_center|LOCUS_26790 2963831 2964067 gene locus_tag LOCUS_26800 2963831 2964067 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030672.1 protein_id gnl|my_center|LOCUS_26800 2965637 2964144 gene locus_tag LOCUS_26810 2965637 2964144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 2966912 2966028 gene locus_tag LOCUS_26820 2966912 2966028 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031550.1 protein_id gnl|my_center|LOCUS_26820 2967204 2968730 gene locus_tag LOCUS_26830 2967204 2968730 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028346.1 protein_id gnl|my_center|LOCUS_26830 2970093 2968810 gene locus_tag LOCUS_26840 2970093 2968810 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_26840 2970279 2971136 gene locus_tag LOCUS_26850 2970279 2971136 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029127.1 protein_id gnl|my_center|LOCUS_26850 2972421 2971216 gene locus_tag LOCUS_26860 2972421 2971216 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_26860 2973200 2972538 gene locus_tag LOCUS_26870 2973200 2972538 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975300.1 protein_id gnl|my_center|LOCUS_26870 2974558 2973197 gene locus_tag LOCUS_26880 2974558 2973197 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029134.1 protein_id gnl|my_center|LOCUS_26880 2975573 2974698 gene locus_tag LOCUS_26890 2975573 2974698 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975294.1 protein_id gnl|my_center|LOCUS_26890 2976898 2975708 gene locus_tag LOCUS_26900 gene kynU 2976898 2975708 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029138.1 protein_id gnl|my_center|LOCUS_26900 2977739 2976891 gene locus_tag LOCUS_26910 2977739 2976891 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029139.1 protein_id gnl|my_center|LOCUS_26910 2978345 2977932 gene locus_tag LOCUS_26920 2978345 2977932 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_26920 2979648 2978494 gene locus_tag LOCUS_26930 2979648 2978494 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027114.1 protein_id gnl|my_center|LOCUS_26930 2980775 2979753 gene locus_tag LOCUS_26940 gene fbaA 2980775 2979753 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029142.1 protein_id gnl|my_center|LOCUS_26940 2981493 2980954 gene locus_tag LOCUS_26950 gene pyrE 2981493 2980954 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_26950 2982318 2981524 gene locus_tag LOCUS_26960 2982318 2981524 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029144.1 protein_id gnl|my_center|LOCUS_26960 2983164 2982340 gene locus_tag LOCUS_26970 2983164 2982340 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109029331.1 protein_id gnl|my_center|LOCUS_26970 2984882 2983284 gene locus_tag LOCUS_26980 2984882 2983284 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029148.1 protein_id gnl|my_center|LOCUS_26980 2985507 2984986 gene locus_tag LOCUS_26990 2985507 2984986 CDS product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975282.1 protein_id gnl|my_center|LOCUS_26990 2985537 2985914 gene locus_tag LOCUS_27000 2985537 2985914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 2986206 2987384 gene locus_tag LOCUS_27010 2986206 2987384 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_27010 2988017 2987472 gene locus_tag LOCUS_27020 2988017 2987472 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975279.1 protein_id gnl|my_center|LOCUS_27020 2989359 2988094 gene locus_tag LOCUS_27030 2989359 2988094 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086847962.1 protein_id gnl|my_center|LOCUS_27030 2992307 2989707 gene locus_tag LOCUS_27040 gene clpB 2992307 2989707 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975278.1 protein_id gnl|my_center|LOCUS_27040 2992515 2992916 gene locus_tag LOCUS_27050 2992515 2992916 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284874.1 protein_id gnl|my_center|LOCUS_27050 2993359 2993039 gene locus_tag LOCUS_27060 2993359 2993039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975277.1 protein_id gnl|my_center|LOCUS_27060 2993577 2993356 gene locus_tag LOCUS_27070 2993577 2993356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 2993754 2994689 gene locus_tag LOCUS_27080 2993754 2994689 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680919.1 protein_id gnl|my_center|LOCUS_27080 2994873 2995865 gene locus_tag LOCUS_27090 2994873 2995865 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680919.1 protein_id gnl|my_center|LOCUS_27090 2996377 2995925 gene locus_tag LOCUS_27100 2996377 2995925 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975271.1 protein_id gnl|my_center|LOCUS_27100 2997563 2996379 gene locus_tag LOCUS_27110 gene dnaJ 2997563 2996379 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975270.1 protein_id gnl|my_center|LOCUS_27110 2998310 2997657 gene locus_tag LOCUS_27120 gene grpE 2998310 2997657 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975269.1 protein_id gnl|my_center|LOCUS_27120 3000163 2998307 gene locus_tag LOCUS_27130 gene dnaK 3000163 2998307 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_27130 3000458 3001231 gene locus_tag LOCUS_27140 3000458 3001231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 3001338 3003620 gene locus_tag LOCUS_27150 3001338 3003620 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029156.1 protein_id gnl|my_center|LOCUS_27150 3003808 3003993 gene locus_tag LOCUS_27160 3003808 3003993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 3004090 3005055 gene locus_tag LOCUS_27170 3004090 3005055 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029158.1 protein_id gnl|my_center|LOCUS_27170 3005647 3005147 gene locus_tag LOCUS_27180 3005647 3005147 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975262.1 protein_id gnl|my_center|LOCUS_27180 3006229 3005654 gene locus_tag LOCUS_27190 gene dcd 3006229 3005654 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_27190 3006831 3006902 gene locus_tag LOCUS_t00350 3006831 3006902 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3008143 3006956 gene locus_tag LOCUS_27200 3008143 3006956 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_27200 3008418 3008143 gene locus_tag LOCUS_27210 3008418 3008143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 3010346 3008856 gene locus_tag LOCUS_27220 3010346 3008856 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029766.1 protein_id gnl|my_center|LOCUS_27220 3011230 3010343 gene locus_tag LOCUS_27230 3011230 3010343 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029767.1 protein_id gnl|my_center|LOCUS_27230 3011782 3011312 gene locus_tag LOCUS_27240 3011782 3011312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 3014075 3011994 gene locus_tag LOCUS_27250 3014075 3011994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 3015685 3014078 gene locus_tag LOCUS_27260 3015685 3014078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 3016160 3015768 gene locus_tag LOCUS_27270 3016160 3015768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 3016508 3016179 gene locus_tag LOCUS_27280 3016508 3016179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029773.1 protein_id gnl|my_center|LOCUS_27280 3017017 3016505 gene locus_tag LOCUS_27290 3017017 3016505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 3018024 3017014 gene locus_tag LOCUS_27300 3018024 3017014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029774.1 protein_id gnl|my_center|LOCUS_27300 3018305 3018021 gene locus_tag LOCUS_27310 3018305 3018021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 3018580 3018302 gene locus_tag LOCUS_27320 3018580 3018302 CDS product DUF6284 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029776.1 protein_id gnl|my_center|LOCUS_27320 3019358 3020158 gene locus_tag LOCUS_27330 3019358 3020158 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029777.1 protein_id gnl|my_center|LOCUS_27330 3020155 3020703 gene locus_tag LOCUS_27340 3020155 3020703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 3021062 3021409 gene locus_tag LOCUS_27350 3021062 3021409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 3021406 3022077 gene locus_tag LOCUS_27360 3021406 3022077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 3023900 3022587 gene locus_tag LOCUS_27370 3023900 3022587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 3024352 3024546 gene locus_tag LOCUS_27380 3024352 3024546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 3024576 3024941 gene locus_tag LOCUS_27390 3024576 3024941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 3024938 3025261 gene locus_tag LOCUS_27400 3024938 3025261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 3025935 3026768 gene locus_tag LOCUS_27410 3025935 3026768 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971512.1 protein_id gnl|my_center|LOCUS_27410 3027495 3026842 gene locus_tag LOCUS_27420 3027495 3026842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 3028816 3027683 gene locus_tag LOCUS_27430 3028816 3027683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 3029745 3028813 gene locus_tag LOCUS_27440 3029745 3028813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978028.1 protein_id gnl|my_center|LOCUS_27440 3030584 3029742 gene locus_tag LOCUS_27450 3030584 3029742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 3030754 3030581 gene locus_tag LOCUS_27460 3030754 3030581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 3031934 3031176 gene locus_tag LOCUS_27470 3031934 3031176 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484236.1 protein_id gnl|my_center|LOCUS_27470 3032108 3032692 gene locus_tag LOCUS_27480 3032108 3032692 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_27480 3032769 3034127 gene locus_tag LOCUS_27490 3032769 3034127 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975611.1 protein_id gnl|my_center|LOCUS_27490 3034142 3034900 gene locus_tag LOCUS_27500 3034142 3034900 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976314.1 protein_id gnl|my_center|LOCUS_27500 3035039 3034875 gene locus_tag LOCUS_27510 3035039 3034875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 3035382 3036962 gene locus_tag LOCUS_27520 3035382 3036962 CDS product CBM35 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866890.1 protein_id gnl|my_center|LOCUS_27520 3037454 3037101 gene locus_tag LOCUS_27530 3037454 3037101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974276.1 protein_id gnl|my_center|LOCUS_27530 3038211 3038549 gene locus_tag LOCUS_27540 3038211 3038549 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973104.1 protein_id gnl|my_center|LOCUS_27540 3039712 3038687 gene locus_tag LOCUS_27550 3039712 3038687 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975178.1 protein_id gnl|my_center|LOCUS_27550 3041049 3039709 gene locus_tag LOCUS_27560 3041049 3039709 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029220.1 protein_id gnl|my_center|LOCUS_27560 3041336 3042586 gene locus_tag LOCUS_27570 3041336 3042586 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410039.1 protein_id gnl|my_center|LOCUS_27570 3042682 3043980 gene locus_tag LOCUS_27580 3042682 3043980 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403001.1 protein_id gnl|my_center|LOCUS_27580 3044344 3044069 gene locus_tag LOCUS_27590 3044344 3044069 CDS product DUF1876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975653.1 protein_id gnl|my_center|LOCUS_27590 3044503 3044868 gene locus_tag LOCUS_27600 3044503 3044868 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975148.1 protein_id gnl|my_center|LOCUS_27600 3045608 3044877 gene locus_tag LOCUS_27610 3045608 3044877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 3046416 3045772 gene locus_tag LOCUS_27620 3046416 3045772 CDS product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972660.1 protein_id gnl|my_center|LOCUS_27620 3046560 3047414 gene locus_tag LOCUS_27630 gene scbA 3046560 3047414 CDS product gamma-butyrolactone biosynthesis protein ScbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972659.1 protein_id gnl|my_center|LOCUS_27630 3048280 3047516 gene locus_tag LOCUS_27640 3048280 3047516 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_27640 3049008 3048277 gene locus_tag LOCUS_27650 3049008 3048277 CDS product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030795.1 protein_id gnl|my_center|LOCUS_27650 3049234 3049040 gene locus_tag LOCUS_27660 3049234 3049040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 3049214 3050014 gene locus_tag LOCUS_27670 3049214 3050014 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229986.1 protein_id gnl|my_center|LOCUS_27670 3050253 3051332 gene locus_tag LOCUS_27680 3050253 3051332 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028459.1 protein_id gnl|my_center|LOCUS_27680 3051557 3051354 gene locus_tag LOCUS_27690 3051557 3051354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 3052044 3051736 gene locus_tag LOCUS_27700 3052044 3051736 CDS product SCO5918 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973102.1 protein_id gnl|my_center|LOCUS_27700 3053660 3052098 gene locus_tag LOCUS_27710 3053660 3052098 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973100.1 protein_id gnl|my_center|LOCUS_27710 3054222 3054019 gene locus_tag LOCUS_27720 3054222 3054019 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975194.1 protein_id gnl|my_center|LOCUS_27720 3055330 3054932 gene locus_tag LOCUS_27730 3055330 3054932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 3057085 3055394 gene locus_tag LOCUS_27740 3057085 3055394 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031409.1 protein_id gnl|my_center|LOCUS_27740 3057536 3057270 gene locus_tag LOCUS_27750 3057536 3057270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 3058344 3057508 gene locus_tag LOCUS_27760 3058344 3057508 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028937.1 protein_id gnl|my_center|LOCUS_27760 3059615 3058890 gene locus_tag LOCUS_27770 3059615 3058890 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037896947.1 protein_id gnl|my_center|LOCUS_27770 3059683 3060168 gene locus_tag LOCUS_27780 3059683 3060168 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140509.1 protein_id gnl|my_center|LOCUS_27780 3060277 3060786 gene locus_tag LOCUS_27790 3060277 3060786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975331.1 protein_id gnl|my_center|LOCUS_27790 3060893 3062332 gene locus_tag LOCUS_27800 3060893 3062332 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029117.1 protein_id gnl|my_center|LOCUS_27800 3063251 3062775 gene locus_tag LOCUS_27810 3063251 3062775 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027265.1 protein_id gnl|my_center|LOCUS_27810 3063403 3063858 gene locus_tag LOCUS_27820 3063403 3063858 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975175.1 protein_id gnl|my_center|LOCUS_27820 3065065 3063995 gene locus_tag LOCUS_27830 3065065 3063995 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975333.1 protein_id gnl|my_center|LOCUS_27830 3065519 3065217 gene locus_tag LOCUS_27840 3065519 3065217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 3065734 3065516 gene locus_tag LOCUS_27850 3065734 3065516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 3065624 3067534 gene locus_tag LOCUS_27860 3065624 3067534 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029118.1 protein_id gnl|my_center|LOCUS_27860 3067705 3068829 gene locus_tag LOCUS_27870 3067705 3068829 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975538.1 protein_id gnl|my_center|LOCUS_27870 3068835 3069494 gene locus_tag LOCUS_27880 3068835 3069494 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975539.1 protein_id gnl|my_center|LOCUS_27880 3070484 3069624 gene locus_tag LOCUS_27890 3070484 3069624 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975109.1 protein_id gnl|my_center|LOCUS_27890 3071452 3070481 gene locus_tag LOCUS_27900 3071452 3070481 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 protein_id gnl|my_center|LOCUS_27900 3071970 3071557 gene locus_tag LOCUS_27910 3071970 3071557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 3071977 3072282 gene locus_tag LOCUS_27920 3071977 3072282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 3072389 3073372 gene locus_tag LOCUS_27930 3072389 3073372 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223358.1 protein_id gnl|my_center|LOCUS_27930 3073483 3073647 gene locus_tag LOCUS_27940 3073483 3073647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 3073711 3075657 gene locus_tag LOCUS_27950 3073711 3075657 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031470.1 protein_id gnl|my_center|LOCUS_27950 3076125 3075718 gene locus_tag LOCUS_27960 3076125 3075718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 3077928 3076255 gene locus_tag LOCUS_27970 3077928 3076255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 3080197 3078113 gene locus_tag LOCUS_27980 3080197 3078113 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029237.1 protein_id gnl|my_center|LOCUS_27980 3080473 3081837 gene locus_tag LOCUS_27990 3080473 3081837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 3081967 3083571 gene locus_tag LOCUS_28000 gene metG 3081967 3083571 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975149.1 protein_id gnl|my_center|LOCUS_28000 3084282 3083653 gene locus_tag LOCUS_28010 3084282 3083653 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978335.1 protein_id gnl|my_center|LOCUS_28010 3086381 3084597 gene locus_tag LOCUS_28020 gene aspS 3086381 3084597 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_28020 3086604 3088706 gene locus_tag LOCUS_28030 3086604 3088706 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975145.1 protein_id gnl|my_center|LOCUS_28030 3089742 3088723 gene locus_tag LOCUS_28040 3089742 3088723 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975144.1 protein_id gnl|my_center|LOCUS_28040 3090856 3089900 gene locus_tag LOCUS_28050 3090856 3089900 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_28050 3091466 3091002 gene locus_tag LOCUS_28060 3091466 3091002 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975142.1 protein_id gnl|my_center|LOCUS_28060 3091610 3093436 gene locus_tag LOCUS_28070 3091610 3093436 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230903.1 protein_id gnl|my_center|LOCUS_28070 3093583 3094881 gene locus_tag LOCUS_28080 3093583 3094881 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975140.1 protein_id gnl|my_center|LOCUS_28080 3095883 3094891 gene locus_tag LOCUS_28090 3095883 3094891 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270028.1 protein_id gnl|my_center|LOCUS_28090 3096032 3096622 gene locus_tag LOCUS_28100 3096032 3096622 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028285.1 protein_id gnl|my_center|LOCUS_28100 3096622 3097341 gene locus_tag LOCUS_28110 3096622 3097341 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028285.1 protein_id gnl|my_center|LOCUS_28110 3097453 3098592 gene locus_tag LOCUS_28120 3097453 3098592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 3098729 3098947 gene locus_tag LOCUS_28130 3098729 3098947 CDS product DUF6458 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975139.1 protein_id gnl|my_center|LOCUS_28130 3101056 3099242 gene locus_tag LOCUS_28140 3101056 3099242 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026880.1 protein_id gnl|my_center|LOCUS_28140 3101120 3101605 gene locus_tag LOCUS_28150 3101120 3101605 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975131.1 protein_id gnl|my_center|LOCUS_28150 3102463 3101672 gene locus_tag LOCUS_28160 3102463 3101672 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_28160 3102672 3103496 gene locus_tag LOCUS_28170 3102672 3103496 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029242.1 protein_id gnl|my_center|LOCUS_28170 3104876 3103566 gene locus_tag LOCUS_28180 3104876 3103566 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975127.1 protein_id gnl|my_center|LOCUS_28180 3105565 3104873 gene locus_tag LOCUS_28190 3105565 3104873 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975126.1 protein_id gnl|my_center|LOCUS_28190 3105765 3106664 gene locus_tag LOCUS_28200 3105765 3106664 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029243.1 protein_id gnl|my_center|LOCUS_28200 3106900 3106724 gene locus_tag LOCUS_28210 3106900 3106724 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_28210 3107781 3106903 gene locus_tag LOCUS_28220 3107781 3106903 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_28220 3107990 3108169 gene locus_tag LOCUS_28230 3107990 3108169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 3109730 3108324 gene locus_tag LOCUS_28240 3109730 3108324 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 protein_id gnl|my_center|LOCUS_28240 3110722 3109742 gene locus_tag LOCUS_28250 3110722 3109742 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_28250 3111882 3110725 gene locus_tag LOCUS_28260 gene pdhA 3111882 3110725 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_28260 3112268 3112879 gene locus_tag LOCUS_28270 3112268 3112879 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_28270 3112997 3113422 gene locus_tag LOCUS_28280 3112997 3113422 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029249.1 protein_id gnl|my_center|LOCUS_28280 3113486 3114490 gene locus_tag LOCUS_28290 3113486 3114490 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109282207.1 protein_id gnl|my_center|LOCUS_28290 3116123 3114519 gene locus_tag LOCUS_28300 3116123 3114519 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326665.1 protein_id gnl|my_center|LOCUS_28300 3116427 3118064 gene locus_tag LOCUS_28310 3116427 3118064 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029251.1 protein_id gnl|my_center|LOCUS_28310 3118402 3119109 gene locus_tag LOCUS_28320 3118402 3119109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 3119284 3119766 gene locus_tag LOCUS_28330 3119284 3119766 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_28330 3120923 3119934 gene locus_tag LOCUS_28340 3120923 3119934 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_28340 3122075 3121002 gene locus_tag LOCUS_28350 3122075 3121002 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975108.1 protein_id gnl|my_center|LOCUS_28350 3123916 3122096 gene locus_tag LOCUS_28360 3123916 3122096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 3124812 3123913 gene locus_tag LOCUS_28370 3124812 3123913 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943903.1 protein_id gnl|my_center|LOCUS_28370 3126336 3124939 gene locus_tag LOCUS_28380 3126336 3124939 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029255.1 protein_id gnl|my_center|LOCUS_28380 3127310 3126336 gene locus_tag LOCUS_28390 3127310 3126336 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029256.1 protein_id gnl|my_center|LOCUS_28390 3128524 3127364 gene locus_tag LOCUS_28400 gene pdhA 3128524 3127364 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467649.1 protein_id gnl|my_center|LOCUS_28400 3128735 3129265 gene locus_tag LOCUS_28410 3128735 3129265 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109029198.1 protein_id gnl|my_center|LOCUS_28410 3129848 3129255 gene locus_tag LOCUS_28420 3129848 3129255 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975101.1 protein_id gnl|my_center|LOCUS_28420 3129972 3131672 gene locus_tag LOCUS_28430 gene paaN 3129972 3131672 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029260.1 protein_id gnl|my_center|LOCUS_28430 3132492 3131743 gene locus_tag LOCUS_28440 3132492 3131743 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776560.1 protein_id gnl|my_center|LOCUS_28440 3133772 3132489 gene locus_tag LOCUS_28450 3133772 3132489 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029262.1 protein_id gnl|my_center|LOCUS_28450 3134722 3133769 gene locus_tag LOCUS_28460 3134722 3133769 CDS product DUF5819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485246.1 protein_id gnl|my_center|LOCUS_28460 3134811 3135857 gene locus_tag LOCUS_28470 gene paaA 3134811 3135857 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031683.1 protein_id gnl|my_center|LOCUS_28470 3135854 3136144 gene locus_tag LOCUS_28480 gene paaB 3135854 3136144 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454960.1 protein_id gnl|my_center|LOCUS_28480 3136141 3136857 gene locus_tag LOCUS_28490 gene paaC 3136141 3136857 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965788.1 protein_id gnl|my_center|LOCUS_28490 3136851 3137348 gene locus_tag LOCUS_28500 gene paaJ 3136851 3137348 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223466.1 protein_id gnl|my_center|LOCUS_28500 3137349 3138401 gene locus_tag LOCUS_28510 gene paaK 3137349 3138401 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083203.1 protein_id gnl|my_center|LOCUS_28510 3139082 3138738 gene locus_tag LOCUS_28520 3139082 3138738 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975095.1 protein_id gnl|my_center|LOCUS_28520 3140057 3139128 gene locus_tag LOCUS_28530 3140057 3139128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975094.1 protein_id gnl|my_center|LOCUS_28530 3141575 3140115 gene locus_tag LOCUS_28540 3141575 3140115 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029264.1 protein_id gnl|my_center|LOCUS_28540 3142812 3141715 gene locus_tag LOCUS_28550 3142812 3141715 CDS product DUF3533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031515.1 protein_id gnl|my_center|LOCUS_28550 3142909 3143358 gene locus_tag LOCUS_28560 3142909 3143358 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972083.1 protein_id gnl|my_center|LOCUS_28560 3143619 3143536 gene locus_tag LOCUS_t00360 3143619 3143536 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3143935 3144819 gene locus_tag LOCUS_28570 gene fhaA 3143935 3144819 CDS product antibiotic biosynthesis regulator FhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975091.1 protein_id gnl|my_center|LOCUS_28570 3144830 3145351 gene locus_tag LOCUS_28580 gene fhaB 3144830 3145351 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_28580 3145436 3146989 gene locus_tag LOCUS_28590 3145436 3146989 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029266.1 protein_id gnl|my_center|LOCUS_28590 3147011 3148411 gene locus_tag LOCUS_28600 3147011 3148411 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029267.1 protein_id gnl|my_center|LOCUS_28600 3148408 3149862 gene locus_tag LOCUS_28610 3148408 3149862 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029268.1 protein_id gnl|my_center|LOCUS_28610 3150027 3152090 gene locus_tag LOCUS_28620 gene pknB 3150027 3152090 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029269.1 protein_id gnl|my_center|LOCUS_28620 3152920 3152186 gene locus_tag LOCUS_28630 3152920 3152186 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975085.1 protein_id gnl|my_center|LOCUS_28630 3154340 3152946 gene locus_tag LOCUS_28640 3154340 3152946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 3154975 3154337 gene locus_tag LOCUS_28650 3154975 3154337 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029271.1 protein_id gnl|my_center|LOCUS_28650 3155160 3154972 gene locus_tag LOCUS_28660 3155160 3154972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174256084.1 protein_id gnl|my_center|LOCUS_28660 3156044 3155277 gene locus_tag LOCUS_28670 3156044 3155277 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485254.1 protein_id gnl|my_center|LOCUS_28670 3156186 3156440 gene locus_tag LOCUS_28680 gene crgA 3156186 3156440 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975080.1 protein_id gnl|my_center|LOCUS_28680 3157613 3156723 gene locus_tag LOCUS_28690 3157613 3156723 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975079.1 protein_id gnl|my_center|LOCUS_28690 3158315 3157788 gene locus_tag LOCUS_28700 3158315 3157788 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975078.1 protein_id gnl|my_center|LOCUS_28700 3158537 3159247 gene locus_tag LOCUS_28710 3158537 3159247 CDS product DUF5324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029273.1 protein_id gnl|my_center|LOCUS_28710 3159518 3159445 gene locus_tag LOCUS_t00370 3159518 3159445 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3159689 3160237 gene locus_tag LOCUS_28720 3159689 3160237 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029275.1 protein_id gnl|my_center|LOCUS_28720 3160310 3161812 gene locus_tag LOCUS_28730 3160310 3161812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28730 3163183 3161843 gene locus_tag LOCUS_28740 3163183 3161843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029277.1 protein_id gnl|my_center|LOCUS_28740 3163663 3163529 gene locus_tag LOCUS_28750 3163663 3163529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28750 3163936 3164295 gene locus_tag LOCUS_28760 3163936 3164295 CDS product DUF6344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975071.1 protein_id gnl|my_center|LOCUS_28760 3164581 3164505 gene locus_tag LOCUS_t00380 3164581 3164505 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 3165233 3164652 gene locus_tag LOCUS_28770 3165233 3164652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 3167954 3165339 gene locus_tag LOCUS_28780 gene gyrA 3167954 3165339 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_28780 3170070 3168001 gene locus_tag LOCUS_28790 gene gyrB 3170070 3168001 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029285.1 protein_id gnl|my_center|LOCUS_28790 3171159 3170539 gene locus_tag LOCUS_28800 3171159 3170539 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975057.1 protein_id gnl|my_center|LOCUS_28800 3172286 3171156 gene locus_tag LOCUS_28810 gene recF 3172286 3171156 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_28810 3173210 3172332 gene locus_tag LOCUS_28820 gene gnd 3173210 3172332 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029286.1 protein_id gnl|my_center|LOCUS_28820 3174473 3173343 gene locus_tag LOCUS_28830 gene dnaN 3174473 3173343 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_28830 3177137 3175392 gene locus_tag LOCUS_28840 gene dnaA 3177137 3175392 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029287.1 protein_id gnl|my_center|LOCUS_28840 3177560 3177697 gene locus_tag LOCUS_28850 gene rpmH 3177560 3177697 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975051.1 protein_id gnl|my_center|LOCUS_28850 3178085 3178444 gene locus_tag LOCUS_28860 gene yidD 3178085 3178444 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975049.1 protein_id gnl|my_center|LOCUS_28860 3178448 3179713 gene locus_tag LOCUS_28870 gene yidC 3178448 3179713 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029289.1 protein_id gnl|my_center|LOCUS_28870 3179728 3180237 gene locus_tag LOCUS_28880 3179728 3180237 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029290.1 protein_id gnl|my_center|LOCUS_28880 3180347 3181063 gene locus_tag LOCUS_28890 gene rsmG 3180347 3181063 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029291.1 protein_id gnl|my_center|LOCUS_28890 3181125 3182384 gene locus_tag LOCUS_28900 3181125 3182384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 3182489 3183475 gene locus_tag LOCUS_28910 3182489 3183475 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863476.1 protein_id gnl|my_center|LOCUS_28910 3183778 3184395 gene locus_tag LOCUS_28920 3183778 3184395 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975043.1 protein_id gnl|my_center|LOCUS_28920 3184808 3184476 gene locus_tag LOCUS_28930 gene trxA 3184808 3184476 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_28930 3185824 3184853 gene locus_tag LOCUS_28940 gene trxB 3185824 3184853 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_28940 3186884 3185949 gene locus_tag LOCUS_28950 3186884 3185949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029294.1 protein_id gnl|my_center|LOCUS_28950 3187582 3186881 gene locus_tag LOCUS_28960 gene sigM 3187582 3186881 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029295.1 protein_id gnl|my_center|LOCUS_28960 3189524 3187794 gene locus_tag LOCUS_28970 3189524 3187794 CDS product protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029296.1 protein_id gnl|my_center|LOCUS_28970 3191810 3189654 gene locus_tag LOCUS_28980 gene murJ 3191810 3189654 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029297.1 protein_id gnl|my_center|LOCUS_28980 3194157 3191860 gene locus_tag LOCUS_28990 3194157 3191860 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029298.1 protein_id gnl|my_center|LOCUS_28990 3194319 3195782 gene locus_tag LOCUS_29000 3194319 3195782 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_29000 3197178 3195895 gene locus_tag LOCUS_29010 3197178 3195895 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029300.1 protein_id gnl|my_center|LOCUS_29010 3198448 3197300 gene locus_tag LOCUS_29020 3198448 3197300 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975032.1 protein_id gnl|my_center|LOCUS_29020 3199152 3198445 gene locus_tag LOCUS_29030 3199152 3198445 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 protein_id gnl|my_center|LOCUS_29030 3199543 3202221 gene locus_tag LOCUS_29040 3199543 3202221 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975030.1 protein_id gnl|my_center|LOCUS_29040 3202386 3203861 gene locus_tag LOCUS_29050 3202386 3203861 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_29050 3204918 3203887 gene locus_tag LOCUS_29060 3204918 3203887 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975028.1 protein_id gnl|my_center|LOCUS_29060 3206170 3205052 gene locus_tag LOCUS_29070 gene femX 3206170 3205052 CDS product peptidoglycan bridge formation glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029302.1 protein_id gnl|my_center|LOCUS_29070 3206614 3206300 gene locus_tag LOCUS_29080 3206614 3206300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975026.1 protein_id gnl|my_center|LOCUS_29080 3206894 3207184 gene locus_tag LOCUS_29090 gene rpsF 3206894 3207184 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975025.1 protein_id gnl|my_center|LOCUS_29090 3207259 3207888 gene locus_tag LOCUS_29100 3207259 3207888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 3207932 3208168 gene locus_tag LOCUS_29110 gene rpsR 3207932 3208168 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_29110 3208187 3208633 gene locus_tag LOCUS_29120 gene rplI 3208187 3208633 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_29120 3210110 3208764 gene locus_tag LOCUS_29130 3210110 3208764 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_29130 3210561 3212036 gene locus_tag LOCUS_29140 gene dnaB 3210561 3212036 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975021.1 protein_id gnl|my_center|LOCUS_29140 3212679 3212107 gene locus_tag LOCUS_29150 3212679 3212107 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224147.1 protein_id gnl|my_center|LOCUS_29150 3212803 3213429 gene locus_tag LOCUS_29160 3212803 3213429 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973718.1 protein_id gnl|my_center|LOCUS_29160 3213528 3214922 gene locus_tag LOCUS_29170 3213528 3214922 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975020.1 protein_id gnl|my_center|LOCUS_29170 3215463 3215011 gene locus_tag LOCUS_29180 3215463 3215011 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029305.1 protein_id gnl|my_center|LOCUS_29180 3215950 3215492 gene locus_tag LOCUS_29190 3215950 3215492 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975018.1 protein_id gnl|my_center|LOCUS_29190 3216967 3216083 gene locus_tag LOCUS_29200 3216967 3216083 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029307.1 protein_id gnl|my_center|LOCUS_29200 3217699 3217220 gene locus_tag LOCUS_29210 3217699 3217220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 3218647 3217751 gene locus_tag LOCUS_29220 3218647 3217751 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029308.1 protein_id gnl|my_center|LOCUS_29220 3219982 3218858 gene locus_tag LOCUS_29230 3219982 3218858 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029309.1 protein_id gnl|my_center|LOCUS_29230 3220423 3220049 gene locus_tag LOCUS_29240 3220423 3220049 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_29240 3220495 3220812 gene locus_tag LOCUS_29250 3220495 3220812 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029310.1 protein_id gnl|my_center|LOCUS_29250 3220931 3221149 gene locus_tag LOCUS_29260 3220931 3221149 CDS product DUF5326 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029311.1 protein_id gnl|my_center|LOCUS_29260 3221411 3222157 gene locus_tag LOCUS_29270 3221411 3222157 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029312.1 protein_id gnl|my_center|LOCUS_29270 3222259 3222696 gene locus_tag LOCUS_29280 3222259 3222696 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975006.1 protein_id gnl|my_center|LOCUS_29280 3224040 3222709 gene locus_tag LOCUS_29290 3224040 3222709 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029314.1 protein_id gnl|my_center|LOCUS_29290 3224238 3226040 gene locus_tag LOCUS_29300 gene thiC 3224238 3226040 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029315.1 protein_id gnl|my_center|LOCUS_29300 3226956 3226162 gene locus_tag LOCUS_29310 3226956 3226162 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029327.1 protein_id gnl|my_center|LOCUS_29310 3228215 3227145 gene locus_tag LOCUS_29320 gene sppA 3228215 3227145 CDS product Ser/Thr/Tyr protein phosphatase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029328.1 protein_id gnl|my_center|LOCUS_29320 3229577 3228390 gene locus_tag LOCUS_29330 3229577 3228390 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975000.1 protein_id gnl|my_center|LOCUS_29330 3229916 3230992 gene locus_tag LOCUS_29340 gene hisC 3229916 3230992 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_29340 3231291 3232802 gene locus_tag LOCUS_29350 3231291 3232802 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974998.1 protein_id gnl|my_center|LOCUS_29350 3232821 3233825 gene locus_tag LOCUS_29360 gene cydB 3232821 3233825 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029331.1 protein_id gnl|my_center|LOCUS_29360 3233865 3237380 gene locus_tag LOCUS_29370 gene cydD 3233865 3237380 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029332.1 protein_id gnl|my_center|LOCUS_29370 3237456 3239162 gene locus_tag LOCUS_29380 3237456 3239162 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029333.1 protein_id gnl|my_center|LOCUS_29380 3240072 3239227 gene locus_tag LOCUS_29390 3240072 3239227 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974993.1 protein_id gnl|my_center|LOCUS_29390 3241116 3240220 gene locus_tag LOCUS_29400 3241116 3240220 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326709.1 protein_id gnl|my_center|LOCUS_29400 3241314 3241604 gene locus_tag LOCUS_29410 3241314 3241604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975314.1 protein_id gnl|my_center|LOCUS_29410 3242172 3241630 gene locus_tag LOCUS_29420 3242172 3241630 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029338.1 protein_id gnl|my_center|LOCUS_29420 3243340 3242321 gene locus_tag LOCUS_29430 3243340 3242321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 3245109 3243337 gene locus_tag LOCUS_29440 3245109 3243337 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029339.1 protein_id gnl|my_center|LOCUS_29440 3245482 3246531 gene locus_tag LOCUS_29450 3245482 3246531 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_29450 3246528 3247439 gene locus_tag LOCUS_29460 3246528 3247439 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974986.1 protein_id gnl|my_center|LOCUS_29460 3247436 3248347 gene locus_tag LOCUS_29470 3247436 3248347 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_29470 3248378 3249097 gene locus_tag LOCUS_29480 3248378 3249097 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974984.1 protein_id gnl|my_center|LOCUS_29480 3250111 3249296 gene locus_tag LOCUS_29490 3250111 3249296 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029342.1 protein_id gnl|my_center|LOCUS_29490 3251385 3250108 gene locus_tag LOCUS_29500 gene serS 3251385 3250108 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974982.1 protein_id gnl|my_center|LOCUS_29500 3252968 3252033 gene locus_tag LOCUS_29510 gene pheA 3252968 3252033 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_29510 3254363 3253032 gene locus_tag LOCUS_29520 gene efeB 3254363 3253032 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029343.1 protein_id gnl|my_center|LOCUS_29520 3256321 3254369 gene locus_tag LOCUS_29530 3256321 3254369 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029406.1 protein_id gnl|my_center|LOCUS_29530 3256780 3256334 gene locus_tag LOCUS_29540 3256780 3256334 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208058.1 protein_id gnl|my_center|LOCUS_29540 3257433 3256777 gene locus_tag LOCUS_29550 3257433 3256777 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974978.1 protein_id gnl|my_center|LOCUS_29550 3258218 3257478 gene locus_tag LOCUS_29560 3258218 3257478 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974977.1 protein_id gnl|my_center|LOCUS_29560 3259102 3258341 gene locus_tag LOCUS_29570 3259102 3258341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029346.1 protein_id gnl|my_center|LOCUS_29570 3259394 3260008 gene locus_tag LOCUS_29580 3259394 3260008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 3261549 3260056 gene locus_tag LOCUS_29590 3261549 3260056 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974973.1 protein_id gnl|my_center|LOCUS_29590 3262977 3261685 gene locus_tag LOCUS_29600 3262977 3261685 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029348.1 protein_id gnl|my_center|LOCUS_29600 3263688 3264371 gene locus_tag LOCUS_29610 3263688 3264371 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974971.1 protein_id gnl|my_center|LOCUS_29610 3264537 3265163 gene locus_tag LOCUS_29620 3264537 3265163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029349.1 protein_id gnl|my_center|LOCUS_29620 3266418 3265453 gene locus_tag LOCUS_29630 3266418 3265453 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 protein_id gnl|my_center|LOCUS_29630 3267359 3266757 gene locus_tag LOCUS_29640 3267359 3266757 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974968.1 protein_id gnl|my_center|LOCUS_29640 3268328 3267498 gene locus_tag LOCUS_29650 3268328 3267498 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974967.1 protein_id gnl|my_center|LOCUS_29650 3268573 3270150 gene locus_tag LOCUS_29660 3268573 3270150 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029350.1 protein_id gnl|my_center|LOCUS_29660 3270786 3270496 gene locus_tag LOCUS_29670 3270786 3270496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 3271424 3271511 gene locus_tag LOCUS_t00390 3271424 3271511 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3271999 3271661 gene locus_tag LOCUS_29680 3271999 3271661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 3272803 3272048 gene locus_tag LOCUS_29690 3272803 3272048 CDS product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028876.1 protein_id gnl|my_center|LOCUS_29690 3272855 3273160 gene locus_tag LOCUS_29700 3272855 3273160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028875.1 protein_id gnl|my_center|LOCUS_29700 3273173 3273484 gene locus_tag LOCUS_29710 3273173 3273484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029355.1 protein_id gnl|my_center|LOCUS_29710 3273639 3273908 gene locus_tag LOCUS_29720 3273639 3273908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 3273905 3274648 gene locus_tag LOCUS_29730 3273905 3274648 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028871.1 protein_id gnl|my_center|LOCUS_29730 3274645 3274947 gene locus_tag LOCUS_29740 3274645 3274947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028870.1 protein_id gnl|my_center|LOCUS_29740 3275292 3276629 gene locus_tag LOCUS_29750 3275292 3276629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 3276646 3277491 gene locus_tag LOCUS_29760 3276646 3277491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 3278407 3278018 gene locus_tag LOCUS_29770 3278407 3278018 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950169.1 protein_id gnl|my_center|LOCUS_29770 3278501 3279280 gene locus_tag LOCUS_29780 3278501 3279280 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028866.1 protein_id gnl|my_center|LOCUS_29780 3279420 3279779 gene locus_tag LOCUS_29790 3279420 3279779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028865.1 protein_id gnl|my_center|LOCUS_29790 3279782 3281134 gene locus_tag LOCUS_29800 3279782 3281134 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028864.1 protein_id gnl|my_center|LOCUS_29800 3281215 3281400 gene locus_tag LOCUS_29810 3281215 3281400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 3281400 3282065 gene locus_tag LOCUS_29820 3281400 3282065 CDS product DUF2637 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028863.1 protein_id gnl|my_center|LOCUS_29820 3282084 3282269 gene locus_tag LOCUS_29830 3282084 3282269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 3282275 3282466 gene locus_tag LOCUS_29840 3282275 3282466 CDS product mobile element transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226027129.1 protein_id gnl|my_center|LOCUS_29840 3282479 3282634 gene locus_tag LOCUS_29850 3282479 3282634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030192.1 protein_id gnl|my_center|LOCUS_29850 3282662 3282976 gene locus_tag LOCUS_29860 3282662 3282976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030193.1 protein_id gnl|my_center|LOCUS_29860 3283067 3284482 gene locus_tag LOCUS_29870 gene repSA 3283067 3284482 CDS product replication initiator protein RepSA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028860.1 protein_id gnl|my_center|LOCUS_29870 3284476 3284706 gene locus_tag LOCUS_29880 3284476 3284706 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043441830.1 protein_id gnl|my_center|LOCUS_29880 3284706 3285833 gene locus_tag LOCUS_29890 3284706 3285833 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178940705.1 protein_id gnl|my_center|LOCUS_29890 3285990 3286400 gene locus_tag LOCUS_29900 3285990 3286400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 3287063 3286692 gene locus_tag LOCUS_29910 3287063 3286692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 3288031 3287138 gene locus_tag LOCUS_29920 3288031 3287138 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029372.1 protein_id gnl|my_center|LOCUS_29920 3288413 3288727 gene locus_tag LOCUS_29930 3288413 3288727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974960.1 protein_id gnl|my_center|LOCUS_29930 3289141 3289704 gene locus_tag LOCUS_29940 3289141 3289704 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495205.1 protein_id gnl|my_center|LOCUS_29940 3289967 3291610 gene locus_tag LOCUS_29950 3289967 3291610 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029376.1 protein_id gnl|my_center|LOCUS_29950 3295792 3291686 gene locus_tag LOCUS_29960 3295792 3291686 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029379.1 protein_id gnl|my_center|LOCUS_29960 3296539 3296030 gene locus_tag LOCUS_29970 3296539 3296030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 3296750 3296841 gene locus_tag LOCUS_t00400 3296750 3296841 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3297058 3297131 gene locus_tag LOCUS_t00410 3297058 3297131 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3297920 3297468 gene locus_tag LOCUS_29980 3297920 3297468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 3297980 3298879 gene locus_tag LOCUS_29990 3297980 3298879 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063628631.1 protein_id gnl|my_center|LOCUS_29990 3299087 3299830 gene locus_tag LOCUS_30000 3299087 3299830 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863629.1 protein_id gnl|my_center|LOCUS_30000 3299871 3300038 gene locus_tag LOCUS_30010 3299871 3300038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 3300303 3301856 gene locus_tag LOCUS_30020 3300303 3301856 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029391.1 protein_id gnl|my_center|LOCUS_30020 3301948 3302724 gene locus_tag LOCUS_30030 3301948 3302724 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029392.1 protein_id gnl|my_center|LOCUS_30030 3303725 3302766 gene locus_tag LOCUS_30040 3303725 3302766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 3304204 3303734 gene locus_tag LOCUS_30050 3304204 3303734 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 protein_id gnl|my_center|LOCUS_30050 3305159 3304233 gene locus_tag LOCUS_30060 3305159 3304233 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029395.1 protein_id gnl|my_center|LOCUS_30060 3307708 3305246 gene locus_tag LOCUS_30070 3307708 3305246 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029396.1 protein_id gnl|my_center|LOCUS_30070 3308244 3307732 gene locus_tag LOCUS_30080 3308244 3307732 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029397.1 protein_id gnl|my_center|LOCUS_30080 3308535 3308750 gene locus_tag LOCUS_30090 3308535 3308750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 3309180 3308842 gene locus_tag LOCUS_30100 3309180 3308842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 3310161 3309568 gene locus_tag LOCUS_30110 3310161 3309568 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229197.1 protein_id gnl|my_center|LOCUS_30110 3310331 3311290 gene locus_tag LOCUS_30120 3310331 3311290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027166.1 protein_id gnl|my_center|LOCUS_30120 3311515 3311297 gene locus_tag LOCUS_30130 3311515 3311297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 3312459 3311593 gene locus_tag LOCUS_30140 3312459 3311593 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974928.1 protein_id gnl|my_center|LOCUS_30140 3313527 3312694 gene locus_tag LOCUS_30150 3313527 3312694 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029398.1 protein_id gnl|my_center|LOCUS_30150 3314033 3313740 gene locus_tag LOCUS_30160 3314033 3313740 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974926.1 protein_id gnl|my_center|LOCUS_30160 3314186 3314043 gene locus_tag LOCUS_30170 3314186 3314043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 3314490 3314405 gene locus_tag LOCUS_t00420 3314490 3314405 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3314964 3314536 gene locus_tag LOCUS_30180 gene tadA 3314964 3314536 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_30180 3315804 3315046 gene locus_tag LOCUS_30190 3315804 3315046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974923.1 protein_id gnl|my_center|LOCUS_30190 3316059 3315823 gene locus_tag LOCUS_30200 3316059 3315823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 3316164 3316799 gene locus_tag LOCUS_30210 gene upp 3316164 3316799 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_30210 3317556 3316867 gene locus_tag LOCUS_30220 3317556 3316867 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974920.1 protein_id gnl|my_center|LOCUS_30220 3317909 3317613 gene locus_tag LOCUS_30230 3317909 3317613 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003999914.1 protein_id gnl|my_center|LOCUS_30230 3319595 3318048 gene locus_tag LOCUS_30240 3319595 3318048 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742107.1 protein_id gnl|my_center|LOCUS_30240 3320370 3319720 gene locus_tag LOCUS_30250 3320370 3319720 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974916.1 protein_id gnl|my_center|LOCUS_30250 3321009 3320593 gene locus_tag LOCUS_30260 3321009 3320593 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228199.1 protein_id gnl|my_center|LOCUS_30260 3321008 3322555 gene locus_tag LOCUS_30270 3321008 3322555 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192813.1 protein_id gnl|my_center|LOCUS_30270 3322552 3323301 gene locus_tag LOCUS_30280 gene cobM 3322552 3323301 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228819.1 protein_id gnl|my_center|LOCUS_30280 3324468 3323350 gene locus_tag LOCUS_30290 3324468 3323350 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390744.1 protein_id gnl|my_center|LOCUS_30290 3324483 3325238 gene locus_tag LOCUS_30300 3324483 3325238 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975552.1 protein_id gnl|my_center|LOCUS_30300 3326788 3325235 gene locus_tag LOCUS_30310 3326788 3325235 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086498.1 protein_id gnl|my_center|LOCUS_30310 3327417 3326791 gene locus_tag LOCUS_30320 3327417 3326791 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_30320 3328781 3327456 gene locus_tag LOCUS_30330 gene cobG 3328781 3327456 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086496.1 protein_id gnl|my_center|LOCUS_30330 3329451 3333056 gene locus_tag LOCUS_30340 gene cobN 3329451 3333056 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729378.1 protein_id gnl|my_center|LOCUS_30340 3334895 3333207 gene locus_tag LOCUS_30350 3334895 3333207 CDS product lysyl oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031808.1 protein_id gnl|my_center|LOCUS_30350 3335076 3335381 gene locus_tag LOCUS_30360 3335076 3335381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 3335768 3336628 gene locus_tag LOCUS_30370 3335768 3336628 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259406.1 protein_id gnl|my_center|LOCUS_30370 3336625 3338181 gene locus_tag LOCUS_30380 3336625 3338181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 3339065 3338640 gene locus_tag LOCUS_30390 3339065 3338640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028878.1 protein_id gnl|my_center|LOCUS_30390 3339340 3339062 gene locus_tag LOCUS_30400 3339340 3339062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975561.1 protein_id gnl|my_center|LOCUS_30400 3340313 3339408 gene locus_tag LOCUS_30410 3340313 3339408 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098074468.1 protein_id gnl|my_center|LOCUS_30410 3342672 3340408 gene locus_tag LOCUS_30420 3342672 3340408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 3344884 3343367 gene locus_tag LOCUS_30430 3344884 3343367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 3346576 3345020 gene locus_tag LOCUS_30440 3346576 3345020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 3346786 3346935 gene locus_tag LOCUS_30450 3346786 3346935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 3348020 3347013 gene locus_tag LOCUS_30460 3348020 3347013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 3349225 3347993 gene locus_tag LOCUS_30470 3349225 3347993 CDS product lanthionine synthetase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026975.1 protein_id gnl|my_center|LOCUS_30470 3352287 3349222 gene locus_tag LOCUS_30480 3352287 3349222 CDS product lantibiotic dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031312.1 protein_id gnl|my_center|LOCUS_30480 3352565 3352374 gene locus_tag LOCUS_30490 3352565 3352374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 3353856 3352621 gene locus_tag LOCUS_30500 3353856 3352621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 3354495 3354076 gene locus_tag LOCUS_30510 3354495 3354076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 3354923 3354492 gene locus_tag LOCUS_30520 3354923 3354492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 3355216 3356409 gene locus_tag LOCUS_30530 3355216 3356409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 3356406 3356933 gene locus_tag LOCUS_30540 3356406 3356933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 3357727 3358065 gene locus_tag LOCUS_30550 3357727 3358065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 3358072 3358719 gene locus_tag LOCUS_30560 3358072 3358719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 3359204 3359037 gene locus_tag LOCUS_30570 3359204 3359037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 3359170 3359646 gene locus_tag LOCUS_30580 3359170 3359646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 3360047 3360847 gene locus_tag LOCUS_30590 3360047 3360847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 3362201 3360780 gene locus_tag LOCUS_30600 3362201 3360780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 3363315 3363842 gene locus_tag LOCUS_30610 3363315 3363842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 3363839 3364411 gene locus_tag LOCUS_30620 3363839 3364411 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137208463.1 protein_id gnl|my_center|LOCUS_30620 3364872 3364399 gene locus_tag LOCUS_30630 3364872 3364399 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030185.1 protein_id gnl|my_center|LOCUS_30630 3365634 3364876 gene locus_tag LOCUS_30640 3365634 3364876 CDS product DUF5919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229650.1 protein_id gnl|my_center|LOCUS_30640 3366515 3366811 gene locus_tag LOCUS_30650 3366515 3366811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 3366808 3367839 gene locus_tag LOCUS_30660 3366808 3367839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30660 3367836 3368480 gene locus_tag LOCUS_30670 3367836 3368480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 3368480 3368866 gene locus_tag LOCUS_30680 3368480 3368866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029773.1 protein_id gnl|my_center|LOCUS_30680 3369155 3371377 gene locus_tag LOCUS_30690 3369155 3371377 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230500.1 protein_id gnl|my_center|LOCUS_30690 3371517 3371768 gene locus_tag LOCUS_30700 3371517 3371768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 3371929 3372117 gene locus_tag LOCUS_30710 3371929 3372117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 3372129 3372740 gene locus_tag LOCUS_30720 3372129 3372740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 3372742 3373065 gene locus_tag LOCUS_30730 3372742 3373065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 3373151 3374077 gene locus_tag LOCUS_30740 3373151 3374077 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029372.1 protein_id gnl|my_center|LOCUS_30740 3374074 3375468 gene locus_tag LOCUS_30750 3374074 3375468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 3375590 3375835 gene locus_tag LOCUS_30760 3375590 3375835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 3375845 3377104 gene locus_tag LOCUS_30770 3375845 3377104 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012477091.1 protein_id gnl|my_center|LOCUS_30770 3377282 3377195 gene locus_tag LOCUS_t00430 3377282 3377195 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3377480 3379882 gene locus_tag LOCUS_30780 3377480 3379882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 3380066 3381316 gene locus_tag LOCUS_30790 gene purD 3380066 3381316 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_30790 3381731 3383437 gene locus_tag LOCUS_30800 3381731 3383437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 3383726 3385189 gene locus_tag LOCUS_30810 3383726 3385189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_30810 3385295 3386215 gene locus_tag LOCUS_30820 3385295 3386215 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 protein_id gnl|my_center|LOCUS_30820 3386345 3386270 gene locus_tag LOCUS_t00440 3386345 3386270 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3387054 3386981 gene locus_tag LOCUS_t00450 3387054 3386981 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3387693 3387358 gene locus_tag LOCUS_30830 3387693 3387358 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974896.1 protein_id gnl|my_center|LOCUS_30830 3388125 3388352 gene locus_tag LOCUS_30840 gene purS 3388125 3388352 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974895.1 protein_id gnl|my_center|LOCUS_30840 3388484 3389029 gene locus_tag LOCUS_30850 gene purQ 3388484 3389029 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974894.1 protein_id gnl|my_center|LOCUS_30850 3389026 3391275 gene locus_tag LOCUS_30860 gene purL 3389026 3391275 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_30860 3391369 3392256 gene locus_tag LOCUS_30870 3391369 3392256 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974890.1 protein_id gnl|my_center|LOCUS_30870 3392267 3393067 gene locus_tag LOCUS_30880 3392267 3393067 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974888.1 protein_id gnl|my_center|LOCUS_30880 3393120 3393935 gene locus_tag LOCUS_30890 3393120 3393935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 3394136 3393939 gene locus_tag LOCUS_30900 3394136 3393939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 3395007 3394591 gene locus_tag LOCUS_30910 3395007 3394591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 3394900 3396255 gene locus_tag LOCUS_30920 gene purF 3394900 3396255 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_30920 3396316 3397389 gene locus_tag LOCUS_30930 gene purM 3396316 3397389 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974885.1 protein_id gnl|my_center|LOCUS_30930 3397858 3397604 gene locus_tag LOCUS_30940 3397858 3397604 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974884.1 protein_id gnl|my_center|LOCUS_30940 3399269 3398178 gene locus_tag LOCUS_30950 3399269 3398178 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029424.1 protein_id gnl|my_center|LOCUS_30950 3399465 3400292 gene locus_tag LOCUS_30960 3399465 3400292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974882.1 protein_id gnl|my_center|LOCUS_30960 3400923 3401129 gene locus_tag LOCUS_30970 gene bldC 3400923 3401129 CDS product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 protein_id gnl|my_center|LOCUS_30970 3401910 3401596 gene locus_tag LOCUS_30980 3401910 3401596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 3402123 3402048 gene locus_tag LOCUS_t00460 3402123 3402048 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3406231 3402275 gene locus_tag LOCUS_30990 gene hrpA 3406231 3402275 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029425.1 protein_id gnl|my_center|LOCUS_30990 3406606 3407409 gene locus_tag LOCUS_31000 3406606 3407409 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030586.1 protein_id gnl|my_center|LOCUS_31000 3407406 3408266 gene locus_tag LOCUS_31010 3407406 3408266 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030587.1 protein_id gnl|my_center|LOCUS_31010 3408381 3408305 gene locus_tag LOCUS_t00470 3408381 3408305 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3408478 3408403 gene locus_tag LOCUS_t00480 3408478 3408403 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3408589 3408516 gene locus_tag LOCUS_t00490 3408589 3408516 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3410183 3408669 gene locus_tag LOCUS_31020 3410183 3408669 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974879.1 protein_id gnl|my_center|LOCUS_31020 3410295 3410636 gene locus_tag LOCUS_31030 3410295 3410636 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_31030 3410660 3411058 gene locus_tag LOCUS_31040 3410660 3411058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 3411055 3411429 gene locus_tag LOCUS_31050 gene crcB 3411055 3411429 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031399.1 protein_id gnl|my_center|LOCUS_31050 3411914 3411501 gene locus_tag LOCUS_31060 3411914 3411501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 3412342 3414819 gene locus_tag LOCUS_31070 3412342 3414819 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974877.1 protein_id gnl|my_center|LOCUS_31070 3414446 3414674 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgttcaaccgtgaccgtcgtgacgagcg 3415049 3417178 gene locus_tag LOCUS_31080 3415049 3417178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 3417377 3417451 gene locus_tag LOCUS_t00500 3417377 3417451 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3418002 3417667 gene locus_tag LOCUS_31090 3418002 3417667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 3418612 3418025 gene locus_tag LOCUS_31100 3418612 3418025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 3419277 3418624 gene locus_tag LOCUS_31110 3419277 3418624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 3419836 3419195 gene locus_tag LOCUS_31120 3419836 3419195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 3420731 3419829 gene locus_tag LOCUS_31130 3420731 3419829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 3421531 3420839 gene locus_tag LOCUS_31140 3421531 3420839 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228563.1 protein_id gnl|my_center|LOCUS_31140 3421628 3422401 gene locus_tag LOCUS_31150 3421628 3422401 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030186.1 protein_id gnl|my_center|LOCUS_31150 3422388 3422855 gene locus_tag LOCUS_31160 3422388 3422855 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110618.1 protein_id gnl|my_center|LOCUS_31160 3423406 3422843 gene locus_tag LOCUS_31170 3423406 3422843 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137208463.1 protein_id gnl|my_center|LOCUS_31170 3424757 3423624 gene locus_tag LOCUS_31180 3424757 3423624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 3425369 3426214 gene locus_tag LOCUS_31190 3425369 3426214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 3426251 3426460 gene locus_tag LOCUS_31200 3426251 3426460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 3426917 3426645 gene locus_tag LOCUS_31210 3426917 3426645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 3427174 3426944 gene locus_tag LOCUS_31220 3427174 3426944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 3428680 3427301 gene locus_tag LOCUS_31230 3428680 3427301 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224565.1 protein_id gnl|my_center|LOCUS_31230 3428911 3428985 gene locus_tag LOCUS_t00510 3428911 3428985 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3429243 3430409 gene locus_tag LOCUS_31240 3429243 3430409 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326766.1 protein_id gnl|my_center|LOCUS_31240 3430859 3431911 gene locus_tag LOCUS_31250 3430859 3431911 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029440.1 protein_id gnl|my_center|LOCUS_31250 3432078 3433022 gene locus_tag LOCUS_31260 3432078 3433022 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230820.1 protein_id gnl|my_center|LOCUS_31260 3434593 3433055 gene locus_tag LOCUS_31270 3434593 3433055 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029441.1 protein_id gnl|my_center|LOCUS_31270 3435523 3434702 gene locus_tag LOCUS_31280 gene trmB 3435523 3434702 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974862.1 protein_id gnl|my_center|LOCUS_31280 3436772 3435516 gene locus_tag LOCUS_31290 gene lhgO 3436772 3435516 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974860.1 protein_id gnl|my_center|LOCUS_31290 3438432 3436918 gene locus_tag LOCUS_31300 3438432 3436918 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974859.1 protein_id gnl|my_center|LOCUS_31300 3439400 3441508 gene locus_tag LOCUS_31310 3439400 3441508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 3443663 3441591 gene locus_tag LOCUS_31320 3443663 3441591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31320 3444723 3443893 gene locus_tag LOCUS_31330 3444723 3443893 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029446.1 protein_id gnl|my_center|LOCUS_31330 3445063 3446493 gene locus_tag LOCUS_31340 3445063 3446493 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974853.1 protein_id gnl|my_center|LOCUS_31340 3446855 3448558 gene locus_tag LOCUS_31350 3446855 3448558 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029448.1 protein_id gnl|my_center|LOCUS_31350 3449868 3448552 gene locus_tag LOCUS_31360 3449868 3448552 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029449.1 protein_id gnl|my_center|LOCUS_31360 3449951 3450556 gene locus_tag LOCUS_31370 3449951 3450556 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974850.1 protein_id gnl|my_center|LOCUS_31370 3451219 3452741 gene locus_tag LOCUS_r00130 3451219 3452741 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3453047 3456167 gene locus_tag LOCUS_r00140 3453047 3456167 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3456251 3456361 gene locus_tag LOCUS_r00150 3456251 3456361 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3457942 3456482 gene locus_tag LOCUS_31380 3457942 3456482 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029453.1 protein_id gnl|my_center|LOCUS_31380 3459362 3457944 gene locus_tag LOCUS_31390 3459362 3457944 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974843.1 protein_id gnl|my_center|LOCUS_31390 3461019 3459469 gene locus_tag LOCUS_31400 3461019 3459469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326782.1 protein_id gnl|my_center|LOCUS_31400 3462347 3461016 gene locus_tag LOCUS_31410 3462347 3461016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668748.1 protein_id gnl|my_center|LOCUS_31410 3463200 3462337 gene locus_tag LOCUS_31420 3463200 3462337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029454.1 protein_id gnl|my_center|LOCUS_31420 3463697 3463389 gene locus_tag LOCUS_31430 3463697 3463389 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974839.1 protein_id gnl|my_center|LOCUS_31430 3464284 3464673 gene locus_tag LOCUS_31440 3464284 3464673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 3464670 3466457 gene locus_tag LOCUS_31450 3464670 3466457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 3466454 3466987 gene locus_tag LOCUS_31460 3466454 3466987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 3467089 3468099 gene locus_tag LOCUS_31470 gene tgdA 3467089 3468099 CDS product transglycosylase TgdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029455.1 protein_id gnl|my_center|LOCUS_31470 3468398 3469135 gene locus_tag LOCUS_31480 3468398 3469135 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974837.1 protein_id gnl|my_center|LOCUS_31480 3469098 3469189 gene locus_tag LOCUS_t00520 3469098 3469189 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3470918 3469215 gene locus_tag LOCUS_31490 3470918 3469215 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093303.1 protein_id gnl|my_center|LOCUS_31490 3471367 3471083 gene locus_tag LOCUS_31500 3471367 3471083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 3471551 3472435 gene locus_tag LOCUS_31510 3471551 3472435 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029457.1 protein_id gnl|my_center|LOCUS_31510 3472544 3472702 gene locus_tag LOCUS_31520 3472544 3472702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 3473160 3472756 gene locus_tag LOCUS_31530 3473160 3472756 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029458.1 protein_id gnl|my_center|LOCUS_31530 3473359 3473979 gene locus_tag LOCUS_31540 3473359 3473979 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_31540 3473985 3474983 gene locus_tag LOCUS_31550 gene pitH 3473985 3474983 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029459.1 protein_id gnl|my_center|LOCUS_31550 3475879 3475103 gene locus_tag LOCUS_31560 gene pstB 3475879 3475103 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974830.1 protein_id gnl|my_center|LOCUS_31560 3477002 3475920 gene locus_tag LOCUS_31570 gene pstA 3477002 3475920 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 protein_id gnl|my_center|LOCUS_31570 3477991 3476999 gene locus_tag LOCUS_31580 gene pstC 3477991 3476999 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029460.1 protein_id gnl|my_center|LOCUS_31580 3477873 3478118 gene locus_tag LOCUS_31590 3477873 3478118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 3479258 3478122 gene locus_tag LOCUS_31600 gene pstS 3479258 3478122 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974827.1 protein_id gnl|my_center|LOCUS_31600 3479957 3479526 gene locus_tag LOCUS_31610 3479957 3479526 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029461.1 protein_id gnl|my_center|LOCUS_31610 3481000 3479954 gene locus_tag LOCUS_31620 3481000 3479954 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487611.1 protein_id gnl|my_center|LOCUS_31620 3483326 3480969 gene locus_tag LOCUS_31630 3483326 3480969 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_31630 3483365 3483544 gene locus_tag LOCUS_31640 3483365 3483544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 3484540 3483617 gene locus_tag LOCUS_31650 gene mshD 3484540 3483617 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_31650 3484838 3486652 gene locus_tag LOCUS_31660 3484838 3486652 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029468.1 protein_id gnl|my_center|LOCUS_31660 3488153 3486645 gene locus_tag LOCUS_31670 3488153 3486645 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029471.1 protein_id gnl|my_center|LOCUS_31670 3488881 3488150 gene locus_tag LOCUS_31680 3488881 3488150 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029472.1 protein_id gnl|my_center|LOCUS_31680 3489995 3488982 gene locus_tag LOCUS_31690 3489995 3488982 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009689.1 protein_id gnl|my_center|LOCUS_31690 3491144 3490095 gene locus_tag LOCUS_31700 3491144 3490095 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974813.1 protein_id gnl|my_center|LOCUS_31700 3491984 3491169 gene locus_tag LOCUS_31710 gene glnR 3491984 3491169 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_31710 3492234 3493430 gene locus_tag LOCUS_31720 3492234 3493430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 3493441 3494742 gene locus_tag LOCUS_31730 3493441 3494742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029476.1 protein_id gnl|my_center|LOCUS_31730 3494817 3495503 gene locus_tag LOCUS_31740 3494817 3495503 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974808.1 protein_id gnl|my_center|LOCUS_31740 3495962 3496807 gene locus_tag LOCUS_31750 3495962 3496807 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974806.1 protein_id gnl|my_center|LOCUS_31750 3496858 3497145 gene locus_tag LOCUS_31760 3496858 3497145 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974805.1 protein_id gnl|my_center|LOCUS_31760 3497264 3497524 gene locus_tag LOCUS_31770 3497264 3497524 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326801.1 protein_id gnl|my_center|LOCUS_31770 3497880 3497533 gene locus_tag LOCUS_31780 3497880 3497533 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974797.1 protein_id gnl|my_center|LOCUS_31780 3498197 3498769 gene locus_tag LOCUS_31790 3498197 3498769 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974791.1 protein_id gnl|my_center|LOCUS_31790 3498829 3499278 gene locus_tag LOCUS_31800 3498829 3499278 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_31800 3499331 3500296 gene locus_tag LOCUS_31810 3499331 3500296 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 protein_id gnl|my_center|LOCUS_31810 3500788 3500339 gene locus_tag LOCUS_31820 gene dtd 3500788 3500339 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029487.1 protein_id gnl|my_center|LOCUS_31820 3501080 3501595 gene locus_tag LOCUS_31830 3501080 3501595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 3501645 3502622 gene locus_tag LOCUS_31840 3501645 3502622 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_31840 3502691 3503941 gene locus_tag LOCUS_31850 3502691 3503941 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974785.1 protein_id gnl|my_center|LOCUS_31850 3504151 3504032 gene locus_tag LOCUS_31860 3504151 3504032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 3504255 3504896 gene locus_tag LOCUS_31870 3504255 3504896 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974777.1 protein_id gnl|my_center|LOCUS_31870 3505104 3505967 gene locus_tag LOCUS_31880 3505104 3505967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 3505961 3508237 gene locus_tag LOCUS_31890 3505961 3508237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 3508239 3509504 gene locus_tag LOCUS_31900 3508239 3509504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 3509504 3510772 gene locus_tag LOCUS_31910 3509504 3510772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 3511332 3511117 gene locus_tag LOCUS_31920 3511332 3511117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 3514454 3511329 gene locus_tag LOCUS_31930 3514454 3511329 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918509.1 protein_id gnl|my_center|LOCUS_31930 3515626 3514454 gene locus_tag LOCUS_31940 3515626 3514454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 3517571 3515619 gene locus_tag LOCUS_31950 3517571 3515619 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385729.1 protein_id gnl|my_center|LOCUS_31950 3517724 3519001 gene locus_tag LOCUS_31960 3517724 3519001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 3519103 3519663 gene locus_tag LOCUS_31970 3519103 3519663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 3519692 3520297 gene locus_tag LOCUS_31980 3519692 3520297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974772.1 protein_id gnl|my_center|LOCUS_31980 3520328 3520795 gene locus_tag LOCUS_31990 3520328 3520795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 3522117 3520777 gene locus_tag LOCUS_32000 3522117 3520777 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487464.1 protein_id gnl|my_center|LOCUS_32000 3523685 3522624 gene locus_tag LOCUS_32010 3523685 3522624 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029498.1 protein_id gnl|my_center|LOCUS_32010 3524874 3524005 gene locus_tag LOCUS_32020 3524874 3524005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974768.1 protein_id gnl|my_center|LOCUS_32020 3525149 3526501 gene locus_tag LOCUS_32030 gene mshA 3525149 3526501 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326818.1 protein_id gnl|my_center|LOCUS_32030 3526494 3527003 gene locus_tag LOCUS_32040 3526494 3527003 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974766.1 protein_id gnl|my_center|LOCUS_32040 3527237 3528019 gene locus_tag LOCUS_32050 3527237 3528019 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029831.1 protein_id gnl|my_center|LOCUS_32050 3528362 3528081 gene locus_tag LOCUS_32060 3528362 3528081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 3528607 3528359 gene locus_tag LOCUS_32070 3528607 3528359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 3528681 3528836 gene locus_tag LOCUS_32080 3528681 3528836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 3530384 3529623 gene locus_tag LOCUS_32090 3530384 3529623 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974762.1 protein_id gnl|my_center|LOCUS_32090 3530720 3532045 gene locus_tag LOCUS_32100 3530720 3532045 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_32100 3533151 3532468 gene locus_tag LOCUS_32110 gene phoU 3533151 3532468 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_32110 3533354 3534616 gene locus_tag LOCUS_32120 3533354 3534616 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_32120 3534613 3535293 gene locus_tag LOCUS_32130 3534613 3535293 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_32130 3536026 3535373 gene locus_tag LOCUS_32140 3536026 3535373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 3536250 3536035 gene locus_tag LOCUS_32150 3536250 3536035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 3536623 3537105 gene locus_tag LOCUS_32160 3536623 3537105 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003953493.1 protein_id gnl|my_center|LOCUS_32160 3537402 3538157 gene locus_tag LOCUS_32170 gene ispD 3537402 3538157 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029521.1 protein_id gnl|my_center|LOCUS_32170 3538147 3538668 gene locus_tag LOCUS_32180 gene ispF 3538147 3538668 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029522.1 protein_id gnl|my_center|LOCUS_32180 3538942 3540342 gene locus_tag LOCUS_32190 gene cysS 3538942 3540342 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_32190 3540449 3541405 gene locus_tag LOCUS_32200 gene rlmB 3540449 3541405 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029524.1 protein_id gnl|my_center|LOCUS_32200 3542068 3541436 gene locus_tag LOCUS_32210 3542068 3541436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 3543581 3542106 gene locus_tag LOCUS_32220 3543581 3542106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 3543793 3545367 gene locus_tag LOCUS_32230 3543793 3545367 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739108.1 protein_id gnl|my_center|LOCUS_32230 3546182 3545463 gene locus_tag LOCUS_32240 3546182 3545463 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974737.1 protein_id gnl|my_center|LOCUS_32240 3546634 3546218 gene locus_tag LOCUS_32250 3546634 3546218 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029526.1 protein_id gnl|my_center|LOCUS_32250 3548034 3546898 gene locus_tag LOCUS_32260 gene msiK 3548034 3546898 CDS product diacetylchitobiose ABC transporter ATP-binding protein MsiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029527.1 protein_id gnl|my_center|LOCUS_32260 3548236 3548312 gene locus_tag LOCUS_t00530 3548236 3548312 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3548842 3549759 gene locus_tag LOCUS_32270 3548842 3549759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229910.1 protein_id gnl|my_center|LOCUS_32270 3549974 3550363 gene locus_tag LOCUS_32280 3549974 3550363 CDS product peptidase inhibitor family I36 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229909.1 protein_id gnl|my_center|LOCUS_32280 3550371 3550916 gene locus_tag LOCUS_32290 3550371 3550916 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081121.1 protein_id gnl|my_center|LOCUS_32290 3552319 3550919 gene locus_tag LOCUS_32300 3552319 3550919 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_32300 3552503 3553477 gene locus_tag LOCUS_32310 3552503 3553477 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867073.1 protein_id gnl|my_center|LOCUS_32310 3553553 3554029 gene locus_tag LOCUS_32320 3553553 3554029 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088503.1 protein_id gnl|my_center|LOCUS_32320 3554034 3554921 gene locus_tag LOCUS_32330 3554034 3554921 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326845.1 protein_id gnl|my_center|LOCUS_32330 3555515 3555015 gene locus_tag LOCUS_32340 3555515 3555015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974706.1 protein_id gnl|my_center|LOCUS_32340 3556359 3555721 gene locus_tag LOCUS_32350 3556359 3555721 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029548.1 protein_id gnl|my_center|LOCUS_32350 3557678 3556356 gene locus_tag LOCUS_32360 3557678 3556356 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029547.1 protein_id gnl|my_center|LOCUS_32360 3557899 3558456 gene locus_tag LOCUS_32370 3557899 3558456 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974701.1 protein_id gnl|my_center|LOCUS_32370 3558781 3560202 gene locus_tag LOCUS_32380 3558781 3560202 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029546.1 protein_id gnl|my_center|LOCUS_32380 3560996 3560421 gene locus_tag LOCUS_32390 3560996 3560421 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974698.1 protein_id gnl|my_center|LOCUS_32390 3561181 3561615 gene locus_tag LOCUS_32400 gene arfB 3561181 3561615 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974697.1 protein_id gnl|my_center|LOCUS_32400 3562255 3561683 gene locus_tag LOCUS_32410 3562255 3561683 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109035270.1 protein_id gnl|my_center|LOCUS_32410 3562562 3564214 gene locus_tag LOCUS_32420 gene cdgB 3562562 3564214 CDS product diguanylate cyclase CdgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029551.1 protein_id gnl|my_center|LOCUS_32420 3564358 3565326 gene locus_tag LOCUS_32430 3564358 3565326 CDS product CBM35 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029552.1 protein_id gnl|my_center|LOCUS_32430 3566598 3565444 gene locus_tag LOCUS_32440 gene nagA 3566598 3565444 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029554.1 protein_id gnl|my_center|LOCUS_32440 3567530 3566598 gene locus_tag LOCUS_32450 3567530 3566598 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029555.1 protein_id gnl|my_center|LOCUS_32450 3567715 3568992 gene locus_tag LOCUS_32460 3567715 3568992 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136207383.1 protein_id gnl|my_center|LOCUS_32460 3569034 3569270 gene locus_tag LOCUS_32470 3569034 3569270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 3569347 3570198 gene locus_tag LOCUS_32480 gene otsB 3569347 3570198 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029558.1 protein_id gnl|my_center|LOCUS_32480 3571554 3570175 gene locus_tag LOCUS_32490 3571554 3570175 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029560.1 protein_id gnl|my_center|LOCUS_32490 3571826 3571611 gene locus_tag LOCUS_32500 3571826 3571611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 3572742 3571864 gene locus_tag LOCUS_32510 3572742 3571864 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974682.1 protein_id gnl|my_center|LOCUS_32510 3573113 3574405 gene locus_tag LOCUS_32520 gene thrC 3573113 3574405 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270150.1 protein_id gnl|my_center|LOCUS_32520 3574437 3574712 gene locus_tag LOCUS_32530 3574437 3574712 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_32530 3574966 3574817 gene locus_tag LOCUS_32540 3574966 3574817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 3575164 3575370 gene locus_tag LOCUS_32550 3575164 3575370 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004929928.1 protein_id gnl|my_center|LOCUS_32550 3575735 3577357 gene locus_tag LOCUS_32560 gene groL 3575735 3577357 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_32560 3578664 3577369 gene locus_tag LOCUS_32570 3578664 3577369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028697.1 protein_id gnl|my_center|LOCUS_32570 3578913 3579359 gene locus_tag LOCUS_32580 3578913 3579359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 3580198 3579383 gene locus_tag LOCUS_32590 3580198 3579383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 3581618 3580641 gene locus_tag LOCUS_32600 3581618 3580641 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223267.1 protein_id gnl|my_center|LOCUS_32600 3581745 3582290 gene locus_tag LOCUS_32610 3581745 3582290 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742221.1 protein_id gnl|my_center|LOCUS_32610 3582752 3582303 gene locus_tag LOCUS_32620 3582752 3582303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 3583186 3585330 gene locus_tag LOCUS_32630 gene helR 3583186 3585330 CDS product RNA polymerase recycling motor ATPase HelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728199.1 protein_id gnl|my_center|LOCUS_32630 3586101 3585418 gene locus_tag LOCUS_32640 3586101 3585418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029884.1 protein_id gnl|my_center|LOCUS_32640 3586522 3586085 gene locus_tag LOCUS_32650 3586522 3586085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 3588957 3586543 gene locus_tag LOCUS_32660 3588957 3586543 CDS product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029885.1 protein_id gnl|my_center|LOCUS_32660 3589409 3589651 gene locus_tag LOCUS_32670 3589409 3589651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 3589641 3589874 gene locus_tag LOCUS_32680 3589641 3589874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028395.1 protein_id gnl|my_center|LOCUS_32680 3590415 3590062 gene locus_tag LOCUS_32690 3590415 3590062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 3592058 3590544 gene locus_tag LOCUS_32700 3592058 3590544 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234968.1 protein_id gnl|my_center|LOCUS_32700 3593085 3592108 gene locus_tag LOCUS_32710 gene murQ 3593085 3592108 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029570.1 protein_id gnl|my_center|LOCUS_32710 3594096 3593179 gene locus_tag LOCUS_32720 3594096 3593179 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974666.1 protein_id gnl|my_center|LOCUS_32720 3594171 3594536 gene locus_tag LOCUS_32730 3594171 3594536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974665.1 protein_id gnl|my_center|LOCUS_32730 3594533 3594805 gene locus_tag LOCUS_32740 3594533 3594805 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974664.1 protein_id gnl|my_center|LOCUS_32740 3596158 3594875 gene locus_tag LOCUS_32750 3596158 3594875 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031724.1 protein_id gnl|my_center|LOCUS_32750 3596866 3596186 gene locus_tag LOCUS_32760 3596866 3596186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974662.1 protein_id gnl|my_center|LOCUS_32760 3596929 3597759 gene locus_tag LOCUS_32770 3596929 3597759 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027118.1 protein_id gnl|my_center|LOCUS_32770 3597756 3598439 gene locus_tag LOCUS_32780 3597756 3598439 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027119.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32780 3598436 3599308 gene locus_tag LOCUS_32790 3598436 3599308 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027120.1 protein_id gnl|my_center|LOCUS_32790 3601644 3599368 gene locus_tag LOCUS_32800 3601644 3599368 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027542.1 protein_id gnl|my_center|LOCUS_32800 3601885 3602574 gene locus_tag LOCUS_32810 3601885 3602574 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029574.1 protein_id gnl|my_center|LOCUS_32810 3602595 3602750 gene locus_tag LOCUS_32820 3602595 3602750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 3604891 3602798 gene locus_tag LOCUS_32830 3604891 3602798 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 protein_id gnl|my_center|LOCUS_32830 3607062 3605419 gene locus_tag LOCUS_32840 3607062 3605419 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063651.1 protein_id gnl|my_center|LOCUS_32840 3609903 3607357 gene locus_tag LOCUS_32850 3609903 3607357 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029578.1 protein_id gnl|my_center|LOCUS_32850 3609967 3611046 gene locus_tag LOCUS_32860 3609967 3611046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190142944.1 protein_id gnl|my_center|LOCUS_32860 3611115 3611783 gene locus_tag LOCUS_32870 3611115 3611783 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029580.1 protein_id gnl|my_center|LOCUS_32870 3611996 3611763 gene locus_tag LOCUS_32880 3611996 3611763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974651.1 protein_id gnl|my_center|LOCUS_32880 3612164 3612547 gene locus_tag LOCUS_32890 3612164 3612547 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974650.1 protein_id gnl|my_center|LOCUS_32890 3613476 3612592 gene locus_tag LOCUS_32900 3613476 3612592 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974649.1 protein_id gnl|my_center|LOCUS_32900 3614161 3613448 gene locus_tag LOCUS_32910 3614161 3613448 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326870.1 protein_id gnl|my_center|LOCUS_32910 3614661 3614179 gene locus_tag LOCUS_32920 3614661 3614179 CDS product DUF2771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668749.1 protein_id gnl|my_center|LOCUS_32920 3616053 3614689 gene locus_tag LOCUS_32930 3616053 3614689 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029582.1 protein_id gnl|my_center|LOCUS_32930 3616147 3616446 gene locus_tag LOCUS_32940 3616147 3616446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 3616662 3617606 gene locus_tag LOCUS_32950 3616662 3617606 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974645.1 protein_id gnl|my_center|LOCUS_32950 3617966 3621178 gene locus_tag LOCUS_32960 3617966 3621178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029583.1 protein_id gnl|my_center|LOCUS_32960 3621436 3621203 gene locus_tag LOCUS_32970 3621436 3621203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 3621329 3622186 gene locus_tag LOCUS_32980 3621329 3622186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 3624616 3622196 gene locus_tag LOCUS_32990 3624616 3622196 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029584.1 protein_id gnl|my_center|LOCUS_32990 3624940 3624647 gene locus_tag LOCUS_33000 3624940 3624647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 3625171 3626625 gene locus_tag LOCUS_33010 3625171 3626625 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029586.1 protein_id gnl|my_center|LOCUS_33010 3626881 3626666 gene locus_tag LOCUS_33020 3626881 3626666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974640.1 protein_id gnl|my_center|LOCUS_33020 3627013 3627453 gene locus_tag LOCUS_33030 3627013 3627453 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974639.1 protein_id gnl|my_center|LOCUS_33030 3627544 3628878 gene locus_tag LOCUS_33040 3627544 3628878 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_33040 3630144 3629137 gene locus_tag LOCUS_33050 3630144 3629137 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030673054.1 protein_id gnl|my_center|LOCUS_33050 3632216 3630240 gene locus_tag LOCUS_33060 3632216 3630240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 3633236 3632448 gene locus_tag LOCUS_33070 3633236 3632448 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777030.1 protein_id gnl|my_center|LOCUS_33070 3633242 3633802 gene locus_tag LOCUS_33080 3633242 3633802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 3634243 3633827 gene locus_tag LOCUS_33090 3634243 3633827 CDS product protease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978099.1 protein_id gnl|my_center|LOCUS_33090 3635831 3634614 gene locus_tag LOCUS_33100 3635831 3634614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 3635930 3636130 gene locus_tag LOCUS_33110 3635930 3636130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 3636127 3636369 gene locus_tag LOCUS_33120 3636127 3636369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 3636562 3637461 gene locus_tag LOCUS_33130 3636562 3637461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 3637488 3637835 gene locus_tag LOCUS_33140 3637488 3637835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 3637951 3638271 gene locus_tag LOCUS_33150 3637951 3638271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 3638525 3639094 gene locus_tag LOCUS_33160 3638525 3639094 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225996.1 protein_id gnl|my_center|LOCUS_33160 3639229 3639864 gene locus_tag LOCUS_33170 3639229 3639864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 3640751 3639996 gene locus_tag LOCUS_33180 3640751 3639996 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974625.1 protein_id gnl|my_center|LOCUS_33180 3640750 3641745 gene locus_tag LOCUS_33190 3640750 3641745 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114660815.1 protein_id gnl|my_center|LOCUS_33190 3641884 3641756 gene locus_tag LOCUS_33200 3641884 3641756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 3641967 3642479 gene locus_tag LOCUS_33210 3641967 3642479 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028212.1 protein_id gnl|my_center|LOCUS_33210 3642491 3643183 gene locus_tag LOCUS_33220 3642491 3643183 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285566.1 protein_id gnl|my_center|LOCUS_33220 3643197 3643613 gene locus_tag LOCUS_33230 3643197 3643613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 3644853 3643735 gene locus_tag LOCUS_33240 gene serC 3644853 3643735 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029607.1 protein_id gnl|my_center|LOCUS_33240 3646149 3644941 gene locus_tag LOCUS_33250 3646149 3644941 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031650.1 protein_id gnl|my_center|LOCUS_33250 3647351 3646146 gene locus_tag LOCUS_33260 3647351 3646146 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031651.1 protein_id gnl|my_center|LOCUS_33260 3648034 3647390 gene locus_tag LOCUS_33270 3648034 3647390 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469546.1 protein_id gnl|my_center|LOCUS_33270 3648386 3648015 gene locus_tag LOCUS_33280 3648386 3648015 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223334.1 protein_id gnl|my_center|LOCUS_33280 3648820 3648383 gene locus_tag LOCUS_33290 3648820 3648383 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971722.1 protein_id gnl|my_center|LOCUS_33290 3650310 3648817 gene locus_tag LOCUS_33300 3650310 3648817 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031653.1 protein_id gnl|my_center|LOCUS_33300 3650624 3652342 gene locus_tag LOCUS_33310 3650624 3652342 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518416.1 protein_id gnl|my_center|LOCUS_33310 3652447 3655239 gene locus_tag LOCUS_33320 3652447 3655239 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029608.1 protein_id gnl|my_center|LOCUS_33320 3655458 3656411 gene locus_tag LOCUS_33330 3655458 3656411 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974609.1 protein_id gnl|my_center|LOCUS_33330 3656563 3658332 gene locus_tag LOCUS_33340 3656563 3658332 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029617.1 protein_id gnl|my_center|LOCUS_33340 3658329 3659936 gene locus_tag LOCUS_33350 3658329 3659936 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974603.1 protein_id gnl|my_center|LOCUS_33350 3659945 3661903 gene locus_tag LOCUS_33360 3659945 3661903 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029618.1 protein_id gnl|my_center|LOCUS_33360 3661900 3663060 gene locus_tag LOCUS_33370 3661900 3663060 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029619.1 protein_id gnl|my_center|LOCUS_33370 3663128 3663862 gene locus_tag LOCUS_33380 3663128 3663862 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974599.1 protein_id gnl|my_center|LOCUS_33380 3663850 3664437 gene locus_tag LOCUS_33390 3663850 3664437 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867225.1 protein_id gnl|my_center|LOCUS_33390 3665571 3664462 gene locus_tag LOCUS_33400 3665571 3664462 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029624.1 protein_id gnl|my_center|LOCUS_33400 3665770 3666486 gene locus_tag LOCUS_33410 gene pdxH 3665770 3666486 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029623.1 protein_id gnl|my_center|LOCUS_33410 3667739 3666984 gene locus_tag LOCUS_33420 3667739 3666984 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974589.1 protein_id gnl|my_center|LOCUS_33420 3667937 3668629 gene locus_tag LOCUS_33430 3667937 3668629 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_33430 3669289 3670191 gene locus_tag LOCUS_33440 3669289 3670191 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326902.1 protein_id gnl|my_center|LOCUS_33440 3671855 3670212 gene locus_tag LOCUS_33450 3671855 3670212 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029630.1 protein_id gnl|my_center|LOCUS_33450 3672700 3671852 gene locus_tag LOCUS_33460 3672700 3671852 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_33460 3673416 3672739 gene locus_tag LOCUS_33470 3673416 3672739 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974584.1 protein_id gnl|my_center|LOCUS_33470 3673688 3675070 gene locus_tag LOCUS_33480 3673688 3675070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029632.1 protein_id gnl|my_center|LOCUS_33480 3675149 3676723 gene locus_tag LOCUS_33490 3675149 3676723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867240.1 protein_id gnl|my_center|LOCUS_33490 3678075 3676801 gene locus_tag LOCUS_33500 3678075 3676801 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974581.1 protein_id gnl|my_center|LOCUS_33500 3678250 3678696 gene locus_tag LOCUS_33510 3678250 3678696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974580.1 protein_id gnl|my_center|LOCUS_33510 3678707 3679627 gene locus_tag LOCUS_33520 gene purU 3678707 3679627 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974579.1 protein_id gnl|my_center|LOCUS_33520 3680760 3679639 gene locus_tag LOCUS_33530 3680760 3679639 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029636.1 protein_id gnl|my_center|LOCUS_33530 3681620 3681024 gene locus_tag LOCUS_33540 3681620 3681024 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974573.1 protein_id gnl|my_center|LOCUS_33540 3681846 3682220 gene locus_tag LOCUS_33550 3681846 3682220 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974572.1 protein_id gnl|my_center|LOCUS_33550 3682304 3682825 gene locus_tag LOCUS_33560 gene calD 3682304 3682825 CDS product calcium binding protein CalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974571.1 protein_id gnl|my_center|LOCUS_33560 3683360 3683911 gene locus_tag LOCUS_33570 3683360 3683911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 3684089 3685387 gene locus_tag LOCUS_33580 3684089 3685387 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031193.1 protein_id gnl|my_center|LOCUS_33580 3685384 3685785 gene locus_tag LOCUS_33590 3685384 3685785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 3686066 3687418 gene locus_tag LOCUS_33600 3686066 3687418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028811.1 protein_id gnl|my_center|LOCUS_33600 3687535 3688362 gene locus_tag LOCUS_33610 3687535 3688362 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972642.1 protein_id gnl|my_center|LOCUS_33610 3689421 3688483 gene locus_tag LOCUS_33620 3689421 3688483 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030927.1 protein_id gnl|my_center|LOCUS_33620 3690681 3689479 gene locus_tag LOCUS_33630 3690681 3689479 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029639.1 protein_id gnl|my_center|LOCUS_33630 3691443 3690778 gene locus_tag LOCUS_33640 3691443 3690778 CDS product pyridoxal 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974564.1 protein_id gnl|my_center|LOCUS_33640 3692239 3691592 gene locus_tag LOCUS_33650 3692239 3691592 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974562.1 protein_id gnl|my_center|LOCUS_33650 3692604 3693374 gene locus_tag LOCUS_33660 3692604 3693374 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031563.1 protein_id gnl|my_center|LOCUS_33660 3693594 3696020 gene locus_tag LOCUS_33670 3693594 3696020 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029643.1 protein_id gnl|my_center|LOCUS_33670 3696695 3696060 gene locus_tag LOCUS_33680 3696695 3696060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 3696953 3697504 gene locus_tag LOCUS_33690 3696953 3697504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 3697809 3697618 gene locus_tag LOCUS_33700 3697809 3697618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 3700331 3698022 gene locus_tag LOCUS_33710 gene afsR 3700331 3698022 CDS product transcriptional regulator AfsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029645.1 protein_id gnl|my_center|LOCUS_33710 3700404 3700715 gene locus_tag LOCUS_33720 3700404 3700715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 3701520 3701317 gene locus_tag LOCUS_33730 3701520 3701317 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_33730 3701829 3702758 gene locus_tag LOCUS_33740 3701829 3702758 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974442.1 protein_id gnl|my_center|LOCUS_33740 3703156 3704904 gene locus_tag LOCUS_33750 3703156 3704904 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029699.1 protein_id gnl|my_center|LOCUS_33750 3704977 3706176 gene locus_tag LOCUS_33760 gene mqnC 3704977 3706176 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029726.1 protein_id gnl|my_center|LOCUS_33760 3706184 3706648 gene locus_tag LOCUS_33770 3706184 3706648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 3706789 3707436 gene locus_tag LOCUS_33780 3706789 3707436 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_33780 3707989 3707471 gene locus_tag LOCUS_33790 3707989 3707471 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029731.1 protein_id gnl|my_center|LOCUS_33790 3708087 3709370 gene locus_tag LOCUS_33800 3708087 3709370 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_33800 3710052 3709612 gene locus_tag LOCUS_33810 3710052 3709612 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095231.1 protein_id gnl|my_center|LOCUS_33810 3710705 3710088 gene locus_tag LOCUS_33820 3710705 3710088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 3712195 3710702 gene locus_tag LOCUS_33830 3712195 3710702 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_33830 3713030 3712158 gene locus_tag LOCUS_33840 3713030 3712158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 3713847 3713647 gene locus_tag LOCUS_33850 3713847 3713647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 3714712 3713858 gene locus_tag LOCUS_33860 gene whiJ 3714712 3713858 CDS product transcriptional regulator WhiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029721.1 protein_id gnl|my_center|LOCUS_33860 3715116 3714817 gene locus_tag LOCUS_33870 3715116 3714817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 3716018 3715494 gene locus_tag LOCUS_33880 3716018 3715494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 3716390 3717643 gene locus_tag LOCUS_33890 3716390 3717643 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731154.1 protein_id gnl|my_center|LOCUS_33890 3718658 3717645 gene locus_tag LOCUS_33900 3718658 3717645 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029732.1 protein_id gnl|my_center|LOCUS_33900 3719343 3719702 gene locus_tag LOCUS_33910 3719343 3719702 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_33910 3719719 3720273 gene locus_tag LOCUS_33920 3719719 3720273 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006133126.1 protein_id gnl|my_center|LOCUS_33920 3720270 3720986 gene locus_tag LOCUS_33930 3720270 3720986 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_33930 3720986 3722308 gene locus_tag LOCUS_33940 3720986 3722308 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_33940 3722305 3723150 gene locus_tag LOCUS_33950 gene nuoE 3722305 3723150 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974380.1 protein_id gnl|my_center|LOCUS_33950 3723150 3724514 gene locus_tag LOCUS_33960 gene nuoF 3723150 3724514 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974379.1 protein_id gnl|my_center|LOCUS_33960 3724511 3727015 gene locus_tag LOCUS_33970 3724511 3727015 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029735.1 protein_id gnl|my_center|LOCUS_33970 3727012 3728415 gene locus_tag LOCUS_33980 gene nuoH 3727012 3728415 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029736.1 protein_id gnl|my_center|LOCUS_33980 3728408 3729019 gene locus_tag LOCUS_33990 gene nuoI 3728408 3729019 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327003.1 protein_id gnl|my_center|LOCUS_33990 3729016 3729840 gene locus_tag LOCUS_34000 3729016 3729840 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029738.1 protein_id gnl|my_center|LOCUS_34000 3729837 3730136 gene locus_tag LOCUS_34010 gene nuoK 3729837 3730136 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974374.1 protein_id gnl|my_center|LOCUS_34010 3730149 3732044 gene locus_tag LOCUS_34020 gene nuoL 3730149 3732044 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974373.1 protein_id gnl|my_center|LOCUS_34020 3732049 3733620 gene locus_tag LOCUS_34030 3732049 3733620 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974372.1 protein_id gnl|my_center|LOCUS_34030 3733617 3735281 gene locus_tag LOCUS_34040 gene nuoN 3733617 3735281 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_34040 3735408 3737459 gene locus_tag LOCUS_34050 gene recQ 3735408 3737459 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029740.1 protein_id gnl|my_center|LOCUS_34050 3738900 3737671 gene locus_tag LOCUS_34060 gene fahA 3738900 3737671 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029743.1 protein_id gnl|my_center|LOCUS_34060 3739252 3739416 gene locus_tag LOCUS_34070 3739252 3739416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 3739545 3740555 gene locus_tag LOCUS_34080 3739545 3740555 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_34080 3740790 3742016 gene locus_tag LOCUS_34090 3740790 3742016 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974363.1 protein_id gnl|my_center|LOCUS_34090 3742346 3742936 gene locus_tag LOCUS_34100 3742346 3742936 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976533.1 protein_id gnl|my_center|LOCUS_34100 3743957 3743034 gene locus_tag LOCUS_34110 3743957 3743034 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974366.1 protein_id gnl|my_center|LOCUS_34110 3744403 3743954 gene locus_tag LOCUS_34120 3744403 3743954 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974357.1 protein_id gnl|my_center|LOCUS_34120 3745822 3744827 gene locus_tag LOCUS_34130 gene rarD 3745822 3744827 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_34130 3745963 3746640 gene locus_tag LOCUS_34140 3745963 3746640 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180345.1 protein_id gnl|my_center|LOCUS_34140 3747802 3746744 gene locus_tag LOCUS_34150 3747802 3746744 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_34150 3749741 3747795 gene locus_tag LOCUS_34160 3749741 3747795 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_34160 3750743 3749991 gene locus_tag LOCUS_34170 3750743 3749991 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974351.1 protein_id gnl|my_center|LOCUS_34170 3752342 3750987 gene locus_tag LOCUS_34180 3752342 3750987 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029752.1 protein_id gnl|my_center|LOCUS_34180 3753710 3752523 gene locus_tag LOCUS_34190 3753710 3752523 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029753.1 protein_id gnl|my_center|LOCUS_34190 3753880 3754290 gene locus_tag LOCUS_34200 3753880 3754290 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974348.1 protein_id gnl|my_center|LOCUS_34200 3754281 3754925 gene locus_tag LOCUS_34210 3754281 3754925 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486629.1 protein_id gnl|my_center|LOCUS_34210 3754922 3756127 gene locus_tag LOCUS_34220 3754922 3756127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34220 3756124 3757092 gene locus_tag LOCUS_34230 3756124 3757092 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029756.1 protein_id gnl|my_center|LOCUS_34230 3757092 3757766 gene locus_tag LOCUS_34240 3757092 3757766 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974344.1 protein_id gnl|my_center|LOCUS_34240 3757763 3758335 gene locus_tag LOCUS_34250 3757763 3758335 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_34250 3758335 3758742 gene locus_tag LOCUS_34260 gene nuoK 3758335 3758742 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029757.1 protein_id gnl|my_center|LOCUS_34260 3758739 3760739 gene locus_tag LOCUS_34270 3758739 3760739 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029758.1 protein_id gnl|my_center|LOCUS_34270 3760743 3762323 gene locus_tag LOCUS_34280 3760743 3762323 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 protein_id gnl|my_center|LOCUS_34280 3762320 3763861 gene locus_tag LOCUS_34290 3762320 3763861 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029760.1 protein_id gnl|my_center|LOCUS_34290 3764149 3765012 gene locus_tag LOCUS_34300 gene htpX 3764149 3765012 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974338.1 protein_id gnl|my_center|LOCUS_34300 3765009 3765401 gene locus_tag LOCUS_34310 3765009 3765401 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029761.1 protein_id gnl|my_center|LOCUS_34310 3766147 3765485 gene locus_tag LOCUS_34320 3766147 3765485 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196240169.1 protein_id gnl|my_center|LOCUS_34320 3766712 3766191 gene locus_tag LOCUS_34330 3766712 3766191 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030689.1 protein_id gnl|my_center|LOCUS_34330 3767402 3766914 gene locus_tag LOCUS_34340 3767402 3766914 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_34340 3767571 3767653 gene locus_tag LOCUS_t00540 3767571 3767653 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3769179 3767815 gene locus_tag LOCUS_34350 3769179 3767815 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029764.1 protein_id gnl|my_center|LOCUS_34350 3769431 3769240 gene locus_tag LOCUS_34360 3769431 3769240 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029765.1 protein_id gnl|my_center|LOCUS_34360 3771358 3769883 gene locus_tag LOCUS_34370 3771358 3769883 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029766.1 protein_id gnl|my_center|LOCUS_34370 3772227 3771361 gene locus_tag LOCUS_34380 3772227 3771361 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029767.1 protein_id gnl|my_center|LOCUS_34380 3772615 3772313 gene locus_tag LOCUS_34390 3772615 3772313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 3774913 3772838 gene locus_tag LOCUS_34400 3774913 3772838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 3776522 3774915 gene locus_tag LOCUS_34410 3776522 3774915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 3777024 3776629 gene locus_tag LOCUS_34420 3777024 3776629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 3777372 3777043 gene locus_tag LOCUS_34430 3777372 3777043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029773.1 protein_id gnl|my_center|LOCUS_34430 3778373 3777369 gene locus_tag LOCUS_34440 3778373 3777369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029774.1 protein_id gnl|my_center|LOCUS_34440 3778654 3778370 gene locus_tag LOCUS_34450 3778654 3778370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 3778953 3778651 gene locus_tag LOCUS_34460 3778953 3778651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 3779315 3779136 gene locus_tag LOCUS_34470 3779315 3779136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 3779708 3779496 gene locus_tag LOCUS_34480 3779708 3779496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 3780001 3780774 gene locus_tag LOCUS_34490 3780001 3780774 CDS product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028876.1 protein_id gnl|my_center|LOCUS_34490 3780771 3781313 gene locus_tag LOCUS_34500 3780771 3781313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 3782284 3782147 gene locus_tag LOCUS_34510 3782284 3782147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 3782608 3783552 gene locus_tag LOCUS_34520 3782608 3783552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 3784252 3783815 gene locus_tag LOCUS_34530 3784252 3783815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081025014.1 protein_id gnl|my_center|LOCUS_34530 3785369 3784242 gene locus_tag LOCUS_34540 3785369 3784242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 3787700 3787909 gene locus_tag LOCUS_34550 3787700 3787909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 3788176 3788568 gene locus_tag LOCUS_34560 3788176 3788568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 3789458 3788802 gene locus_tag LOCUS_34570 3789458 3788802 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029782.1 protein_id gnl|my_center|LOCUS_34570 3790848 3789493 gene locus_tag LOCUS_34580 3790848 3789493 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029783.1 protein_id gnl|my_center|LOCUS_34580 3791186 3791259 gene locus_tag LOCUS_t00550 3791186 3791259 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3791304 3791377 gene locus_tag LOCUS_t00560 3791304 3791377 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3791466 3791630 gene locus_tag LOCUS_34590 gene rpmG 3791466 3791630 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948671.1 protein_id gnl|my_center|LOCUS_34590 3791734 3792189 gene locus_tag LOCUS_34600 3791734 3792189 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_34600 3792186 3792614 gene locus_tag LOCUS_34610 3792186 3792614 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_34610 3792676 3792969 gene locus_tag LOCUS_34620 3792676 3792969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 3792998 3794053 gene locus_tag LOCUS_34630 3792998 3794053 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_34630 3795078 3794068 gene locus_tag LOCUS_34640 3795078 3794068 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974319.1 protein_id gnl|my_center|LOCUS_34640 3796445 3795210 gene locus_tag LOCUS_34650 3796445 3795210 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_34650 3796652 3796725 gene locus_tag LOCUS_t00570 3796652 3796725 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3796831 3797115 gene locus_tag LOCUS_34660 gene secE 3796831 3797115 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974317.1 protein_id gnl|my_center|LOCUS_34660 3797189 3798085 gene locus_tag LOCUS_34670 gene nusG 3797189 3798085 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029791.1 protein_id gnl|my_center|LOCUS_34670 3798259 3798693 gene locus_tag LOCUS_34680 gene rplK 3798259 3798693 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974315.1 protein_id gnl|my_center|LOCUS_34680 3798775 3799497 gene locus_tag LOCUS_34690 gene rplA 3798775 3799497 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974314.1 protein_id gnl|my_center|LOCUS_34690 3799903 3800469 gene locus_tag LOCUS_34700 gene rplJ 3799903 3800469 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_34700 3800554 3800937 gene locus_tag LOCUS_34710 gene rplL 3800554 3800937 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974310.1 protein_id gnl|my_center|LOCUS_34710 3801552 3805037 gene locus_tag LOCUS_34720 gene rpoB 3801552 3805037 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_34720 3805159 3809058 gene locus_tag LOCUS_34730 3805159 3809058 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_34730 3809512 3809883 gene locus_tag LOCUS_34740 gene rpsL 3809512 3809883 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_34740 3809886 3810356 gene locus_tag LOCUS_34750 gene rpsG 3809886 3810356 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974303.1 protein_id gnl|my_center|LOCUS_34750 3810395 3812524 gene locus_tag LOCUS_34760 gene fusA 3810395 3812524 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974302.1 protein_id gnl|my_center|LOCUS_34760 3812683 3813876 gene locus_tag LOCUS_34770 gene tuf 3812683 3813876 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 protein_id gnl|my_center|LOCUS_34770 3814570 3814878 gene locus_tag LOCUS_34780 gene rpsJ 3814570 3814878 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_34780 3814892 3815536 gene locus_tag LOCUS_34790 gene rplC 3814892 3815536 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_34790 3815541 3816191 gene locus_tag LOCUS_34800 gene rplD 3815541 3816191 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974266.1 protein_id gnl|my_center|LOCUS_34800 3816191 3816529 gene locus_tag LOCUS_34810 gene rplW 3816191 3816529 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974265.1 protein_id gnl|my_center|LOCUS_34810 3816570 3817406 gene locus_tag LOCUS_34820 gene rplB 3816570 3817406 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974264.1 protein_id gnl|my_center|LOCUS_34820 3817419 3817700 gene locus_tag LOCUS_34830 gene rpsS 3817419 3817700 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974263.1 protein_id gnl|my_center|LOCUS_34830 3817741 3818088 gene locus_tag LOCUS_34840 gene rplV 3817741 3818088 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974262.1 protein_id gnl|my_center|LOCUS_34840 3818088 3818933 gene locus_tag LOCUS_34850 gene rpsC 3818088 3818933 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974261.1 protein_id gnl|my_center|LOCUS_34850 3818939 3819358 gene locus_tag LOCUS_34860 gene rplP 3818939 3819358 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974260.1 protein_id gnl|my_center|LOCUS_34860 3819358 3819582 gene locus_tag LOCUS_34870 gene rpmC 3819358 3819582 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_34870 3819582 3819866 gene locus_tag LOCUS_34880 gene rpsQ 3819582 3819866 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_34880 3819973 3820341 gene locus_tag LOCUS_34890 gene rplN 3819973 3820341 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974257.1 protein_id gnl|my_center|LOCUS_34890 3820344 3820667 gene locus_tag LOCUS_34900 gene rplX 3820344 3820667 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974256.1 protein_id gnl|my_center|LOCUS_34900 3820667 3821224 gene locus_tag LOCUS_34910 gene rplE 3820667 3821224 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_34910 3821227 3821412 gene locus_tag LOCUS_34920 3821227 3821412 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_34920 3821637 3822035 gene locus_tag LOCUS_34930 gene rpsH 3821637 3822035 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974254.1 protein_id gnl|my_center|LOCUS_34930 3822057 3822596 gene locus_tag LOCUS_34940 gene rplF 3822057 3822596 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_34940 3822600 3822983 gene locus_tag LOCUS_34950 gene rplR 3822600 3822983 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974252.1 protein_id gnl|my_center|LOCUS_34950 3823031 3823633 gene locus_tag LOCUS_34960 gene rpsE 3823031 3823633 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974251.1 protein_id gnl|my_center|LOCUS_34960 3823633 3823815 gene locus_tag LOCUS_34970 gene rpmD 3823633 3823815 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_34970 3823817 3824272 gene locus_tag LOCUS_34980 gene rplO 3823817 3824272 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974249.1 protein_id gnl|my_center|LOCUS_34980 3824497 3825816 gene locus_tag LOCUS_34990 gene secY 3824497 3825816 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_34990 3825816 3826475 gene locus_tag LOCUS_35000 3825816 3826475 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 protein_id gnl|my_center|LOCUS_35000 3826597 3827433 gene locus_tag LOCUS_35010 gene map 3826597 3827433 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029827.1 protein_id gnl|my_center|LOCUS_35010 3827598 3827819 gene locus_tag LOCUS_35020 gene infA 3827598 3827819 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 protein_id gnl|my_center|LOCUS_35020 3828192 3828572 gene locus_tag LOCUS_35030 gene rpsM 3828192 3828572 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974244.1 protein_id gnl|my_center|LOCUS_35030 3828645 3829049 gene locus_tag LOCUS_35040 gene rpsK 3828645 3829049 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_35040 3829186 3830208 gene locus_tag LOCUS_35050 3829186 3830208 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_35050 3830391 3830921 gene locus_tag LOCUS_35060 gene rplQ 3830391 3830921 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974243.1 protein_id gnl|my_center|LOCUS_35060 3831000 3831854 gene locus_tag LOCUS_35070 gene truA 3831000 3831854 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974242.1 protein_id gnl|my_center|LOCUS_35070 3832725 3831871 gene locus_tag LOCUS_35080 3832725 3831871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029828.1 protein_id gnl|my_center|LOCUS_35080 3832724 3834415 gene locus_tag LOCUS_35090 3832724 3834415 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030975.1 protein_id gnl|my_center|LOCUS_35090 3834756 3835199 gene locus_tag LOCUS_35100 gene rplM 3834756 3835199 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974239.1 protein_id gnl|my_center|LOCUS_35100 3835244 3835780 gene locus_tag LOCUS_35110 gene rpsI 3835244 3835780 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974238.1 protein_id gnl|my_center|LOCUS_35110 3836021 3837379 gene locus_tag LOCUS_35120 gene glmM 3836021 3837379 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_35120 3838349 3837387 gene locus_tag LOCUS_35130 3838349 3837387 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466857.1 protein_id gnl|my_center|LOCUS_35130 3839466 3838369 gene locus_tag LOCUS_35140 gene coaA 3839466 3838369 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974235.1 protein_id gnl|my_center|LOCUS_35140 3839522 3841372 gene locus_tag LOCUS_35150 gene glmS 3839522 3841372 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_35150 3841373 3841753 gene locus_tag LOCUS_35160 3841373 3841753 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_35160 3841758 3843206 gene locus_tag LOCUS_35170 3841758 3843206 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 protein_id gnl|my_center|LOCUS_35170 3843280 3844419 gene locus_tag LOCUS_35180 gene alr 3843280 3844419 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_35180 3844464 3845684 gene locus_tag LOCUS_35190 3844464 3845684 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327056.1 protein_id gnl|my_center|LOCUS_35190 3845696 3846232 gene locus_tag LOCUS_35200 gene tsaE 3845696 3846232 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029837.1 protein_id gnl|my_center|LOCUS_35200 3846367 3846606 gene locus_tag LOCUS_35210 3846367 3846606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 3847164 3846628 gene locus_tag LOCUS_35220 3847164 3846628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974224.1 protein_id gnl|my_center|LOCUS_35220 3847342 3848004 gene locus_tag LOCUS_35230 gene tsaB 3847342 3848004 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_35230 3848001 3848519 gene locus_tag LOCUS_35240 gene rimI 3848001 3848519 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_35240 3848519 3849619 gene locus_tag LOCUS_35250 gene tsaD 3848519 3849619 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_35250 3849616 3849882 gene locus_tag LOCUS_35260 3849616 3849882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029842.1 protein_id gnl|my_center|LOCUS_35260 3849909 3850265 gene locus_tag LOCUS_35270 3849909 3850265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 3851598 3850291 gene locus_tag LOCUS_35280 3851598 3850291 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_35280 3851630 3852571 gene locus_tag LOCUS_35290 3851630 3852571 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486593.1 protein_id gnl|my_center|LOCUS_35290 3852655 3853101 gene locus_tag LOCUS_35300 3852655 3853101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 3853203 3854825 gene locus_tag LOCUS_35310 gene groL 3853203 3854825 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_35310 3855860 3855087 gene locus_tag LOCUS_35320 3855860 3855087 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_35320 3856626 3855940 gene locus_tag LOCUS_35330 3856626 3855940 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284363.1 protein_id gnl|my_center|LOCUS_35330 3856699 3857589 gene locus_tag LOCUS_35340 3856699 3857589 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 protein_id gnl|my_center|LOCUS_35340 3857903 3857730 gene locus_tag LOCUS_35350 3857903 3857730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 3858485 3859096 gene locus_tag LOCUS_35360 3858485 3859096 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948568.1 protein_id gnl|my_center|LOCUS_35360 3859385 3859960 gene locus_tag LOCUS_35370 3859385 3859960 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974204.1 protein_id gnl|my_center|LOCUS_35370 3860089 3861591 gene locus_tag LOCUS_35380 gene guaB 3860089 3861591 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974203.1 protein_id gnl|my_center|LOCUS_35380 3861699 3862823 gene locus_tag LOCUS_35390 3861699 3862823 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_35390 3863482 3862910 gene locus_tag LOCUS_35400 3863482 3862910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 3864864 3863602 gene locus_tag LOCUS_35410 3864864 3863602 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974201.1 protein_id gnl|my_center|LOCUS_35410 3865112 3866893 gene locus_tag LOCUS_35420 3865112 3866893 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_35420 3867271 3869286 gene locus_tag LOCUS_35430 3867271 3869286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 3869468 3872206 gene locus_tag LOCUS_35440 3869468 3872206 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029855.1 protein_id gnl|my_center|LOCUS_35440 3872330 3873991 gene locus_tag LOCUS_35450 3872330 3873991 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486587.1 protein_id gnl|my_center|LOCUS_35450 3874149 3875777 gene locus_tag LOCUS_35460 3874149 3875777 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_35460 3875867 3877651 gene locus_tag LOCUS_35470 3875867 3877651 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029860.1 protein_id gnl|my_center|LOCUS_35470 3878307 3878005 gene locus_tag LOCUS_35480 3878307 3878005 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486583.1 protein_id gnl|my_center|LOCUS_35480 3878669 3880261 gene locus_tag LOCUS_35490 gene guaA 3878669 3880261 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 protein_id gnl|my_center|LOCUS_35490 3880383 3881138 gene locus_tag LOCUS_35500 3880383 3881138 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226783.1 protein_id gnl|my_center|LOCUS_35500 3881248 3882552 gene locus_tag LOCUS_35510 3881248 3882552 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029864.1 protein_id gnl|my_center|LOCUS_35510 3882665 3887896 gene locus_tag LOCUS_35520 3882665 3887896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 3887955 3888464 gene locus_tag LOCUS_35530 3887955 3888464 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897578.1 protein_id gnl|my_center|LOCUS_35530 3889946 3888621 gene locus_tag LOCUS_35540 3889946 3888621 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029865.1 protein_id gnl|my_center|LOCUS_35540 3890113 3891396 gene locus_tag LOCUS_35550 3890113 3891396 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974180.1 protein_id gnl|my_center|LOCUS_35550 3891393 3892088 gene locus_tag LOCUS_35560 3891393 3892088 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029866.1 protein_id gnl|my_center|LOCUS_35560 3893184 3892102 gene locus_tag LOCUS_35570 3893184 3892102 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_35570 3893627 3896065 gene locus_tag LOCUS_35580 gene pcrA 3893627 3896065 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_35580 3897672 3896140 gene locus_tag LOCUS_35590 3897672 3896140 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029871.1 protein_id gnl|my_center|LOCUS_35590 3898810 3897932 gene locus_tag LOCUS_35600 3898810 3897932 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029872.1 protein_id gnl|my_center|LOCUS_35600 3899156 3899569 gene locus_tag LOCUS_35610 3899156 3899569 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_35610 3901317 3899662 gene locus_tag LOCUS_35620 3901317 3899662 CDS product DUF5691 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029873.1 protein_id gnl|my_center|LOCUS_35620 3902813 3901473 gene locus_tag LOCUS_35630 3902813 3901473 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055512687.1 protein_id gnl|my_center|LOCUS_35630 3902977 3904089 gene locus_tag LOCUS_35640 3902977 3904089 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029875.1 protein_id gnl|my_center|LOCUS_35640 3904086 3906422 gene locus_tag LOCUS_35650 3904086 3906422 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029876.1 protein_id gnl|my_center|LOCUS_35650 3906419 3907657 gene locus_tag LOCUS_35660 3906419 3907657 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495359.1 protein_id gnl|my_center|LOCUS_35660 3908044 3909225 gene locus_tag LOCUS_35670 gene sucC 3908044 3909225 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974164.1 protein_id gnl|my_center|LOCUS_35670 3909247 3910131 gene locus_tag LOCUS_35680 gene sucD 3909247 3910131 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974163.1 protein_id gnl|my_center|LOCUS_35680 3911239 3910274 gene locus_tag LOCUS_35690 3911239 3910274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 3911477 3913192 gene locus_tag LOCUS_35700 3911477 3913192 CDS product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029881.1 protein_id gnl|my_center|LOCUS_35700 3914226 3913249 gene locus_tag LOCUS_35710 3914226 3913249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029882.1 protein_id gnl|my_center|LOCUS_35710 3914467 3915123 gene locus_tag LOCUS_35720 gene purN 3914467 3915123 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 protein_id gnl|my_center|LOCUS_35720 3915110 3916663 gene locus_tag LOCUS_35730 gene purH 3915110 3916663 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 protein_id gnl|my_center|LOCUS_35730 3916844 3918343 gene locus_tag LOCUS_35740 3916844 3918343 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929884.1 protein_id gnl|my_center|LOCUS_35740 3919022 3918417 gene locus_tag LOCUS_35750 3919022 3918417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974149.1 protein_id gnl|my_center|LOCUS_35750 3919258 3920142 gene locus_tag LOCUS_35760 3919258 3920142 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_35760 3920165 3920785 gene locus_tag LOCUS_35770 3920165 3920785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 3921134 3922123 gene locus_tag LOCUS_35780 3921134 3922123 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_35780 3922748 3922221 gene locus_tag LOCUS_35790 3922748 3922221 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029897.1 protein_id gnl|my_center|LOCUS_35790 3924082 3922877 gene locus_tag LOCUS_35800 gene rocD 3924082 3922877 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977608.1 protein_id gnl|my_center|LOCUS_35800 3924297 3925310 gene locus_tag LOCUS_35810 gene trpS 3924297 3925310 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974132.1 protein_id gnl|my_center|LOCUS_35810 3925413 3926003 gene locus_tag LOCUS_35820 3925413 3926003 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029900.1 protein_id gnl|my_center|LOCUS_35820 3926145 3927107 gene locus_tag LOCUS_35830 3926145 3927107 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974125.1 protein_id gnl|my_center|LOCUS_35830 3928302 3927055 gene locus_tag LOCUS_35840 3928302 3927055 CDS product DUF5136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486558.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35840 3928460 3928705 gene locus_tag LOCUS_35850 3928460 3928705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974124.1 protein_id gnl|my_center|LOCUS_35850 3928792 3930144 gene locus_tag LOCUS_35860 3928792 3930144 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029904.1 protein_id gnl|my_center|LOCUS_35860 3930969 3930217 gene locus_tag LOCUS_35870 3930969 3930217 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029905.1 protein_id gnl|my_center|LOCUS_35870 3931813 3931232 gene locus_tag LOCUS_35880 3931813 3931232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 3932728 3931952 gene locus_tag LOCUS_35890 3932728 3931952 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974116.1 protein_id gnl|my_center|LOCUS_35890 3934488 3932728 gene locus_tag LOCUS_35900 gene sdhA 3934488 3932728 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974115.1 protein_id gnl|my_center|LOCUS_35900 3935003 3934518 gene locus_tag LOCUS_35910 3935003 3934518 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029907.1 protein_id gnl|my_center|LOCUS_35910 3935239 3935009 gene locus_tag LOCUS_35920 3935239 3935009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 3935171 3935347 gene locus_tag LOCUS_35930 3935171 3935347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 3935765 3935556 gene locus_tag LOCUS_35940 3935765 3935556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 3935745 3936302 gene locus_tag LOCUS_35950 3935745 3936302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 3936469 3938094 gene locus_tag LOCUS_35960 3936469 3938094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 3939370 3938171 gene locus_tag LOCUS_35970 3939370 3938171 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028730.1 protein_id gnl|my_center|LOCUS_35970 3939333 3939503 gene locus_tag LOCUS_35980 3939333 3939503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 3939971 3939714 gene locus_tag LOCUS_35990 3939971 3939714 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976289.1 protein_id gnl|my_center|LOCUS_35990 3940833 3939979 gene locus_tag LOCUS_36000 3940833 3939979 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029566.1 protein_id gnl|my_center|LOCUS_36000 3941021 3941236 gene locus_tag LOCUS_36010 3941021 3941236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028396.1 protein_id gnl|my_center|LOCUS_36010 3941236 3941667 gene locus_tag LOCUS_36020 3941236 3941667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 3941735 3942262 gene locus_tag LOCUS_36030 3941735 3942262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029911.1 protein_id gnl|my_center|LOCUS_36030 3945084 3942385 gene locus_tag LOCUS_36040 3945084 3942385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 3945470 3945910 gene locus_tag LOCUS_36050 3945470 3945910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 3946029 3946670 gene locus_tag LOCUS_36060 3946029 3946670 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247785.1 protein_id gnl|my_center|LOCUS_36060 3946667 3947548 gene locus_tag LOCUS_36070 3946667 3947548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 3947622 3947987 gene locus_tag LOCUS_36080 3947622 3947987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 3947998 3948222 gene locus_tag LOCUS_36090 3947998 3948222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 3948519 3948112 gene locus_tag LOCUS_36100 3948519 3948112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180053.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36100 3948655 3948497 gene locus_tag LOCUS_36110 3948655 3948497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 3949092 3948856 gene locus_tag LOCUS_36120 3949092 3948856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 3949721 3949089 gene locus_tag LOCUS_36130 3949721 3949089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 3951136 3949718 gene locus_tag LOCUS_36140 3951136 3949718 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039073.1 protein_id gnl|my_center|LOCUS_36140 3952852 3951440 gene locus_tag LOCUS_36150 3952852 3951440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 3952988 3954025 gene locus_tag LOCUS_36160 gene rfbB 3952988 3954025 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978112.1 protein_id gnl|my_center|LOCUS_36160 3954015 3955025 gene locus_tag LOCUS_36170 3954015 3955025 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_36170 3955022 3956155 gene locus_tag LOCUS_36180 3955022 3956155 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_36180 3956155 3956586 gene locus_tag LOCUS_36190 3956155 3956586 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832373.1 protein_id gnl|my_center|LOCUS_36190 3957790 3956606 gene locus_tag LOCUS_36200 gene murG 3957790 3956606 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930513.1 protein_id gnl|my_center|LOCUS_36200 3958359 3959096 gene locus_tag LOCUS_36210 3958359 3959096 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974105.1 protein_id gnl|my_center|LOCUS_36210 3959096 3960274 gene locus_tag LOCUS_36220 3959096 3960274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 3961355 3960420 gene locus_tag LOCUS_36230 3961355 3960420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 3961618 3963198 gene locus_tag LOCUS_36240 3961618 3963198 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974103.1 protein_id gnl|my_center|LOCUS_36240 3963435 3964097 gene locus_tag LOCUS_36250 gene leuE 3963435 3964097 CDS product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192135.1 protein_id gnl|my_center|LOCUS_36250 3964581 3964123 gene locus_tag LOCUS_36260 3964581 3964123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 3964760 3965725 gene locus_tag LOCUS_36270 3964760 3965725 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974094.1 protein_id gnl|my_center|LOCUS_36270 3965729 3967072 gene locus_tag LOCUS_36280 3965729 3967072 CDS product alpha-2,8-polysialyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029922.1 protein_id gnl|my_center|LOCUS_36280 3967082 3968173 gene locus_tag LOCUS_36290 3967082 3968173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 3969550 3968228 gene locus_tag LOCUS_36300 3969550 3968228 CDS product alpha-2,8-polysialyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029922.1 protein_id gnl|my_center|LOCUS_36300 3970533 3969547 gene locus_tag LOCUS_36310 3970533 3969547 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974094.1 protein_id gnl|my_center|LOCUS_36310 3970822 3972135 gene locus_tag LOCUS_36320 3970822 3972135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029923.1 protein_id gnl|my_center|LOCUS_36320 3972186 3973433 gene locus_tag LOCUS_36330 3972186 3973433 CDS product N-acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029924.1 protein_id gnl|my_center|LOCUS_36330 3973447 3974376 gene locus_tag LOCUS_36340 3973447 3974376 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974091.1 protein_id gnl|my_center|LOCUS_36340 3974387 3975445 gene locus_tag LOCUS_36350 3974387 3975445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974090.1 protein_id gnl|my_center|LOCUS_36350 3976117 3977298 gene locus_tag LOCUS_36360 3976117 3977298 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029925.1 protein_id gnl|my_center|LOCUS_36360 3977437 3978477 gene locus_tag LOCUS_36370 3977437 3978477 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029926.1 protein_id gnl|my_center|LOCUS_36370 3978771 3980303 gene locus_tag LOCUS_36380 3978771 3980303 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974086.1 protein_id gnl|my_center|LOCUS_36380 3980300 3981415 gene locus_tag LOCUS_36390 3980300 3981415 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029927.1 protein_id gnl|my_center|LOCUS_36390 3981412 3982701 gene locus_tag LOCUS_36400 3981412 3982701 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029928.1 protein_id gnl|my_center|LOCUS_36400 3982698 3983096 gene locus_tag LOCUS_36410 3982698 3983096 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974083.1 protein_id gnl|my_center|LOCUS_36410 3983220 3984497 gene locus_tag LOCUS_36420 3983220 3984497 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 protein_id gnl|my_center|LOCUS_36420 3984552 3984920 gene locus_tag LOCUS_36430 3984552 3984920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 3985937 3984948 gene locus_tag LOCUS_36440 3985937 3984948 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974078.1 protein_id gnl|my_center|LOCUS_36440 3986747 3986031 gene locus_tag LOCUS_36450 3986747 3986031 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978125.1 protein_id gnl|my_center|LOCUS_36450 3988018 3986834 gene locus_tag LOCUS_36460 3988018 3986834 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029933.1 protein_id gnl|my_center|LOCUS_36460 3988258 3989145 gene locus_tag LOCUS_36470 3988258 3989145 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029934.1 protein_id gnl|my_center|LOCUS_36470 3989911 3989153 gene locus_tag LOCUS_36480 3989911 3989153 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029936.1 protein_id gnl|my_center|LOCUS_36480 3990015 3991169 gene locus_tag LOCUS_36490 3990015 3991169 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_36490 3991305 3991595 gene locus_tag LOCUS_36500 3991305 3991595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 3991878 3991675 gene locus_tag LOCUS_36510 3991878 3991675 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974070.1 protein_id gnl|my_center|LOCUS_36510 3992524 3991970 gene locus_tag LOCUS_36520 3992524 3991970 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029938.1 protein_id gnl|my_center|LOCUS_36520 3993235 3992594 gene locus_tag LOCUS_36530 3993235 3992594 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974068.1 protein_id gnl|my_center|LOCUS_36530 3994767 3993232 gene locus_tag LOCUS_36540 gene afsQ2 3994767 3993232 CDS product two-component system sensor histidine kinase AfsQ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974067.1 protein_id gnl|my_center|LOCUS_36540 3995441 3994764 gene locus_tag LOCUS_36550 gene afsQ1 3995441 3994764 CDS product two-component system response regulator AfsQ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974066.1 protein_id gnl|my_center|LOCUS_36550 3995758 3996372 gene locus_tag LOCUS_36560 3995758 3996372 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327117.1 protein_id gnl|my_center|LOCUS_36560 3997224 3996520 gene locus_tag LOCUS_36570 3997224 3996520 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189397579.1 protein_id gnl|my_center|LOCUS_36570 3998281 3997367 gene locus_tag LOCUS_36580 3998281 3997367 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_36580 3999710 3998271 gene locus_tag LOCUS_36590 3999710 3998271 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 protein_id gnl|my_center|LOCUS_36590 4000663 3999716 gene locus_tag LOCUS_36600 gene deoC 4000663 3999716 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_36600 4000788 4001429 gene locus_tag LOCUS_36610 4000788 4001429 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029946.1 protein_id gnl|my_center|LOCUS_36610 4003158 4001518 gene locus_tag LOCUS_36620 4003158 4001518 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_36620 4004099 4003275 gene locus_tag LOCUS_36630 4004099 4003275 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974056.1 protein_id gnl|my_center|LOCUS_36630 4004692 4004204 gene locus_tag LOCUS_36640 4004692 4004204 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974055.1 protein_id gnl|my_center|LOCUS_36640 4004893 4006332 gene locus_tag LOCUS_36650 4004893 4006332 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 protein_id gnl|my_center|LOCUS_36650 4006474 4007418 gene locus_tag LOCUS_36660 4006474 4007418 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029949.1 protein_id gnl|my_center|LOCUS_36660 4008063 4007452 gene locus_tag LOCUS_36670 4008063 4007452 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030034.1 protein_id gnl|my_center|LOCUS_36670 4010010 4008253 gene locus_tag LOCUS_36680 4010010 4008253 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029950.1 protein_id gnl|my_center|LOCUS_36680 4010513 4010040 gene locus_tag LOCUS_36690 4010513 4010040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 4011440 4010829 gene locus_tag LOCUS_36700 4011440 4010829 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 protein_id gnl|my_center|LOCUS_36700 4011579 4011451 gene locus_tag LOCUS_36710 4011579 4011451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974049.1 protein_id gnl|my_center|LOCUS_36710 4011878 4011672 gene locus_tag LOCUS_36720 4011878 4011672 CDS product acyl-CoA carboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974048.1 protein_id gnl|my_center|LOCUS_36720 4013482 4011893 gene locus_tag LOCUS_36730 4013482 4011893 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_36730 4013680 4014534 gene locus_tag LOCUS_36740 4013680 4014534 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_36740 4014731 4015933 gene locus_tag LOCUS_36750 4014731 4015933 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029954.1 protein_id gnl|my_center|LOCUS_36750 4016032 4016844 gene locus_tag LOCUS_36760 4016032 4016844 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029956.1 protein_id gnl|my_center|LOCUS_36760 4016962 4018116 gene locus_tag LOCUS_36770 4016962 4018116 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870180.1 protein_id gnl|my_center|LOCUS_36770 4018264 4019805 gene locus_tag LOCUS_36780 gene hutH 4018264 4019805 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974041.1 protein_id gnl|my_center|LOCUS_36780 4020118 4019813 gene locus_tag LOCUS_36790 4020118 4019813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 4020275 4020670 gene locus_tag LOCUS_36800 4020275 4020670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 4020927 4022183 gene locus_tag LOCUS_36810 4020927 4022183 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029959.1 protein_id gnl|my_center|LOCUS_36810 4022988 4022404 gene locus_tag LOCUS_36820 4022988 4022404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 4023354 4024733 gene locus_tag LOCUS_36830 gene gdhA 4023354 4024733 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896839.1 protein_id gnl|my_center|LOCUS_36830 4024990 4025379 gene locus_tag LOCUS_36840 4024990 4025379 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031561.1 protein_id gnl|my_center|LOCUS_36840 4026139 4025438 gene locus_tag LOCUS_36850 gene msrA 4026139 4025438 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338316.1 protein_id gnl|my_center|LOCUS_36850 4027326 4026223 gene locus_tag LOCUS_36860 4027326 4026223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974019.1 protein_id gnl|my_center|LOCUS_36860 4027395 4028540 gene locus_tag LOCUS_36870 4027395 4028540 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_36870 4029227 4028697 gene locus_tag LOCUS_36880 4029227 4028697 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666375.1 protein_id gnl|my_center|LOCUS_36880 4029383 4030612 gene locus_tag LOCUS_36890 gene ilvA 4029383 4030612 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_36890 4030726 4031676 gene locus_tag LOCUS_36900 4030726 4031676 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_36900 4031673 4032524 gene locus_tag LOCUS_36910 4031673 4032524 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 protein_id gnl|my_center|LOCUS_36910 4033092 4032595 gene locus_tag LOCUS_36920 gene greA 4033092 4032595 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974011.1 protein_id gnl|my_center|LOCUS_36920 4033652 4033236 gene locus_tag LOCUS_36930 4033652 4033236 CDS product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974010.1 protein_id gnl|my_center|LOCUS_36930 4033804 4034685 gene locus_tag LOCUS_36940 gene mca 4033804 4034685 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444314.1 protein_id gnl|my_center|LOCUS_36940 4034687 4034923 gene locus_tag LOCUS_36950 4034687 4034923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 4035061 4035579 gene locus_tag LOCUS_36960 4035061 4035579 CDS product FBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978065.1 protein_id gnl|my_center|LOCUS_36960 4035625 4037661 gene locus_tag LOCUS_36970 4035625 4037661 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974002.1 protein_id gnl|my_center|LOCUS_36970 4038406 4037717 gene locus_tag LOCUS_36980 4038406 4037717 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_36980 4038614 4040440 gene locus_tag LOCUS_36990 4038614 4040440 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_36990 4040968 4040573 gene locus_tag LOCUS_37000 4040968 4040573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973994.1 protein_id gnl|my_center|LOCUS_37000 4042271 4041060 gene locus_tag LOCUS_37010 4042271 4041060 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973993.1 protein_id gnl|my_center|LOCUS_37010 4043298 4042486 gene locus_tag LOCUS_37020 4043298 4042486 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640272.1 protein_id gnl|my_center|LOCUS_37020 4043664 4043389 gene locus_tag LOCUS_37030 4043664 4043389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 4044577 4043687 gene locus_tag LOCUS_37040 4044577 4043687 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028377.1 protein_id gnl|my_center|LOCUS_37040 4044676 4045017 gene locus_tag LOCUS_37050 4044676 4045017 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028376.1 protein_id gnl|my_center|LOCUS_37050 4045622 4045179 gene locus_tag LOCUS_37060 4045622 4045179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 4046640 4045711 gene locus_tag LOCUS_37070 4046640 4045711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 4047045 4048013 gene locus_tag LOCUS_37080 4047045 4048013 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026990.1 protein_id gnl|my_center|LOCUS_37080 4049701 4048076 gene locus_tag LOCUS_37090 4049701 4048076 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029987.1 protein_id gnl|my_center|LOCUS_37090 4051047 4049761 gene locus_tag LOCUS_37100 4051047 4049761 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973990.1 protein_id gnl|my_center|LOCUS_37100 4051186 4052265 gene locus_tag LOCUS_37110 4051186 4052265 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029988.1 protein_id gnl|my_center|LOCUS_37110 4052262 4053020 gene locus_tag LOCUS_37120 4052262 4053020 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973988.1 protein_id gnl|my_center|LOCUS_37120 4053027 4053437 gene locus_tag LOCUS_37130 4053027 4053437 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973987.1 protein_id gnl|my_center|LOCUS_37130 4053654 4053430 gene locus_tag LOCUS_37140 4053654 4053430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 4053545 4055020 gene locus_tag LOCUS_37150 4053545 4055020 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029989.1 protein_id gnl|my_center|LOCUS_37150 4055188 4056501 gene locus_tag LOCUS_37160 4055188 4056501 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327153.1 protein_id gnl|my_center|LOCUS_37160 4058417 4056639 gene locus_tag LOCUS_37170 4058417 4056639 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029996.1 protein_id gnl|my_center|LOCUS_37170 4058748 4058443 gene locus_tag LOCUS_37180 4058748 4058443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 4058978 4059901 gene locus_tag LOCUS_37190 4058978 4059901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029997.1 protein_id gnl|my_center|LOCUS_37190 4059975 4060691 gene locus_tag LOCUS_37200 gene cpaB 4059975 4060691 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973972.1 protein_id gnl|my_center|LOCUS_37200 4060699 4061946 gene locus_tag LOCUS_37210 4060699 4061946 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973971.1 protein_id gnl|my_center|LOCUS_37210 4061986 4062426 gene locus_tag LOCUS_37220 4061986 4062426 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973970.1 protein_id gnl|my_center|LOCUS_37220 4062423 4062872 gene locus_tag LOCUS_37230 4062423 4062872 CDS product TadE/TadG family type IV pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029999.1 protein_id gnl|my_center|LOCUS_37230 4062909 4064249 gene locus_tag LOCUS_37240 4062909 4064249 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973968.1 protein_id gnl|my_center|LOCUS_37240 4064326 4065264 gene locus_tag LOCUS_37250 4064326 4065264 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030000.1 protein_id gnl|my_center|LOCUS_37250 4065309 4066196 gene locus_tag LOCUS_37260 4065309 4066196 CDS product DUF5936 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030001.1 protein_id gnl|my_center|LOCUS_37260 4066260 4067675 gene locus_tag LOCUS_37270 4066260 4067675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 4067692 4068774 gene locus_tag LOCUS_37280 4067692 4068774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 4068978 4069211 gene locus_tag LOCUS_37290 4068978 4069211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 4069211 4069810 gene locus_tag LOCUS_37300 4069211 4069810 CDS product pilus assembly protein TadG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030003.1 protein_id gnl|my_center|LOCUS_37300 4069840 4070433 gene locus_tag LOCUS_37310 4069840 4070433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030004.1 protein_id gnl|my_center|LOCUS_37310 4070433 4071077 gene locus_tag LOCUS_37320 4070433 4071077 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030005.1 protein_id gnl|my_center|LOCUS_37320 4071758 4072609 gene locus_tag LOCUS_37330 4071758 4072609 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229489.1 protein_id gnl|my_center|LOCUS_37330 4072623 4073180 gene locus_tag LOCUS_37340 4072623 4073180 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971886.1 protein_id gnl|my_center|LOCUS_37340 4073703 4073251 gene locus_tag LOCUS_37350 4073703 4073251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 4074986 4073766 gene locus_tag LOCUS_37360 4074986 4073766 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105034.1 protein_id gnl|my_center|LOCUS_37360 4076323 4075037 gene locus_tag LOCUS_37370 4076323 4075037 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101032.1 protein_id gnl|my_center|LOCUS_37370 4077656 4076382 gene locus_tag LOCUS_37380 4077656 4076382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 4079896 4077653 gene locus_tag LOCUS_37390 4079896 4077653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 4080549 4079980 gene locus_tag LOCUS_37400 4080549 4079980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 4084716 4080652 gene locus_tag LOCUS_37410 4084716 4080652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 4085363 4085181 gene locus_tag LOCUS_37420 4085363 4085181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 4085755 4087080 gene locus_tag LOCUS_37430 4085755 4087080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 4088748 4087132 gene locus_tag LOCUS_37440 4088748 4087132 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325733.1 protein_id gnl|my_center|LOCUS_37440 4089020 4090240 gene locus_tag LOCUS_37450 4089020 4090240 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977073.1 protein_id gnl|my_center|LOCUS_37450 4090655 4090266 gene locus_tag LOCUS_37460 4090655 4090266 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487141.1 protein_id gnl|my_center|LOCUS_37460 4090761 4091597 gene locus_tag LOCUS_37470 4090761 4091597 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029725.1 protein_id gnl|my_center|LOCUS_37470 4091662 4092072 gene locus_tag LOCUS_37480 4091662 4092072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 4092212 4092667 gene locus_tag LOCUS_37490 4092212 4092667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 4094011 4092974 gene locus_tag LOCUS_37500 gene mgrA 4094011 4092974 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_37500 4094235 4094990 gene locus_tag LOCUS_37510 4094235 4094990 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_37510 4095339 4096661 gene locus_tag LOCUS_37520 4095339 4096661 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_37520 4097107 4096829 gene locus_tag LOCUS_37530 4097107 4096829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 4097052 4097780 gene locus_tag LOCUS_37540 4097052 4097780 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973948.1 protein_id gnl|my_center|LOCUS_37540 4097931 4099349 gene locus_tag LOCUS_37550 4097931 4099349 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030013.1 protein_id gnl|my_center|LOCUS_37550 4099955 4099422 gene locus_tag LOCUS_37560 4099955 4099422 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973946.1 protein_id gnl|my_center|LOCUS_37560 4100522 4099968 gene locus_tag LOCUS_37570 4100522 4099968 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973945.1 protein_id gnl|my_center|LOCUS_37570 4100739 4101722 gene locus_tag LOCUS_37580 4100739 4101722 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973944.1 protein_id gnl|my_center|LOCUS_37580 4102147 4104318 gene locus_tag LOCUS_37590 4102147 4104318 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973938.1 protein_id gnl|my_center|LOCUS_37590 4106308 4104377 gene locus_tag LOCUS_37600 4106308 4104377 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487155.1 protein_id gnl|my_center|LOCUS_37600 4107300 4106605 gene locus_tag LOCUS_37610 4107300 4106605 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030017.1 protein_id gnl|my_center|LOCUS_37610 4108748 4107345 gene locus_tag LOCUS_37620 4108748 4107345 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_37620 4108855 4110390 gene locus_tag LOCUS_37630 4108855 4110390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 4112131 4110464 gene locus_tag LOCUS_37640 4112131 4110464 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_37640 4112339 4113037 gene locus_tag LOCUS_37650 4112339 4113037 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030020.1 protein_id gnl|my_center|LOCUS_37650 4113196 4113567 gene locus_tag LOCUS_37660 4113196 4113567 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030021.1 protein_id gnl|my_center|LOCUS_37660 4114765 4113731 gene locus_tag LOCUS_37670 gene glpX 4114765 4113731 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_37670 4114857 4115429 gene locus_tag LOCUS_37680 4114857 4115429 CDS product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973929.1 protein_id gnl|my_center|LOCUS_37680 4116098 4115508 gene locus_tag LOCUS_37690 4116098 4115508 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973928.1 protein_id gnl|my_center|LOCUS_37690 4116578 4116303 gene locus_tag LOCUS_37700 4116578 4116303 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030026.1 protein_id gnl|my_center|LOCUS_37700 4117866 4116655 gene locus_tag LOCUS_37710 gene xseA 4117866 4116655 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030027.1 protein_id gnl|my_center|LOCUS_37710 4119347 4117941 gene locus_tag LOCUS_37720 4119347 4117941 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973921.1 protein_id gnl|my_center|LOCUS_37720 4119440 4120420 gene locus_tag LOCUS_37730 4119440 4120420 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973920.1 protein_id gnl|my_center|LOCUS_37730 4120459 4121205 gene locus_tag LOCUS_37740 4120459 4121205 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973919.1 protein_id gnl|my_center|LOCUS_37740 4121836 4121225 gene locus_tag LOCUS_37750 4121836 4121225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 4122025 4123113 gene locus_tag LOCUS_37760 gene ychF 4122025 4123113 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 protein_id gnl|my_center|LOCUS_37760 4123426 4125582 gene locus_tag LOCUS_37770 4123426 4125582 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921779.1 protein_id gnl|my_center|LOCUS_37770 4126686 4125847 gene locus_tag LOCUS_37780 4126686 4125847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 4126823 4128907 gene locus_tag LOCUS_37790 4126823 4128907 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028768.1 protein_id gnl|my_center|LOCUS_37790 4129000 4131024 gene locus_tag LOCUS_37800 4129000 4131024 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 protein_id gnl|my_center|LOCUS_37800 4131021 4132202 gene locus_tag LOCUS_37810 4131021 4132202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 4132199 4135435 gene locus_tag LOCUS_37820 4132199 4135435 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_37820 4135618 4137159 gene locus_tag LOCUS_37830 gene pkaE 4135618 4137159 CDS product serine/threonine protein kinase PkaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028766.1 protein_id gnl|my_center|LOCUS_37830 4137177 4139321 gene locus_tag LOCUS_37840 4137177 4139321 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 protein_id gnl|my_center|LOCUS_37840 4140403 4139996 gene locus_tag LOCUS_37850 4140403 4139996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028878.1 protein_id gnl|my_center|LOCUS_37850 4140675 4140400 gene locus_tag LOCUS_37860 4140675 4140400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 4141453 4140872 gene locus_tag LOCUS_37870 4141453 4140872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 4141875 4141450 gene locus_tag LOCUS_37880 4141875 4141450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37880 4142225 4141935 gene locus_tag LOCUS_37890 4142225 4141935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37890 4142435 4142295 gene locus_tag LOCUS_37900 4142435 4142295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 4143337 4142723 gene locus_tag LOCUS_37910 4143337 4142723 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026968.1 protein_id gnl|my_center|LOCUS_37910 4144585 4143431 gene locus_tag LOCUS_37920 4144585 4143431 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368573.1 protein_id gnl|my_center|LOCUS_37920 4144855 4145676 gene locus_tag LOCUS_37930 gene fabG 4144855 4145676 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919547.1 protein_id gnl|my_center|LOCUS_37930 4145673 4146443 gene locus_tag LOCUS_37940 4145673 4146443 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_37940 4146725 4146531 gene locus_tag LOCUS_37950 4146725 4146531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 4148014 4146854 gene locus_tag LOCUS_37960 4148014 4146854 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226442.1 protein_id gnl|my_center|LOCUS_37960 4148188 4149762 gene locus_tag LOCUS_37970 4148188 4149762 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027742.1 protein_id gnl|my_center|LOCUS_37970 4151179 4149827 gene locus_tag LOCUS_37980 4151179 4149827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 4151460 4152212 gene locus_tag LOCUS_37990 4151460 4152212 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973878.1 protein_id gnl|my_center|LOCUS_37990 4152582 4152809 gene locus_tag LOCUS_38000 4152582 4152809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 4152843 4153247 gene locus_tag LOCUS_38010 4152843 4153247 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973876.1 protein_id gnl|my_center|LOCUS_38010 4153399 4153845 gene locus_tag LOCUS_38020 4153399 4153845 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030058.1 protein_id gnl|my_center|LOCUS_38020 4154006 4156597 gene locus_tag LOCUS_38030 4154006 4156597 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030059.1 protein_id gnl|my_center|LOCUS_38030 4157348 4156638 gene locus_tag LOCUS_38040 4157348 4156638 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258171.1 protein_id gnl|my_center|LOCUS_38040 4159451 4157493 gene locus_tag LOCUS_38050 4159451 4157493 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729869.1 protein_id gnl|my_center|LOCUS_38050 4160511 4159735 gene locus_tag LOCUS_38060 4160511 4159735 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973872.1 protein_id gnl|my_center|LOCUS_38060 4162451 4160508 gene locus_tag LOCUS_38070 4162451 4160508 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030061.1 protein_id gnl|my_center|LOCUS_38070 4163303 4162452 gene locus_tag LOCUS_38080 4163303 4162452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_38080 4163603 4163370 gene locus_tag LOCUS_38090 4163603 4163370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973869.1 protein_id gnl|my_center|LOCUS_38090 4163916 4166453 gene locus_tag LOCUS_38100 4163916 4166453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 4166878 4168752 gene locus_tag LOCUS_38110 gene typA 4166878 4168752 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_38110 4169232 4170866 gene locus_tag LOCUS_38120 4169232 4170866 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973860.1 protein_id gnl|my_center|LOCUS_38120 4171038 4171970 gene locus_tag LOCUS_38130 4171038 4171970 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973859.1 protein_id gnl|my_center|LOCUS_38130 4171963 4172910 gene locus_tag LOCUS_38140 4171963 4172910 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973858.1 protein_id gnl|my_center|LOCUS_38140 4172922 4173980 gene locus_tag LOCUS_38150 4172922 4173980 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_38150 4173973 4175115 gene locus_tag LOCUS_38160 4173973 4175115 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 protein_id gnl|my_center|LOCUS_38160 4175280 4176914 gene locus_tag LOCUS_38170 4175280 4176914 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973860.1 protein_id gnl|my_center|LOCUS_38170 4177012 4177935 gene locus_tag LOCUS_38180 4177012 4177935 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973859.1 protein_id gnl|my_center|LOCUS_38180 4177928 4178905 gene locus_tag LOCUS_38190 4177928 4178905 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973858.1 protein_id gnl|my_center|LOCUS_38190 4178919 4179896 gene locus_tag LOCUS_38200 4178919 4179896 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_38200 4179886 4181127 gene locus_tag LOCUS_38210 4179886 4181127 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 protein_id gnl|my_center|LOCUS_38210 4181320 4182423 gene locus_tag LOCUS_38220 4181320 4182423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 4184565 4182427 gene locus_tag LOCUS_38230 4184565 4182427 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 protein_id gnl|my_center|LOCUS_38230 4184744 4184938 gene locus_tag LOCUS_38240 4184744 4184938 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973854.1 protein_id gnl|my_center|LOCUS_38240 4184988 4185905 gene locus_tag LOCUS_38250 gene mshB 4184988 4185905 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030070.1 protein_id gnl|my_center|LOCUS_38250 4185902 4186360 gene locus_tag LOCUS_38260 4185902 4186360 CDS product DUF6113 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030071.1 protein_id gnl|my_center|LOCUS_38260 4186653 4188584 gene locus_tag LOCUS_38270 4186653 4188584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38270 4188696 4189043 gene locus_tag LOCUS_38280 4188696 4189043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 4189617 4189099 gene locus_tag LOCUS_38290 4189617 4189099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 4190646 4189786 gene locus_tag LOCUS_38300 4190646 4189786 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030075.1 protein_id gnl|my_center|LOCUS_38300 4191665 4190643 gene locus_tag LOCUS_38310 4191665 4190643 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030076.1 protein_id gnl|my_center|LOCUS_38310 4191783 4192103 gene locus_tag LOCUS_38320 4191783 4192103 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_38320 4192360 4193364 gene locus_tag LOCUS_38330 4192360 4193364 CDS product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_38330 4193901 4193452 gene locus_tag LOCUS_38340 4193901 4193452 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973840.1 protein_id gnl|my_center|LOCUS_38340 4195125 4194190 gene locus_tag LOCUS_38350 4195125 4194190 CDS product heavy metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486364.1 protein_id gnl|my_center|LOCUS_38350 4195126 4196265 gene locus_tag LOCUS_38360 gene dapE 4195126 4196265 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_38360 4196349 4197134 gene locus_tag LOCUS_38370 4196349 4197134 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973837.1 protein_id gnl|my_center|LOCUS_38370 4198117 4197245 gene locus_tag LOCUS_38380 gene folP 4198117 4197245 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327205.1 protein_id gnl|my_center|LOCUS_38380 4198216 4198599 gene locus_tag LOCUS_38390 4198216 4198599 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973835.1 protein_id gnl|my_center|LOCUS_38390 4198596 4199183 gene locus_tag LOCUS_38400 4198596 4199183 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973834.1 protein_id gnl|my_center|LOCUS_38400 4199992 4199180 gene locus_tag LOCUS_38410 4199992 4199180 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030081.1 protein_id gnl|my_center|LOCUS_38410 4200308 4200475 gene locus_tag LOCUS_38420 4200308 4200475 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966491.1 protein_id gnl|my_center|LOCUS_38420 4201285 4200620 gene locus_tag LOCUS_38430 4201285 4200620 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469700.1 protein_id gnl|my_center|LOCUS_38430 4201578 4202225 gene locus_tag LOCUS_38440 gene sigE 4201578 4202225 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973830.1 protein_id gnl|my_center|LOCUS_38440 4202222 4203259 gene locus_tag LOCUS_38450 4202222 4203259 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030084.1 protein_id gnl|my_center|LOCUS_38450 4203350 4205107 gene locus_tag LOCUS_38460 4203350 4205107 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456948.1 protein_id gnl|my_center|LOCUS_38460 4205218 4205694 gene locus_tag LOCUS_38470 4205218 4205694 CDS product sec-independent translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030086.1 protein_id gnl|my_center|LOCUS_38470 4205955 4206614 gene locus_tag LOCUS_38480 4205955 4206614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327210.1 protein_id gnl|my_center|LOCUS_38480 4207819 4206665 gene locus_tag LOCUS_38490 4207819 4206665 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_38490 4208408 4207842 gene locus_tag LOCUS_38500 4208408 4207842 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469672.1 protein_id gnl|my_center|LOCUS_38500 4209672 4208398 gene locus_tag LOCUS_38510 4209672 4208398 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_38510 4209787 4210611 gene locus_tag LOCUS_38520 4209787 4210611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973822.1 protein_id gnl|my_center|LOCUS_38520 4211141 4210623 gene locus_tag LOCUS_38530 4211141 4210623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973821.1 protein_id gnl|my_center|LOCUS_38530 4212270 4211155 gene locus_tag LOCUS_38540 4212270 4211155 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030090.1 protein_id gnl|my_center|LOCUS_38540 4212699 4213283 gene locus_tag LOCUS_38550 4212699 4213283 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030091.1 protein_id gnl|my_center|LOCUS_38550 4213389 4214033 gene locus_tag LOCUS_38560 4213389 4214033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973817.1 protein_id gnl|my_center|LOCUS_38560 4214121 4214987 gene locus_tag LOCUS_38570 4214121 4214987 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973816.1 protein_id gnl|my_center|LOCUS_38570 4215138 4215743 gene locus_tag LOCUS_38580 4215138 4215743 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973815.1 protein_id gnl|my_center|LOCUS_38580 4215976 4215824 gene locus_tag LOCUS_38590 4215976 4215824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444413.1 protein_id gnl|my_center|LOCUS_38590 4216308 4217093 gene locus_tag LOCUS_38600 4216308 4217093 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469674.1 protein_id gnl|my_center|LOCUS_38600 4218006 4217158 gene locus_tag LOCUS_38610 4218006 4217158 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030092.1 protein_id gnl|my_center|LOCUS_38610 4220162 4218114 gene locus_tag LOCUS_38620 4220162 4218114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38620 4220610 4221344 gene locus_tag LOCUS_38630 4220610 4221344 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 protein_id gnl|my_center|LOCUS_38630 4221650 4221378 gene locus_tag LOCUS_38640 4221650 4221378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973810.1 protein_id gnl|my_center|LOCUS_38640 4222125 4221898 gene locus_tag LOCUS_38650 4222125 4221898 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221492514.1 protein_id gnl|my_center|LOCUS_38650 4222920 4222279 gene locus_tag LOCUS_38660 4222920 4222279 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_38660 4223304 4223089 gene locus_tag LOCUS_38670 4223304 4223089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973806.1 protein_id gnl|my_center|LOCUS_38670 4223415 4224380 gene locus_tag LOCUS_38680 4223415 4224380 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030094.1 protein_id gnl|my_center|LOCUS_38680 4224539 4225810 gene locus_tag LOCUS_38690 4224539 4225810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38690 4226072 4225830 gene locus_tag LOCUS_38700 4226072 4225830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 4226047 4227867 gene locus_tag LOCUS_38710 4226047 4227867 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030096.1 protein_id gnl|my_center|LOCUS_38710 4227902 4229431 gene locus_tag LOCUS_38720 4227902 4229431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 4229579 4230544 gene locus_tag LOCUS_38730 4229579 4230544 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134112038.1 protein_id gnl|my_center|LOCUS_38730 4230532 4231350 gene locus_tag LOCUS_38740 4230532 4231350 CDS product spherulation-specific family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973799.1 protein_id gnl|my_center|LOCUS_38740 4231436 4232614 gene locus_tag LOCUS_38750 gene moeZ 4231436 4232614 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_38750 4234255 4232681 gene locus_tag LOCUS_38760 4234255 4232681 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030099.1 protein_id gnl|my_center|LOCUS_38760 4235951 4234353 gene locus_tag LOCUS_38770 4235951 4234353 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030100.1 protein_id gnl|my_center|LOCUS_38770 4238757 4236037 gene locus_tag LOCUS_38780 4238757 4236037 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030101.1 protein_id gnl|my_center|LOCUS_38780 4238979 4239389 gene locus_tag LOCUS_38790 4238979 4239389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 4239689 4243120 gene locus_tag LOCUS_38800 4239689 4243120 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030103.1 protein_id gnl|my_center|LOCUS_38800 4243177 4246680 gene locus_tag LOCUS_38810 4243177 4246680 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486348.1 protein_id gnl|my_center|LOCUS_38810 4246691 4248085 gene locus_tag LOCUS_38820 4246691 4248085 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973791.1 protein_id gnl|my_center|LOCUS_38820 4248130 4249077 gene locus_tag LOCUS_38830 gene nudC 4248130 4249077 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_38830 4249404 4249162 gene locus_tag LOCUS_38840 4249404 4249162 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_38840 4249650 4251878 gene locus_tag LOCUS_38850 4249650 4251878 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_38850 4252045 4252374 gene locus_tag LOCUS_38860 4252045 4252374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973787.1 protein_id gnl|my_center|LOCUS_38860 4252548 4252916 gene locus_tag LOCUS_38870 4252548 4252916 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973786.1 protein_id gnl|my_center|LOCUS_38870 4252913 4253272 gene locus_tag LOCUS_38880 4252913 4253272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 4253439 4253639 gene locus_tag LOCUS_38890 4253439 4253639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 4255201 4253669 gene locus_tag LOCUS_38900 4255201 4253669 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_38900 4256343 4255198 gene locus_tag LOCUS_38910 4256343 4255198 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486346.1 protein_id gnl|my_center|LOCUS_38910 4256526 4257149 gene locus_tag LOCUS_38920 4256526 4257149 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867997.1 protein_id gnl|my_center|LOCUS_38920 4257254 4258783 gene locus_tag LOCUS_38930 4257254 4258783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 4258795 4259475 gene locus_tag LOCUS_38940 4258795 4259475 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973780.1 protein_id gnl|my_center|LOCUS_38940 4259492 4260247 gene locus_tag LOCUS_38950 4259492 4260247 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030111.1 protein_id gnl|my_center|LOCUS_38950 4260873 4260319 gene locus_tag LOCUS_38960 4260873 4260319 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973778.1 protein_id gnl|my_center|LOCUS_38960 4262324 4260870 gene locus_tag LOCUS_38970 4262324 4260870 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_38970 4262515 4263657 gene locus_tag LOCUS_38980 4262515 4263657 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973776.1 protein_id gnl|my_center|LOCUS_38980 4263757 4264218 gene locus_tag LOCUS_38990 4263757 4264218 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973775.1 protein_id gnl|my_center|LOCUS_38990 4264348 4264518 gene locus_tag LOCUS_39000 4264348 4264518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 4264620 4265708 gene locus_tag LOCUS_39010 4264620 4265708 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973773.1 protein_id gnl|my_center|LOCUS_39010 4266323 4265757 gene locus_tag LOCUS_39020 4266323 4265757 CDS product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167526720.1 protein_id gnl|my_center|LOCUS_39020 4266401 4269427 gene locus_tag LOCUS_39030 4266401 4269427 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_39030 4269470 4269544 gene locus_tag LOCUS_t00580 4269470 4269544 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4269803 4271827 gene locus_tag LOCUS_39040 4269803 4271827 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030113.1 protein_id gnl|my_center|LOCUS_39040 4271918 4271992 gene locus_tag LOCUS_t00590 4271918 4271992 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4272575 4272156 gene locus_tag LOCUS_39050 4272575 4272156 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973766.1 protein_id gnl|my_center|LOCUS_39050 4272735 4274189 gene locus_tag LOCUS_39060 4272735 4274189 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972723.1 protein_id gnl|my_center|LOCUS_39060 4274667 4274266 gene locus_tag LOCUS_39070 4274667 4274266 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486342.1 protein_id gnl|my_center|LOCUS_39070 4276120 4275284 gene locus_tag LOCUS_39080 4276120 4275284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 4277274 4277618 gene locus_tag LOCUS_39090 4277274 4277618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 4277945 4277697 gene locus_tag LOCUS_39100 4277945 4277697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 4280103 4279543 gene locus_tag LOCUS_39110 4280103 4279543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 4280858 4280100 gene locus_tag LOCUS_39120 4280858 4280100 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749510.1 protein_id gnl|my_center|LOCUS_39120 4280937 4281176 gene locus_tag LOCUS_39130 4280937 4281176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 4281227 4281997 gene locus_tag LOCUS_39140 4281227 4281997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 4281994 4282578 gene locus_tag LOCUS_39150 4281994 4282578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 4282575 4284251 gene locus_tag LOCUS_39160 4282575 4284251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 4284502 4284723 gene locus_tag LOCUS_39170 4284502 4284723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 4285129 4286364 gene locus_tag LOCUS_39180 4285129 4286364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 4287202 4286402 gene locus_tag LOCUS_39190 gene hisN 4287202 4286402 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973764.1 protein_id gnl|my_center|LOCUS_39190 4287596 4287273 gene locus_tag LOCUS_39200 4287596 4287273 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973762.1 protein_id gnl|my_center|LOCUS_39200 4288716 4287700 gene locus_tag LOCUS_39210 gene rsgA 4288716 4287700 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973761.1 protein_id gnl|my_center|LOCUS_39210 4290054 4288720 gene locus_tag LOCUS_39220 gene aroA 4290054 4288720 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_39220 4290871 4290158 gene locus_tag LOCUS_39230 4290871 4290158 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 protein_id gnl|my_center|LOCUS_39230 4290925 4291740 gene locus_tag LOCUS_39240 4290925 4291740 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_39240 4291785 4292408 gene locus_tag LOCUS_39250 4291785 4292408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973757.1 protein_id gnl|my_center|LOCUS_39250 4292496 4293338 gene locus_tag LOCUS_39260 gene sigR 4292496 4293338 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_39260 4293335 4293655 gene locus_tag LOCUS_39270 gene rsrA 4293335 4293655 CDS product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973755.1 protein_id gnl|my_center|LOCUS_39270 4293830 4295272 gene locus_tag LOCUS_39280 4293830 4295272 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030117.1 protein_id gnl|my_center|LOCUS_39280 4295269 4296534 gene locus_tag LOCUS_39290 4295269 4296534 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495247.1 protein_id gnl|my_center|LOCUS_39290 4296627 4297619 gene locus_tag LOCUS_39300 4296627 4297619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973752.1 protein_id gnl|my_center|LOCUS_39300 4297712 4298350 gene locus_tag LOCUS_39310 gene def 4297712 4298350 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973751.1 protein_id gnl|my_center|LOCUS_39310 4298510 4299247 gene locus_tag LOCUS_39320 4298510 4299247 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091388998.1 protein_id gnl|my_center|LOCUS_39320 4300496 4299477 gene locus_tag LOCUS_39330 4300496 4299477 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030122.1 protein_id gnl|my_center|LOCUS_39330 4302886 4300493 gene locus_tag LOCUS_39340 4302886 4300493 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030123.1 protein_id gnl|my_center|LOCUS_39340 4304959 4303325 gene locus_tag LOCUS_39350 4304959 4303325 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973742.1 protein_id gnl|my_center|LOCUS_39350 4305210 4304956 gene locus_tag LOCUS_39360 4305210 4304956 CDS product DUF3311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973741.1 protein_id gnl|my_center|LOCUS_39360 4306233 4305469 gene locus_tag LOCUS_39370 4306233 4305469 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973740.1 protein_id gnl|my_center|LOCUS_39370 4306517 4307812 gene locus_tag LOCUS_39380 gene dasA 4306517 4307812 CDS product N,N'-diacetylchitobiose ABC transporter substrate-binding protein DasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973739.1 protein_id gnl|my_center|LOCUS_39380 4307935 4308945 gene locus_tag LOCUS_39390 4307935 4308945 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978331.1 protein_id gnl|my_center|LOCUS_39390 4308942 4309814 gene locus_tag LOCUS_39400 4308942 4309814 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226209.1 protein_id gnl|my_center|LOCUS_39400 4309821 4311347 gene locus_tag LOCUS_39410 4309821 4311347 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031132272.1 protein_id gnl|my_center|LOCUS_39410 4312341 4311556 gene locus_tag LOCUS_39420 gene nagB 4312341 4311556 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030128.1 protein_id gnl|my_center|LOCUS_39420 4312546 4313628 gene locus_tag LOCUS_39430 4312546 4313628 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092074.1 protein_id gnl|my_center|LOCUS_39430 4313986 4315452 gene locus_tag LOCUS_39440 4313986 4315452 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_39440 4315886 4315629 gene locus_tag LOCUS_39450 4315886 4315629 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_39450 4317174 4316206 gene locus_tag LOCUS_39460 4317174 4316206 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_39460 4317387 4317764 gene locus_tag LOCUS_39470 4317387 4317764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 4318761 4317835 gene locus_tag LOCUS_39480 4318761 4317835 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270193.1 protein_id gnl|my_center|LOCUS_39480 4319210 4318785 gene locus_tag LOCUS_39490 4319210 4318785 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973726.1 protein_id gnl|my_center|LOCUS_39490 4319688 4319428 gene locus_tag LOCUS_39500 4319688 4319428 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973725.1 protein_id gnl|my_center|LOCUS_39500 4319724 4321325 gene locus_tag LOCUS_39510 4319724 4321325 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973724.1 protein_id gnl|my_center|LOCUS_39510 4322147 4321347 gene locus_tag LOCUS_39520 4322147 4321347 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969730.1 protein_id gnl|my_center|LOCUS_39520 4322286 4322666 gene locus_tag LOCUS_39530 4322286 4322666 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969729.1 protein_id gnl|my_center|LOCUS_39530 4323569 4322676 gene locus_tag LOCUS_39540 4323569 4322676 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030134.1 protein_id gnl|my_center|LOCUS_39540 4324182 4323592 gene locus_tag LOCUS_39550 4324182 4323592 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030135.1 protein_id gnl|my_center|LOCUS_39550 4324169 4324348 gene locus_tag LOCUS_39560 4324169 4324348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 4324435 4325841 gene locus_tag LOCUS_39570 4324435 4325841 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973721.1 protein_id gnl|my_center|LOCUS_39570 4325981 4327024 gene locus_tag LOCUS_39580 4325981 4327024 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973720.1 protein_id gnl|my_center|LOCUS_39580 4327083 4327700 gene locus_tag LOCUS_39590 4327083 4327700 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973719.1 protein_id gnl|my_center|LOCUS_39590 4327803 4328471 gene locus_tag LOCUS_39600 4327803 4328471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 4329218 4328541 gene locus_tag LOCUS_39610 gene snpA 4329218 4328541 CDS product snapalysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971712.1 protein_id gnl|my_center|LOCUS_39610 4329499 4329215 gene locus_tag LOCUS_39620 4329499 4329215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 4329532 4330473 gene locus_tag LOCUS_39630 4329532 4330473 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031660.1 protein_id gnl|my_center|LOCUS_39630 4330573 4331550 gene locus_tag LOCUS_39640 4330573 4331550 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849145.1 protein_id gnl|my_center|LOCUS_39640 4331646 4331999 gene locus_tag LOCUS_39650 4331646 4331999 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804861.1 protein_id gnl|my_center|LOCUS_39650 4331996 4332877 gene locus_tag LOCUS_39660 4331996 4332877 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261950.1 protein_id gnl|my_center|LOCUS_39660 4333339 4333761 gene locus_tag LOCUS_39670 4333339 4333761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028319.1 protein_id gnl|my_center|LOCUS_39670 4334360 4333965 gene locus_tag LOCUS_39680 gene sodN 4334360 4333965 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_39680 4334542 4334979 gene locus_tag LOCUS_39690 gene sodX 4334542 4334979 CDS product nickel-type superoxide dismutase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868025.1 protein_id gnl|my_center|LOCUS_39690 4335512 4334883 gene locus_tag LOCUS_39700 4335512 4334883 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973714.1 protein_id gnl|my_center|LOCUS_39700 4335634 4336407 gene locus_tag LOCUS_39710 4335634 4336407 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030136.1 protein_id gnl|my_center|LOCUS_39710 4337414 4336653 gene locus_tag LOCUS_39720 4337414 4336653 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 protein_id gnl|my_center|LOCUS_39720 4338361 4337411 gene locus_tag LOCUS_39730 4338361 4337411 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973711.1 protein_id gnl|my_center|LOCUS_39730 4339346 4338390 gene locus_tag LOCUS_39740 4339346 4338390 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973710.1 protein_id gnl|my_center|LOCUS_39740 4339870 4341129 gene locus_tag LOCUS_39750 4339870 4341129 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973709.1 protein_id gnl|my_center|LOCUS_39750 4341375 4342337 gene locus_tag LOCUS_39760 4341375 4342337 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_39760 4342403 4342612 gene locus_tag LOCUS_39770 4342403 4342612 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559389.1 protein_id gnl|my_center|LOCUS_39770 4342612 4343187 gene locus_tag LOCUS_39780 4342612 4343187 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030137.1 protein_id gnl|my_center|LOCUS_39780 4344241 4343237 gene locus_tag LOCUS_39790 4344241 4343237 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973705.1 protein_id gnl|my_center|LOCUS_39790 4345100 4344243 gene locus_tag LOCUS_39800 4345100 4344243 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486398.1 protein_id gnl|my_center|LOCUS_39800 4345393 4345926 gene locus_tag LOCUS_39810 4345393 4345926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223938.1 protein_id gnl|my_center|LOCUS_39810 4346025 4346858 gene locus_tag LOCUS_39820 4346025 4346858 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223937.1 protein_id gnl|my_center|LOCUS_39820 4346992 4347978 gene locus_tag LOCUS_39830 4346992 4347978 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029634.1 protein_id gnl|my_center|LOCUS_39830 4347975 4348763 gene locus_tag LOCUS_39840 4347975 4348763 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974578.1 protein_id gnl|my_center|LOCUS_39840 4348876 4349700 gene locus_tag LOCUS_39850 4348876 4349700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973703.1 protein_id gnl|my_center|LOCUS_39850 4349898 4349716 gene locus_tag LOCUS_39860 4349898 4349716 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_39860 4353988 4350134 gene locus_tag LOCUS_39870 4353988 4350134 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_39870 4354063 4354281 gene locus_tag LOCUS_39880 4354063 4354281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 4355323 4354247 gene locus_tag LOCUS_39890 4355323 4354247 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973687.1 protein_id gnl|my_center|LOCUS_39890 4356057 4355320 gene locus_tag LOCUS_39900 4356057 4355320 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973686.1 protein_id gnl|my_center|LOCUS_39900 4356966 4356289 gene locus_tag LOCUS_39910 4356966 4356289 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030151.1 protein_id gnl|my_center|LOCUS_39910 4357677 4357087 gene locus_tag LOCUS_39920 4357677 4357087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 4357803 4360226 gene locus_tag LOCUS_39930 gene lon 4357803 4360226 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030152.1 protein_id gnl|my_center|LOCUS_39930 4360452 4360934 gene locus_tag LOCUS_39940 4360452 4360934 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973682.1 protein_id gnl|my_center|LOCUS_39940 4361788 4360994 gene locus_tag LOCUS_39950 4361788 4360994 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030154.1 protein_id gnl|my_center|LOCUS_39950 4362153 4365026 gene locus_tag LOCUS_39960 4362153 4365026 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486303.1 protein_id gnl|my_center|LOCUS_39960 4365077 4365502 gene locus_tag LOCUS_39970 4365077 4365502 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327267.1 protein_id gnl|my_center|LOCUS_39970 4365499 4365912 gene locus_tag LOCUS_39980 4365499 4365912 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973678.1 protein_id gnl|my_center|LOCUS_39980 4365893 4366543 gene locus_tag LOCUS_39990 4365893 4366543 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973677.1 protein_id gnl|my_center|LOCUS_39990 4366581 4367822 gene locus_tag LOCUS_40000 4366581 4367822 CDS product alanine-phosphoribitol ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973676.1 protein_id gnl|my_center|LOCUS_40000 4369147 4367789 gene locus_tag LOCUS_40010 4369147 4367789 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030158.1 protein_id gnl|my_center|LOCUS_40010 4371858 4369267 gene locus_tag LOCUS_40020 4371858 4369267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 4372294 4371980 gene locus_tag LOCUS_40030 4372294 4371980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030159.1 protein_id gnl|my_center|LOCUS_40030 4373024 4372260 gene locus_tag LOCUS_40040 4373024 4372260 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030160.1 protein_id gnl|my_center|LOCUS_40040 4374021 4373086 gene locus_tag LOCUS_40050 4374021 4373086 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030161.1 protein_id gnl|my_center|LOCUS_40050 4374204 4375310 gene locus_tag LOCUS_40060 4374204 4375310 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_40060 4375449 4376288 gene locus_tag LOCUS_40070 4375449 4376288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 4377482 4376289 gene locus_tag LOCUS_40080 4377482 4376289 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_40080 4378980 4377523 gene locus_tag LOCUS_40090 4378980 4377523 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973670.1 protein_id gnl|my_center|LOCUS_40090 4380335 4378977 gene locus_tag LOCUS_40100 4380335 4378977 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283896.1 protein_id gnl|my_center|LOCUS_40100 4380895 4380452 gene locus_tag LOCUS_40110 4380895 4380452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 4381489 4381166 gene locus_tag LOCUS_40120 4381489 4381166 CDS product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029116.1 protein_id gnl|my_center|LOCUS_40120 4383600 4381486 gene locus_tag LOCUS_40130 4383600 4381486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 4384669 4383779 gene locus_tag LOCUS_40140 gene ligD 4384669 4383779 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973663.1 protein_id gnl|my_center|LOCUS_40140 4385850 4384801 gene locus_tag LOCUS_40150 4385850 4384801 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872665.1 protein_id gnl|my_center|LOCUS_40150 4385944 4386177 gene locus_tag LOCUS_40160 4385944 4386177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 4387757 4386072 gene locus_tag LOCUS_40170 4387757 4386072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 4388076 4389350 gene locus_tag LOCUS_40180 4388076 4389350 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230479.1 protein_id gnl|my_center|LOCUS_40180 4390921 4390526 gene locus_tag LOCUS_40190 4390921 4390526 CDS product Imm7 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043780022.1 protein_id gnl|my_center|LOCUS_40190 4391400 4391050 gene locus_tag LOCUS_40200 4391400 4391050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 4396078 4391459 gene locus_tag LOCUS_40210 4396078 4391459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 4396725 4396078 gene locus_tag LOCUS_40220 4396725 4396078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 4397228 4396722 gene locus_tag LOCUS_40230 4397228 4396722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 4397531 4397328 gene locus_tag LOCUS_40240 4397531 4397328 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_40240 4398400 4397528 gene locus_tag LOCUS_40250 4398400 4397528 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_40250 4398667 4399230 gene locus_tag LOCUS_40260 4398667 4399230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 4399496 4399870 gene locus_tag LOCUS_40270 4399496 4399870 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 protein_id gnl|my_center|LOCUS_40270 4400019 4400558 gene locus_tag LOCUS_40280 4400019 4400558 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_40280 4401607 4400567 gene locus_tag LOCUS_40290 4401607 4400567 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368575.1 protein_id gnl|my_center|LOCUS_40290 4401927 4402745 gene locus_tag LOCUS_40300 4401927 4402745 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445567.1 protein_id gnl|my_center|LOCUS_40300 4403762 4402800 gene locus_tag LOCUS_40310 4403762 4402800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 4404553 4403759 gene locus_tag LOCUS_40320 4404553 4403759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 4404751 4405446 gene locus_tag LOCUS_40330 4404751 4405446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 4406899 4405376 gene locus_tag LOCUS_40340 4406899 4405376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 4408484 4407021 gene locus_tag LOCUS_40350 4408484 4407021 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225330.1 protein_id gnl|my_center|LOCUS_40350 4410523 4408481 gene locus_tag LOCUS_40360 4410523 4408481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 4411980 4410577 gene locus_tag LOCUS_40370 4411980 4410577 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940879.1 protein_id gnl|my_center|LOCUS_40370 4413364 4411952 gene locus_tag LOCUS_40380 4413364 4411952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 4414475 4413366 gene locus_tag LOCUS_40390 4414475 4413366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 protein_id gnl|my_center|LOCUS_40390 4415938 4414514 gene locus_tag LOCUS_40400 4415938 4414514 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031441.1 protein_id gnl|my_center|LOCUS_40400 4417389 4415941 gene locus_tag LOCUS_40410 4417389 4415941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 4417868 4418650 gene locus_tag LOCUS_40420 4417868 4418650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 4418659 4419519 gene locus_tag LOCUS_40430 4418659 4419519 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808069.1 protein_id gnl|my_center|LOCUS_40430 4420222 4419542 gene locus_tag LOCUS_40440 4420222 4419542 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_40440 4420441 4421607 gene locus_tag LOCUS_40450 4420441 4421607 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028819.1 protein_id gnl|my_center|LOCUS_40450 4422036 4421638 gene locus_tag LOCUS_40460 4422036 4421638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 4426074 4422109 gene locus_tag LOCUS_40470 4426074 4422109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 4427745 4426285 gene locus_tag LOCUS_40480 4427745 4426285 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976504.1 protein_id gnl|my_center|LOCUS_40480 4429381 4427798 gene locus_tag LOCUS_40490 4429381 4427798 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727883.1 protein_id gnl|my_center|LOCUS_40490 4430608 4429394 gene locus_tag LOCUS_40500 4430608 4429394 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_40500 4430957 4432228 gene locus_tag LOCUS_40510 gene lat 4430957 4432228 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080767.1 protein_id gnl|my_center|LOCUS_40510 4432282 4443444 gene locus_tag LOCUS_40520 gene srfAA 4432282 4443444 CDS product surfactin non-ribosomal peptide synthetase SrfAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886402.1 protein_id gnl|my_center|LOCUS_40520 4434256 4434184 gene locus_tag LOCUS_t00600 4434256 4434184 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4443471 4444460 gene locus_tag LOCUS_40530 4443471 4444460 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103268.1 protein_id gnl|my_center|LOCUS_40530 4444661 4445614 gene locus_tag LOCUS_40540 gene bla 4444661 4445614 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226950.1 protein_id gnl|my_center|LOCUS_40540 4445916 4445843 gene locus_tag LOCUS_t00610 4445916 4445843 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4446010 4446537 gene locus_tag LOCUS_40550 4446010 4446537 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030200.1 protein_id gnl|my_center|LOCUS_40550 4446593 4447654 gene locus_tag LOCUS_40560 4446593 4447654 CDS product DALR anticodon-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030201.1 protein_id gnl|my_center|LOCUS_40560 4447679 4449070 gene locus_tag LOCUS_40570 gene lysA 4447679 4449070 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_40570 4449167 4450477 gene locus_tag LOCUS_40580 4449167 4450477 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_40580 4450484 4451554 gene locus_tag LOCUS_40590 gene thrC 4450484 4451554 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_40590 4451902 4452819 gene locus_tag LOCUS_40600 gene thrB 4451902 4452819 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_40600 4453210 4455291 gene locus_tag LOCUS_40610 4453210 4455291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 4455572 4457320 gene locus_tag LOCUS_40620 4455572 4457320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 4457545 4457769 gene locus_tag LOCUS_40630 gene rpmE 4457545 4457769 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973638.1 protein_id gnl|my_center|LOCUS_40630 4457917 4458993 gene locus_tag LOCUS_40640 gene prfA 4457917 4458993 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973637.1 protein_id gnl|my_center|LOCUS_40640 4459033 4459878 gene locus_tag LOCUS_40650 gene prmC 4459033 4459878 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_40650 4459943 4460590 gene locus_tag LOCUS_40660 4459943 4460590 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973635.1 protein_id gnl|my_center|LOCUS_40660 4460587 4461228 gene locus_tag LOCUS_40670 4460587 4461228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 4461336 4462616 gene locus_tag LOCUS_40680 4461336 4462616 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973633.1 protein_id gnl|my_center|LOCUS_40680 4462701 4464065 gene locus_tag LOCUS_40690 4462701 4464065 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030207.1 protein_id gnl|my_center|LOCUS_40690 4464329 4464766 gene locus_tag LOCUS_40700 4464329 4464766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973631.1 protein_id gnl|my_center|LOCUS_40700 4464992 4465813 gene locus_tag LOCUS_40710 gene atpB 4464992 4465813 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030208.1 protein_id gnl|my_center|LOCUS_40710 4465886 4466110 gene locus_tag LOCUS_40720 gene atpE 4465886 4466110 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973629.1 protein_id gnl|my_center|LOCUS_40720 4466150 4466695 gene locus_tag LOCUS_40730 4466150 4466695 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030209.1 protein_id gnl|my_center|LOCUS_40730 4466692 4467507 gene locus_tag LOCUS_40740 4466692 4467507 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_40740 4467651 4469222 gene locus_tag LOCUS_40750 gene atpA 4467651 4469222 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973626.1 protein_id gnl|my_center|LOCUS_40750 4469226 4470152 gene locus_tag LOCUS_40760 4469226 4470152 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_40760 4470153 4471604 gene locus_tag LOCUS_40770 gene atpD 4470153 4471604 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973624.1 protein_id gnl|my_center|LOCUS_40770 4471714 4472088 gene locus_tag LOCUS_40780 4471714 4472088 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973623.1 protein_id gnl|my_center|LOCUS_40780 4472186 4472668 gene locus_tag LOCUS_40790 4472186 4472668 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973622.1 protein_id gnl|my_center|LOCUS_40790 4474652 4472775 gene locus_tag LOCUS_40800 4474652 4472775 CDS product glycoside hydrolase family 18 chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030211.1 protein_id gnl|my_center|LOCUS_40800 4475471 4474821 gene locus_tag LOCUS_40810 4475471 4474821 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973620.1 protein_id gnl|my_center|LOCUS_40810 4476727 4475468 gene locus_tag LOCUS_40820 4476727 4475468 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030212.1 protein_id gnl|my_center|LOCUS_40820 4476816 4477358 gene locus_tag LOCUS_40830 4476816 4477358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030213.1 protein_id gnl|my_center|LOCUS_40830 4477953 4477381 gene locus_tag LOCUS_40840 4477953 4477381 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973616.1 protein_id gnl|my_center|LOCUS_40840 4478154 4479002 gene locus_tag LOCUS_40850 4478154 4479002 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030215.1 protein_id gnl|my_center|LOCUS_40850 4479241 4479564 gene locus_tag LOCUS_40860 4479241 4479564 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973611.1 protein_id gnl|my_center|LOCUS_40860 4479788 4482160 gene locus_tag LOCUS_40870 4479788 4482160 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030216.1 protein_id gnl|my_center|LOCUS_40870 4482900 4482229 gene locus_tag LOCUS_40880 gene nucS 4482900 4482229 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007387684.1 protein_id gnl|my_center|LOCUS_40880 4483161 4483553 gene locus_tag LOCUS_40890 4483161 4483553 CDS product SCO5389 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973607.1 protein_id gnl|my_center|LOCUS_40890 4484736 4483696 gene locus_tag LOCUS_40900 4484736 4483696 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030217.1 protein_id gnl|my_center|LOCUS_40900 4484948 4485277 gene locus_tag LOCUS_40910 4484948 4485277 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973605.1 protein_id gnl|my_center|LOCUS_40910 4486175 4485303 gene locus_tag LOCUS_40920 4486175 4485303 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973604.1 protein_id gnl|my_center|LOCUS_40920 4487374 4486172 gene locus_tag LOCUS_40930 4487374 4486172 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030218.1 protein_id gnl|my_center|LOCUS_40930 4488260 4487481 gene locus_tag LOCUS_40940 4488260 4487481 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973602.1 protein_id gnl|my_center|LOCUS_40940 4489273 4488266 gene locus_tag LOCUS_40950 4489273 4488266 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973601.1 protein_id gnl|my_center|LOCUS_40950 4490303 4489365 gene locus_tag LOCUS_40960 4490303 4489365 CDS product cellulose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973600.1 protein_id gnl|my_center|LOCUS_40960 4494282 4490488 gene locus_tag LOCUS_40970 gene scy 4494282 4490488 CDS product polarized growth protein Scy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030220.1 protein_id gnl|my_center|LOCUS_40970 4494946 4494518 gene locus_tag LOCUS_40980 gene mce 4494946 4494518 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973598.1 protein_id gnl|my_center|LOCUS_40980 4495081 4496283 gene locus_tag LOCUS_40990 4495081 4496283 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 protein_id gnl|my_center|LOCUS_40990 4496331 4497287 gene locus_tag LOCUS_41000 gene meaB 4496331 4497287 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_41000 4497960 4497346 gene locus_tag LOCUS_41010 4497960 4497346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 4498094 4498741 gene locus_tag LOCUS_41020 4498094 4498741 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973594.1 protein_id gnl|my_center|LOCUS_41020 4498738 4500243 gene locus_tag LOCUS_41030 4498738 4500243 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_41030 4500794 4500318 gene locus_tag LOCUS_41040 4500794 4500318 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973592.1 protein_id gnl|my_center|LOCUS_41040 4501683 4500901 gene locus_tag LOCUS_41050 4501683 4500901 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973591.1 protein_id gnl|my_center|LOCUS_41050 4502330 4501680 gene locus_tag LOCUS_41060 4502330 4501680 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033475.1 protein_id gnl|my_center|LOCUS_41060 4502962 4502330 gene locus_tag LOCUS_41070 4502962 4502330 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189739317.1 protein_id gnl|my_center|LOCUS_41070 4503122 4503469 gene locus_tag LOCUS_41080 4503122 4503469 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030226.1 protein_id gnl|my_center|LOCUS_41080 4503466 4503759 gene locus_tag LOCUS_41090 4503466 4503759 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409536.1 protein_id gnl|my_center|LOCUS_41090 4503900 4505753 gene locus_tag LOCUS_41100 4503900 4505753 CDS product cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028608.1 protein_id gnl|my_center|LOCUS_41100 4505757 4507709 gene locus_tag LOCUS_41110 4505757 4507709 CDS product kelch motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028609.1 protein_id gnl|my_center|LOCUS_41110 4508765 4507731 gene locus_tag LOCUS_41120 4508765 4507731 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715516.1 protein_id gnl|my_center|LOCUS_41120 4509065 4509574 gene locus_tag LOCUS_41130 4509065 4509574 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973586.1 protein_id gnl|my_center|LOCUS_41130 4509618 4509944 gene locus_tag LOCUS_41140 4509618 4509944 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666291.1 protein_id gnl|my_center|LOCUS_41140 4510026 4511726 gene locus_tag LOCUS_41150 4510026 4511726 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030230.1 protein_id gnl|my_center|LOCUS_41150 4512361 4511702 gene locus_tag LOCUS_41160 4512361 4511702 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030233.1 protein_id gnl|my_center|LOCUS_41160 4512703 4513662 gene locus_tag LOCUS_41170 4512703 4513662 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973580.1 protein_id gnl|my_center|LOCUS_41170 4514263 4514904 gene locus_tag LOCUS_41180 4514263 4514904 CDS product DUF6230 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030235.1 protein_id gnl|my_center|LOCUS_41180 4515000 4515569 gene locus_tag LOCUS_41190 4515000 4515569 CDS product DUF6114 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030236.1 protein_id gnl|my_center|LOCUS_41190 4515559 4516830 gene locus_tag LOCUS_41200 4515559 4516830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283916.1 protein_id gnl|my_center|LOCUS_41200 4516864 4517259 gene locus_tag LOCUS_41210 4516864 4517259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 4517305 4518045 gene locus_tag LOCUS_41220 4517305 4518045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 4518504 4518124 gene locus_tag LOCUS_41230 4518504 4518124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 4525892 4518606 gene locus_tag LOCUS_41240 4525892 4518606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 4525789 4526118 gene locus_tag LOCUS_41250 4525789 4526118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 4527888 4526458 gene locus_tag LOCUS_41260 gene pyk 4527888 4526458 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973575.1 protein_id gnl|my_center|LOCUS_41260 4529261 4527963 gene locus_tag LOCUS_41270 4529261 4527963 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030238.1 protein_id gnl|my_center|LOCUS_41270 4531339 4529267 gene locus_tag LOCUS_41280 gene pta 4531339 4529267 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030239.1 protein_id gnl|my_center|LOCUS_41280 4531710 4532735 gene locus_tag LOCUS_41290 4531710 4532735 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973572.1 protein_id gnl|my_center|LOCUS_41290 4533549 4532809 gene locus_tag LOCUS_41300 4533549 4532809 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973571.1 protein_id gnl|my_center|LOCUS_41300 4534359 4533685 gene locus_tag LOCUS_41310 4534359 4533685 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030245.1 protein_id gnl|my_center|LOCUS_41310 4536032 4534356 gene locus_tag LOCUS_41320 4536032 4534356 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030246.1 protein_id gnl|my_center|LOCUS_41320 4536192 4537550 gene locus_tag LOCUS_41330 4536192 4537550 CDS product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973562.1 protein_id gnl|my_center|LOCUS_41330 4540104 4537693 gene locus_tag LOCUS_41340 gene glgB 4540104 4537693 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486244.1 protein_id gnl|my_center|LOCUS_41340 4541720 4540158 gene locus_tag LOCUS_41350 4541720 4540158 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973557.1 protein_id gnl|my_center|LOCUS_41350 4543662 4541938 gene locus_tag LOCUS_41360 gene treS 4543662 4541938 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973556.1 protein_id gnl|my_center|LOCUS_41360 4545710 4543659 gene locus_tag LOCUS_41370 4545710 4543659 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030248.1 protein_id gnl|my_center|LOCUS_41370 4546418 4549006 gene locus_tag LOCUS_41380 4546418 4549006 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486976.1 protein_id gnl|my_center|LOCUS_41380 4549031 4549243 gene locus_tag LOCUS_41390 4549031 4549243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 4551159 4549132 gene locus_tag LOCUS_41400 4551159 4549132 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973551.1 protein_id gnl|my_center|LOCUS_41400 4553672 4551801 gene locus_tag LOCUS_41410 4553672 4551801 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030254.1 protein_id gnl|my_center|LOCUS_41410 4555498 4553669 gene locus_tag LOCUS_41420 4555498 4553669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030255.1 protein_id gnl|my_center|LOCUS_41420 4557892 4555676 gene locus_tag LOCUS_41430 gene glgX 4557892 4555676 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486968.1 protein_id gnl|my_center|LOCUS_41430 4558142 4559299 gene locus_tag LOCUS_41440 4558142 4559299 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030260.1 protein_id gnl|my_center|LOCUS_41440 4559596 4560747 gene locus_tag LOCUS_41450 4559596 4560747 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486965.1 protein_id gnl|my_center|LOCUS_41450 4560831 4561598 gene locus_tag LOCUS_41460 4560831 4561598 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_41460 4561790 4562365 gene locus_tag LOCUS_41470 4561790 4562365 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079178808.1 protein_id gnl|my_center|LOCUS_41470 4562833 4563048 gene locus_tag LOCUS_41480 4562833 4563048 CDS product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973534.1 protein_id gnl|my_center|LOCUS_41480 4564560 4563091 gene locus_tag LOCUS_41490 4564560 4563091 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030671.1 protein_id gnl|my_center|LOCUS_41490 4565676 4564669 gene locus_tag LOCUS_41500 4565676 4564669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 4567290 4566139 gene locus_tag LOCUS_41510 4567290 4566139 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027640.1 protein_id gnl|my_center|LOCUS_41510 4567324 4567632 gene locus_tag LOCUS_41520 4567324 4567632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 4568840 4567818 gene locus_tag LOCUS_41530 4568840 4567818 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027638.1 protein_id gnl|my_center|LOCUS_41530 4569195 4571861 gene locus_tag LOCUS_41540 4569195 4571861 CDS product cellulase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027340.1 protein_id gnl|my_center|LOCUS_41540 4571950 4573332 gene locus_tag LOCUS_41550 4571950 4573332 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971507.1 protein_id gnl|my_center|LOCUS_41550 4574918 4573533 gene locus_tag LOCUS_41560 4574918 4573533 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 protein_id gnl|my_center|LOCUS_41560 4576340 4575081 gene locus_tag LOCUS_41570 4576340 4575081 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973528.1 protein_id gnl|my_center|LOCUS_41570 4576736 4576359 gene locus_tag LOCUS_41580 gene gcvH 4576736 4576359 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973527.1 protein_id gnl|my_center|LOCUS_41580 4577964 4576837 gene locus_tag LOCUS_41590 gene gcvT 4577964 4576837 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973526.1 protein_id gnl|my_center|LOCUS_41590 4578374 4579048 gene locus_tag LOCUS_41600 4578374 4579048 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030270.1 protein_id gnl|my_center|LOCUS_41600 4579115 4579882 gene locus_tag LOCUS_41610 4579115 4579882 CDS product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973524.1 protein_id gnl|my_center|LOCUS_41610 4580004 4580795 gene locus_tag LOCUS_41620 4580004 4580795 CDS product enhanced serine sensitivity protein SseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030271.1 protein_id gnl|my_center|LOCUS_41620 4581257 4582177 gene locus_tag LOCUS_41630 4581257 4582177 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_41630 4582278 4584029 gene locus_tag LOCUS_41640 4582278 4584029 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973521.1 protein_id gnl|my_center|LOCUS_41640 4584175 4585146 gene locus_tag LOCUS_41650 4584175 4585146 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_41650 4585143 4586243 gene locus_tag LOCUS_41660 4585143 4586243 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 protein_id gnl|my_center|LOCUS_41660 4586240 4587499 gene locus_tag LOCUS_41670 4586240 4587499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 4587519 4588178 gene locus_tag LOCUS_41680 4587519 4588178 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973517.1 protein_id gnl|my_center|LOCUS_41680 4588229 4589101 gene locus_tag LOCUS_41690 4588229 4589101 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327314.1 protein_id gnl|my_center|LOCUS_41690 4589367 4589098 gene locus_tag LOCUS_41700 4589367 4589098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 4589479 4590648 gene locus_tag LOCUS_41710 4589479 4590648 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030274.1 protein_id gnl|my_center|LOCUS_41710 4591342 4590641 gene locus_tag LOCUS_41720 4591342 4590641 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973511.1 protein_id gnl|my_center|LOCUS_41720 4591404 4592534 gene locus_tag LOCUS_41730 gene mnmA 4591404 4592534 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_41730 4593366 4592566 gene locus_tag LOCUS_41740 4593366 4592566 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973509.1 protein_id gnl|my_center|LOCUS_41740 4593822 4593463 gene locus_tag LOCUS_41750 4593822 4593463 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973508.1 protein_id gnl|my_center|LOCUS_41750 4593912 4594451 gene locus_tag LOCUS_41760 4593912 4594451 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870058.1 protein_id gnl|my_center|LOCUS_41760 4594467 4595156 gene locus_tag LOCUS_41770 4594467 4595156 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870060.1 protein_id gnl|my_center|LOCUS_41770 4595379 4595125 gene locus_tag LOCUS_41780 4595379 4595125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 4595261 4596286 gene locus_tag LOCUS_41790 4595261 4596286 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_41790 4596317 4598509 gene locus_tag LOCUS_41800 gene ligA 4596317 4598509 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030278.1 protein_id gnl|my_center|LOCUS_41800 4598889 4601060 gene locus_tag LOCUS_41810 gene rmdB 4598889 4601060 CDS product cyclic Di-GMP phosphodiesterase RmdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030279.1 protein_id gnl|my_center|LOCUS_41810 4601180 4601476 gene locus_tag LOCUS_41820 gene gatC 4601180 4601476 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_41820 4601482 4602984 gene locus_tag LOCUS_41830 gene gatA 4601482 4602984 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973499.1 protein_id gnl|my_center|LOCUS_41830 4602981 4603223 gene locus_tag LOCUS_41840 4602981 4603223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444751.1 protein_id gnl|my_center|LOCUS_41840 4603240 4604748 gene locus_tag LOCUS_41850 gene gatB 4603240 4604748 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 protein_id gnl|my_center|LOCUS_41850 4604951 4607059 gene locus_tag LOCUS_41860 4604951 4607059 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208034.1 protein_id gnl|my_center|LOCUS_41860 4607291 4609534 gene locus_tag LOCUS_41870 4607291 4609534 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_41870 4609550 4610104 gene locus_tag LOCUS_41880 4609550 4610104 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973495.1 protein_id gnl|my_center|LOCUS_41880 4610156 4610836 gene locus_tag LOCUS_41890 4610156 4610836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 4612251 4611052 gene locus_tag LOCUS_41900 4612251 4611052 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486947.1 protein_id gnl|my_center|LOCUS_41900 4613336 4612344 gene locus_tag LOCUS_41910 4613336 4612344 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870088.1 protein_id gnl|my_center|LOCUS_41910 4613467 4614393 gene locus_tag LOCUS_41920 4613467 4614393 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030286.1 protein_id gnl|my_center|LOCUS_41920 4614720 4617548 gene locus_tag LOCUS_41930 4614720 4617548 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030287.1 protein_id gnl|my_center|LOCUS_41930 4617761 4619611 gene locus_tag LOCUS_41940 4617761 4619611 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973484.1 protein_id gnl|my_center|LOCUS_41940 4619634 4620161 gene locus_tag LOCUS_41950 gene ilvN 4619634 4620161 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_41950 4620279 4621280 gene locus_tag LOCUS_41960 gene ilvC 4620279 4621280 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973482.1 protein_id gnl|my_center|LOCUS_41960 4621575 4623167 gene locus_tag LOCUS_41970 gene serA 4621575 4623167 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_41970 4623503 4625905 gene locus_tag LOCUS_41980 4623503 4625905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 4625986 4626702 gene locus_tag LOCUS_41990 4625986 4626702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 4626699 4627253 gene locus_tag LOCUS_42000 4626699 4627253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 4628435 4627263 gene locus_tag LOCUS_42010 4628435 4627263 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973478.1 protein_id gnl|my_center|LOCUS_42010 4628616 4629542 gene locus_tag LOCUS_42020 4628616 4629542 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973477.1 protein_id gnl|my_center|LOCUS_42020 4629590 4631221 gene locus_tag LOCUS_42030 gene pruA 4629590 4631221 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 protein_id gnl|my_center|LOCUS_42030 4631427 4632479 gene locus_tag LOCUS_42040 4631427 4632479 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027949.1 protein_id gnl|my_center|LOCUS_42040 4632554 4633093 gene locus_tag LOCUS_42050 gene aac(2')-Ic 4632554 4633093 CDS product aminoglycoside N-acetyltransferase AAC(2')-Ic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899880.1 protein_id gnl|my_center|LOCUS_42050 4633372 4633500 gene locus_tag LOCUS_42060 4633372 4633500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030289.1 protein_id gnl|my_center|LOCUS_42060 4633591 4634628 gene locus_tag LOCUS_42070 4633591 4634628 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030290.1 protein_id gnl|my_center|LOCUS_42070 4634881 4635984 gene locus_tag LOCUS_42080 4634881 4635984 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030291.1 protein_id gnl|my_center|LOCUS_42080 4636172 4636858 gene locus_tag LOCUS_42090 gene ureA 4636172 4636858 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030293.1 protein_id gnl|my_center|LOCUS_42090 4636858 4638540 gene locus_tag LOCUS_42100 4636858 4638540 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030294.1 protein_id gnl|my_center|LOCUS_42100 4638567 4639592 gene locus_tag LOCUS_42110 4638567 4639592 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973469.1 protein_id gnl|my_center|LOCUS_42110 4639649 4640266 gene locus_tag LOCUS_42120 4639649 4640266 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973468.1 protein_id gnl|my_center|LOCUS_42120 4640589 4642196 gene locus_tag LOCUS_42130 gene cimA 4640589 4642196 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_42130 4642546 4645641 gene locus_tag LOCUS_42140 4642546 4645641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 4645711 4647078 gene locus_tag LOCUS_42150 4645711 4647078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973466.1 protein_id gnl|my_center|LOCUS_42150 4647354 4648328 gene locus_tag LOCUS_42160 4647354 4648328 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027649.1 protein_id gnl|my_center|LOCUS_42160 4649031 4648414 gene locus_tag LOCUS_42170 4649031 4648414 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973463.1 protein_id gnl|my_center|LOCUS_42170 4649275 4649796 gene locus_tag LOCUS_42180 4649275 4649796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227099.1 protein_id gnl|my_center|LOCUS_42180 4649988 4652330 gene locus_tag LOCUS_42190 4649988 4652330 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030298.1 protein_id gnl|my_center|LOCUS_42190 4652509 4654092 gene locus_tag LOCUS_42200 4652509 4654092 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973461.1 protein_id gnl|my_center|LOCUS_42200 4654156 4654359 gene locus_tag LOCUS_42210 4654156 4654359 CDS product acyl-CoA carboxylase epsilon subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030299.1 protein_id gnl|my_center|LOCUS_42210 4655020 4654439 gene locus_tag LOCUS_42220 4655020 4654439 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314218.1 protein_id gnl|my_center|LOCUS_42220 4655705 4655001 gene locus_tag LOCUS_42230 4655705 4655001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 4656218 4655796 gene locus_tag LOCUS_42240 4656218 4655796 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078643930.1 protein_id gnl|my_center|LOCUS_42240 4659408 4656220 gene locus_tag LOCUS_42250 4659408 4656220 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030300.1 protein_id gnl|my_center|LOCUS_42250 4660339 4659758 gene locus_tag LOCUS_42260 4660339 4659758 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314218.1 protein_id gnl|my_center|LOCUS_42260 4660727 4660320 gene locus_tag LOCUS_42270 4660727 4660320 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973454.1 protein_id gnl|my_center|LOCUS_42270 4661284 4660862 gene locus_tag LOCUS_42280 4661284 4660862 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078643930.1 protein_id gnl|my_center|LOCUS_42280 4664929 4661285 gene locus_tag LOCUS_42290 4664929 4661285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 4665549 4665719 gene locus_tag LOCUS_42300 4665549 4665719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327338.1 protein_id gnl|my_center|LOCUS_42300 4665808 4666593 gene locus_tag LOCUS_42310 4665808 4666593 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973449.1 protein_id gnl|my_center|LOCUS_42310 4666586 4668094 gene locus_tag LOCUS_42320 gene gltX 4666586 4668094 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 protein_id gnl|my_center|LOCUS_42320 4668192 4668914 gene locus_tag LOCUS_42330 4668192 4668914 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030303.1 protein_id gnl|my_center|LOCUS_42330 4669000 4669072 gene locus_tag LOCUS_t00620 4669000 4669072 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4669090 4669163 gene locus_tag LOCUS_t00630 4669090 4669163 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4669249 4669322 gene locus_tag LOCUS_t00640 4669249 4669322 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4669334 4669406 gene locus_tag LOCUS_t00650 4669334 4669406 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4669424 4669497 gene locus_tag LOCUS_t00660 4669424 4669497 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4670374 4669658 gene locus_tag LOCUS_42340 gene ndgR 4670374 4669658 CDS product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_42340 4670549 4671976 gene locus_tag LOCUS_42350 gene leuC 4670549 4671976 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973442.1 protein_id gnl|my_center|LOCUS_42350 4671979 4672572 gene locus_tag LOCUS_42360 gene leuD 4671979 4672572 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030306.1 protein_id gnl|my_center|LOCUS_42360 4672677 4672904 gene locus_tag LOCUS_42370 4672677 4672904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973440.1 protein_id gnl|my_center|LOCUS_42370 4673048 4673740 gene locus_tag LOCUS_42380 4673048 4673740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 4674024 4673821 gene locus_tag LOCUS_42390 4674024 4673821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030307.1 protein_id gnl|my_center|LOCUS_42390 4674718 4674035 gene locus_tag LOCUS_42400 gene cofC 4674718 4674035 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973437.1 protein_id gnl|my_center|LOCUS_42400 4674868 4675620 gene locus_tag LOCUS_42410 4674868 4675620 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_42410 4675677 4676627 gene locus_tag LOCUS_42420 4675677 4676627 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_42420 4676704 4677876 gene locus_tag LOCUS_42430 4676704 4677876 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_42430 4678396 4677911 gene locus_tag LOCUS_42440 4678396 4677911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 4678650 4678417 gene locus_tag LOCUS_42450 4678650 4678417 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_42450 4679008 4678676 gene locus_tag LOCUS_42460 4679008 4678676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 4678968 4679939 gene locus_tag LOCUS_42470 4678968 4679939 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_42470 4679950 4680765 gene locus_tag LOCUS_42480 gene thiD 4679950 4680765 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973431.1 protein_id gnl|my_center|LOCUS_42480 4681029 4680844 gene locus_tag LOCUS_42490 gene rpmB 4681029 4680844 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_42490 4681180 4682904 gene locus_tag LOCUS_42500 4681180 4682904 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030309.1 protein_id gnl|my_center|LOCUS_42500 4682972 4685197 gene locus_tag LOCUS_42510 gene recG 4682972 4685197 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973428.1 protein_id gnl|my_center|LOCUS_42510 4685288 4685872 gene locus_tag LOCUS_42520 gene rsmD 4685288 4685872 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 protein_id gnl|my_center|LOCUS_42520 4685869 4686378 gene locus_tag LOCUS_42530 gene coaD 4685869 4686378 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_42530 4686476 4687606 gene locus_tag LOCUS_42540 4686476 4687606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030311.1 protein_id gnl|my_center|LOCUS_42540 4687686 4688420 gene locus_tag LOCUS_42550 4687686 4688420 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_42550 4688423 4688596 gene locus_tag LOCUS_42560 gene rpmF 4688423 4688596 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006139588.1 protein_id gnl|my_center|LOCUS_42560 4688616 4689440 gene locus_tag LOCUS_42570 gene rnc 4688616 4689440 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_42570 4689523 4690389 gene locus_tag LOCUS_42580 gene mutM 4689523 4690389 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973422.1 protein_id gnl|my_center|LOCUS_42580 4691283 4690402 gene locus_tag LOCUS_42590 4691283 4690402 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030314.1 protein_id gnl|my_center|LOCUS_42590 4691439 4691720 gene locus_tag LOCUS_42600 4691439 4691720 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973419.1 protein_id gnl|my_center|LOCUS_42600 4692162 4692374 gene locus_tag LOCUS_42610 4692162 4692374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 4692669 4696244 gene locus_tag LOCUS_42620 gene smc 4692669 4696244 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_42620 4696453 4697871 gene locus_tag LOCUS_42630 4696453 4697871 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971990.1 protein_id gnl|my_center|LOCUS_42630 4698165 4699376 gene locus_tag LOCUS_42640 gene ftsY 4698165 4699376 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_42640 4700106 4699459 gene locus_tag LOCUS_42650 4700106 4699459 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030317.1 protein_id gnl|my_center|LOCUS_42650 4700598 4702004 gene locus_tag LOCUS_42660 4700598 4702004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030318.1 protein_id gnl|my_center|LOCUS_42660 4702348 4703697 gene locus_tag LOCUS_42670 4702348 4703697 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030319.1 protein_id gnl|my_center|LOCUS_42670 4703694 4704032 gene locus_tag LOCUS_42680 4703694 4704032 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051565.1 protein_id gnl|my_center|LOCUS_42680 4704061 4706511 gene locus_tag LOCUS_42690 4704061 4706511 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487177.1 protein_id gnl|my_center|LOCUS_42690 4706660 4708210 gene locus_tag LOCUS_42700 gene ffh 4706660 4708210 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327355.1 protein_id gnl|my_center|LOCUS_42700 4709117 4708296 gene locus_tag LOCUS_42710 4709117 4708296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030324.1 protein_id gnl|my_center|LOCUS_42710 4709749 4710342 gene locus_tag LOCUS_42720 4709749 4710342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973403.1 protein_id gnl|my_center|LOCUS_42720 4710499 4710936 gene locus_tag LOCUS_42730 gene rpsP 4710499 4710936 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444852.1 protein_id gnl|my_center|LOCUS_42730 4710939 4711178 gene locus_tag LOCUS_42740 4710939 4711178 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_42740 4711277 4711870 gene locus_tag LOCUS_42750 gene rimM 4711277 4711870 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973400.1 protein_id gnl|my_center|LOCUS_42750 4711867 4712688 gene locus_tag LOCUS_42760 gene trmD 4711867 4712688 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973399.1 protein_id gnl|my_center|LOCUS_42760 4712814 4713164 gene locus_tag LOCUS_42770 gene rplS 4712814 4713164 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973398.1 protein_id gnl|my_center|LOCUS_42770 4713210 4713980 gene locus_tag LOCUS_42780 gene lepB 4713210 4713980 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030325.1 protein_id gnl|my_center|LOCUS_42780 4713973 4715022 gene locus_tag LOCUS_42790 4713973 4715022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42790 4715030 4715845 gene locus_tag LOCUS_42800 gene lepB 4715030 4715845 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973395.1 protein_id gnl|my_center|LOCUS_42800 4715896 4716660 gene locus_tag LOCUS_42810 gene lepB 4715896 4716660 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030327.1 protein_id gnl|my_center|LOCUS_42810 4716650 4717138 gene locus_tag LOCUS_42820 4716650 4717138 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327363.1 protein_id gnl|my_center|LOCUS_42820 4717202 4717510 gene locus_tag LOCUS_42830 4717202 4717510 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003965949.1 protein_id gnl|my_center|LOCUS_42830 4717594 4717953 gene locus_tag LOCUS_42840 4717594 4717953 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872622.1 protein_id gnl|my_center|LOCUS_42840 4717953 4719578 gene locus_tag LOCUS_42850 4717953 4719578 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030329.1 protein_id gnl|my_center|LOCUS_42850 4719575 4720783 gene locus_tag LOCUS_42860 gene dprA 4719575 4720783 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487183.1 protein_id gnl|my_center|LOCUS_42860 4721131 4721874 gene locus_tag LOCUS_42870 gene whiG 4721131 4721874 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_42870 4722065 4722622 gene locus_tag LOCUS_42880 4722065 4722622 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973388.1 protein_id gnl|my_center|LOCUS_42880 4723613 4724554 gene locus_tag LOCUS_42890 gene rpsB 4723613 4724554 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 protein_id gnl|my_center|LOCUS_42890 4724652 4725488 gene locus_tag LOCUS_42900 gene tsf 4724652 4725488 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973385.1 protein_id gnl|my_center|LOCUS_42900 4725648 4726424 gene locus_tag LOCUS_42910 gene pyrH 4725648 4726424 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973384.1 protein_id gnl|my_center|LOCUS_42910 4726538 4727098 gene locus_tag LOCUS_42920 gene frr 4726538 4727098 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_42920 4727335 4728180 gene locus_tag LOCUS_42930 4727335 4728180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 4728285 4729391 gene locus_tag LOCUS_42940 gene rlmN 4728285 4729391 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_42940 4729635 4730732 gene locus_tag LOCUS_42950 4729635 4730732 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487181.1 protein_id gnl|my_center|LOCUS_42950 4730744 4732417 gene locus_tag LOCUS_42960 4730744 4732417 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487169.1 protein_id gnl|my_center|LOCUS_42960 4732420 4733460 gene locus_tag LOCUS_42970 4732420 4733460 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030362.1 protein_id gnl|my_center|LOCUS_42970 4733543 4734043 gene locus_tag LOCUS_42980 4733543 4734043 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224367.1 protein_id gnl|my_center|LOCUS_42980 4735092 4734103 gene locus_tag LOCUS_42990 4735092 4734103 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029688.1 protein_id gnl|my_center|LOCUS_42990 4735185 4735583 gene locus_tag LOCUS_43000 4735185 4735583 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974464.1 protein_id gnl|my_center|LOCUS_43000 4735915 4736175 gene locus_tag LOCUS_43010 4735915 4736175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43010 4737179 4736193 gene locus_tag LOCUS_43020 4737179 4736193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 4738087 4737350 gene locus_tag LOCUS_43030 4738087 4737350 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973371.1 protein_id gnl|my_center|LOCUS_43030 4739681 4738302 gene locus_tag LOCUS_43040 4739681 4738302 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973370.1 protein_id gnl|my_center|LOCUS_43040 4740172 4739666 gene locus_tag LOCUS_43050 4740172 4739666 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973369.1 protein_id gnl|my_center|LOCUS_43050 4740334 4741773 gene locus_tag LOCUS_43060 4740334 4741773 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_43060 4742688 4741882 gene locus_tag LOCUS_43070 4742688 4741882 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 protein_id gnl|my_center|LOCUS_43070 4743477 4742755 gene locus_tag LOCUS_43080 4743477 4742755 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973364.1 protein_id gnl|my_center|LOCUS_43080 4744532 4743498 gene locus_tag LOCUS_43090 4744532 4743498 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030372.1 protein_id gnl|my_center|LOCUS_43090 4744662 4745369 gene locus_tag LOCUS_43100 4744662 4745369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 4746028 4745462 gene locus_tag LOCUS_43110 4746028 4745462 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680960.1 protein_id gnl|my_center|LOCUS_43110 4746218 4747732 gene locus_tag LOCUS_43120 4746218 4747732 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030374.1 protein_id gnl|my_center|LOCUS_43120 4747779 4749029 gene locus_tag LOCUS_43130 4747779 4749029 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973358.1 protein_id gnl|my_center|LOCUS_43130 4749085 4750254 gene locus_tag LOCUS_43140 4749085 4750254 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973357.1 protein_id gnl|my_center|LOCUS_43140 4750251 4751183 gene locus_tag LOCUS_43150 4750251 4751183 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030376.1 protein_id gnl|my_center|LOCUS_43150 4751183 4751986 gene locus_tag LOCUS_43160 4751183 4751986 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973355.1 protein_id gnl|my_center|LOCUS_43160 4752012 4753427 gene locus_tag LOCUS_43170 4752012 4753427 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_43170 4753643 4755472 gene locus_tag LOCUS_43180 4753643 4755472 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851194.1 protein_id gnl|my_center|LOCUS_43180 4755981 4755457 gene locus_tag LOCUS_43190 4755981 4755457 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247811.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43190 4757748 4756408 gene locus_tag LOCUS_43200 gene gabT 4757748 4756408 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973349.1 protein_id gnl|my_center|LOCUS_43200 4758013 4760379 gene locus_tag LOCUS_43210 4758013 4760379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 4760500 4762089 gene locus_tag LOCUS_43220 4760500 4762089 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030383.1 protein_id gnl|my_center|LOCUS_43220 4762223 4763668 gene locus_tag LOCUS_43230 4762223 4763668 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030384.1 protein_id gnl|my_center|LOCUS_43230 4763907 4765862 gene locus_tag LOCUS_43240 4763907 4765862 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030396.1 protein_id gnl|my_center|LOCUS_43240 4765946 4767199 gene locus_tag LOCUS_43250 gene dxr 4765946 4767199 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_43250 4767214 4768506 gene locus_tag LOCUS_43260 4767214 4768506 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030397.1 protein_id gnl|my_center|LOCUS_43260 4768672 4769826 gene locus_tag LOCUS_43270 gene ispG 4768672 4769826 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973330.1 protein_id gnl|my_center|LOCUS_43270 4770004 4770849 gene locus_tag LOCUS_43280 4770004 4770849 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_43280 4770885 4771490 gene locus_tag LOCUS_43290 4770885 4771490 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973328.1 protein_id gnl|my_center|LOCUS_43290 4771527 4773227 gene locus_tag LOCUS_43300 4771527 4773227 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973327.1 protein_id gnl|my_center|LOCUS_43300 4774224 4773307 gene locus_tag LOCUS_43310 4774224 4773307 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030398.1 protein_id gnl|my_center|LOCUS_43310 4774747 4774253 gene locus_tag LOCUS_43320 4774747 4774253 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030399.1 protein_id gnl|my_center|LOCUS_43320 4775217 4774744 gene locus_tag LOCUS_43330 4775217 4774744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 4775451 4775948 gene locus_tag LOCUS_43340 gene rimP 4775451 4775948 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973323.1 protein_id gnl|my_center|LOCUS_43340 4775951 4776991 gene locus_tag LOCUS_43350 gene nusA 4775951 4776991 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_43350 4777134 4777421 gene locus_tag LOCUS_43360 4777134 4777421 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973321.1 protein_id gnl|my_center|LOCUS_43360 4777562 4780702 gene locus_tag LOCUS_43370 4777562 4780702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 4778518 4778719 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tggccccggtggcggcggc 4780767 4781132 gene locus_tag LOCUS_43380 4780767 4781132 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973319.1 protein_id gnl|my_center|LOCUS_43380 4781171 4781644 gene locus_tag LOCUS_43390 gene rbfA 4781171 4781644 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973318.1 protein_id gnl|my_center|LOCUS_43390 4781641 4782540 gene locus_tag LOCUS_43400 gene truB 4781641 4782540 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030403.1 protein_id gnl|my_center|LOCUS_43400 4782732 4786337 gene locus_tag LOCUS_43410 4782732 4786337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 4786380 4787336 gene locus_tag LOCUS_43420 4786380 4787336 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_43420 4788369 4787392 gene locus_tag LOCUS_43430 4788369 4787392 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030405.1 protein_id gnl|my_center|LOCUS_43430 4789415 4788366 gene locus_tag LOCUS_43440 4789415 4788366 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030406.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43440 4790332 4789412 gene locus_tag LOCUS_43450 4790332 4789412 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973312.1 protein_id gnl|my_center|LOCUS_43450 4791420 4790329 gene locus_tag LOCUS_43460 4791420 4790329 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226493.1 protein_id gnl|my_center|LOCUS_43460 4793256 4791424 gene locus_tag LOCUS_43470 4793256 4791424 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030408.1 protein_id gnl|my_center|LOCUS_43470 4796391 4793500 gene locus_tag LOCUS_43480 4796391 4793500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43480 4797432 4796710 gene locus_tag LOCUS_43490 4797432 4796710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030411.1 protein_id gnl|my_center|LOCUS_43490 4798589 4797432 gene locus_tag LOCUS_43500 gene eccE 4798589 4797432 CDS product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487445.1 protein_id gnl|my_center|LOCUS_43500 4799060 4798863 gene locus_tag LOCUS_43510 4799060 4798863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 4799008 4800555 gene locus_tag LOCUS_43520 gene eccB 4799008 4800555 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030413.1 protein_id gnl|my_center|LOCUS_43520 4800605 4801843 gene locus_tag LOCUS_43530 gene mycP 4800605 4801843 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030414.1 protein_id gnl|my_center|LOCUS_43530 4802088 4802438 gene locus_tag LOCUS_43540 4802088 4802438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 4802490 4802795 gene locus_tag LOCUS_43550 4802490 4802795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 4803108 4802875 gene locus_tag LOCUS_43560 4803108 4802875 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030415.1 protein_id gnl|my_center|LOCUS_43560 4807187 4803225 gene locus_tag LOCUS_43570 4807187 4803225 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030426.1 protein_id gnl|my_center|LOCUS_43570 4807372 4808853 gene locus_tag LOCUS_43580 gene eccD 4807372 4808853 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270242.1 protein_id gnl|my_center|LOCUS_43580 4809031 4809321 gene locus_tag LOCUS_43590 gene rpsO 4809031 4809321 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973291.1 protein_id gnl|my_center|LOCUS_43590 4809578 4811806 gene locus_tag LOCUS_43600 4809578 4811806 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_43600 4811803 4813194 gene locus_tag LOCUS_43610 4811803 4813194 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_43610 4813209 4813961 gene locus_tag LOCUS_43620 gene dapB 4813209 4813961 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030428.1 protein_id gnl|my_center|LOCUS_43620 4813976 4814440 gene locus_tag LOCUS_43630 4813976 4814440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973287.1 protein_id gnl|my_center|LOCUS_43630 4815046 4814495 gene locus_tag LOCUS_43640 4815046 4814495 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030429.1 protein_id gnl|my_center|LOCUS_43640 4815391 4815152 gene locus_tag LOCUS_43650 4815391 4815152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973285.1 protein_id gnl|my_center|LOCUS_43650 4815579 4816316 gene locus_tag LOCUS_43660 gene thyX 4815579 4816316 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030430.1 protein_id gnl|my_center|LOCUS_43660 4816469 4817368 gene locus_tag LOCUS_43670 gene dapA 4816469 4817368 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_43670 4817499 4819184 gene locus_tag LOCUS_43680 4817499 4819184 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_43680 4819808 4821330 gene locus_tag LOCUS_r00160 4819808 4821330 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4821637 4824759 gene locus_tag LOCUS_r00170 4821637 4824759 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4824843 4824953 gene locus_tag LOCUS_r00180 4824843 4824953 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4825132 4825205 gene locus_tag LOCUS_t00670 4825132 4825205 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4827889 4825265 gene locus_tag LOCUS_43690 4827889 4825265 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973277.1 protein_id gnl|my_center|LOCUS_43690 4828290 4833740 gene locus_tag LOCUS_43700 4828290 4833740 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030433.1 protein_id gnl|my_center|LOCUS_43700 4833985 4834668 gene locus_tag LOCUS_43710 4833985 4834668 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030434.1 protein_id gnl|my_center|LOCUS_43710 4834780 4837566 gene locus_tag LOCUS_43720 4834780 4837566 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973274.1 protein_id gnl|my_center|LOCUS_43720 4837770 4838570 gene locus_tag LOCUS_43730 4837770 4838570 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973273.1 protein_id gnl|my_center|LOCUS_43730 4838699 4840177 gene locus_tag LOCUS_43740 gene rimO 4838699 4840177 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973272.1 protein_id gnl|my_center|LOCUS_43740 4840174 4840962 gene locus_tag LOCUS_43750 gene pgsA 4840174 4840962 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973271.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43750 4840959 4841483 gene locus_tag LOCUS_43760 4840959 4841483 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030436.1 protein_id gnl|my_center|LOCUS_43760 4841578 4841961 gene locus_tag LOCUS_43770 4841578 4841961 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973269.1 protein_id gnl|my_center|LOCUS_43770 4843077 4842229 gene locus_tag LOCUS_43780 4843077 4842229 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_43780 4847875 4843175 gene locus_tag LOCUS_43790 4847875 4843175 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030438.1 protein_id gnl|my_center|LOCUS_43790 4847978 4848841 gene locus_tag LOCUS_43800 4847978 4848841 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115566.1 protein_id gnl|my_center|LOCUS_43800 4848888 4849679 gene locus_tag LOCUS_43810 4848888 4849679 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973261.1 protein_id gnl|my_center|LOCUS_43810 4849676 4849981 gene locus_tag LOCUS_43820 4849676 4849981 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973260.1 protein_id gnl|my_center|LOCUS_43820 4850982 4850068 gene locus_tag LOCUS_43830 4850982 4850068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715181.1 protein_id gnl|my_center|LOCUS_43830 4851062 4851256 gene locus_tag LOCUS_43840 4851062 4851256 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973258.1 protein_id gnl|my_center|LOCUS_43840 4851382 4852659 gene locus_tag LOCUS_43850 4851382 4852659 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030441.1 protein_id gnl|my_center|LOCUS_43850 4852943 4854076 gene locus_tag LOCUS_43860 gene recA 4852943 4854076 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030442.1 protein_id gnl|my_center|LOCUS_43860 4854080 4854886 gene locus_tag LOCUS_43870 4854080 4854886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 4855733 4855056 gene locus_tag LOCUS_43880 4855733 4855056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 4856623 4856204 gene locus_tag LOCUS_43890 4856623 4856204 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973252.1 protein_id gnl|my_center|LOCUS_43890 4857198 4856620 gene locus_tag LOCUS_43900 4857198 4856620 CDS product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030444.1 protein_id gnl|my_center|LOCUS_43900 4859127 4857391 gene locus_tag LOCUS_43910 4859127 4857391 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189108986.1 protein_id gnl|my_center|LOCUS_43910 4860137 4859223 gene locus_tag LOCUS_43920 4860137 4859223 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030446.1 protein_id gnl|my_center|LOCUS_43920 4860802 4860134 gene locus_tag LOCUS_43930 4860802 4860134 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973248.1 protein_id gnl|my_center|LOCUS_43930 4861743 4860901 gene locus_tag LOCUS_43940 4861743 4860901 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030447.1 protein_id gnl|my_center|LOCUS_43940 4862588 4861803 gene locus_tag LOCUS_43950 4862588 4861803 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973246.1 protein_id gnl|my_center|LOCUS_43950 4862861 4863553 gene locus_tag LOCUS_43960 4862861 4863553 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973245.1 protein_id gnl|my_center|LOCUS_43960 4863569 4864963 gene locus_tag LOCUS_43970 4863569 4864963 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224238.1 protein_id gnl|my_center|LOCUS_43970 4865977 4864979 gene locus_tag LOCUS_43980 4865977 4864979 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030449.1 protein_id gnl|my_center|LOCUS_43980 4866098 4867615 gene locus_tag LOCUS_43990 gene miaB 4866098 4867615 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_43990 4867677 4868396 gene locus_tag LOCUS_44000 4867677 4868396 CDS product class III extradiol dioxygenase subunit B-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030454.1 protein_id gnl|my_center|LOCUS_44000 4868717 4868478 gene locus_tag LOCUS_44010 4868717 4868478 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030455.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44010 4868958 4869896 gene locus_tag LOCUS_44020 gene miaA 4868958 4869896 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_44020 4869974 4870441 gene locus_tag LOCUS_44030 4869974 4870441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327425.1 protein_id gnl|my_center|LOCUS_44030 4870506 4871378 gene locus_tag LOCUS_44040 gene dapF 4870506 4871378 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030458.1 protein_id gnl|my_center|LOCUS_44040 4871518 4873662 gene locus_tag LOCUS_44050 4871518 4873662 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030459.1 protein_id gnl|my_center|LOCUS_44050 4873749 4875200 gene locus_tag LOCUS_44060 4873749 4875200 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030460.1 protein_id gnl|my_center|LOCUS_44060 4875385 4876905 gene locus_tag LOCUS_44070 gene hflX 4875385 4876905 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_44070 4878192 4877035 gene locus_tag LOCUS_44080 4878192 4877035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973224.1 protein_id gnl|my_center|LOCUS_44080 4878574 4879962 gene locus_tag LOCUS_44090 4878574 4879962 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011319592.1 protein_id gnl|my_center|LOCUS_44090 4879991 4881880 gene locus_tag LOCUS_44100 4879991 4881880 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485565.1 protein_id gnl|my_center|LOCUS_44100 4881928 4882653 gene locus_tag LOCUS_44110 4881928 4882653 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973221.1 protein_id gnl|my_center|LOCUS_44110 4882714 4884627 gene locus_tag LOCUS_44120 4882714 4884627 CDS product IucA/IucC family siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904090.1 protein_id gnl|my_center|LOCUS_44120 4884666 4886636 gene locus_tag LOCUS_44130 4884666 4886636 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030465.1 protein_id gnl|my_center|LOCUS_44130 4887629 4886832 gene locus_tag LOCUS_44140 gene lexA 4887629 4886832 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_44140 4888126 4888638 gene locus_tag LOCUS_44150 gene nrdR 4888126 4888638 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973218.1 protein_id gnl|my_center|LOCUS_44150 4888798 4891701 gene locus_tag LOCUS_44160 4888798 4891701 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 protein_id gnl|my_center|LOCUS_44160 4892383 4891847 gene locus_tag LOCUS_44170 4892383 4891847 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030468.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44170 4892633 4893238 gene locus_tag LOCUS_44180 4892633 4893238 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973215.1 protein_id gnl|my_center|LOCUS_44180 4893436 4894095 gene locus_tag LOCUS_44190 4893436 4894095 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973214.1 protein_id gnl|my_center|LOCUS_44190 4894108 4895016 gene locus_tag LOCUS_44200 4894108 4895016 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_44200 4895216 4895926 gene locus_tag LOCUS_44210 4895216 4895926 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_44210 4895986 4896618 gene locus_tag LOCUS_44220 4895986 4896618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030472.1 protein_id gnl|my_center|LOCUS_44220 4897024 4896674 gene locus_tag LOCUS_44230 4897024 4896674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 4897197 4897361 gene locus_tag LOCUS_44240 4897197 4897361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 4897602 4899836 gene locus_tag LOCUS_44250 4897602 4899836 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030473.1 protein_id gnl|my_center|LOCUS_44250 4900151 4901566 gene locus_tag LOCUS_44260 4900151 4901566 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030474.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44260 4902124 4902888 gene locus_tag LOCUS_44270 4902124 4902888 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973205.1 protein_id gnl|my_center|LOCUS_44270 4903117 4904844 gene locus_tag LOCUS_44280 4903117 4904844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 4905005 4905892 gene locus_tag LOCUS_44290 gene whiH 4905005 4905892 CDS product sporulation transcriptional regulator WhiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030477.1 protein_id gnl|my_center|LOCUS_44290 4906216 4907763 gene locus_tag LOCUS_44300 4906216 4907763 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973202.1 protein_id gnl|my_center|LOCUS_44300 4907896 4908726 gene locus_tag LOCUS_44310 4907896 4908726 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973201.1 protein_id gnl|my_center|LOCUS_44310 4909096 4908863 gene locus_tag LOCUS_44320 4909096 4908863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 4909536 4911668 gene locus_tag LOCUS_44330 4909536 4911668 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973199.1 protein_id gnl|my_center|LOCUS_44330 4912453 4911776 gene locus_tag LOCUS_44340 4912453 4911776 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030483.1 protein_id gnl|my_center|LOCUS_44340 4914120 4912450 gene locus_tag LOCUS_44350 4914120 4912450 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850856.1 protein_id gnl|my_center|LOCUS_44350 4914402 4915745 gene locus_tag LOCUS_44360 4914402 4915745 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030486.1 protein_id gnl|my_center|LOCUS_44360 4918213 4915763 gene locus_tag LOCUS_44370 4918213 4915763 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030487.1 protein_id gnl|my_center|LOCUS_44370 4918462 4919832 gene locus_tag LOCUS_44380 4918462 4919832 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_44380 4919859 4921241 gene locus_tag LOCUS_44390 4919859 4921241 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030488.1 protein_id gnl|my_center|LOCUS_44390 4921661 4922452 gene locus_tag LOCUS_44400 4921661 4922452 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030489.1 protein_id gnl|my_center|LOCUS_44400 4922646 4923350 gene locus_tag LOCUS_44410 4922646 4923350 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030490.1 protein_id gnl|my_center|LOCUS_44410 4923792 4923511 gene locus_tag LOCUS_44420 4923792 4923511 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973180.1 protein_id gnl|my_center|LOCUS_44420 4923954 4926800 gene locus_tag LOCUS_44430 4923954 4926800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 4926868 4927458 gene locus_tag LOCUS_44440 4926868 4927458 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_44440 4927458 4928645 gene locus_tag LOCUS_44450 4927458 4928645 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_44450 4928716 4929366 gene locus_tag LOCUS_44460 4928716 4929366 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973175.1 protein_id gnl|my_center|LOCUS_44460 4930284 4929508 gene locus_tag LOCUS_44470 4930284 4929508 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973167.1 protein_id gnl|my_center|LOCUS_44470 4930525 4931355 gene locus_tag LOCUS_44480 4930525 4931355 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030499.1 protein_id gnl|my_center|LOCUS_44480 4932510 4931446 gene locus_tag LOCUS_44490 gene sepH 4932510 4931446 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973165.1 protein_id gnl|my_center|LOCUS_44490 4933003 4933956 gene locus_tag LOCUS_44500 4933003 4933956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030500.1 protein_id gnl|my_center|LOCUS_44500 4935191 4934016 gene locus_tag LOCUS_44510 4935191 4934016 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_44510 4935145 4935327 gene locus_tag LOCUS_44520 4935145 4935327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 4936542 4935295 gene locus_tag LOCUS_44530 4936542 4935295 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973162.1 protein_id gnl|my_center|LOCUS_44530 4936666 4937838 gene locus_tag LOCUS_44540 4936666 4937838 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973161.1 protein_id gnl|my_center|LOCUS_44540 4937875 4938675 gene locus_tag LOCUS_44550 4937875 4938675 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153505920.1 protein_id gnl|my_center|LOCUS_44550 4938951 4938778 gene locus_tag LOCUS_44560 4938951 4938778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 4939329 4939982 gene locus_tag LOCUS_44570 4939329 4939982 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_44570 4939990 4941225 gene locus_tag LOCUS_44580 4939990 4941225 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973157.1 protein_id gnl|my_center|LOCUS_44580 4941632 4941928 gene locus_tag LOCUS_44590 4941632 4941928 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993510.1 protein_id gnl|my_center|LOCUS_44590 4941941 4942846 gene locus_tag LOCUS_44600 4941941 4942846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030505.1 protein_id gnl|my_center|LOCUS_44600 4943320 4942862 gene locus_tag LOCUS_44610 4943320 4942862 CDS product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973155.1 protein_id gnl|my_center|LOCUS_44610 4943379 4943963 gene locus_tag LOCUS_44620 4943379 4943963 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030506.1 protein_id gnl|my_center|LOCUS_44620 4943963 4944490 gene locus_tag LOCUS_44630 gene dut 4943963 4944490 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973153.1 protein_id gnl|my_center|LOCUS_44630 4944492 4945259 gene locus_tag LOCUS_44640 4944492 4945259 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973152.1 protein_id gnl|my_center|LOCUS_44640 4945498 4948041 gene locus_tag LOCUS_44650 4945498 4948041 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 protein_id gnl|my_center|LOCUS_44650 4948112 4948804 gene locus_tag LOCUS_44660 4948112 4948804 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_44660 4948914 4949330 gene locus_tag LOCUS_44670 4948914 4949330 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327459.1 protein_id gnl|my_center|LOCUS_44670 4949334 4950092 gene locus_tag LOCUS_44680 4949334 4950092 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973147.1 protein_id gnl|my_center|LOCUS_44680 4950875 4950198 gene locus_tag LOCUS_44690 4950875 4950198 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_44690 4951543 4950875 gene locus_tag LOCUS_44700 4951543 4950875 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_44700 4951844 4952509 gene locus_tag LOCUS_44710 4951844 4952509 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742191.1 protein_id gnl|my_center|LOCUS_44710 4952741 4954789 gene locus_tag LOCUS_44720 4952741 4954789 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973119.1 protein_id gnl|my_center|LOCUS_44720 4954847 4956262 gene locus_tag LOCUS_44730 4954847 4956262 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_44730 4956409 4956735 gene locus_tag LOCUS_44740 4956409 4956735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 4957716 4960034 gene locus_tag LOCUS_44750 4957716 4960034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 4960515 4960667 gene locus_tag LOCUS_44760 4960515 4960667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 4961342 4962769 gene locus_tag LOCUS_44770 4961342 4962769 CDS product non-reducing end alpha-L-arabinofuranosidase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030541.1 protein_id gnl|my_center|LOCUS_44770 4963571 4963170 gene locus_tag LOCUS_44780 4963571 4963170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 4963807 4963568 gene locus_tag LOCUS_44790 4963807 4963568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 4963939 4964178 gene locus_tag LOCUS_44800 4963939 4964178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44800 4965378 4964272 gene locus_tag LOCUS_44810 4965378 4964272 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_44810 4965487 4965690 gene locus_tag LOCUS_44820 4965487 4965690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 4966318 4965860 gene locus_tag LOCUS_44830 4966318 4965860 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730224.1 protein_id gnl|my_center|LOCUS_44830 4967922 4966693 gene locus_tag LOCUS_44840 4967922 4966693 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188478.1 protein_id gnl|my_center|LOCUS_44840 4968912 4969694 gene locus_tag LOCUS_44850 4968912 4969694 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879184.1 protein_id gnl|my_center|LOCUS_44850 4970046 4970249 gene locus_tag LOCUS_44860 4970046 4970249 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975209.1 protein_id gnl|my_center|LOCUS_44860 4970597 4972090 gene locus_tag LOCUS_44870 4970597 4972090 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973100.1 protein_id gnl|my_center|LOCUS_44870 4972461 4972775 gene locus_tag LOCUS_44880 4972461 4972775 CDS product SCO5918 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973102.1 protein_id gnl|my_center|LOCUS_44880 4973214 4972861 gene locus_tag LOCUS_44890 4973214 4972861 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973104.1 protein_id gnl|my_center|LOCUS_44890 4975460 4974150 gene locus_tag LOCUS_44900 4975460 4974150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 4976833 4975634 gene locus_tag LOCUS_44910 4976833 4975634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 4977143 4976874 gene locus_tag LOCUS_44920 4977143 4976874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 4977313 4977149 gene locus_tag LOCUS_44930 4977313 4977149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 4977500 4978564 gene locus_tag LOCUS_44940 4977500 4978564 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279310.1 protein_id gnl|my_center|LOCUS_44940 4980258 4978669 gene locus_tag LOCUS_44950 4980258 4978669 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027641.1 protein_id gnl|my_center|LOCUS_44950 4980799 4980326 gene locus_tag LOCUS_44960 4980799 4980326 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027642.1 protein_id gnl|my_center|LOCUS_44960 4981891 4980842 gene locus_tag LOCUS_44970 4981891 4980842 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739097.1 protein_id gnl|my_center|LOCUS_44970 4982089 4983336 gene locus_tag LOCUS_44980 4982089 4983336 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972116.1 protein_id gnl|my_center|LOCUS_44980 4983342 4984226 gene locus_tag LOCUS_44990 4983342 4984226 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972115.1 protein_id gnl|my_center|LOCUS_44990 4984223 4985044 gene locus_tag LOCUS_45000 4984223 4985044 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972114.1 protein_id gnl|my_center|LOCUS_45000 4985041 4987488 gene locus_tag LOCUS_45010 4985041 4987488 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031390.1 protein_id gnl|my_center|LOCUS_45010 4988963 4987566 gene locus_tag LOCUS_45020 4988963 4987566 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027286.1 protein_id gnl|my_center|LOCUS_45020 4989233 4989469 gene locus_tag LOCUS_45030 gene rpmB 4989233 4989469 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028971.1 protein_id gnl|my_center|LOCUS_45030 4989469 4989774 gene locus_tag LOCUS_45040 gene rpsN 4989469 4989774 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975403.1 protein_id gnl|my_center|LOCUS_45040 4991093 4989846 gene locus_tag LOCUS_45050 4991093 4989846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 4991419 4991153 gene locus_tag LOCUS_45060 4991419 4991153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 4991385 4992230 gene locus_tag LOCUS_45070 4991385 4992230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 4992227 4993246 gene locus_tag LOCUS_45080 gene fecC 4992227 4993246 CDS product iron-dicitrate ABC transporter permease FecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237124.1 protein_id gnl|my_center|LOCUS_45080 4993243 4994331 gene locus_tag LOCUS_45090 4993243 4994331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 4994379 4995275 gene locus_tag LOCUS_45100 4994379 4995275 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339288.1 protein_id gnl|my_center|LOCUS_45100 4995333 4995464 gene locus_tag LOCUS_45110 4995333 4995464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 4995544 4996371 gene locus_tag LOCUS_45120 4995544 4996371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 4996368 4997879 gene locus_tag LOCUS_45130 4996368 4997879 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083480.1 protein_id gnl|my_center|LOCUS_45130 4997876 4999261 gene locus_tag LOCUS_45140 4997876 4999261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 4999271 5000587 gene locus_tag LOCUS_45150 4999271 5000587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 5000584 5002323 gene locus_tag LOCUS_45160 5000584 5002323 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141300.1 protein_id gnl|my_center|LOCUS_45160 5002320 5004071 gene locus_tag LOCUS_45170 5002320 5004071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 5004308 5004138 gene locus_tag LOCUS_45180 gene rpmF 5004308 5004138 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978430.1 protein_id gnl|my_center|LOCUS_45180 5005385 5004453 gene locus_tag LOCUS_45190 5005385 5004453 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_45190 5005499 5006536 gene locus_tag LOCUS_45200 5005499 5006536 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974569.1 protein_id gnl|my_center|LOCUS_45200 5006690 5007739 gene locus_tag LOCUS_45210 5006690 5007739 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211882.1 protein_id gnl|my_center|LOCUS_45210 5007775 5008812 gene locus_tag LOCUS_45220 5007775 5008812 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027977.1 protein_id gnl|my_center|LOCUS_45220 5008809 5009873 gene locus_tag LOCUS_45230 5008809 5009873 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868181.1 protein_id gnl|my_center|LOCUS_45230 5009873 5010460 gene locus_tag LOCUS_45240 5009873 5010460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973985.1 protein_id gnl|my_center|LOCUS_45240 5011433 5010549 gene locus_tag LOCUS_45250 5011433 5010549 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007446839.1 protein_id gnl|my_center|LOCUS_45250 5011639 5012439 gene locus_tag LOCUS_45260 5011639 5012439 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027539.1 protein_id gnl|my_center|LOCUS_45260 5012556 5012960 gene locus_tag LOCUS_45270 5012556 5012960 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864086.1 protein_id gnl|my_center|LOCUS_45270 5013007 5013366 gene locus_tag LOCUS_45280 5013007 5013366 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030572.1 protein_id gnl|my_center|LOCUS_45280 5013491 5014009 gene locus_tag LOCUS_45290 5013491 5014009 CDS product DUF6099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030573.1 protein_id gnl|my_center|LOCUS_45290 5014103 5015035 gene locus_tag LOCUS_45300 5014103 5015035 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973051.1 protein_id gnl|my_center|LOCUS_45300 5015095 5016042 gene locus_tag LOCUS_45310 gene mmuM 5015095 5016042 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030679.1 protein_id gnl|my_center|LOCUS_45310 5016500 5016264 gene locus_tag LOCUS_45320 5016500 5016264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 5016703 5016500 gene locus_tag LOCUS_45330 5016703 5016500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 5016874 5017608 gene locus_tag LOCUS_45340 5016874 5017608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 5017619 5018293 gene locus_tag LOCUS_45350 5017619 5018293 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199889868.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45350 5018339 5018470 gene locus_tag LOCUS_45360 5018339 5018470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 5018490 5018798 gene locus_tag LOCUS_45370 5018490 5018798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 5018776 5020041 gene locus_tag LOCUS_45380 5018776 5020041 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973047.1 protein_id gnl|my_center|LOCUS_45380 5020197 5021213 gene locus_tag LOCUS_45390 gene argF 5020197 5021213 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030578.1 protein_id gnl|my_center|LOCUS_45390 5021679 5021215 gene locus_tag LOCUS_45400 5021679 5021215 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973043.1 protein_id gnl|my_center|LOCUS_45400 5022656 5022102 gene locus_tag LOCUS_45410 5022656 5022102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 5023528 5022710 gene locus_tag LOCUS_45420 5023528 5022710 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030580.1 protein_id gnl|my_center|LOCUS_45420 5023514 5023918 gene locus_tag LOCUS_45430 5023514 5023918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 5024038 5026938 gene locus_tag LOCUS_45440 5024038 5026938 CDS product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031336.1 protein_id gnl|my_center|LOCUS_45440 5026935 5027546 gene locus_tag LOCUS_45450 5026935 5027546 CDS product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972191.1 protein_id gnl|my_center|LOCUS_45450 5027543 5029192 gene locus_tag LOCUS_45460 5027543 5029192 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031337.1 protein_id gnl|my_center|LOCUS_45460 5029189 5029818 gene locus_tag LOCUS_45470 5029189 5029818 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972189.1 protein_id gnl|my_center|LOCUS_45470 5029815 5030129 gene locus_tag LOCUS_45480 5029815 5030129 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972188.1 protein_id gnl|my_center|LOCUS_45480 5030126 5030479 gene locus_tag LOCUS_45490 gene mnhG 5030126 5030479 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031338.1 protein_id gnl|my_center|LOCUS_45490 5031700 5030498 gene locus_tag LOCUS_45500 5031700 5030498 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_45500 5032413 5031697 gene locus_tag LOCUS_45510 5032413 5031697 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230191.1 protein_id gnl|my_center|LOCUS_45510 5033654 5032410 gene locus_tag LOCUS_45520 5033654 5032410 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306837.1 protein_id gnl|my_center|LOCUS_45520 5034239 5033658 gene locus_tag LOCUS_45530 5034239 5033658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230193.1 protein_id gnl|my_center|LOCUS_45530 5034417 5035070 gene locus_tag LOCUS_45540 5034417 5035070 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230194.1 protein_id gnl|my_center|LOCUS_45540 5035082 5036245 gene locus_tag LOCUS_45550 5035082 5036245 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230195.1 protein_id gnl|my_center|LOCUS_45550 5038449 5036284 gene locus_tag LOCUS_45560 5038449 5036284 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230927.1 protein_id gnl|my_center|LOCUS_45560 5038536 5040377 gene locus_tag LOCUS_45570 5038536 5040377 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140584.1 protein_id gnl|my_center|LOCUS_45570 5041644 5040415 gene locus_tag LOCUS_45580 5041644 5040415 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405098.1 protein_id gnl|my_center|LOCUS_45580 5041795 5041649 gene locus_tag LOCUS_45590 5041795 5041649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 5042078 5042845 gene locus_tag LOCUS_45600 5042078 5042845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 5042984 5043703 gene locus_tag LOCUS_45610 5042984 5043703 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803937.1 protein_id gnl|my_center|LOCUS_45610 5044118 5043672 gene locus_tag LOCUS_45620 5044118 5043672 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930108.1 protein_id gnl|my_center|LOCUS_45620 5044314 5045534 gene locus_tag LOCUS_45630 5044314 5045534 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139561.1 protein_id gnl|my_center|LOCUS_45630 5045531 5047213 gene locus_tag LOCUS_45640 5045531 5047213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 5047210 5048454 gene locus_tag LOCUS_45650 5047210 5048454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 5049886 5048423 gene locus_tag LOCUS_45660 5049886 5048423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 5049996 5051156 gene locus_tag LOCUS_45670 5049996 5051156 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730916.1 protein_id gnl|my_center|LOCUS_45670 5051985 5051158 gene locus_tag LOCUS_45680 5051985 5051158 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_45680 5052701 5051982 gene locus_tag LOCUS_45690 5052701 5051982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 5054908 5052701 gene locus_tag LOCUS_45700 5054908 5052701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 5055516 5054953 gene locus_tag LOCUS_45710 5055516 5054953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45710 5056526 5055513 gene locus_tag LOCUS_45720 gene gmd 5056526 5055513 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407639.1 protein_id gnl|my_center|LOCUS_45720 5056674 5057621 gene locus_tag LOCUS_45730 5056674 5057621 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868775.1 protein_id gnl|my_center|LOCUS_45730 5059026 5057674 gene locus_tag LOCUS_45740 5059026 5057674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 5060661 5059471 gene locus_tag LOCUS_45750 5060661 5059471 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028534.1 protein_id gnl|my_center|LOCUS_45750 5062089 5060773 gene locus_tag LOCUS_45760 5062089 5060773 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728434.1 protein_id gnl|my_center|LOCUS_45760 5062252 5062734 gene locus_tag LOCUS_45770 5062252 5062734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 5062754 5063614 gene locus_tag LOCUS_45780 5062754 5063614 CDS product tyrosinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976100.1 protein_id gnl|my_center|LOCUS_45780 5064010 5063693 gene locus_tag LOCUS_45790 gene chpF 5064010 5063693 CDS product chaplin ChpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028524.1 protein_id gnl|my_center|LOCUS_45790 5065275 5064127 gene locus_tag LOCUS_45800 5065275 5064127 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028533.1 protein_id gnl|my_center|LOCUS_45800 5065943 5065275 gene locus_tag LOCUS_45810 5065943 5065275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 5067120 5065999 gene locus_tag LOCUS_45820 5067120 5065999 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028531.1 protein_id gnl|my_center|LOCUS_45820 5067935 5067117 gene locus_tag LOCUS_45830 5067935 5067117 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976090.1 protein_id gnl|my_center|LOCUS_45830 5069676 5067925 gene locus_tag LOCUS_45840 5069676 5067925 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866257.1 protein_id gnl|my_center|LOCUS_45840 5071058 5069673 gene locus_tag LOCUS_45850 5071058 5069673 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028529.1 protein_id gnl|my_center|LOCUS_45850 5072560 5071061 gene locus_tag LOCUS_45860 5072560 5071061 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028528.1 protein_id gnl|my_center|LOCUS_45860 5073732 5072557 gene locus_tag LOCUS_45870 5073732 5072557 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028527.1 protein_id gnl|my_center|LOCUS_45870 5074346 5074606 gene locus_tag LOCUS_45880 5074346 5074606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 5074937 5074734 gene locus_tag LOCUS_45890 5074937 5074734 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975194.1 protein_id gnl|my_center|LOCUS_45890 5076405 5075320 gene locus_tag LOCUS_45900 5076405 5075320 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785424.1 protein_id gnl|my_center|LOCUS_45900 5079732 5076574 gene locus_tag LOCUS_45910 5079732 5076574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 5080967 5079981 gene locus_tag LOCUS_45920 5080967 5079981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 5081710 5081081 gene locus_tag LOCUS_45930 5081710 5081081 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973087.1 protein_id gnl|my_center|LOCUS_45930 5082977 5081871 gene locus_tag LOCUS_45940 5082977 5081871 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226261.1 protein_id gnl|my_center|LOCUS_45940 5083671 5083108 gene locus_tag LOCUS_45950 5083671 5083108 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226262.1 protein_id gnl|my_center|LOCUS_45950 5084321 5083899 gene locus_tag LOCUS_45960 5084321 5083899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 5084316 5084867 gene locus_tag LOCUS_45970 5084316 5084867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 5085281 5085532 gene locus_tag LOCUS_45980 5085281 5085532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 5086711 5085437 gene locus_tag LOCUS_45990 5086711 5085437 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389104.1 protein_id gnl|my_center|LOCUS_45990 5087550 5087287 gene locus_tag LOCUS_46000 5087550 5087287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46000 5088109 5087819 gene locus_tag LOCUS_46010 5088109 5087819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 5088479 5088084 gene locus_tag LOCUS_46020 5088479 5088084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 5089006 5089746 gene locus_tag LOCUS_46030 5089006 5089746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46030 5090023 5091003 gene locus_tag LOCUS_46040 5090023 5091003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 5091021 5095502 gene locus_tag LOCUS_46050 5091021 5095502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 5096119 5095559 gene locus_tag LOCUS_46060 5096119 5095559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 5097268 5096324 gene locus_tag LOCUS_46070 5097268 5096324 CDS product transposase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169801917.1 protein_id gnl|my_center|LOCUS_46070 5098268 5097717 gene locus_tag LOCUS_46080 gene calD 5098268 5097717 CDS product calcium binding protein CalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974571.1 protein_id gnl|my_center|LOCUS_46080 5099293 5098541 gene locus_tag LOCUS_46090 5099293 5098541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 5100720 5099290 gene locus_tag LOCUS_46100 5100720 5099290 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031941.1 protein_id gnl|my_center|LOCUS_46100 5101528 5100917 gene locus_tag LOCUS_46110 5101528 5100917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 5104510 5101940 gene locus_tag LOCUS_46120 5104510 5101940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 5105199 5104507 gene locus_tag LOCUS_46130 5105199 5104507 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265944.1 protein_id gnl|my_center|LOCUS_46130 5105569 5105201 gene locus_tag LOCUS_46140 5105569 5105201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 5107871 5106342 gene locus_tag LOCUS_46150 5107871 5106342 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972925.1 protein_id gnl|my_center|LOCUS_46150 5108545 5108126 gene locus_tag LOCUS_46160 5108545 5108126 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974546.1 protein_id gnl|my_center|LOCUS_46160 5109826 5108624 gene locus_tag LOCUS_46170 5109826 5108624 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889604.1 protein_id gnl|my_center|LOCUS_46170 5109855 5110655 gene locus_tag LOCUS_46180 5109855 5110655 CDS product TioE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230388.1 protein_id gnl|my_center|LOCUS_46180 5111319 5110834 gene locus_tag LOCUS_46190 5111319 5110834 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729049.1 protein_id gnl|my_center|LOCUS_46190 5111742 5114576 gene locus_tag LOCUS_46200 gene acnA 5111742 5114576 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_46200 5115799 5115194 gene locus_tag LOCUS_46210 5115799 5115194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 5115758 5116099 gene locus_tag LOCUS_46220 5115758 5116099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 5116464 5116039 gene locus_tag LOCUS_46230 5116464 5116039 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229515.1 protein_id gnl|my_center|LOCUS_46230 5116551 5117162 gene locus_tag LOCUS_46240 5116551 5117162 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230929.1 protein_id gnl|my_center|LOCUS_46240 5118148 5117300 gene locus_tag LOCUS_46250 5118148 5117300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 5118147 5118773 gene locus_tag LOCUS_46260 5118147 5118773 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972709.1 protein_id gnl|my_center|LOCUS_46260 5119496 5118852 gene locus_tag LOCUS_46270 5119496 5118852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 5120166 5119549 gene locus_tag LOCUS_46280 5120166 5119549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 5124266 5120397 gene locus_tag LOCUS_46290 5124266 5120397 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226484.1 protein_id gnl|my_center|LOCUS_46290 5124799 5126253 gene locus_tag LOCUS_46300 gene ngcE 5124799 5126253 CDS product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776381.1 protein_id gnl|my_center|LOCUS_46300 5126390 5127313 gene locus_tag LOCUS_46310 5126390 5127313 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776380.1 protein_id gnl|my_center|LOCUS_46310 5127326 5128267 gene locus_tag LOCUS_46320 5127326 5128267 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_46320 5128453 5129652 gene locus_tag LOCUS_46330 5128453 5129652 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 protein_id gnl|my_center|LOCUS_46330 5129773 5130885 gene locus_tag LOCUS_46340 5129773 5130885 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972913.1 protein_id gnl|my_center|LOCUS_46340 5131177 5131956 gene locus_tag LOCUS_46350 5131177 5131956 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972912.1 protein_id gnl|my_center|LOCUS_46350 5131953 5133242 gene locus_tag LOCUS_46360 5131953 5133242 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972911.1 protein_id gnl|my_center|LOCUS_46360 5133447 5135375 gene locus_tag LOCUS_46370 gene dxs 5133447 5135375 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972908.1 protein_id gnl|my_center|LOCUS_46370 5135639 5137129 gene locus_tag LOCUS_46380 5135639 5137129 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972907.1 protein_id gnl|my_center|LOCUS_46380 5137553 5137122 gene locus_tag LOCUS_46390 5137553 5137122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030597.1 protein_id gnl|my_center|LOCUS_46390 5138693 5137593 gene locus_tag LOCUS_46400 5138693 5137593 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972903.1 protein_id gnl|my_center|LOCUS_46400 5139017 5140150 gene locus_tag LOCUS_46410 5139017 5140150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972904.1 protein_id gnl|my_center|LOCUS_46410 5140469 5142097 gene locus_tag LOCUS_46420 5140469 5142097 CDS product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030599.1 protein_id gnl|my_center|LOCUS_46420 5142113 5143723 gene locus_tag LOCUS_46430 5142113 5143723 CDS product exopolysaccharide phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972901.1 protein_id gnl|my_center|LOCUS_46430 5143816 5145483 gene locus_tag LOCUS_46440 5143816 5145483 CDS product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030600.1 protein_id gnl|my_center|LOCUS_46440 5145480 5147576 gene locus_tag LOCUS_46450 5145480 5147576 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972899.1 protein_id gnl|my_center|LOCUS_46450 5147664 5148989 gene locus_tag LOCUS_46460 5147664 5148989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 5151185 5149056 gene locus_tag LOCUS_46470 5151185 5149056 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030602.1 protein_id gnl|my_center|LOCUS_46470 5152402 5151182 gene locus_tag LOCUS_46480 5152402 5151182 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030603.1 protein_id gnl|my_center|LOCUS_46480 5153994 5152720 gene locus_tag LOCUS_46490 5153994 5152720 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_46490 5154776 5154114 gene locus_tag LOCUS_46500 5154776 5154114 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972894.1 protein_id gnl|my_center|LOCUS_46500 5155710 5154985 gene locus_tag LOCUS_46510 5155710 5154985 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030605.1 protein_id gnl|my_center|LOCUS_46510 5155745 5156818 gene locus_tag LOCUS_46520 gene hemE 5155745 5156818 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_46520 5158229 5156847 gene locus_tag LOCUS_46530 5158229 5156847 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030612.1 protein_id gnl|my_center|LOCUS_46530 5159327 5158311 gene locus_tag LOCUS_46540 5159327 5158311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 5159453 5160952 gene locus_tag LOCUS_46550 gene hemG 5159453 5160952 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_46550 5160957 5161685 gene locus_tag LOCUS_46560 5160957 5161685 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 protein_id gnl|my_center|LOCUS_46560 5163289 5161718 gene locus_tag LOCUS_46570 5163289 5161718 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485448.1 protein_id gnl|my_center|LOCUS_46570 5163174 5163380 gene locus_tag LOCUS_46580 5163174 5163380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 5164219 5163425 gene locus_tag LOCUS_46590 5164219 5163425 CDS product TIGR04222 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972877.1 protein_id gnl|my_center|LOCUS_46590 5165373 5164324 gene locus_tag LOCUS_46600 5165373 5164324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 5166679 5165378 gene locus_tag LOCUS_46610 5166679 5165378 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030615.1 protein_id gnl|my_center|LOCUS_46610 5167547 5166831 gene locus_tag LOCUS_46620 5167547 5166831 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030616.1 protein_id gnl|my_center|LOCUS_46620 5167610 5168296 gene locus_tag LOCUS_46630 5167610 5168296 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971849.1 protein_id gnl|my_center|LOCUS_46630 5168293 5168469 gene locus_tag LOCUS_46640 5168293 5168469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 5169389 5168511 gene locus_tag LOCUS_46650 5169389 5168511 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030618.1 protein_id gnl|my_center|LOCUS_46650 5170667 5169492 gene locus_tag LOCUS_46660 5170667 5169492 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030620.1 protein_id gnl|my_center|LOCUS_46660 5170551 5170856 gene locus_tag LOCUS_46670 5170551 5170856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 5171433 5171008 gene locus_tag LOCUS_46680 5171433 5171008 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972448.1 protein_id gnl|my_center|LOCUS_46680 5172614 5171520 gene locus_tag LOCUS_46690 gene zapE 5172614 5171520 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485435.1 protein_id gnl|my_center|LOCUS_46690 5172652 5173503 gene locus_tag LOCUS_46700 5172652 5173503 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030623.1 protein_id gnl|my_center|LOCUS_46700 5173649 5174101 gene locus_tag LOCUS_46710 5173649 5174101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972862.1 protein_id gnl|my_center|LOCUS_46710 5174144 5175538 gene locus_tag LOCUS_46720 gene murC 5174144 5175538 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030625.1 protein_id gnl|my_center|LOCUS_46720 5175549 5175956 gene locus_tag LOCUS_46730 gene msrB 5175549 5175956 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972860.1 protein_id gnl|my_center|LOCUS_46730 5176465 5176004 gene locus_tag LOCUS_46740 5176465 5176004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 5179008 5176597 gene locus_tag LOCUS_46750 5179008 5176597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 5179374 5179129 gene locus_tag LOCUS_46760 5179374 5179129 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030757.1 protein_id gnl|my_center|LOCUS_46760 5180222 5179371 gene locus_tag LOCUS_46770 5180222 5179371 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226025318.1 protein_id gnl|my_center|LOCUS_46770 5181086 5180361 gene locus_tag LOCUS_46780 5181086 5180361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 5181572 5182036 gene locus_tag LOCUS_46790 5181572 5182036 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030759.1 protein_id gnl|my_center|LOCUS_46790 5182758 5182348 gene locus_tag LOCUS_46800 5182758 5182348 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110060.1 protein_id gnl|my_center|LOCUS_46800 5183198 5182797 gene locus_tag LOCUS_46810 5183198 5182797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 5183562 5184590 gene locus_tag LOCUS_46820 gene tdh 5183562 5184590 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031190.1 protein_id gnl|my_center|LOCUS_46820 5184665 5185858 gene locus_tag LOCUS_46830 5184665 5185858 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_46830 5185926 5186891 gene locus_tag LOCUS_46840 5185926 5186891 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972197.1 protein_id gnl|my_center|LOCUS_46840 5187297 5186908 gene locus_tag LOCUS_46850 5187297 5186908 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031553.1 protein_id gnl|my_center|LOCUS_46850 5187335 5188021 gene locus_tag LOCUS_46860 5187335 5188021 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230842.1 protein_id gnl|my_center|LOCUS_46860 5190008 5188248 gene locus_tag LOCUS_46870 gene treZ 5190008 5188248 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030636.1 protein_id gnl|my_center|LOCUS_46870 5191075 5190164 gene locus_tag LOCUS_46880 5191075 5190164 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230336.1 protein_id gnl|my_center|LOCUS_46880 5191059 5191229 gene locus_tag LOCUS_46890 5191059 5191229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 5191362 5191928 gene locus_tag LOCUS_46900 5191362 5191928 CDS product DUF1707 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030637.1 protein_id gnl|my_center|LOCUS_46900 5192188 5193285 gene locus_tag LOCUS_46910 5192188 5193285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 5195683 5193188 gene locus_tag LOCUS_46920 gene treY 5195683 5193188 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030639.1 protein_id gnl|my_center|LOCUS_46920 5197880 5195718 gene locus_tag LOCUS_46930 gene glgX 5197880 5195718 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030640.1 protein_id gnl|my_center|LOCUS_46930 5198325 5199461 gene locus_tag LOCUS_46940 5198325 5199461 CDS product SAV2148 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030641.1 protein_id gnl|my_center|LOCUS_46940 5199559 5200287 gene locus_tag LOCUS_46950 5199559 5200287 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030642.1 protein_id gnl|my_center|LOCUS_46950 5201304 5200363 gene locus_tag LOCUS_46960 5201304 5200363 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030643.1 protein_id gnl|my_center|LOCUS_46960 5201371 5202318 gene locus_tag LOCUS_46970 5201371 5202318 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030644.1 protein_id gnl|my_center|LOCUS_46970 5202315 5203154 gene locus_tag LOCUS_46980 5202315 5203154 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030645.1 protein_id gnl|my_center|LOCUS_46980 5203154 5204449 gene locus_tag LOCUS_46990 5203154 5204449 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030646.1 protein_id gnl|my_center|LOCUS_46990 5204515 5205714 gene locus_tag LOCUS_47000 gene mgt 5204515 5205714 CDS product macrolide-inactivating glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972830.1 protein_id gnl|my_center|LOCUS_47000 5205843 5206226 gene locus_tag LOCUS_47010 5205843 5206226 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036200.1 protein_id gnl|my_center|LOCUS_47010 5207008 5206250 gene locus_tag LOCUS_47020 5207008 5206250 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030650.1 protein_id gnl|my_center|LOCUS_47020 5207894 5207016 gene locus_tag LOCUS_47030 5207894 5207016 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030651.1 protein_id gnl|my_center|LOCUS_47030 5208672 5207881 gene locus_tag LOCUS_47040 5208672 5207881 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972825.1 protein_id gnl|my_center|LOCUS_47040 5209841 5208726 gene locus_tag LOCUS_47050 5209841 5208726 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_47050 5211428 5210076 gene locus_tag LOCUS_47060 5211428 5210076 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972823.1 protein_id gnl|my_center|LOCUS_47060 5212365 5211430 gene locus_tag LOCUS_47070 gene cysD 5212365 5211430 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972822.1 protein_id gnl|my_center|LOCUS_47070 5212907 5212362 gene locus_tag LOCUS_47080 gene cysC 5212907 5212362 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164276380.1 protein_id gnl|my_center|LOCUS_47080 5213647 5212931 gene locus_tag LOCUS_47090 5213647 5212931 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_47090 5213823 5213644 gene locus_tag LOCUS_47100 5213823 5213644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972819.1 protein_id gnl|my_center|LOCUS_47100 5215517 5213820 gene locus_tag LOCUS_47110 gene sirA 5215517 5213820 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 protein_id gnl|my_center|LOCUS_47110 5216430 5215837 gene locus_tag LOCUS_47120 5216430 5215837 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_47120 5217759 5216521 gene locus_tag LOCUS_47130 5217759 5216521 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015602777.1 protein_id gnl|my_center|LOCUS_47130 5219092 5217881 gene locus_tag LOCUS_47140 5219092 5217881 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972815.1 protein_id gnl|my_center|LOCUS_47140 5221006 5219369 gene locus_tag LOCUS_47150 5221006 5219369 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030655.1 protein_id gnl|my_center|LOCUS_47150 5221024 5222169 gene locus_tag LOCUS_47160 5221024 5222169 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972813.1 protein_id gnl|my_center|LOCUS_47160 5223845 5222307 gene locus_tag LOCUS_47170 5223845 5222307 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230649.1 protein_id gnl|my_center|LOCUS_47170 5224659 5223880 gene locus_tag LOCUS_47180 5224659 5223880 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035619.1 protein_id gnl|my_center|LOCUS_47180 5225678 5224704 gene locus_tag LOCUS_47190 5225678 5224704 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768681.1 protein_id gnl|my_center|LOCUS_47190 5225843 5226766 gene locus_tag LOCUS_47200 5225843 5226766 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_47200 5226864 5228087 gene locus_tag LOCUS_47210 5226864 5228087 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877333.1 protein_id gnl|my_center|LOCUS_47210 5229027 5228242 gene locus_tag LOCUS_47220 5229027 5228242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 5229272 5229559 gene locus_tag LOCUS_47230 5229272 5229559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 5229777 5230109 gene locus_tag LOCUS_47240 5229777 5230109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 5230297 5230647 gene locus_tag LOCUS_47250 5230297 5230647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 5230965 5231165 gene locus_tag LOCUS_47260 5230965 5231165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 5231562 5232752 gene locus_tag LOCUS_47270 gene rsgA 5231562 5232752 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030687.1 protein_id gnl|my_center|LOCUS_47270 5232825 5234282 gene locus_tag LOCUS_47280 5232825 5234282 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030688.1 protein_id gnl|my_center|LOCUS_47280 5234673 5234191 gene locus_tag LOCUS_47290 5234673 5234191 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030690.1 protein_id gnl|my_center|LOCUS_47290 5235755 5234766 gene locus_tag LOCUS_47300 5235755 5234766 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030691.1 protein_id gnl|my_center|LOCUS_47300 5235663 5236076 gene locus_tag LOCUS_47310 5235663 5236076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 5236164 5237675 gene locus_tag LOCUS_47320 5236164 5237675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47320 5237741 5239483 gene locus_tag LOCUS_47330 5237741 5239483 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030693.1 protein_id gnl|my_center|LOCUS_47330 5239636 5240064 gene locus_tag LOCUS_47340 5239636 5240064 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865215.1 protein_id gnl|my_center|LOCUS_47340 5241215 5240109 gene locus_tag LOCUS_47350 5241215 5240109 CDS product DUF2637 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030695.1 protein_id gnl|my_center|LOCUS_47350 5242256 5241408 gene locus_tag LOCUS_47360 5242256 5241408 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030696.1 protein_id gnl|my_center|LOCUS_47360 5242402 5243160 gene locus_tag LOCUS_47370 5242402 5243160 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030697.1 protein_id gnl|my_center|LOCUS_47370 5244015 5243170 gene locus_tag LOCUS_47380 5244015 5243170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972756.1 protein_id gnl|my_center|LOCUS_47380 5245886 5244147 gene locus_tag LOCUS_47390 5245886 5244147 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030705.1 protein_id gnl|my_center|LOCUS_47390 5246159 5247049 gene locus_tag LOCUS_47400 5246159 5247049 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030706.1 protein_id gnl|my_center|LOCUS_47400 5247052 5247645 gene locus_tag LOCUS_47410 5247052 5247645 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030707.1 protein_id gnl|my_center|LOCUS_47410 5247651 5250068 gene locus_tag LOCUS_47420 5247651 5250068 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030708.1 protein_id gnl|my_center|LOCUS_47420 5250316 5251773 gene locus_tag LOCUS_47430 5250316 5251773 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030709.1 protein_id gnl|my_center|LOCUS_47430 5251812 5252951 gene locus_tag LOCUS_47440 5251812 5252951 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030710.1 protein_id gnl|my_center|LOCUS_47440 5253030 5253707 gene locus_tag LOCUS_47450 5253030 5253707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028451.1 protein_id gnl|my_center|LOCUS_47450 5254080 5254313 gene locus_tag LOCUS_47460 5254080 5254313 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559546.1 protein_id gnl|my_center|LOCUS_47460 5254310 5255578 gene locus_tag LOCUS_47470 5254310 5255578 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043779541.1 protein_id gnl|my_center|LOCUS_47470 5255575 5255784 gene locus_tag LOCUS_47480 5255575 5255784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 5258190 5255794 gene locus_tag LOCUS_47490 5258190 5255794 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230662.1 protein_id gnl|my_center|LOCUS_47490 5258360 5259868 gene locus_tag LOCUS_47500 5258360 5259868 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224038.1 protein_id gnl|my_center|LOCUS_47500 5259865 5260902 gene locus_tag LOCUS_47510 5259865 5260902 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978084.1 protein_id gnl|my_center|LOCUS_47510 5260987 5262114 gene locus_tag LOCUS_47520 5260987 5262114 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030728.1 protein_id gnl|my_center|LOCUS_47520 5262392 5262162 gene locus_tag LOCUS_47530 5262392 5262162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 5263192 5262488 gene locus_tag LOCUS_47540 5263192 5262488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030736.1 protein_id gnl|my_center|LOCUS_47540 5263420 5265195 gene locus_tag LOCUS_47550 gene gcl 5263420 5265195 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030737.1 protein_id gnl|my_center|LOCUS_47550 5267042 5265585 gene locus_tag LOCUS_47560 5267042 5265585 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972723.1 protein_id gnl|my_center|LOCUS_47560 5268125 5267232 gene locus_tag LOCUS_47570 5268125 5267232 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972722.1 protein_id gnl|my_center|LOCUS_47570 5269013 5268174 gene locus_tag LOCUS_47580 5269013 5268174 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972721.1 protein_id gnl|my_center|LOCUS_47580 5269238 5270404 gene locus_tag LOCUS_47590 5269238 5270404 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668699.1 protein_id gnl|my_center|LOCUS_47590 5270508 5270759 gene locus_tag LOCUS_47600 5270508 5270759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063646595.1 protein_id gnl|my_center|LOCUS_47600 5270756 5271130 gene locus_tag LOCUS_47610 5270756 5271130 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972719.1 protein_id gnl|my_center|LOCUS_47610 5271289 5271801 gene locus_tag LOCUS_47620 gene uraD 5271289 5271801 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030740.1 protein_id gnl|my_center|LOCUS_47620 5271801 5272208 gene locus_tag LOCUS_47630 gene uraH 5271801 5272208 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030741.1 protein_id gnl|my_center|LOCUS_47630 5272215 5273138 gene locus_tag LOCUS_47640 gene pucL 5272215 5273138 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972716.1 protein_id gnl|my_center|LOCUS_47640 5273266 5274597 gene locus_tag LOCUS_47650 5273266 5274597 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972715.1 protein_id gnl|my_center|LOCUS_47650 5274643 5276034 gene locus_tag LOCUS_47660 5274643 5276034 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030742.1 protein_id gnl|my_center|LOCUS_47660 5276288 5277706 gene locus_tag LOCUS_47670 5276288 5277706 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972712.1 protein_id gnl|my_center|LOCUS_47670 5278593 5277772 gene locus_tag LOCUS_47680 gene csnA 5278593 5277772 CDS product chitosanase CsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027289.1 protein_id gnl|my_center|LOCUS_47680 5279448 5278846 gene locus_tag LOCUS_47690 5279448 5278846 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028034.1 protein_id gnl|my_center|LOCUS_47690 5279596 5280573 gene locus_tag LOCUS_47700 5279596 5280573 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031414.1 protein_id gnl|my_center|LOCUS_47700 5282332 5280713 gene locus_tag LOCUS_47710 gene aceB 5282332 5280713 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030763.1 protein_id gnl|my_center|LOCUS_47710 5283171 5282590 gene locus_tag LOCUS_47720 5283171 5282590 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_47720 5283510 5283208 gene locus_tag LOCUS_47730 5283510 5283208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 5283400 5283717 gene locus_tag LOCUS_47740 5283400 5283717 CDS product DUF5955 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972682.1 protein_id gnl|my_center|LOCUS_47740 5284649 5283849 gene locus_tag LOCUS_47750 gene allR 5284649 5283849 CDS product allantoin degradation transcriptional regulator AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972681.1 protein_id gnl|my_center|LOCUS_47750 5284985 5286328 gene locus_tag LOCUS_47760 gene allB 5284985 5286328 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972680.1 protein_id gnl|my_center|LOCUS_47760 5286331 5287446 gene locus_tag LOCUS_47770 gene alc 5286331 5287446 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030765.1 protein_id gnl|my_center|LOCUS_47770 5287539 5287868 gene locus_tag LOCUS_47780 5287539 5287868 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948541.1 protein_id gnl|my_center|LOCUS_47780 5289050 5288094 gene locus_tag LOCUS_47790 5289050 5288094 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229733.1 protein_id gnl|my_center|LOCUS_47790 5289090 5289569 gene locus_tag LOCUS_47800 5289090 5289569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 5289733 5290662 gene locus_tag LOCUS_47810 5289733 5290662 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802593.1 protein_id gnl|my_center|LOCUS_47810 5291110 5290652 gene locus_tag LOCUS_47820 5291110 5290652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 5291088 5292218 gene locus_tag LOCUS_47830 5291088 5292218 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 protein_id gnl|my_center|LOCUS_47830 5292215 5292955 gene locus_tag LOCUS_47840 5292215 5292955 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_47840 5294107 5293076 gene locus_tag LOCUS_47850 5294107 5293076 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972671.1 protein_id gnl|my_center|LOCUS_47850 5294209 5294967 gene locus_tag LOCUS_47860 5294209 5294967 CDS product myo-inositol degradation transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030772.1 protein_id gnl|my_center|LOCUS_47860 5295194 5296174 gene locus_tag LOCUS_47870 5295194 5296174 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030773.1 protein_id gnl|my_center|LOCUS_47870 5296171 5297235 gene locus_tag LOCUS_47880 5296171 5297235 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972668.1 protein_id gnl|my_center|LOCUS_47880 5297232 5298044 gene locus_tag LOCUS_47890 5297232 5298044 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030774.1 protein_id gnl|my_center|LOCUS_47890 5298157 5299323 gene locus_tag LOCUS_47900 5298157 5299323 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_47900 5299379 5299975 gene locus_tag LOCUS_47910 5299379 5299975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972665.1 protein_id gnl|my_center|LOCUS_47910 5300797 5301138 gene locus_tag LOCUS_47920 5300797 5301138 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973104.1 protein_id gnl|my_center|LOCUS_47920 5301540 5301743 gene locus_tag LOCUS_47930 5301540 5301743 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973099.1 protein_id gnl|my_center|LOCUS_47930 5302059 5303129 gene locus_tag LOCUS_47940 5302059 5303129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 5303176 5303580 gene locus_tag LOCUS_47950 5303176 5303580 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030532.1 protein_id gnl|my_center|LOCUS_47950 5303636 5303947 gene locus_tag LOCUS_47960 5303636 5303947 CDS product SCO5918 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973102.1 protein_id gnl|my_center|LOCUS_47960 5305356 5304070 gene locus_tag LOCUS_47970 5305356 5304070 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079030578.1 protein_id gnl|my_center|LOCUS_47970 5306099 5305752 gene locus_tag LOCUS_47980 5306099 5305752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 5306325 5307392 gene locus_tag LOCUS_47990 5306325 5307392 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282703.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47990 5307711 5308277 gene locus_tag LOCUS_48000 5307711 5308277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 5308720 5308268 gene locus_tag LOCUS_48010 5308720 5308268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 5309114 5310970 gene locus_tag LOCUS_48020 5309114 5310970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 5311011 5311265 gene locus_tag LOCUS_48030 5311011 5311265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 5311262 5311696 gene locus_tag LOCUS_48040 5311262 5311696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 5311693 5313561 gene locus_tag LOCUS_48050 5311693 5313561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978119.1 protein_id gnl|my_center|LOCUS_48050 5313887 5314774 gene locus_tag LOCUS_48060 5313887 5314774 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027127.1 protein_id gnl|my_center|LOCUS_48060 5315252 5314872 gene locus_tag LOCUS_48070 5315252 5314872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 5315664 5315290 gene locus_tag LOCUS_48080 5315664 5315290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 5319161 5315877 gene locus_tag LOCUS_48090 5319161 5315877 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226639.1 protein_id gnl|my_center|LOCUS_48090 5319365 5320030 gene locus_tag LOCUS_48100 5319365 5320030 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976477.1 protein_id gnl|my_center|LOCUS_48100 5320071 5320667 gene locus_tag LOCUS_48110 5320071 5320667 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222096.1 protein_id gnl|my_center|LOCUS_48110 5320791 5321666 gene locus_tag LOCUS_48120 5320791 5321666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 5321741 5322511 gene locus_tag LOCUS_48130 5321741 5322511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 5322505 5322924 gene locus_tag LOCUS_48140 5322505 5322924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 5323129 5324337 gene locus_tag LOCUS_48150 5323129 5324337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 5324634 5324882 gene locus_tag LOCUS_48160 5324634 5324882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 5325025 5325510 gene locus_tag LOCUS_48170 5325025 5325510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 5325597 5327474 gene locus_tag LOCUS_48180 5325597 5327474 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 protein_id gnl|my_center|LOCUS_48180 5327514 5329280 gene locus_tag LOCUS_48190 5327514 5329280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 5329400 5329741 gene locus_tag LOCUS_48200 5329400 5329741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 5329805 5331727 gene locus_tag LOCUS_48210 5329805 5331727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 5331869 5332669 gene locus_tag LOCUS_48220 5331869 5332669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 5336613 5332900 gene locus_tag LOCUS_48230 5336613 5332900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 5336955 5337623 gene locus_tag LOCUS_48240 5336955 5337623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 5338340 5337708 gene locus_tag LOCUS_48250 5338340 5337708 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030052.1 protein_id gnl|my_center|LOCUS_48250 5339829 5338366 gene locus_tag LOCUS_48260 5339829 5338366 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029543.1 protein_id gnl|my_center|LOCUS_48260 5339963 5340559 gene locus_tag LOCUS_48270 5339963 5340559 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030053.1 protein_id gnl|my_center|LOCUS_48270 5340884 5340585 gene locus_tag LOCUS_48280 5340884 5340585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 5341615 5340797 gene locus_tag LOCUS_48290 5341615 5340797 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111640.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48290 5342060 5341842 gene locus_tag LOCUS_48300 5342060 5341842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 5342112 5342456 gene locus_tag LOCUS_48310 5342112 5342456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 5342813 5342568 gene locus_tag LOCUS_48320 5342813 5342568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 5343785 5343132 gene locus_tag LOCUS_48330 5343785 5343132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 5344897 5343827 gene locus_tag LOCUS_48340 5344897 5343827 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037683496.1 protein_id gnl|my_center|LOCUS_48340 5345474 5344932 gene locus_tag LOCUS_48350 5345474 5344932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 5345647 5345913 gene locus_tag LOCUS_48360 5345647 5345913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 5345906 5346403 gene locus_tag LOCUS_48370 5345906 5346403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 5348451 5346856 gene locus_tag LOCUS_48380 5348451 5346856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 5349687 5348455 gene locus_tag LOCUS_48390 5349687 5348455 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270060.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48390 5351210 5349723 gene locus_tag LOCUS_48400 5351210 5349723 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_48400 5351494 5352195 gene locus_tag LOCUS_48410 5351494 5352195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 5352511 5352849 gene locus_tag LOCUS_48420 5352511 5352849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 5352946 5354166 gene locus_tag LOCUS_48430 5352946 5354166 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030840.1 protein_id gnl|my_center|LOCUS_48430 5354179 5354826 gene locus_tag LOCUS_48440 5354179 5354826 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972584.1 protein_id gnl|my_center|LOCUS_48440 5354889 5355668 gene locus_tag LOCUS_48450 5354889 5355668 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030841.1 protein_id gnl|my_center|LOCUS_48450 5355703 5355909 gene locus_tag LOCUS_48460 5355703 5355909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 5356653 5355874 gene locus_tag LOCUS_48470 5356653 5355874 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976215.1 protein_id gnl|my_center|LOCUS_48470 5356965 5356756 gene locus_tag LOCUS_48480 5356965 5356756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064732467.1 protein_id gnl|my_center|LOCUS_48480 5357435 5357875 gene locus_tag LOCUS_48490 5357435 5357875 CDS product DUF6278 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972582.1 protein_id gnl|my_center|LOCUS_48490 5357998 5358741 gene locus_tag LOCUS_48500 5357998 5358741 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973246.1 protein_id gnl|my_center|LOCUS_48500 5358756 5359667 gene locus_tag LOCUS_48510 5358756 5359667 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224235.1 protein_id gnl|my_center|LOCUS_48510 5359684 5360328 gene locus_tag LOCUS_48520 5359684 5360328 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224234.1 protein_id gnl|my_center|LOCUS_48520 5360325 5361191 gene locus_tag LOCUS_48530 5360325 5361191 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224233.1 protein_id gnl|my_center|LOCUS_48530 5361687 5361935 gene locus_tag LOCUS_48540 5361687 5361935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 5362190 5363989 gene locus_tag LOCUS_48550 gene ggt 5362190 5363989 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030896.1 protein_id gnl|my_center|LOCUS_48550 5364095 5364229 gene locus_tag LOCUS_48560 5364095 5364229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 5365015 5364248 gene locus_tag LOCUS_48570 gene map 5365015 5364248 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972570.1 protein_id gnl|my_center|LOCUS_48570 5365057 5365377 gene locus_tag LOCUS_48580 5365057 5365377 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972569.1 protein_id gnl|my_center|LOCUS_48580 5365459 5365839 gene locus_tag LOCUS_48590 5365459 5365839 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080074.1 protein_id gnl|my_center|LOCUS_48590 5365976 5367337 gene locus_tag LOCUS_48600 5365976 5367337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 5367736 5368578 gene locus_tag LOCUS_48610 5367736 5368578 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972568.1 protein_id gnl|my_center|LOCUS_48610 5368575 5369858 gene locus_tag LOCUS_48620 5368575 5369858 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_48620 5370101 5371501 gene locus_tag LOCUS_48630 gene hydA 5370101 5371501 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_48630 5372647 5371562 gene locus_tag LOCUS_48640 5372647 5371562 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 protein_id gnl|my_center|LOCUS_48640 5374303 5372822 gene locus_tag LOCUS_48650 5374303 5372822 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167861.1 protein_id gnl|my_center|LOCUS_48650 5374947 5374300 gene locus_tag LOCUS_48660 5374947 5374300 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237178.1 protein_id gnl|my_center|LOCUS_48660 5374983 5375504 gene locus_tag LOCUS_48670 5374983 5375504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 5375599 5376963 gene locus_tag LOCUS_48680 5375599 5376963 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106243816.1 protein_id gnl|my_center|LOCUS_48680 5377018 5378376 gene locus_tag LOCUS_48690 5377018 5378376 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_48690 5379493 5378504 gene locus_tag LOCUS_48700 5379493 5378504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 5380579 5379656 gene locus_tag LOCUS_48710 5380579 5379656 CDS product tyrosinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976100.1 protein_id gnl|my_center|LOCUS_48710 5380958 5380611 gene locus_tag LOCUS_48720 5380958 5380611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 5382482 5381106 gene locus_tag LOCUS_48730 5382482 5381106 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106243816.1 protein_id gnl|my_center|LOCUS_48730 5383964 5382645 gene locus_tag LOCUS_48740 5383964 5382645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 5385559 5383961 gene locus_tag LOCUS_48750 5385559 5383961 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396014.1 protein_id gnl|my_center|LOCUS_48750 5385718 5386491 gene locus_tag LOCUS_48760 5385718 5386491 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 protein_id gnl|my_center|LOCUS_48760 5386512 5387618 gene locus_tag LOCUS_48770 5386512 5387618 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870761.1 protein_id gnl|my_center|LOCUS_48770 5387623 5387958 gene locus_tag LOCUS_48780 5387623 5387958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 5388101 5389207 gene locus_tag LOCUS_48790 5388101 5389207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 5389397 5390398 gene locus_tag LOCUS_48800 5389397 5390398 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030901.1 protein_id gnl|my_center|LOCUS_48800 5390687 5391163 gene locus_tag LOCUS_48810 5390687 5391163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 5391219 5391713 gene locus_tag LOCUS_48820 5391219 5391713 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230087.1 protein_id gnl|my_center|LOCUS_48820 5392357 5391683 gene locus_tag LOCUS_48830 gene cofC 5392357 5391683 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223625.1 protein_id gnl|my_center|LOCUS_48830 5392821 5392363 gene locus_tag LOCUS_48840 5392821 5392363 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030037.1 protein_id gnl|my_center|LOCUS_48840 5392828 5393196 gene locus_tag LOCUS_48850 5392828 5393196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 5394188 5393178 gene locus_tag LOCUS_48860 5394188 5393178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 5394364 5395629 gene locus_tag LOCUS_48870 5394364 5395629 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973891.1 protein_id gnl|my_center|LOCUS_48870 5395626 5396915 gene locus_tag LOCUS_48880 5395626 5396915 CDS product ketosynthase chain-length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030048.1 protein_id gnl|my_center|LOCUS_48880 5396988 5397245 gene locus_tag LOCUS_48890 5396988 5397245 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973889.1 protein_id gnl|my_center|LOCUS_48890 5397263 5398057 gene locus_tag LOCUS_48900 5397263 5398057 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973892.1 protein_id gnl|my_center|LOCUS_48900 5398218 5399099 gene locus_tag LOCUS_48910 5398218 5399099 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030049.1 protein_id gnl|my_center|LOCUS_48910 5399096 5400046 gene locus_tag LOCUS_48920 5399096 5400046 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030050.1 protein_id gnl|my_center|LOCUS_48920 5400039 5400782 gene locus_tag LOCUS_48930 5400039 5400782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 5401858 5400725 gene locus_tag LOCUS_48940 gene actVA 5401858 5400725 CDS product actinorhodin polyketide dimerase ActVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030043.1 protein_id gnl|my_center|LOCUS_48940 5402581 5401997 gene locus_tag LOCUS_48950 5402581 5401997 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226699.1 protein_id gnl|my_center|LOCUS_48950 5402731 5403195 gene locus_tag LOCUS_48960 5402731 5403195 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894385.1 protein_id gnl|my_center|LOCUS_48960 5403199 5404266 gene locus_tag LOCUS_48970 5403199 5404266 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929295.1 protein_id gnl|my_center|LOCUS_48970 5404812 5404354 gene locus_tag LOCUS_48980 5404812 5404354 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027616.1 protein_id gnl|my_center|LOCUS_48980 5405231 5404815 gene locus_tag LOCUS_48990 5405231 5404815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 5406307 5405228 gene locus_tag LOCUS_49000 5406307 5405228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 5407029 5406352 gene locus_tag LOCUS_49010 5407029 5406352 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931377.1 protein_id gnl|my_center|LOCUS_49010 5407946 5407026 gene locus_tag LOCUS_49020 5407946 5407026 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722579.1 protein_id gnl|my_center|LOCUS_49020 5408117 5409181 gene locus_tag LOCUS_49030 5408117 5409181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49030 5409989 5409258 gene locus_tag LOCUS_49040 5409989 5409258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 5410992 5410420 gene locus_tag LOCUS_49050 5410992 5410420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 5412703 5411174 gene locus_tag LOCUS_49060 5412703 5411174 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_49060 5412795 5413268 gene locus_tag LOCUS_49070 5412795 5413268 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230087.1 protein_id gnl|my_center|LOCUS_49070 5413999 5413352 gene locus_tag LOCUS_49080 5413999 5413352 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228649.1 protein_id gnl|my_center|LOCUS_49080 5414206 5415216 gene locus_tag LOCUS_49090 5414206 5415216 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067528888.1 protein_id gnl|my_center|LOCUS_49090 5415285 5415740 gene locus_tag LOCUS_49100 gene actVB 5415285 5415740 CDS product actinorhodin polyketide dimerase ActVB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973886.1 protein_id gnl|my_center|LOCUS_49100 5415864 5418086 gene locus_tag LOCUS_49110 5415864 5418086 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031369.1 protein_id gnl|my_center|LOCUS_49110 5418178 5418363 gene locus_tag LOCUS_49120 5418178 5418363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 5418764 5418270 gene locus_tag LOCUS_49130 5418764 5418270 CDS product lamin tail domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109036335.1 protein_id gnl|my_center|LOCUS_49130 5419267 5418893 gene locus_tag LOCUS_49140 5419267 5418893 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030937.1 protein_id gnl|my_center|LOCUS_49140 5419363 5421366 gene locus_tag LOCUS_49150 5419363 5421366 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030938.1 protein_id gnl|my_center|LOCUS_49150 5421658 5421407 gene locus_tag LOCUS_49160 5421658 5421407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 5422397 5421903 gene locus_tag LOCUS_49170 5422397 5421903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 5422798 5425224 gene locus_tag LOCUS_49180 5422798 5425224 CDS product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029885.1 protein_id gnl|my_center|LOCUS_49180 5425228 5425656 gene locus_tag LOCUS_49190 5425228 5425656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 5425653 5426318 gene locus_tag LOCUS_49200 5425653 5426318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029884.1 protein_id gnl|my_center|LOCUS_49200 5426633 5428468 gene locus_tag LOCUS_49210 5426633 5428468 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327729.1 protein_id gnl|my_center|LOCUS_49210 5428514 5429377 gene locus_tag LOCUS_49220 5428514 5429377 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972533.1 protein_id gnl|my_center|LOCUS_49220 5429455 5430870 gene locus_tag LOCUS_49230 5429455 5430870 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972529.1 protein_id gnl|my_center|LOCUS_49230 5430933 5432456 gene locus_tag LOCUS_49240 5430933 5432456 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972517.1 protein_id gnl|my_center|LOCUS_49240 5432467 5432985 gene locus_tag LOCUS_49250 5432467 5432985 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030939.1 protein_id gnl|my_center|LOCUS_49250 5433624 5433040 gene locus_tag LOCUS_49260 5433624 5433040 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028297.1 protein_id gnl|my_center|LOCUS_49260 5433961 5434374 gene locus_tag LOCUS_49270 5433961 5434374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004993226.1 protein_id gnl|my_center|LOCUS_49270 5434878 5434384 gene locus_tag LOCUS_49280 5434878 5434384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 5435009 5436127 gene locus_tag LOCUS_49290 5435009 5436127 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457344.1 protein_id gnl|my_center|LOCUS_49290 5436993 5436253 gene locus_tag LOCUS_49300 5436993 5436253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 5437290 5438087 gene locus_tag LOCUS_49310 5437290 5438087 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228790.1 protein_id gnl|my_center|LOCUS_49310 5438084 5438887 gene locus_tag LOCUS_49320 5438084 5438887 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978153.1 protein_id gnl|my_center|LOCUS_49320 5438884 5439774 gene locus_tag LOCUS_49330 5438884 5439774 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027308.1 protein_id gnl|my_center|LOCUS_49330 5439767 5440894 gene locus_tag LOCUS_49340 5439767 5440894 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027307.1 protein_id gnl|my_center|LOCUS_49340 5440891 5442141 gene locus_tag LOCUS_49350 5440891 5442141 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978156.1 protein_id gnl|my_center|LOCUS_49350 5443308 5442454 gene locus_tag LOCUS_49360 gene pssA 5443308 5442454 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972511.1 protein_id gnl|my_center|LOCUS_49360 5443942 5443295 gene locus_tag LOCUS_49370 5443942 5443295 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972510.1 protein_id gnl|my_center|LOCUS_49370 5445328 5444123 gene locus_tag LOCUS_49380 5445328 5444123 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030944.1 protein_id gnl|my_center|LOCUS_49380 5445859 5445356 gene locus_tag LOCUS_49390 5445859 5445356 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030945.1 protein_id gnl|my_center|LOCUS_49390 5446827 5445862 gene locus_tag LOCUS_49400 5446827 5445862 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_49400 5448803 5446824 gene locus_tag LOCUS_49410 5448803 5446824 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030947.1 protein_id gnl|my_center|LOCUS_49410 5450175 5448838 gene locus_tag LOCUS_49420 gene ccrA 5450175 5448838 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283587.1 protein_id gnl|my_center|LOCUS_49420 5451323 5450532 gene locus_tag LOCUS_49430 5451323 5450532 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122195341.1 protein_id gnl|my_center|LOCUS_49430 5451463 5452224 gene locus_tag LOCUS_49440 5451463 5452224 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031675.1 protein_id gnl|my_center|LOCUS_49440 5453050 5452235 gene locus_tag LOCUS_49450 5453050 5452235 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972504.1 protein_id gnl|my_center|LOCUS_49450 5454923 5453142 gene locus_tag LOCUS_49460 5454923 5453142 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030948.1 protein_id gnl|my_center|LOCUS_49460 5455273 5455872 gene locus_tag LOCUS_49470 5455273 5455872 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030949.1 protein_id gnl|my_center|LOCUS_49470 5457502 5455901 gene locus_tag LOCUS_49480 5457502 5455901 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030952.1 protein_id gnl|my_center|LOCUS_49480 5458731 5457676 gene locus_tag LOCUS_49490 5458731 5457676 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972497.1 protein_id gnl|my_center|LOCUS_49490 5458909 5459352 gene locus_tag LOCUS_49500 5458909 5459352 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972496.1 protein_id gnl|my_center|LOCUS_49500 5459538 5461976 gene locus_tag LOCUS_49510 5459538 5461976 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668834.1 protein_id gnl|my_center|LOCUS_49510 5462873 5461986 gene locus_tag LOCUS_49520 5462873 5461986 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971873.1 protein_id gnl|my_center|LOCUS_49520 5463000 5463992 gene locus_tag LOCUS_49530 gene mgrA 5463000 5463992 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031556.1 protein_id gnl|my_center|LOCUS_49530 5465090 5464002 gene locus_tag LOCUS_49540 5465090 5464002 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030090.1 protein_id gnl|my_center|LOCUS_49540 5465308 5468007 gene locus_tag LOCUS_49550 5465308 5468007 CDS product SpoIIE family protein phosphatase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009676.1 protein_id gnl|my_center|LOCUS_49550 5468186 5469019 gene locus_tag LOCUS_49560 5468186 5469019 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030957.1 protein_id gnl|my_center|LOCUS_49560 5469012 5470355 gene locus_tag LOCUS_49570 5469012 5470355 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030958.1 protein_id gnl|my_center|LOCUS_49570 5470376 5472394 gene locus_tag LOCUS_49580 5470376 5472394 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972490.1 protein_id gnl|my_center|LOCUS_49580 5472391 5473335 gene locus_tag LOCUS_49590 5472391 5473335 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863161.1 protein_id gnl|my_center|LOCUS_49590 5473505 5475280 gene locus_tag LOCUS_49600 5473505 5475280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_49600 5475489 5477543 gene locus_tag LOCUS_49610 5475489 5477543 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975145.1 protein_id gnl|my_center|LOCUS_49610 5480015 5477562 gene locus_tag LOCUS_49620 5480015 5477562 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108688.1 protein_id gnl|my_center|LOCUS_49620 5480683 5480261 gene locus_tag LOCUS_49630 5480683 5480261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 5481247 5480813 gene locus_tag LOCUS_49640 5481247 5480813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 5481801 5481343 gene locus_tag LOCUS_49650 5481801 5481343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 5482824 5481898 gene locus_tag LOCUS_49660 5482824 5481898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 5482955 5483971 gene locus_tag LOCUS_49670 5482955 5483971 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229227.1 protein_id gnl|my_center|LOCUS_49670 5484109 5484465 gene locus_tag LOCUS_49680 5484109 5484465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 5485695 5484865 gene locus_tag LOCUS_49690 5485695 5484865 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031538.1 protein_id gnl|my_center|LOCUS_49690 5485756 5486367 gene locus_tag LOCUS_49700 5485756 5486367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 5486866 5486507 gene locus_tag LOCUS_49710 5486866 5486507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972485.1 protein_id gnl|my_center|LOCUS_49710 5487711 5486920 gene locus_tag LOCUS_49720 5487711 5486920 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030973.1 protein_id gnl|my_center|LOCUS_49720 5489242 5487824 gene locus_tag LOCUS_49730 5489242 5487824 CDS product bifunctional phosphatase PAP2/diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030974.1 protein_id gnl|my_center|LOCUS_49730 5489558 5490331 gene locus_tag LOCUS_49740 5489558 5490331 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976366.1 protein_id gnl|my_center|LOCUS_49740 5490328 5491176 gene locus_tag LOCUS_49750 5490328 5491176 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028354.1 protein_id gnl|my_center|LOCUS_49750 5491388 5492614 gene locus_tag LOCUS_49760 5491388 5492614 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485736.1 protein_id gnl|my_center|LOCUS_49760 5492627 5493652 gene locus_tag LOCUS_49770 5492627 5493652 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030985.1 protein_id gnl|my_center|LOCUS_49770 5494293 5493646 gene locus_tag LOCUS_49780 5494293 5493646 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030986.1 protein_id gnl|my_center|LOCUS_49780 5495063 5494287 gene locus_tag LOCUS_49790 5495063 5494287 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972454.1 protein_id gnl|my_center|LOCUS_49790 5495261 5497354 gene locus_tag LOCUS_49800 5495261 5497354 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030989.1 protein_id gnl|my_center|LOCUS_49800 5497496 5497801 gene locus_tag LOCUS_49810 5497496 5497801 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972439.1 protein_id gnl|my_center|LOCUS_49810 5498801 5497839 gene locus_tag LOCUS_49820 5498801 5497839 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029804.1 protein_id gnl|my_center|LOCUS_49820 5498894 5499634 gene locus_tag LOCUS_49830 5498894 5499634 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972438.1 protein_id gnl|my_center|LOCUS_49830 5499827 5500759 gene locus_tag LOCUS_49840 5499827 5500759 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972431.1 protein_id gnl|my_center|LOCUS_49840 5501691 5500855 gene locus_tag LOCUS_49850 5501691 5500855 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031003.1 protein_id gnl|my_center|LOCUS_49850 5503596 5501773 gene locus_tag LOCUS_49860 5503596 5501773 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972428.1 protein_id gnl|my_center|LOCUS_49860 5504801 5503953 gene locus_tag LOCUS_49870 gene fdhD 5504801 5503953 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031006.1 protein_id gnl|my_center|LOCUS_49870 5505140 5506090 gene locus_tag LOCUS_49880 5505140 5506090 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031009.1 protein_id gnl|my_center|LOCUS_49880 5506431 5507612 gene locus_tag LOCUS_49890 5506431 5507612 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225823.1 protein_id gnl|my_center|LOCUS_49890 5507770 5509269 gene locus_tag LOCUS_49900 5507770 5509269 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972412.1 protein_id gnl|my_center|LOCUS_49900 5509266 5510318 gene locus_tag LOCUS_49910 5509266 5510318 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972411.1 protein_id gnl|my_center|LOCUS_49910 5510387 5511430 gene locus_tag LOCUS_49920 5510387 5511430 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972410.1 protein_id gnl|my_center|LOCUS_49920 5511502 5512734 gene locus_tag LOCUS_49930 5511502 5512734 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_49930 5512747 5513751 gene locus_tag LOCUS_49940 5512747 5513751 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972408.1 protein_id gnl|my_center|LOCUS_49940 5513997 5517719 gene locus_tag LOCUS_49950 5513997 5517719 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031012.1 protein_id gnl|my_center|LOCUS_49950 5517811 5518929 gene locus_tag LOCUS_49960 5517811 5518929 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031013.1 protein_id gnl|my_center|LOCUS_49960 5519181 5520290 gene locus_tag LOCUS_49970 5519181 5520290 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031014.1 protein_id gnl|my_center|LOCUS_49970 5520287 5521147 gene locus_tag LOCUS_49980 5520287 5521147 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031015.1 protein_id gnl|my_center|LOCUS_49980 5521503 5521856 gene locus_tag LOCUS_49990 5521503 5521856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 5521856 5522704 gene locus_tag LOCUS_50000 5521856 5522704 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031017.1 protein_id gnl|my_center|LOCUS_50000 5522709 5523884 gene locus_tag LOCUS_50010 gene eboE 5522709 5523884 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031018.1 protein_id gnl|my_center|LOCUS_50010 5523881 5525296 gene locus_tag LOCUS_50020 5523881 5525296 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_50020 5525332 5526351 gene locus_tag LOCUS_50030 5525332 5526351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 5526628 5526715 gene locus_tag LOCUS_t00680 5526628 5526715 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5528244 5526790 gene locus_tag LOCUS_50040 5528244 5526790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 5528491 5528339 gene locus_tag LOCUS_50050 5528491 5528339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50050 5532854 5528733 gene locus_tag LOCUS_50060 5532854 5528733 CDS product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052667156.1 protein_id gnl|my_center|LOCUS_50060 5534113 5532851 gene locus_tag LOCUS_50070 5534113 5532851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 5535672 5534110 gene locus_tag LOCUS_50080 5535672 5534110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 5536412 5535939 gene locus_tag LOCUS_50090 5536412 5535939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 5536723 5537553 gene locus_tag LOCUS_50100 5536723 5537553 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583414.1 protein_id gnl|my_center|LOCUS_50100 5537550 5538392 gene locus_tag LOCUS_50110 5537550 5538392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 5538415 5539182 gene locus_tag LOCUS_50120 5538415 5539182 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937416.1 protein_id gnl|my_center|LOCUS_50120 5539439 5540752 gene locus_tag LOCUS_50130 5539439 5540752 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031651.1 protein_id gnl|my_center|LOCUS_50130 5540749 5541990 gene locus_tag LOCUS_50140 5540749 5541990 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031650.1 protein_id gnl|my_center|LOCUS_50140 5542309 5543322 gene locus_tag LOCUS_50150 5542309 5543322 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973334.1 protein_id gnl|my_center|LOCUS_50150 5545332 5543350 gene locus_tag LOCUS_50160 5545332 5543350 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030394.1 protein_id gnl|my_center|LOCUS_50160 5547572 5545347 gene locus_tag LOCUS_50170 5547572 5545347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 5548583 5547642 gene locus_tag LOCUS_50180 5548583 5547642 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109035954.1 protein_id gnl|my_center|LOCUS_50180 5549593 5548580 gene locus_tag LOCUS_50190 5549593 5548580 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030392.1 protein_id gnl|my_center|LOCUS_50190 5551202 5549595 gene locus_tag LOCUS_50200 5551202 5549595 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030391.1 protein_id gnl|my_center|LOCUS_50200 5551654 5554533 gene locus_tag LOCUS_50210 5551654 5554533 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030390.1 protein_id gnl|my_center|LOCUS_50210 5554530 5556803 gene locus_tag LOCUS_50220 gene yicI 5554530 5556803 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027547.1 protein_id gnl|my_center|LOCUS_50220 5557090 5558592 gene locus_tag LOCUS_50230 5557090 5558592 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029892.1 protein_id gnl|my_center|LOCUS_50230 5558661 5560226 gene locus_tag LOCUS_50240 5558661 5560226 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974143.1 protein_id gnl|my_center|LOCUS_50240 5560223 5561284 gene locus_tag LOCUS_50250 5560223 5561284 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029893.1 protein_id gnl|my_center|LOCUS_50250 5561284 5563266 gene locus_tag LOCUS_50260 5561284 5563266 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029894.1 protein_id gnl|my_center|LOCUS_50260 5563268 5564251 gene locus_tag LOCUS_50270 5563268 5564251 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029895.1 protein_id gnl|my_center|LOCUS_50270 5565017 5565922 gene locus_tag LOCUS_50280 5565017 5565922 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977080.1 protein_id gnl|my_center|LOCUS_50280 5567405 5566008 gene locus_tag LOCUS_50290 5567405 5566008 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_50290 5569374 5567590 gene locus_tag LOCUS_50300 5569374 5567590 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027306.1 protein_id gnl|my_center|LOCUS_50300 5569497 5570189 gene locus_tag LOCUS_50310 5569497 5570189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 5571749 5570268 gene locus_tag LOCUS_50320 gene xylB 5571749 5570268 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027626.1 protein_id gnl|my_center|LOCUS_50320 5572016 5573185 gene locus_tag LOCUS_50330 gene xylA 5572016 5573185 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_50330 5573736 5573299 gene locus_tag LOCUS_50340 5573736 5573299 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222796.1 protein_id gnl|my_center|LOCUS_50340 5574989 5573733 gene locus_tag LOCUS_50350 5574989 5573733 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027551.1 protein_id gnl|my_center|LOCUS_50350 5575758 5575105 gene locus_tag LOCUS_50360 5575758 5575105 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_50360 5576411 5575755 gene locus_tag LOCUS_50370 5576411 5575755 CDS product DUF3105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028218.1 protein_id gnl|my_center|LOCUS_50370 5576824 5576513 gene locus_tag LOCUS_50380 5576824 5576513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 5576709 5577002 gene locus_tag LOCUS_50390 5576709 5577002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50390 5577850 5579418 gene locus_tag LOCUS_50400 5577850 5579418 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977196.1 protein_id gnl|my_center|LOCUS_50400 5579415 5579822 gene locus_tag LOCUS_50410 5579415 5579822 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977197.1 protein_id gnl|my_center|LOCUS_50410 5579819 5580187 gene locus_tag LOCUS_50420 5579819 5580187 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977198.1 protein_id gnl|my_center|LOCUS_50420 5580168 5580782 gene locus_tag LOCUS_50430 5580168 5580782 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977199.1 protein_id gnl|my_center|LOCUS_50430 5580936 5582477 gene locus_tag LOCUS_50440 5580936 5582477 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027891.1 protein_id gnl|my_center|LOCUS_50440 5582537 5583883 gene locus_tag LOCUS_50450 5582537 5583883 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031093.1 protein_id gnl|my_center|LOCUS_50450 5584360 5583920 gene locus_tag LOCUS_50460 5584360 5583920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 5584812 5584354 gene locus_tag LOCUS_50470 5584812 5584354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 5585018 5585878 gene locus_tag LOCUS_50480 5585018 5585878 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976840.1 protein_id gnl|my_center|LOCUS_50480 5585879 5586115 gene locus_tag LOCUS_50490 5585879 5586115 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976841.1 protein_id gnl|my_center|LOCUS_50490 5586740 5587186 gene locus_tag LOCUS_50500 5586740 5587186 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027912.1 protein_id gnl|my_center|LOCUS_50500 5587230 5587817 gene locus_tag LOCUS_50510 5587230 5587817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 5589916 5587823 gene locus_tag LOCUS_50520 5589916 5587823 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487206.1 protein_id gnl|my_center|LOCUS_50520 5590808 5589972 gene locus_tag LOCUS_50530 5590808 5589972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325235.1 protein_id gnl|my_center|LOCUS_50530 5591153 5590890 gene locus_tag LOCUS_50540 5591153 5590890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50540 5592389 5591430 gene locus_tag LOCUS_50550 5592389 5591430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50550 5593685 5592543 gene locus_tag LOCUS_50560 5593685 5592543 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976380.1 protein_id gnl|my_center|LOCUS_50560 5594390 5595025 gene locus_tag LOCUS_50570 5594390 5595025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028343.1 protein_id gnl|my_center|LOCUS_50570 5595246 5596685 gene locus_tag LOCUS_50580 5595246 5596685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028344.1 protein_id gnl|my_center|LOCUS_50580 5596778 5597731 gene locus_tag LOCUS_50590 5596778 5597731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028345.1 protein_id gnl|my_center|LOCUS_50590 5598304 5599287 gene locus_tag LOCUS_50600 5598304 5599287 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326134.1 protein_id gnl|my_center|LOCUS_50600 5599284 5600129 gene locus_tag LOCUS_50610 5599284 5600129 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976385.1 protein_id gnl|my_center|LOCUS_50610 5600133 5600936 gene locus_tag LOCUS_50620 5600133 5600936 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976386.1 protein_id gnl|my_center|LOCUS_50620 5600936 5602240 gene locus_tag LOCUS_50630 5600936 5602240 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976387.1 protein_id gnl|my_center|LOCUS_50630 5602237 5603268 gene locus_tag LOCUS_50640 5602237 5603268 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976388.1 protein_id gnl|my_center|LOCUS_50640 5603271 5604281 gene locus_tag LOCUS_50650 5603271 5604281 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028342.1 protein_id gnl|my_center|LOCUS_50650 5604283 5605392 gene locus_tag LOCUS_50660 5604283 5605392 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976390.1 protein_id gnl|my_center|LOCUS_50660 5605389 5606549 gene locus_tag LOCUS_50670 5605389 5606549 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028341.1 protein_id gnl|my_center|LOCUS_50670 5606546 5607742 gene locus_tag LOCUS_50680 5606546 5607742 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028340.1 protein_id gnl|my_center|LOCUS_50680 5607739 5608260 gene locus_tag LOCUS_50690 5607739 5608260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223667.1 protein_id gnl|my_center|LOCUS_50690 5608257 5608886 gene locus_tag LOCUS_50700 5608257 5608886 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028338.1 protein_id gnl|my_center|LOCUS_50700 5608962 5609492 gene locus_tag LOCUS_50710 5608962 5609492 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028337.1 protein_id gnl|my_center|LOCUS_50710 5609535 5610272 gene locus_tag LOCUS_50720 5609535 5610272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 5610312 5611613 gene locus_tag LOCUS_50730 5610312 5611613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 5612675 5611602 gene locus_tag LOCUS_50740 5612675 5611602 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031122.1 protein_id gnl|my_center|LOCUS_50740 5612750 5613763 gene locus_tag LOCUS_50750 gene ligD 5612750 5613763 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_50750 5613760 5614824 gene locus_tag LOCUS_50760 5613760 5614824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977778.1 protein_id gnl|my_center|LOCUS_50760 5617070 5614839 gene locus_tag LOCUS_50770 5617070 5614839 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031124.1 protein_id gnl|my_center|LOCUS_50770 5619499 5617067 gene locus_tag LOCUS_50780 5619499 5617067 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031125.1 protein_id gnl|my_center|LOCUS_50780 5620004 5619738 gene locus_tag LOCUS_50790 5620004 5619738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 5619910 5620806 gene locus_tag LOCUS_50800 5619910 5620806 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972284.1 protein_id gnl|my_center|LOCUS_50800 5621003 5621800 gene locus_tag LOCUS_50810 5621003 5621800 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031127.1 protein_id gnl|my_center|LOCUS_50810 5621797 5622126 gene locus_tag LOCUS_50820 5621797 5622126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 5623092 5622190 gene locus_tag LOCUS_50830 5623092 5622190 CDS product chitosanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028103.1 protein_id gnl|my_center|LOCUS_50830 5624174 5623200 gene locus_tag LOCUS_50840 5624174 5623200 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031130.1 protein_id gnl|my_center|LOCUS_50840 5624847 5624431 gene locus_tag LOCUS_50850 5624847 5624431 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972274.1 protein_id gnl|my_center|LOCUS_50850 5625631 5625314 gene locus_tag LOCUS_50860 5625631 5625314 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972271.1 protein_id gnl|my_center|LOCUS_50860 5625648 5626310 gene locus_tag LOCUS_50870 5625648 5626310 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031135.1 protein_id gnl|my_center|LOCUS_50870 5627704 5626514 gene locus_tag LOCUS_50880 5627704 5626514 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031138.1 protein_id gnl|my_center|LOCUS_50880 5627905 5629059 gene locus_tag LOCUS_50890 5627905 5629059 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031139.1 protein_id gnl|my_center|LOCUS_50890 5629069 5630211 gene locus_tag LOCUS_50900 5629069 5630211 CDS product long-chain specific acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031182.1 protein_id gnl|my_center|LOCUS_50900 5630247 5631461 gene locus_tag LOCUS_50910 5630247 5631461 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031183.1 protein_id gnl|my_center|LOCUS_50910 5631501 5633672 gene locus_tag LOCUS_50920 5631501 5633672 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031141.1 protein_id gnl|my_center|LOCUS_50920 5634439 5633708 gene locus_tag LOCUS_50930 5634439 5633708 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031142.1 protein_id gnl|my_center|LOCUS_50930 5634660 5635289 gene locus_tag LOCUS_50940 5634660 5635289 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972206.1 protein_id gnl|my_center|LOCUS_50940 5635495 5635746 gene locus_tag LOCUS_50950 5635495 5635746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 5635801 5637132 gene locus_tag LOCUS_50960 5635801 5637132 CDS product DUF2817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031146.1 protein_id gnl|my_center|LOCUS_50960 5637206 5638987 gene locus_tag LOCUS_50970 5637206 5638987 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972257.1 protein_id gnl|my_center|LOCUS_50970 5639947 5639024 gene locus_tag LOCUS_50980 5639947 5639024 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031147.1 protein_id gnl|my_center|LOCUS_50980 5640079 5641716 gene locus_tag LOCUS_50990 5640079 5641716 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972254.1 protein_id gnl|my_center|LOCUS_50990 5644307 5641860 gene locus_tag LOCUS_51000 5644307 5641860 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031148.1 protein_id gnl|my_center|LOCUS_51000 5644588 5644460 gene locus_tag LOCUS_51010 5644588 5644460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 5645528 5644656 gene locus_tag LOCUS_51020 5645528 5644656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972252.1 protein_id gnl|my_center|LOCUS_51020 5646617 5645823 gene locus_tag LOCUS_51030 5646617 5645823 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972249.1 protein_id gnl|my_center|LOCUS_51030 5646698 5647363 gene locus_tag LOCUS_51040 5646698 5647363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 5647500 5647952 gene locus_tag LOCUS_51050 5647500 5647952 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327856.1 protein_id gnl|my_center|LOCUS_51050 5648507 5647974 gene locus_tag LOCUS_51060 gene idi 5648507 5647974 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972247.1 protein_id gnl|my_center|LOCUS_51060 5649562 5648792 gene locus_tag LOCUS_51070 5649562 5648792 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294685.1 protein_id gnl|my_center|LOCUS_51070 5650726 5649785 gene locus_tag LOCUS_51080 5650726 5649785 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 protein_id gnl|my_center|LOCUS_51080 5651890 5650907 gene locus_tag LOCUS_51090 gene galE 5651890 5650907 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975823.1 protein_id gnl|my_center|LOCUS_51090 5652232 5653950 gene locus_tag LOCUS_51100 5652232 5653950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51100 5653947 5654684 gene locus_tag LOCUS_51110 5653947 5654684 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_51110 5654672 5655733 gene locus_tag LOCUS_51120 5654672 5655733 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972242.1 protein_id gnl|my_center|LOCUS_51120 5655711 5656490 gene locus_tag LOCUS_51130 5655711 5656490 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270333.1 protein_id gnl|my_center|LOCUS_51130 5656487 5657383 gene locus_tag LOCUS_51140 5656487 5657383 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_51140 5657489 5658418 gene locus_tag LOCUS_51150 5657489 5658418 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972239.1 protein_id gnl|my_center|LOCUS_51150 5658411 5659196 gene locus_tag LOCUS_51160 5658411 5659196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972238.1 protein_id gnl|my_center|LOCUS_51160 5659614 5660534 gene locus_tag LOCUS_51170 gene hpnC 5659614 5660534 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031161.1 protein_id gnl|my_center|LOCUS_51170 5660531 5661484 gene locus_tag LOCUS_51180 gene hpnD 5660531 5661484 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483877.1 protein_id gnl|my_center|LOCUS_51180 5661609 5662997 gene locus_tag LOCUS_51190 gene hpnE 5661609 5662997 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_51190 5663027 5664097 gene locus_tag LOCUS_51200 5663027 5664097 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107420324.1 protein_id gnl|my_center|LOCUS_51200 5664205 5666205 gene locus_tag LOCUS_51210 gene shc 5664205 5666205 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_51210 5666205 5666861 gene locus_tag LOCUS_51220 5666205 5666861 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972232.1 protein_id gnl|my_center|LOCUS_51220 5666868 5667887 gene locus_tag LOCUS_51230 gene hpnH 5666868 5667887 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972231.1 protein_id gnl|my_center|LOCUS_51230 5668055 5669452 gene locus_tag LOCUS_51240 5668055 5669452 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031169.1 protein_id gnl|my_center|LOCUS_51240 5670347 5669535 gene locus_tag LOCUS_51250 5670347 5669535 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972225.1 protein_id gnl|my_center|LOCUS_51250 5670961 5671911 gene locus_tag LOCUS_51260 5670961 5671911 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031172.1 protein_id gnl|my_center|LOCUS_51260 5672111 5672965 gene locus_tag LOCUS_51270 5672111 5672965 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972223.1 protein_id gnl|my_center|LOCUS_51270 5673853 5672951 gene locus_tag LOCUS_51280 5673853 5672951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51280 5675223 5673850 gene locus_tag LOCUS_51290 5675223 5673850 CDS product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202627.1 protein_id gnl|my_center|LOCUS_51290 5676086 5675220 gene locus_tag LOCUS_51300 5676086 5675220 CDS product STM4013/SEN3800 family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202626.1 protein_id gnl|my_center|LOCUS_51300 5677200 5676067 gene locus_tag LOCUS_51310 5677200 5676067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 5678157 5677207 gene locus_tag LOCUS_51320 5678157 5677207 CDS product STM4015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042080.1 protein_id gnl|my_center|LOCUS_51320 5678330 5678656 gene locus_tag LOCUS_51330 5678330 5678656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51330 5678750 5679751 gene locus_tag LOCUS_51340 5678750 5679751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229816.1 protein_id gnl|my_center|LOCUS_51340 5680395 5679784 gene locus_tag LOCUS_51350 5680395 5679784 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972222.1 protein_id gnl|my_center|LOCUS_51350 5681722 5680508 gene locus_tag LOCUS_51360 5681722 5680508 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223248.1 protein_id gnl|my_center|LOCUS_51360 5682409 5681846 gene locus_tag LOCUS_51370 5682409 5681846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 5682551 5682991 gene locus_tag LOCUS_51380 5682551 5682991 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730357.1 protein_id gnl|my_center|LOCUS_51380 5683147 5684340 gene locus_tag LOCUS_51390 5683147 5684340 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873148.1 protein_id gnl|my_center|LOCUS_51390 5684935 5686683 gene locus_tag LOCUS_51400 5684935 5686683 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031188.1 protein_id gnl|my_center|LOCUS_51400 5686691 5687125 gene locus_tag LOCUS_51410 5686691 5687125 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972203.1 protein_id gnl|my_center|LOCUS_51410 5687128 5687499 gene locus_tag LOCUS_51420 5687128 5687499 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031189.1 protein_id gnl|my_center|LOCUS_51420 5687477 5688109 gene locus_tag LOCUS_51430 5687477 5688109 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327875.1 protein_id gnl|my_center|LOCUS_51430 5688106 5688687 gene locus_tag LOCUS_51440 5688106 5688687 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972200.1 protein_id gnl|my_center|LOCUS_51440 5689687 5688788 gene locus_tag LOCUS_51450 5689687 5688788 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224138.1 protein_id gnl|my_center|LOCUS_51450 5690423 5689728 gene locus_tag LOCUS_51460 5690423 5689728 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030391327.1 protein_id gnl|my_center|LOCUS_51460 5690551 5690625 gene locus_tag LOCUS_t00690 5690551 5690625 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5690792 5692237 gene locus_tag LOCUS_51470 5690792 5692237 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972104.1 protein_id gnl|my_center|LOCUS_51470 5693230 5692313 gene locus_tag LOCUS_51480 5693230 5692313 CDS product DUF2510 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031111.1 protein_id gnl|my_center|LOCUS_51480 5693357 5694088 gene locus_tag LOCUS_51490 5693357 5694088 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804816.1 protein_id gnl|my_center|LOCUS_51490 5694209 5694976 gene locus_tag LOCUS_51500 5694209 5694976 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892015.1 protein_id gnl|my_center|LOCUS_51500 5694973 5696508 gene locus_tag LOCUS_51510 5694973 5696508 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 protein_id gnl|my_center|LOCUS_51510 5696505 5697149 gene locus_tag LOCUS_51520 5696505 5697149 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 protein_id gnl|my_center|LOCUS_51520 5699099 5697207 gene locus_tag LOCUS_51530 5699099 5697207 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027279.1 protein_id gnl|my_center|LOCUS_51530 5699247 5700026 gene locus_tag LOCUS_51540 5699247 5700026 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031344.1 protein_id gnl|my_center|LOCUS_51540 5700551 5700183 gene locus_tag LOCUS_51550 5700551 5700183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 5701085 5700600 gene locus_tag LOCUS_51560 5701085 5700600 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972173.1 protein_id gnl|my_center|LOCUS_51560 5701190 5703847 gene locus_tag LOCUS_51570 5701190 5703847 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031112.1 protein_id gnl|my_center|LOCUS_51570 5703898 5703972 gene locus_tag LOCUS_t00700 5703898 5703972 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5704660 5704130 gene locus_tag LOCUS_51580 5704660 5704130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 5706744 5704729 gene locus_tag LOCUS_51590 5706744 5704729 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027064.1 protein_id gnl|my_center|LOCUS_51590 5708043 5707144 gene locus_tag LOCUS_51600 5708043 5707144 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226431.1 protein_id gnl|my_center|LOCUS_51600 5709053 5708040 gene locus_tag LOCUS_51610 5709053 5708040 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226432.1 protein_id gnl|my_center|LOCUS_51610 5708992 5709195 gene locus_tag LOCUS_51620 5708992 5709195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 5709973 5709338 gene locus_tag LOCUS_51630 5709973 5709338 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975649.1 protein_id gnl|my_center|LOCUS_51630 5710138 5710947 gene locus_tag LOCUS_51640 5710138 5710947 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972302.1 protein_id gnl|my_center|LOCUS_51640 5710944 5711903 gene locus_tag LOCUS_51650 5710944 5711903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031110.1 protein_id gnl|my_center|LOCUS_51650 5712504 5711926 gene locus_tag LOCUS_51660 5712504 5711926 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972077.1 protein_id gnl|my_center|LOCUS_51660 5714554 5712539 gene locus_tag LOCUS_51670 5714554 5712539 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031412.1 protein_id gnl|my_center|LOCUS_51670 5714751 5715281 gene locus_tag LOCUS_51680 5714751 5715281 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976524.1 protein_id gnl|my_center|LOCUS_51680 5716505 5715618 gene locus_tag LOCUS_51690 5716505 5715618 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225774.1 protein_id gnl|my_center|LOCUS_51690 5717070 5716756 gene locus_tag LOCUS_51700 5717070 5716756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 5717261 5717070 gene locus_tag LOCUS_51710 5717261 5717070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51710 5717652 5717810 gene locus_tag LOCUS_51720 5717652 5717810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 5717862 5718110 gene locus_tag LOCUS_51730 5717862 5718110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51730 5718495 5718310 gene locus_tag LOCUS_51740 5718495 5718310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 5720969 5718564 gene locus_tag LOCUS_51750 5720969 5718564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327169.1 protein_id gnl|my_center|LOCUS_51750 5721655 5720966 gene locus_tag LOCUS_51760 5721655 5720966 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973942.1 protein_id gnl|my_center|LOCUS_51760 5722176 5721652 gene locus_tag LOCUS_51770 5722176 5721652 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_51770 5723419 5722685 gene locus_tag LOCUS_51780 5723419 5722685 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031845.1 protein_id gnl|my_center|LOCUS_51780 5724741 5723932 gene locus_tag LOCUS_51790 5724741 5723932 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222556.1 protein_id gnl|my_center|LOCUS_51790 5725074 5724766 gene locus_tag LOCUS_51800 5725074 5724766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 5724967 5725656 gene locus_tag LOCUS_51810 5724967 5725656 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104905.1 protein_id gnl|my_center|LOCUS_51810 5725766 5726785 gene locus_tag LOCUS_51820 5725766 5726785 CDS product 3-dehydroquinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222554.1 protein_id gnl|my_center|LOCUS_51820 5726833 5727882 gene locus_tag LOCUS_51830 5726833 5727882 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224942.1 protein_id gnl|my_center|LOCUS_51830 5728967 5727939 gene locus_tag LOCUS_51840 5728967 5727939 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_51840 5730526 5729114 gene locus_tag LOCUS_51850 5730526 5729114 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106243816.1 protein_id gnl|my_center|LOCUS_51850 5731056 5730523 gene locus_tag LOCUS_51860 5731056 5730523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 5731946 5731059 gene locus_tag LOCUS_51870 gene cysD 5731946 5731059 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972822.1 protein_id gnl|my_center|LOCUS_51870 5732506 5731943 gene locus_tag LOCUS_51880 gene cysC 5732506 5731943 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164276380.1 protein_id gnl|my_center|LOCUS_51880 5734164 5732503 gene locus_tag LOCUS_51890 5734164 5732503 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227261.1 protein_id gnl|my_center|LOCUS_51890 5735822 5734182 gene locus_tag LOCUS_51900 5735822 5734182 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188100697.1 protein_id gnl|my_center|LOCUS_51900 5736484 5737800 gene locus_tag LOCUS_51910 5736484 5737800 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 protein_id gnl|my_center|LOCUS_51910 5737876 5738226 gene locus_tag LOCUS_51920 5737876 5738226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 5738223 5739665 gene locus_tag LOCUS_51930 5738223 5739665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51930 5739662 5740876 gene locus_tag LOCUS_51940 5739662 5740876 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_51940 5740873 5741604 gene locus_tag LOCUS_51950 5740873 5741604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 5741647 5743203 gene locus_tag LOCUS_51960 5741647 5743203 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966249.1 protein_id gnl|my_center|LOCUS_51960 5743200 5744039 gene locus_tag LOCUS_51970 5743200 5744039 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227264.1 protein_id gnl|my_center|LOCUS_51970 5744091 5744855 gene locus_tag LOCUS_51980 5744091 5744855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51980 5744867 5745403 gene locus_tag LOCUS_51990 5744867 5745403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51990 5746522 5745434 gene locus_tag LOCUS_52000 5746522 5745434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 5748357 5746516 gene locus_tag LOCUS_52010 5748357 5746516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 5748667 5748389 gene locus_tag LOCUS_52020 5748667 5748389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52020 5750241 5748697 gene locus_tag LOCUS_52030 5750241 5748697 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144207.1 protein_id gnl|my_center|LOCUS_52030 5750746 5751684 gene locus_tag LOCUS_52040 5750746 5751684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52040 5751681 5752454 gene locus_tag LOCUS_52050 5751681 5752454 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256999.1 protein_id gnl|my_center|LOCUS_52050 5752547 5753659 gene locus_tag LOCUS_52060 5752547 5753659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 5753652 5755967 gene locus_tag LOCUS_52070 5753652 5755967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52070 5755967 5756740 gene locus_tag LOCUS_52080 gene fabG 5755967 5756740 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258271.1 protein_id gnl|my_center|LOCUS_52080 5756740 5757936 gene locus_tag LOCUS_52090 5756740 5757936 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222558.1 protein_id gnl|my_center|LOCUS_52090 5757933 5759036 gene locus_tag LOCUS_52100 5757933 5759036 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173087.1 protein_id gnl|my_center|LOCUS_52100 5759063 5759434 gene locus_tag LOCUS_52110 5759063 5759434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 5759449 5760381 gene locus_tag LOCUS_52120 5759449 5760381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52120 5760587 5760955 gene locus_tag LOCUS_52130 5760587 5760955 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028411.1 protein_id gnl|my_center|LOCUS_52130 5761018 5761416 gene locus_tag LOCUS_52140 5761018 5761416 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030668.1 protein_id gnl|my_center|LOCUS_52140 5761435 5762376 gene locus_tag LOCUS_52150 5761435 5762376 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222560.1 protein_id gnl|my_center|LOCUS_52150 5763770 5762397 gene locus_tag LOCUS_52160 5763770 5762397 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 protein_id gnl|my_center|LOCUS_52160 5764269 5763820 gene locus_tag LOCUS_52170 5764269 5763820 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222584.1 protein_id gnl|my_center|LOCUS_52170 5765648 5764266 gene locus_tag LOCUS_52180 5765648 5764266 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937466.1 protein_id gnl|my_center|LOCUS_52180 5765897 5765667 gene locus_tag LOCUS_52190 5765897 5765667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52190 5766596 5767762 gene locus_tag LOCUS_52200 gene rifK 5766596 5767762 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_52200 5767819 5768475 gene locus_tag LOCUS_52210 5767819 5768475 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222559.1 protein_id gnl|my_center|LOCUS_52210 5768472 5769497 gene locus_tag LOCUS_52220 5768472 5769497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52220 5769500 5771122 gene locus_tag LOCUS_52230 5769500 5771122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 5771184 5772026 gene locus_tag LOCUS_52240 5771184 5772026 CDS product 27-O-demethylrifamycin SV methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222580.1 protein_id gnl|my_center|LOCUS_52240 5772150 5773520 gene locus_tag LOCUS_52250 5772150 5773520 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976504.1 protein_id gnl|my_center|LOCUS_52250 5773598 5773816 gene locus_tag LOCUS_52260 5773598 5773816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 5774026 5774454 gene locus_tag LOCUS_52270 5774026 5774454 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027487.1 protein_id gnl|my_center|LOCUS_52270 5774591 5774830 gene locus_tag LOCUS_52280 5774591 5774830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 5776393 5775014 gene locus_tag LOCUS_52290 5776393 5775014 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027010.1 protein_id gnl|my_center|LOCUS_52290 5778119 5776503 gene locus_tag LOCUS_52300 5778119 5776503 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027011.1 protein_id gnl|my_center|LOCUS_52300 5778381 5778196 gene locus_tag LOCUS_52310 5778381 5778196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 5778951 5778442 gene locus_tag LOCUS_52320 5778951 5778442 CDS product DUF5709 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027611.1 protein_id gnl|my_center|LOCUS_52320 5779509 5780984 gene locus_tag LOCUS_52330 5779509 5780984 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966104.1 protein_id gnl|my_center|LOCUS_52330 5781796 5783109 gene locus_tag LOCUS_52340 5781796 5783109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 5784254 5783079 gene locus_tag LOCUS_52350 5784254 5783079 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027482.1 protein_id gnl|my_center|LOCUS_52350 5784485 5785195 gene locus_tag LOCUS_52360 5784485 5785195 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027474.1 protein_id gnl|my_center|LOCUS_52360 5785685 5785230 gene locus_tag LOCUS_52370 5785685 5785230 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971866.1 protein_id gnl|my_center|LOCUS_52370 5786591 5785812 gene locus_tag LOCUS_52380 5786591 5785812 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978261.1 protein_id gnl|my_center|LOCUS_52380 5786929 5788413 gene locus_tag LOCUS_52390 5786929 5788413 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977903.1 protein_id gnl|my_center|LOCUS_52390 5788793 5788966 gene locus_tag LOCUS_52400 5788793 5788966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027467.1 protein_id gnl|my_center|LOCUS_52400 5790454 5789024 gene locus_tag LOCUS_52410 5790454 5789024 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977913.1 protein_id gnl|my_center|LOCUS_52410 5790991 5790470 gene locus_tag LOCUS_52420 5790991 5790470 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943975.1 protein_id gnl|my_center|LOCUS_52420 5791824 5790988 gene locus_tag LOCUS_52430 5791824 5790988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 5792005 5793102 gene locus_tag LOCUS_52440 5792005 5793102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52440 5793181 5795295 gene locus_tag LOCUS_52450 5793181 5795295 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975145.1 protein_id gnl|my_center|LOCUS_52450 5795614 5796621 gene locus_tag LOCUS_52460 5795614 5796621 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223734.1 protein_id gnl|my_center|LOCUS_52460 5796808 5797668 gene locus_tag LOCUS_52470 5796808 5797668 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_52470 5797703 5798455 gene locus_tag LOCUS_52480 5797703 5798455 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977611.1 protein_id gnl|my_center|LOCUS_52480 5798572 5798880 gene locus_tag LOCUS_52490 5798572 5798880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 5798877 5800367 gene locus_tag LOCUS_52500 5798877 5800367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 5800364 5801551 gene locus_tag LOCUS_52510 5800364 5801551 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_52510 5802065 5801562 gene locus_tag LOCUS_52520 5802065 5801562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977917.1 protein_id gnl|my_center|LOCUS_52520 5802177 5802374 gene locus_tag LOCUS_52530 5802177 5802374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 5802877 5802308 gene locus_tag LOCUS_52540 5802877 5802308 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977918.1 protein_id gnl|my_center|LOCUS_52540 5803135 5804346 gene locus_tag LOCUS_52550 5803135 5804346 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977919.1 protein_id gnl|my_center|LOCUS_52550 5804835 5804374 gene locus_tag LOCUS_52560 5804835 5804374 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977923.1 protein_id gnl|my_center|LOCUS_52560 5805042 5805848 gene locus_tag LOCUS_52570 5805042 5805848 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868999.1 protein_id gnl|my_center|LOCUS_52570 5806539 5805880 gene locus_tag LOCUS_52580 5806539 5805880 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027455.1 protein_id gnl|my_center|LOCUS_52580 5806883 5807362 gene locus_tag LOCUS_52590 5806883 5807362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 5807423 5807353 gene locus_tag LOCUS_t00710 5807423 5807353 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5808024 5807458 gene locus_tag LOCUS_52600 5808024 5807458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 5808983 5808216 gene locus_tag LOCUS_52610 5808983 5808216 CDS product DUF4239 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977928.1 protein_id gnl|my_center|LOCUS_52610 5808922 5809119 gene locus_tag LOCUS_52620 5808922 5809119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 5809160 5809774 gene locus_tag LOCUS_52630 5809160 5809774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 5810582 5811400 gene locus_tag LOCUS_52640 5810582 5811400 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_52640 5811397 5813574 gene locus_tag LOCUS_52650 gene rmdA 5811397 5813574 CDS product cyclic Di-GMP phosphodiesterase RmdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027451.1 protein_id gnl|my_center|LOCUS_52650 5814507 5813605 gene locus_tag LOCUS_52660 5814507 5813605 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977934.1 protein_id gnl|my_center|LOCUS_52660 5814640 5815311 gene locus_tag LOCUS_52670 5814640 5815311 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325539.1 protein_id gnl|my_center|LOCUS_52670 5815313 5817262 gene locus_tag LOCUS_52680 5815313 5817262 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977936.1 protein_id gnl|my_center|LOCUS_52680 5817259 5818005 gene locus_tag LOCUS_52690 5817259 5818005 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027448.1 protein_id gnl|my_center|LOCUS_52690 5819072 5818059 gene locus_tag LOCUS_52700 5819072 5818059 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027444.1 protein_id gnl|my_center|LOCUS_52700 5819144 5819632 gene locus_tag LOCUS_52710 5819144 5819632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977943.1 protein_id gnl|my_center|LOCUS_52710 5819804 5821429 gene locus_tag LOCUS_52720 5819804 5821429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 5822060 5821740 gene locus_tag LOCUS_52730 5822060 5821740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 5822160 5822252 gene locus_tag LOCUS_t00720 5822160 5822252 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5822438 5822512 gene locus_tag LOCUS_t00730 5822438 5822512 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5822680 5822752 gene locus_tag LOCUS_t00740 5822680 5822752 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5822842 5822917 gene locus_tag LOCUS_t00750 5822842 5822917 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5822928 5823000 gene locus_tag LOCUS_t00760 5822928 5823000 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5823002 5823085 gene locus_tag LOCUS_t00770 5823002 5823085 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5823338 5823411 gene locus_tag LOCUS_t00780 5823338 5823411 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5823414 5823489 gene locus_tag LOCUS_t00790 5823414 5823489 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5823555 5823740 gene locus_tag LOCUS_52740 5823555 5823740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 5824008 5823769 gene locus_tag LOCUS_52750 5824008 5823769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52750 5824049 5824348 gene locus_tag LOCUS_52760 5824049 5824348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 5824428 5824907 gene locus_tag LOCUS_52770 5824428 5824907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 5824904 5825179 gene locus_tag LOCUS_52780 5824904 5825179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 5825467 5826030 gene locus_tag LOCUS_52790 5825467 5826030 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389872.1 protein_id gnl|my_center|LOCUS_52790 5826222 5826683 gene locus_tag LOCUS_52800 5826222 5826683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52800 5826703 5828421 gene locus_tag LOCUS_52810 5826703 5828421 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389873.1 protein_id gnl|my_center|LOCUS_52810 5828435 5829961 gene locus_tag LOCUS_52820 5828435 5829961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52820 5829942 5830748 gene locus_tag LOCUS_52830 5829942 5830748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 5830790 5831425 gene locus_tag LOCUS_52840 5830790 5831425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52840 5831450 5831848 gene locus_tag LOCUS_52850 5831450 5831848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52850 5831867 5832883 gene locus_tag LOCUS_52860 5831867 5832883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52860 5832907 5833140 gene locus_tag LOCUS_52870 5832907 5833140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52870 5833121 5833498 gene locus_tag LOCUS_52880 5833121 5833498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52880 5833495 5833854 gene locus_tag LOCUS_52890 5833495 5833854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 5833854 5834213 gene locus_tag LOCUS_52900 5833854 5834213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 5834206 5834571 gene locus_tag LOCUS_52910 5834206 5834571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52910 5834632 5835225 gene locus_tag LOCUS_52920 5834632 5835225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 5835326 5835646 gene locus_tag LOCUS_52930 5835326 5835646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 5835772 5836053 gene locus_tag LOCUS_52940 5835772 5836053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 5836053 5840888 gene locus_tag LOCUS_52950 5836053 5840888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 5840888 5841037 gene locus_tag LOCUS_52960 5840888 5841037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 5841034 5843274 gene locus_tag LOCUS_52970 5841034 5843274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 5843337 5844383 gene locus_tag LOCUS_52980 5843337 5844383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52980 5844380 5844640 gene locus_tag LOCUS_52990 5844380 5844640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52990 5844658 5845242 gene locus_tag LOCUS_53000 5844658 5845242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 5845315 5846235 gene locus_tag LOCUS_53010 5845315 5846235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53010 5846242 5846589 gene locus_tag LOCUS_53020 5846242 5846589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 5846586 5848559 gene locus_tag LOCUS_53030 5846586 5848559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 5848642 5849238 gene locus_tag LOCUS_53040 5848642 5849238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 5849251 5849496 gene locus_tag LOCUS_53050 5849251 5849496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53050 5849558 5850271 gene locus_tag LOCUS_53060 5849558 5850271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 5850457 5851080 gene locus_tag LOCUS_53070 5850457 5851080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 5851168 5851908 gene locus_tag LOCUS_53080 5851168 5851908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53080 5852167 5852970 gene locus_tag LOCUS_53090 5852167 5852970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 5852967 5853698 gene locus_tag LOCUS_53100 5852967 5853698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53100 5853695 5853967 gene locus_tag LOCUS_53110 5853695 5853967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53110 5854033 5854455 gene locus_tag LOCUS_53120 5854033 5854455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 5854452 5854646 gene locus_tag LOCUS_53130 5854452 5854646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 5854809 5855042 gene locus_tag LOCUS_53140 5854809 5855042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53140 5855039 5855236 gene locus_tag LOCUS_53150 5855039 5855236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 5855233 5855463 gene locus_tag LOCUS_53160 5855233 5855463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 5855460 5855675 gene locus_tag LOCUS_53170 5855460 5855675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 5855672 5855923 gene locus_tag LOCUS_53180 5855672 5855923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 5855920 5856102 gene locus_tag LOCUS_53190 5855920 5856102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 5856102 5856260 gene locus_tag LOCUS_53200 5856102 5856260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 5856257 5856559 gene locus_tag LOCUS_53210 5856257 5856559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53210 5856561 5857004 gene locus_tag LOCUS_53220 5856561 5857004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 5857001 5857168 gene locus_tag LOCUS_53230 5857001 5857168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 5857165 5857506 gene locus_tag LOCUS_53240 5857165 5857506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53240 5857500 5858051 gene locus_tag LOCUS_53250 5857500 5858051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53250 5858044 5858502 gene locus_tag LOCUS_53260 5858044 5858502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 5858627 5859394 gene locus_tag LOCUS_53270 5858627 5859394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 5859397 5859891 gene locus_tag LOCUS_53280 5859397 5859891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53280 5859969 5860238 gene locus_tag LOCUS_53290 5859969 5860238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 5860311 5861042 gene locus_tag LOCUS_53300 5860311 5861042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 5861097 5861303 gene locus_tag LOCUS_53310 5861097 5861303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 5861319 5861744 gene locus_tag LOCUS_53320 5861319 5861744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 5861741 5861935 gene locus_tag LOCUS_53330 5861741 5861935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 5861935 5862294 gene locus_tag LOCUS_53340 5861935 5862294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 5862425 5862628 gene locus_tag LOCUS_53350 5862425 5862628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 5862637 5862987 gene locus_tag LOCUS_53360 5862637 5862987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53360 5862984 5863310 gene locus_tag LOCUS_53370 5862984 5863310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53370 5863288 5863695 gene locus_tag LOCUS_53380 5863288 5863695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 5863692 5863895 gene locus_tag LOCUS_53390 5863692 5863895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 5863992 5866478 gene locus_tag LOCUS_53400 5863992 5866478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 5866475 5868403 gene locus_tag LOCUS_53410 5866475 5868403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53410 5868589 5868816 gene locus_tag LOCUS_53420 5868589 5868816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 5869029 5869517 gene locus_tag LOCUS_53430 5869029 5869517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53430 5869486 5869635 gene locus_tag LOCUS_53440 5869486 5869635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53440 5869811 5870599 gene locus_tag LOCUS_53450 5869811 5870599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 5870635 5870778 gene locus_tag LOCUS_53460 5870635 5870778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53460 5870828 5871673 gene locus_tag LOCUS_53470 5870828 5871673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 5871670 5871855 gene locus_tag LOCUS_53480 5871670 5871855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53480 5871903 5872499 gene locus_tag LOCUS_53490 5871903 5872499 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975213.1 protein_id gnl|my_center|LOCUS_53490 5872630 5872839 gene locus_tag LOCUS_53500 5872630 5872839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53500 5872911 5873126 gene locus_tag LOCUS_53510 5872911 5873126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 5873132 5873200 gene locus_tag LOCUS_t00800 5873132 5873200 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5873226 5873423 gene locus_tag LOCUS_53520 5873226 5873423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 5873504 5873668 gene locus_tag LOCUS_53530 5873504 5873668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53530 5873668 5873883 gene locus_tag LOCUS_53540 5873668 5873883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53540 5873880 5874068 gene locus_tag LOCUS_53550 5873880 5874068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53550 5874127 5874507 gene locus_tag LOCUS_53560 5874127 5874507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53560 5874580 5874813 gene locus_tag LOCUS_53570 5874580 5874813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 5874798 5874998 gene locus_tag LOCUS_53580 5874798 5874998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53580 5875018 5875227 gene locus_tag LOCUS_53590 5875018 5875227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53590 5875312 5876061 gene locus_tag LOCUS_53600 5875312 5876061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53600 5876071 5876523 gene locus_tag LOCUS_53610 5876071 5876523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53610 5876520 5876741 gene locus_tag LOCUS_53620 5876520 5876741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53620 5876763 5877014 gene locus_tag LOCUS_53630 5876763 5877014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53630 5877024 5877437 gene locus_tag LOCUS_53640 5877024 5877437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53640 5877427 5877693 gene locus_tag LOCUS_53650 5877427 5877693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53650 5878844 5877873 gene locus_tag LOCUS_53660 5878844 5877873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 5879212 5878949 gene locus_tag LOCUS_53670 5879212 5878949 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055540536.1 protein_id gnl|my_center|LOCUS_53670 5879333 5879530 gene locus_tag LOCUS_53680 5879333 5879530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53680 5879740 5880093 gene locus_tag LOCUS_53690 5879740 5880093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53690 5880400 5880275 gene locus_tag LOCUS_53700 5880400 5880275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53700 5880602 5881855 gene locus_tag LOCUS_53710 5880602 5881855 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027442.1 protein_id gnl|my_center|LOCUS_53710 5882091 5882570 gene locus_tag LOCUS_53720 5882091 5882570 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_53720 5883594 5882632 gene locus_tag LOCUS_53730 gene egtD 5883594 5882632 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027441.1 protein_id gnl|my_center|LOCUS_53730 5884346 5883591 gene locus_tag LOCUS_53740 gene egtC 5884346 5883591 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027440.1 protein_id gnl|my_center|LOCUS_53740 5885710 5884346 gene locus_tag LOCUS_53750 gene egtB 5885710 5884346 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027439.1 protein_id gnl|my_center|LOCUS_53750 5887014 5885707 gene locus_tag LOCUS_53760 gene egtA 5887014 5885707 CDS product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027438.1 protein_id gnl|my_center|LOCUS_53760 5887162 5887998 gene locus_tag LOCUS_53770 5887162 5887998 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869145.1 protein_id gnl|my_center|LOCUS_53770 5888450 5887983 gene locus_tag LOCUS_53780 5888450 5887983 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027436.1 protein_id gnl|my_center|LOCUS_53780 5888501 5889673 gene locus_tag LOCUS_53790 5888501 5889673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 5889897 5890190 gene locus_tag LOCUS_53800 5889897 5890190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 5890354 5890127 gene locus_tag LOCUS_53810 5890354 5890127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 5890298 5890675 gene locus_tag LOCUS_53820 5890298 5890675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 5891227 5890844 gene locus_tag LOCUS_53830 gene trxA 5891227 5890844 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_53830 5891306 5892787 gene locus_tag LOCUS_53840 5891306 5892787 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027415.1 protein_id gnl|my_center|LOCUS_53840 5893165 5894223 gene locus_tag LOCUS_53850 5893165 5894223 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028737.1 protein_id gnl|my_center|LOCUS_53850 5894477 5894857 gene locus_tag LOCUS_53860 5894477 5894857 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029513.1 protein_id gnl|my_center|LOCUS_53860 5895216 5894992 gene locus_tag LOCUS_53870 gene rpsR 5895216 5894992 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028969.1 protein_id gnl|my_center|LOCUS_53870 5896424 5895270 gene locus_tag LOCUS_53880 5896424 5895270 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456408.1 protein_id gnl|my_center|LOCUS_53880 5896678 5896424 gene locus_tag LOCUS_53890 5896678 5896424 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975406.1 protein_id gnl|my_center|LOCUS_53890 5896871 5896707 gene locus_tag LOCUS_53900 gene rpmG 5896871 5896707 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063154.1 protein_id gnl|my_center|LOCUS_53900 5897039 5899312 gene locus_tag LOCUS_53910 5897039 5899312 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223220.1 protein_id gnl|my_center|LOCUS_53910 5899442 5899663 gene locus_tag LOCUS_53920 5899442 5899663 CDS product DUF6480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971811.1 protein_id gnl|my_center|LOCUS_53920 5900122 5899721 gene locus_tag LOCUS_53930 5900122 5899721 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977738.1 protein_id gnl|my_center|LOCUS_53930 5900625 5900185 gene locus_tag LOCUS_53940 5900625 5900185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 5900738 5901046 gene locus_tag LOCUS_53950 5900738 5901046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 5901088 5901303 gene locus_tag LOCUS_53960 5901088 5901303 CDS product CbtB-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228805.1 protein_id gnl|my_center|LOCUS_53960 5901330 5902106 gene locus_tag LOCUS_53970 5901330 5902106 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228806.1 protein_id gnl|my_center|LOCUS_53970 5902489 5903238 gene locus_tag LOCUS_53980 5902489 5903238 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224871.1 protein_id gnl|my_center|LOCUS_53980 5903401 5904108 gene locus_tag LOCUS_53990 5903401 5904108 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226429.1 protein_id gnl|my_center|LOCUS_53990 5904431 5905318 gene locus_tag LOCUS_54000 5904431 5905318 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222000.1 protein_id gnl|my_center|LOCUS_54000 5905315 5905971 gene locus_tag LOCUS_54010 5905315 5905971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222001.1 protein_id gnl|my_center|LOCUS_54010 5906117 5906620 gene locus_tag LOCUS_54020 5906117 5906620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 5907034 5907249 gene locus_tag LOCUS_54030 5907034 5907249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54030 5907491 5907841 gene locus_tag LOCUS_54040 5907491 5907841 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029058.1 protein_id gnl|my_center|LOCUS_54040 5907835 5908542 gene locus_tag LOCUS_54050 5907835 5908542 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029057.1 protein_id gnl|my_center|LOCUS_54050 5909505 5908795 gene locus_tag LOCUS_54060 5909505 5908795 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179719124.1 protein_id gnl|my_center|LOCUS_54060 5909664 5910344 gene locus_tag LOCUS_54070 5909664 5910344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 5910709 5911245 gene locus_tag LOCUS_54080 5910709 5911245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 5911593 5914871 gene locus_tag LOCUS_54090 5911593 5914871 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027471.1 protein_id gnl|my_center|LOCUS_54090 5915929 5914937 gene locus_tag LOCUS_54100 5915929 5914937 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225188.1 protein_id gnl|my_center|LOCUS_54100 5916178 5917029 gene locus_tag LOCUS_54110 5916178 5917029 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225189.1 protein_id gnl|my_center|LOCUS_54110 5919467 5917116 gene locus_tag LOCUS_54120 5919467 5917116 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223208.1 protein_id gnl|my_center|LOCUS_54120 5921943 5919499 gene locus_tag LOCUS_54130 5921943 5919499 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225437.1 protein_id gnl|my_center|LOCUS_54130 5922431 5923516 gene locus_tag LOCUS_54140 5922431 5923516 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223212.1 protein_id gnl|my_center|LOCUS_54140 5923617 5925224 gene locus_tag LOCUS_54150 5923617 5925224 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223211.1 protein_id gnl|my_center|LOCUS_54150 5925221 5926219 gene locus_tag LOCUS_54160 5925221 5926219 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223210.1 protein_id gnl|my_center|LOCUS_54160 5926216 5927271 gene locus_tag LOCUS_54170 5926216 5927271 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223209.1 protein_id gnl|my_center|LOCUS_54170 5927331 5928368 gene locus_tag LOCUS_54180 5927331 5928368 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977764.1 protein_id gnl|my_center|LOCUS_54180 5928368 5929441 gene locus_tag LOCUS_54190 5928368 5929441 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225221.1 protein_id gnl|my_center|LOCUS_54190 5929689 5930690 gene locus_tag LOCUS_54200 5929689 5930690 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 protein_id gnl|my_center|LOCUS_54200 5931143 5934517 gene locus_tag LOCUS_54210 5931143 5934517 CDS product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031394.1 protein_id gnl|my_center|LOCUS_54210 5934703 5938950 gene locus_tag LOCUS_54220 5934703 5938950 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487683.1 protein_id gnl|my_center|LOCUS_54220 5939220 5940635 gene locus_tag LOCUS_54230 5939220 5940635 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972131.1 protein_id gnl|my_center|LOCUS_54230 5940794 5941753 gene locus_tag LOCUS_54240 5940794 5941753 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_54240 5941770 5942645 gene locus_tag LOCUS_54250 5941770 5942645 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972133.1 protein_id gnl|my_center|LOCUS_54250 5942759 5944363 gene locus_tag LOCUS_54260 5942759 5944363 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972134.1 protein_id gnl|my_center|LOCUS_54260 5944853 5946337 gene locus_tag LOCUS_54270 5944853 5946337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54270 5946361 5947806 gene locus_tag LOCUS_54280 5946361 5947806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54280 5948107 5949144 gene locus_tag LOCUS_54290 5948107 5949144 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226137.1 protein_id gnl|my_center|LOCUS_54290 5949910 5951463 gene locus_tag LOCUS_54300 5949910 5951463 CDS product polysaccharide lyase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975979.1 protein_id gnl|my_center|LOCUS_54300 5952656 5951640 gene locus_tag LOCUS_54310 5952656 5951640 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282703.1 protein_id gnl|my_center|LOCUS_54310 5953454 5952783 gene locus_tag LOCUS_54320 5953454 5952783 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224979.1 protein_id gnl|my_center|LOCUS_54320 5953879 5953430 gene locus_tag LOCUS_54330 5953879 5953430 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224980.1 protein_id gnl|my_center|LOCUS_54330 5954605 5953892 gene locus_tag LOCUS_54340 5954605 5953892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 5955154 5956662 gene locus_tag LOCUS_54350 5955154 5956662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 5956782 5956973 gene locus_tag LOCUS_54360 5956782 5956973 CDS product DUF1272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162789.1 protein_id gnl|my_center|LOCUS_54360 5959403 5957007 gene locus_tag LOCUS_54370 5959403 5957007 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030980.1 protein_id gnl|my_center|LOCUS_54370 5959775 5960044 gene locus_tag LOCUS_54380 5959775 5960044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027204.1 protein_id gnl|my_center|LOCUS_54380 5960157 5960357 gene locus_tag LOCUS_54390 5960157 5960357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 5962050 5960419 gene locus_tag LOCUS_54400 5962050 5960419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 5963568 5962060 gene locus_tag LOCUS_54410 5963568 5962060 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726803.1 protein_id gnl|my_center|LOCUS_54410 5963856 5964473 gene locus_tag LOCUS_54420 5963856 5964473 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975987.1 protein_id gnl|my_center|LOCUS_54420 5965516 5964542 gene locus_tag LOCUS_54430 5965516 5964542 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972087.1 protein_id gnl|my_center|LOCUS_54430 5966356 5965784 gene locus_tag LOCUS_54440 5966356 5965784 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027252.1 protein_id gnl|my_center|LOCUS_54440 5966453 5966731 gene locus_tag LOCUS_54450 5966453 5966731 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978241.1 protein_id gnl|my_center|LOCUS_54450 5967083 5967682 gene locus_tag LOCUS_54460 5967083 5967682 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027648.1 protein_id gnl|my_center|LOCUS_54460 5967787 5968755 gene locus_tag LOCUS_54470 5967787 5968755 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_54470 5968752 5969948 gene locus_tag LOCUS_54480 5968752 5969948 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_54480 5969945 5971093 gene locus_tag LOCUS_54490 5969945 5971093 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027646.1 protein_id gnl|my_center|LOCUS_54490 5971255 5972859 gene locus_tag LOCUS_54500 5971255 5972859 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030930.1 protein_id gnl|my_center|LOCUS_54500 5972883 5973848 gene locus_tag LOCUS_54510 5972883 5973848 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270309.1 protein_id gnl|my_center|LOCUS_54510 5973841 5974698 gene locus_tag LOCUS_54520 5973841 5974698 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469199.1 protein_id gnl|my_center|LOCUS_54520 5974695 5975684 gene locus_tag LOCUS_54530 5974695 5975684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030933.1 protein_id gnl|my_center|LOCUS_54530 5975677 5976369 gene locus_tag LOCUS_54540 5975677 5976369 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972523.1 protein_id gnl|my_center|LOCUS_54540 5976559 5977446 gene locus_tag LOCUS_54550 5976559 5977446 CDS product phosphatidylinositol-specific phospholipase C/glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027645.1 protein_id gnl|my_center|LOCUS_54550 5977582 5977776 gene locus_tag LOCUS_54560 5977582 5977776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977636.1 protein_id gnl|my_center|LOCUS_54560 5977921 5978679 gene locus_tag LOCUS_54570 5977921 5978679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54570 5978887 5980452 gene locus_tag LOCUS_54580 5978887 5980452 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_54580 5980599 5980760 gene locus_tag LOCUS_54590 5980599 5980760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54590 5980848 5982353 gene locus_tag LOCUS_54600 gene mptB 5980848 5982353 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877585.1 protein_id gnl|my_center|LOCUS_54600 5982983 5982363 gene locus_tag LOCUS_54610 5982983 5982363 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328048.1 protein_id gnl|my_center|LOCUS_54610 5984647 5983001 gene locus_tag LOCUS_54620 5984647 5983001 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225258.1 protein_id gnl|my_center|LOCUS_54620 5985606 5984692 gene locus_tag LOCUS_54630 5985606 5984692 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225257.1 protein_id gnl|my_center|LOCUS_54630 5987167 5985911 gene locus_tag LOCUS_54640 5987167 5985911 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869305.1 protein_id gnl|my_center|LOCUS_54640 5988133 5987567 gene locus_tag LOCUS_54650 5988133 5987567 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112987.1 protein_id gnl|my_center|LOCUS_54650 5989024 5988290 gene locus_tag LOCUS_54660 5989024 5988290 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227312.1 protein_id gnl|my_center|LOCUS_54660 5989129 5990292 gene locus_tag LOCUS_54670 5989129 5990292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 5991222 5990314 gene locus_tag LOCUS_54680 5991222 5990314 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030727.1 protein_id gnl|my_center|LOCUS_54680 5991529 5992488 gene locus_tag LOCUS_54690 5991529 5992488 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030715.1 protein_id gnl|my_center|LOCUS_54690 5992501 5994135 gene locus_tag LOCUS_54700 5992501 5994135 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226120.1 protein_id gnl|my_center|LOCUS_54700 5994132 5995184 gene locus_tag LOCUS_54710 5994132 5995184 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030717.1 protein_id gnl|my_center|LOCUS_54710 5995181 5995780 gene locus_tag LOCUS_54720 5995181 5995780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 5995777 5996784 gene locus_tag LOCUS_54730 5995777 5996784 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030719.1 protein_id gnl|my_center|LOCUS_54730 5996781 5997743 gene locus_tag LOCUS_54740 5996781 5997743 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030720.1 protein_id gnl|my_center|LOCUS_54740 5997740 5998981 gene locus_tag LOCUS_54750 5997740 5998981 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030721.1 protein_id gnl|my_center|LOCUS_54750 5998978 5999613 gene locus_tag LOCUS_54760 5998978 5999613 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030722.1 protein_id gnl|my_center|LOCUS_54760 5999610 6001079 gene locus_tag LOCUS_54770 gene rfaE2 5999610 6001079 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270276.1 protein_id gnl|my_center|LOCUS_54770 6001084 6002109 gene locus_tag LOCUS_54780 6001084 6002109 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483893.1 protein_id gnl|my_center|LOCUS_54780 6002102 6003010 gene locus_tag LOCUS_54790 6002102 6003010 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030725.1 protein_id gnl|my_center|LOCUS_54790 6003010 6003927 gene locus_tag LOCUS_54800 6003010 6003927 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030726.1 protein_id gnl|my_center|LOCUS_54800 6004534 6004977 gene locus_tag LOCUS_54810 6004534 6004977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 6005041 6006858 gene locus_tag LOCUS_54820 6005041 6006858 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225166.1 protein_id gnl|my_center|LOCUS_54820 6007416 6006997 gene locus_tag LOCUS_54830 6007416 6006997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 6007950 6007522 gene locus_tag LOCUS_54840 6007950 6007522 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224922.1 protein_id gnl|my_center|LOCUS_54840 6008076 6008768 gene locus_tag LOCUS_54850 6008076 6008768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54850 6009835 6008918 gene locus_tag LOCUS_54860 6009835 6008918 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977080.1 protein_id gnl|my_center|LOCUS_54860 6009768 6010106 gene locus_tag LOCUS_54870 6009768 6010106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 6010537 6012588 gene locus_tag LOCUS_54880 6010537 6012588 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466817.1 protein_id gnl|my_center|LOCUS_54880 6012632 6013750 gene locus_tag LOCUS_54890 6012632 6013750 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614684.1 protein_id gnl|my_center|LOCUS_54890 6013947 6015386 gene locus_tag LOCUS_54900 6013947 6015386 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030871.1 protein_id gnl|my_center|LOCUS_54900 6015432 6016916 gene locus_tag LOCUS_54910 6015432 6016916 CDS product DUF6056 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030870.1 protein_id gnl|my_center|LOCUS_54910 6017772 6016969 gene locus_tag LOCUS_54920 6017772 6016969 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028572.1 protein_id gnl|my_center|LOCUS_54920 6018049 6017861 gene locus_tag LOCUS_54930 6018049 6017861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54930 6018037 6019167 gene locus_tag LOCUS_54940 6018037 6019167 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138052126.1 protein_id gnl|my_center|LOCUS_54940 6019649 6019188 gene locus_tag LOCUS_54950 6019649 6019188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54950 6019934 6020557 gene locus_tag LOCUS_54960 6019934 6020557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54960 6020536 6021078 gene locus_tag LOCUS_54970 6020536 6021078 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064289.1 protein_id gnl|my_center|LOCUS_54970 6021468 6022235 gene locus_tag LOCUS_54980 6021468 6022235 CDS product NPP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031599.1 protein_id gnl|my_center|LOCUS_54980 6024238 6022274 gene locus_tag LOCUS_54990 6024238 6022274 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029615.1 protein_id gnl|my_center|LOCUS_54990 6024436 6025317 gene locus_tag LOCUS_55000 6024436 6025317 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030153.1 protein_id gnl|my_center|LOCUS_55000 6025546 6026193 gene locus_tag LOCUS_55010 6025546 6026193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55010 6026671 6026225 gene locus_tag LOCUS_55020 6026671 6026225 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 protein_id gnl|my_center|LOCUS_55020 6027218 6026808 gene locus_tag LOCUS_55030 6027218 6026808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 6027868 6029217 gene locus_tag LOCUS_55040 6027868 6029217 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485197.1 protein_id gnl|my_center|LOCUS_55040 6029223 6030431 gene locus_tag LOCUS_55050 6029223 6030431 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031197.1 protein_id gnl|my_center|LOCUS_55050 6030458 6031108 gene locus_tag LOCUS_55060 6030458 6031108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 6031192 6031809 gene locus_tag LOCUS_55070 6031192 6031809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030751.1 protein_id gnl|my_center|LOCUS_55070 6032038 6033006 gene locus_tag LOCUS_55080 6032038 6033006 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027561.1 protein_id gnl|my_center|LOCUS_55080 6033460 6035082 gene locus_tag LOCUS_55090 6033460 6035082 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027200.1 protein_id gnl|my_center|LOCUS_55090 6036183 6035155 gene locus_tag LOCUS_55100 6036183 6035155 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972694.1 protein_id gnl|my_center|LOCUS_55100 6038603 6036180 gene locus_tag LOCUS_55110 6038603 6036180 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030755.1 protein_id gnl|my_center|LOCUS_55110 6038972 6039463 gene locus_tag LOCUS_55120 6038972 6039463 CDS product DUF5709 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027314.1 protein_id gnl|my_center|LOCUS_55120 6040043 6040561 gene locus_tag LOCUS_55130 6040043 6040561 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225192.1 protein_id gnl|my_center|LOCUS_55130 6040802 6042364 gene locus_tag LOCUS_55140 6040802 6042364 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976504.1 protein_id gnl|my_center|LOCUS_55140 6042306 6042620 gene locus_tag LOCUS_55150 6042306 6042620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55150 6042620 6042796 gene locus_tag LOCUS_55160 6042620 6042796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55160 6043338 6042916 gene locus_tag LOCUS_55170 6043338 6042916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55170 6044709 6043573 gene locus_tag LOCUS_55180 6044709 6043573 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031628.1 protein_id gnl|my_center|LOCUS_55180 6045485 6044826 gene locus_tag LOCUS_55190 6045485 6044826 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081655759.1 protein_id gnl|my_center|LOCUS_55190 6046087 6045743 gene locus_tag LOCUS_55200 6046087 6045743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027359.1 protein_id gnl|my_center|LOCUS_55200 6046396 6047007 gene locus_tag LOCUS_55210 6046396 6047007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55210 6048035 6047694 gene locus_tag LOCUS_55220 6048035 6047694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 6048296 6049096 gene locus_tag LOCUS_55230 6048296 6049096 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975248.1 protein_id gnl|my_center|LOCUS_55230 6049096 6050352 gene locus_tag LOCUS_55240 6049096 6050352 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029167.1 protein_id gnl|my_center|LOCUS_55240 6051957 6050422 gene locus_tag LOCUS_55250 6051957 6050422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55250 6052293 6054113 gene locus_tag LOCUS_55260 6052293 6054113 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028566.1 protein_id gnl|my_center|LOCUS_55260 6055787 6054267 gene locus_tag LOCUS_55270 6055787 6054267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 6057188 6055899 gene locus_tag LOCUS_55280 6057188 6055899 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226093.1 protein_id gnl|my_center|LOCUS_55280 6057154 6057390 gene locus_tag LOCUS_55290 6057154 6057390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55290 6057943 6058842 gene locus_tag LOCUS_55300 6057943 6058842 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282703.1 protein_id gnl|my_center|LOCUS_55300 6058882 6059451 gene locus_tag LOCUS_55310 6058882 6059451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 6059581 6060048 gene locus_tag LOCUS_55320 6059581 6060048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 6060045 6060311 gene locus_tag LOCUS_55330 6060045 6060311 CDS product DUF4235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978083.1 protein_id gnl|my_center|LOCUS_55330 6060391 6060693 gene locus_tag LOCUS_55340 6060391 6060693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55340 6061611 6060862 gene locus_tag LOCUS_55350 6061611 6060862 CDS product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 protein_id gnl|my_center|LOCUS_55350 6063600 6061867 gene locus_tag LOCUS_55360 6063600 6061867 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227075.1 protein_id gnl|my_center|LOCUS_55360 6063970 6063782 gene locus_tag LOCUS_55370 6063970 6063782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55370 6064084 6065106 gene locus_tag LOCUS_55380 6064084 6065106 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031126.1 protein_id gnl|my_center|LOCUS_55380 6065281 6066576 gene locus_tag LOCUS_55390 6065281 6066576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 6066844 6067431 gene locus_tag LOCUS_55400 6066844 6067431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 6067892 6067452 gene locus_tag LOCUS_55410 6067892 6067452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55410 6069900 6068002 gene locus_tag LOCUS_55420 6069900 6068002 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_55420 6070206 6072182 gene locus_tag LOCUS_55430 6070206 6072182 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399325.1 protein_id gnl|my_center|LOCUS_55430 6072865 6072284 gene locus_tag LOCUS_55440 6072865 6072284 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977659.1 protein_id gnl|my_center|LOCUS_55440 6073173 6074003 gene locus_tag LOCUS_55450 gene nadE 6073173 6074003 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027169.1 protein_id gnl|my_center|LOCUS_55450 6075502 6074141 gene locus_tag LOCUS_55460 6075502 6074141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027625.1 protein_id gnl|my_center|LOCUS_55460 6078411 6075499 gene locus_tag LOCUS_55470 6078411 6075499 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030777.1 protein_id gnl|my_center|LOCUS_55470 6078718 6079755 gene locus_tag LOCUS_55480 6078718 6079755 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029216.1 protein_id gnl|my_center|LOCUS_55480 6079836 6080018 gene locus_tag LOCUS_55490 6079836 6080018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325661.1 protein_id gnl|my_center|LOCUS_55490 6080926 6080045 gene locus_tag LOCUS_55500 6080926 6080045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027623.1 protein_id gnl|my_center|LOCUS_55500 6081190 6082095 gene locus_tag LOCUS_55510 6081190 6082095 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 protein_id gnl|my_center|LOCUS_55510 6082823 6082224 gene locus_tag LOCUS_55520 6082823 6082224 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027620.1 protein_id gnl|my_center|LOCUS_55520 6083425 6084030 gene locus_tag LOCUS_55530 6083425 6084030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 6084141 6085196 gene locus_tag LOCUS_55540 6084141 6085196 CDS product DUF6397 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027615.1 protein_id gnl|my_center|LOCUS_55540 6085267 6085812 gene locus_tag LOCUS_55550 6085267 6085812 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027466.1 protein_id gnl|my_center|LOCUS_55550 6085930 6086988 gene locus_tag LOCUS_55560 6085930 6086988 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109991.1 protein_id gnl|my_center|LOCUS_55560 6087413 6087153 gene locus_tag LOCUS_55570 6087413 6087153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55570 6087839 6087612 gene locus_tag LOCUS_55580 6087839 6087612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55580 6088422 6087937 gene locus_tag LOCUS_55590 6088422 6087937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 6088613 6088419 gene locus_tag LOCUS_55600 6088613 6088419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55600 6088675 6089517 gene locus_tag LOCUS_55610 6088675 6089517 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027366.1 protein_id gnl|my_center|LOCUS_55610 6090097 6089597 gene locus_tag LOCUS_55620 6090097 6089597 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742062.1 protein_id gnl|my_center|LOCUS_55620 6090970 6090314 gene locus_tag LOCUS_55630 6090970 6090314 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973533.1 protein_id gnl|my_center|LOCUS_55630 6091181 6091762 gene locus_tag LOCUS_55640 6091181 6091762 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973532.1 protein_id gnl|my_center|LOCUS_55640 6091999 6092340 gene locus_tag LOCUS_55650 6091999 6092340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 6094356 6092467 gene locus_tag LOCUS_55660 6094356 6092467 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028078.1 protein_id gnl|my_center|LOCUS_55660 6096109 6094514 gene locus_tag LOCUS_55670 6096109 6094514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 6096512 6096309 gene locus_tag LOCUS_55680 6096512 6096309 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730673.1 protein_id gnl|my_center|LOCUS_55680 6096515 6096757 gene locus_tag LOCUS_55690 6096515 6096757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 6097783 6096788 gene locus_tag LOCUS_55700 6097783 6096788 CDS product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027126.1 protein_id gnl|my_center|LOCUS_55700 6098679 6097846 gene locus_tag LOCUS_55710 6098679 6097846 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978415.1 protein_id gnl|my_center|LOCUS_55710 6100279 6098807 gene locus_tag LOCUS_55720 gene rox 6100279 6098807 CDS product rifampin monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877344.1 protein_id gnl|my_center|LOCUS_55720 6101108 6102676 gene locus_tag LOCUS_55730 6101108 6102676 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_55730 6102756 6104105 gene locus_tag LOCUS_55740 6102756 6104105 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270060.1 protein_id gnl|my_center|LOCUS_55740 6104102 6105715 gene locus_tag LOCUS_55750 6104102 6105715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55750 6105709 6107214 gene locus_tag LOCUS_55760 6105709 6107214 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484182.1 protein_id gnl|my_center|LOCUS_55760 6107385 6107245 gene locus_tag LOCUS_55770 6107385 6107245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 6107443 6108513 gene locus_tag LOCUS_55780 6107443 6108513 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031759.1 protein_id gnl|my_center|LOCUS_55780 6111140 6108735 gene locus_tag LOCUS_55790 6111140 6108735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 6112442 6111837 gene locus_tag LOCUS_55800 6112442 6111837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55800 6114294 6112885 gene locus_tag LOCUS_55810 6114294 6112885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108905338.1 protein_id gnl|my_center|LOCUS_55810 6114507 6114956 gene locus_tag LOCUS_55820 6114507 6114956 CDS product spore-associated protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978456.1 protein_id gnl|my_center|LOCUS_55820 6115339 6114980 gene locus_tag LOCUS_55830 6115339 6114980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55830 6115433 6116398 gene locus_tag LOCUS_55840 6115433 6116398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55840 6116872 6116468 gene locus_tag LOCUS_55850 6116872 6116468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55850 6116774 6117034 gene locus_tag LOCUS_55860 6116774 6117034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55860 6118229 6117231 gene locus_tag LOCUS_55870 gene gap 6118229 6117231 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971634.1 protein_id gnl|my_center|LOCUS_55870 6119293 6118337 gene locus_tag LOCUS_55880 6119293 6118337 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031713.1 protein_id gnl|my_center|LOCUS_55880 6119593 6120393 gene locus_tag LOCUS_55890 6119593 6120393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55890 6121062 6120598 gene locus_tag LOCUS_55900 6121062 6120598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55900 6121564 6122169 gene locus_tag LOCUS_55910 6121564 6122169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55910 6122166 6123053 gene locus_tag LOCUS_55920 6122166 6123053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55920 6123337 6124140 gene locus_tag LOCUS_55930 6123337 6124140 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091316930.1 protein_id gnl|my_center|LOCUS_55930 6124137 6125426 gene locus_tag LOCUS_55940 6124137 6125426 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029167.1 protein_id gnl|my_center|LOCUS_55940 6125423 6125761 gene locus_tag LOCUS_55950 6125423 6125761 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229185.1 protein_id gnl|my_center|LOCUS_55950 6127014 6125953 gene locus_tag LOCUS_55960 6127014 6125953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 6127942 6127289 gene locus_tag LOCUS_55970 6127942 6127289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55970 6128057 6128284 gene locus_tag LOCUS_55980 6128057 6128284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55980 6128847 6129389 gene locus_tag LOCUS_55990 6128847 6129389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55990 6130653 6130021 gene locus_tag LOCUS_56000 6130653 6130021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56000 6131449 6131796 gene locus_tag LOCUS_56010 6131449 6131796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56010 6132476 6132024 gene locus_tag LOCUS_56020 6132476 6132024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56020 6133743 6132580 gene locus_tag LOCUS_56030 6133743 6132580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56030 6137133 6133774 gene locus_tag LOCUS_56040 6137133 6133774 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007510795.1 protein_id gnl|my_center|LOCUS_56040 6137269 6137730 gene locus_tag LOCUS_56050 6137269 6137730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 6137727 6138635 gene locus_tag LOCUS_56060 6137727 6138635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56060 6139473 6138811 gene locus_tag LOCUS_56070 6139473 6138811 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027455.1 protein_id gnl|my_center|LOCUS_56070 6140247 6139483 gene locus_tag LOCUS_56080 6140247 6139483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56080 6141241 6140837 gene locus_tag LOCUS_56090 6141241 6140837 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224929.1 protein_id gnl|my_center|LOCUS_56090 6141378 6142238 gene locus_tag LOCUS_56100 6141378 6142238 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267584.1 protein_id gnl|my_center|LOCUS_56100 6143203 6142763 gene locus_tag LOCUS_56110 6143203 6142763 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223989.1 protein_id gnl|my_center|LOCUS_56110 6143686 6144213 gene locus_tag LOCUS_56120 6143686 6144213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56120 6144634 6145161 gene locus_tag LOCUS_56130 6144634 6145161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56130 6145282 6145530 gene locus_tag LOCUS_56140 6145282 6145530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56140 6145551 6146381 gene locus_tag LOCUS_56150 6145551 6146381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56150 6146512 6146916 gene locus_tag LOCUS_56160 6146512 6146916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56160 6147389 6146883 gene locus_tag LOCUS_56170 6147389 6146883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56170 6148726 6147944 gene locus_tag LOCUS_56180 6148726 6147944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 6148946 6149446 gene locus_tag LOCUS_56190 6148946 6149446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 6150011 6150133 gene locus_tag LOCUS_56200 6150011 6150133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56200 6150637 6151206 gene locus_tag LOCUS_56210 6150637 6151206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56210 6151606 6151415 gene locus_tag LOCUS_56220 6151606 6151415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56220 6152456 6152046 gene locus_tag LOCUS_56230 6152456 6152046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56230 6154009 6153326 gene locus_tag LOCUS_56240 6154009 6153326 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_56240 6154961 6154068 gene locus_tag LOCUS_56250 6154961 6154068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56250 6156616 6155921 gene locus_tag LOCUS_56260 6156616 6155921 CDS product IS5/IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028796838.1 protein_id gnl|my_center|LOCUS_56260 6157346 6156729 gene locus_tag LOCUS_56270 6157346 6156729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 6157484 6157855 gene locus_tag LOCUS_56280 6157484 6157855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56280 6157848 6158189 gene locus_tag LOCUS_56290 6157848 6158189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56290 6158861 6158253 gene locus_tag LOCUS_56300 6158861 6158253 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140910.1 protein_id gnl|my_center|LOCUS_56300 6159859 6158858 gene locus_tag LOCUS_56310 6159859 6158858 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727413.1 protein_id gnl|my_center|LOCUS_56310 6160708 6161400 gene locus_tag LOCUS_56320 6160708 6161400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56320 6161450 6163129 gene locus_tag LOCUS_56330 6161450 6163129 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031712.1 protein_id gnl|my_center|LOCUS_56330 6163129 6164868 gene locus_tag LOCUS_56340 6163129 6164868 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228710.1 protein_id gnl|my_center|LOCUS_56340 6164959 6166233 gene locus_tag LOCUS_56350 6164959 6166233 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640554.1 protein_id gnl|my_center|LOCUS_56350 6166627 6167472 gene locus_tag LOCUS_56360 6166627 6167472 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970106.1 protein_id gnl|my_center|LOCUS_56360 6167667 6169421 gene locus_tag LOCUS_56370 6167667 6169421 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027792.1 protein_id gnl|my_center|LOCUS_56370 6169467 6170678 gene locus_tag LOCUS_56380 6169467 6170678 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_56380 6170860 6172545 gene locus_tag LOCUS_56390 6170860 6172545 CDS product alpha-keto acid decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730751.1 protein_id gnl|my_center|LOCUS_56390 6172992 6174200 gene locus_tag LOCUS_56400 6172992 6174200 CDS product glycoside hydrolase family 64 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223266.1 protein_id gnl|my_center|LOCUS_56400 6175048 6174704 gene locus_tag LOCUS_56410 6175048 6174704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56410 6175871 6175686 gene locus_tag LOCUS_56420 6175871 6175686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56420 6176343 6175996 gene locus_tag LOCUS_56430 6176343 6175996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56430 6176316 6176627 gene locus_tag LOCUS_56440 6176316 6176627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56440 6177293 6176997 gene locus_tag LOCUS_56450 6177293 6176997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56450 6177798 6177559 gene locus_tag LOCUS_56460 6177798 6177559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56460 6178015 6178398 gene locus_tag LOCUS_56470 6178015 6178398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56470 6178552 6178956 gene locus_tag LOCUS_56480 6178552 6178956 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325209.1 protein_id gnl|my_center|LOCUS_56480 6179815 6179642 gene locus_tag LOCUS_56490 6179815 6179642 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160420.1 protein_id gnl|my_center|LOCUS_56490 6180065 6180334 gene locus_tag LOCUS_56500 6180065 6180334 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029763.1 protein_id gnl|my_center|LOCUS_56500 6181255 6180413 gene locus_tag LOCUS_56510 6181255 6180413 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029500.1 protein_id gnl|my_center|LOCUS_56510 6181272 6181751 gene locus_tag LOCUS_56520 6181272 6181751 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974764.1 protein_id gnl|my_center|LOCUS_56520 6182852 6182232 gene locus_tag LOCUS_56530 6182852 6182232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56530 6183875 6183525 gene locus_tag LOCUS_56540 6183875 6183525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56540 6185228 6184296 gene locus_tag LOCUS_56550 6185228 6184296 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971753.1 protein_id gnl|my_center|LOCUS_56550 6186353 6185424 gene locus_tag LOCUS_56560 6186353 6185424 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971796.1 protein_id gnl|my_center|LOCUS_56560 6187723 6187229 gene locus_tag LOCUS_56570 6187723 6187229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56570 6188167 6187805 gene locus_tag LOCUS_56580 6188167 6187805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 6188579 6189574 gene locus_tag LOCUS_56590 6188579 6189574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 6190872 6189910 gene locus_tag LOCUS_56600 6190872 6189910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56600 6192025 6192336 gene locus_tag LOCUS_56610 6192025 6192336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56610 6192419 6192829 gene locus_tag LOCUS_56620 6192419 6192829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56620 6192856 6194427 gene locus_tag LOCUS_56630 6192856 6194427 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226069.1 protein_id gnl|my_center|LOCUS_56630 6194573 6194755 gene locus_tag LOCUS_56640 6194573 6194755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 6195904 6194924 gene locus_tag LOCUS_56650 6195904 6194924 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225357.1 protein_id gnl|my_center|LOCUS_56650 6197199 6195958 gene locus_tag LOCUS_56660 6197199 6195958 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043779541.1 protein_id gnl|my_center|LOCUS_56660 6197441 6197196 gene locus_tag LOCUS_56670 6197441 6197196 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559546.1 protein_id gnl|my_center|LOCUS_56670 6197575 6197892 gene locus_tag LOCUS_56680 6197575 6197892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56680 6198015 6199205 gene locus_tag LOCUS_56690 6198015 6199205 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115262.1 protein_id gnl|my_center|LOCUS_56690 6200159 6199635 gene locus_tag LOCUS_56700 6200159 6199635 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030929.1 protein_id gnl|my_center|LOCUS_56700 6201952 6200462 gene locus_tag LOCUS_56710 6201952 6200462 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115028.1 protein_id gnl|my_center|LOCUS_56710 6202548 6201967 gene locus_tag LOCUS_56720 6202548 6201967 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972866.1 protein_id gnl|my_center|LOCUS_56720 6203757 6204311 gene locus_tag LOCUS_56730 6203757 6204311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56730 6205373 6204495 gene locus_tag LOCUS_56740 6205373 6204495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56740 6206262 6206465 gene locus_tag LOCUS_56750 6206262 6206465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56750 6207534 6207388 gene locus_tag LOCUS_56760 6207534 6207388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 6209327 6208557 gene locus_tag LOCUS_56770 6209327 6208557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56770 6209710 6210384 gene locus_tag LOCUS_56780 6209710 6210384 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223308.1 protein_id gnl|my_center|LOCUS_56780 6211634 6210978 gene locus_tag LOCUS_56790 6211634 6210978 CDS product DUF3156 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227628.1 protein_id gnl|my_center|LOCUS_56790 6211759 6212193 gene locus_tag LOCUS_56800 6211759 6212193 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224922.1 protein_id gnl|my_center|LOCUS_56800 6212544 6212978 gene locus_tag LOCUS_56810 6212544 6212978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56810 6213266 6213715 gene locus_tag LOCUS_56820 6213266 6213715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56820 6214520 6213987 gene locus_tag LOCUS_56830 6214520 6213987 CDS product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031802.1 protein_id gnl|my_center|LOCUS_56830 6214896 6214513 gene locus_tag LOCUS_56840 6214896 6214513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56840 6215102 6215857 gene locus_tag LOCUS_56850 6215102 6215857 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972538.1 protein_id gnl|my_center|LOCUS_56850 6215867 6217276 gene locus_tag LOCUS_56860 6215867 6217276 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030921.1 protein_id gnl|my_center|LOCUS_56860 6217273 6218382 gene locus_tag LOCUS_56870 6217273 6218382 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030922.1 protein_id gnl|my_center|LOCUS_56870 6218680 6219525 gene locus_tag LOCUS_56880 6218680 6219525 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030923.1 protein_id gnl|my_center|LOCUS_56880 6219801 6219535 gene locus_tag LOCUS_56890 6219801 6219535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56890 6220287 6219919 gene locus_tag LOCUS_56900 6220287 6219919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56900 6221925 6220441 gene locus_tag LOCUS_56910 6221925 6220441 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245274.1 protein_id gnl|my_center|LOCUS_56910 6221977 6222600 gene locus_tag LOCUS_56920 6221977 6222600 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026959.1 protein_id gnl|my_center|LOCUS_56920 6223551 6224267 gene locus_tag LOCUS_56930 6223551 6224267 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026963.1 protein_id gnl|my_center|LOCUS_56930 6224849 6224394 gene locus_tag LOCUS_56940 6224849 6224394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56940 6226101 6227027 gene locus_tag LOCUS_56950 6226101 6227027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56950 6227558 6227944 gene locus_tag LOCUS_56960 6227558 6227944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56960 6228303 6228512 gene locus_tag LOCUS_56970 6228303 6228512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56970 6228833 6229222 gene locus_tag LOCUS_56980 6228833 6229222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56980 6229652 6229347 gene locus_tag LOCUS_56990 6229652 6229347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56990 6229695 6229952 gene locus_tag LOCUS_57000 6229695 6229952 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173915017.1 protein_id gnl|my_center|LOCUS_57000 6230418 6229900 gene locus_tag LOCUS_57010 6230418 6229900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57010 6231561 6231352 gene locus_tag LOCUS_57020 6231561 6231352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 6231523 6233319 gene locus_tag LOCUS_57030 6231523 6233319 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551762.1 protein_id gnl|my_center|LOCUS_57030 6233501 6233791 gene locus_tag LOCUS_57040 6233501 6233791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57040 6233909 6236602 gene locus_tag LOCUS_57050 6233909 6236602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57050 6236698 6252795 gene locus_tag LOCUS_57060 6236698 6252795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_57060 6252792 6259190 gene locus_tag LOCUS_57070 6252792 6259190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_57070 6259190 6274972 gene locus_tag LOCUS_57080 6259190 6274972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_57080 6270280 6270204 gene locus_tag LOCUS_t00810 6270280 6270204 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6274972 6282132 gene locus_tag LOCUS_57090 6274972 6282132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 6282129 6282371 gene locus_tag LOCUS_57100 6282129 6282371 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975599.1 protein_id gnl|my_center|LOCUS_57100 6282485 6283279 gene locus_tag LOCUS_57110 6282485 6283279 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975579.1 protein_id gnl|my_center|LOCUS_57110 6283292 6284233 gene locus_tag LOCUS_57120 6283292 6284233 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201198.1 protein_id gnl|my_center|LOCUS_57120 6284311 6285099 gene locus_tag LOCUS_57130 6284311 6285099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57130 6285168 6286127 gene locus_tag LOCUS_57140 6285168 6286127 CDS product clavaminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028519.1 protein_id gnl|my_center|LOCUS_57140 6286127 6287188 gene locus_tag LOCUS_57150 6286127 6287188 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229376.1 protein_id gnl|my_center|LOCUS_57150 6287185 6288033 gene locus_tag LOCUS_57160 6287185 6288033 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229377.1 protein_id gnl|my_center|LOCUS_57160 6288731 6288099 gene locus_tag LOCUS_57170 6288731 6288099 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224042.1 protein_id gnl|my_center|LOCUS_57170 6289289 6290335 gene locus_tag LOCUS_57180 6289289 6290335 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010692778.1 protein_id gnl|my_center|LOCUS_57180 6290902 6290387 gene locus_tag LOCUS_57190 6290902 6290387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57190 6291402 6290923 gene locus_tag LOCUS_57200 6291402 6290923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57200 6291423 6292118 gene locus_tag LOCUS_57210 6291423 6292118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57210 6292137 6292538 gene locus_tag LOCUS_57220 6292137 6292538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57220 6292626 6292931 gene locus_tag LOCUS_57230 6292626 6292931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57230 6293229 6292921 gene locus_tag LOCUS_57240 6293229 6292921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57240 6294498 6293560 gene locus_tag LOCUS_57250 6294498 6293560 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107014379.1 protein_id gnl|my_center|LOCUS_57250 6294600 6295205 gene locus_tag LOCUS_57260 6294600 6295205 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941820.1 protein_id gnl|my_center|LOCUS_57260 6295858 6296190 gene locus_tag LOCUS_57270 6295858 6296190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57270 6296802 6297350 gene locus_tag LOCUS_57280 6296802 6297350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57280 6298068 6297517 gene locus_tag LOCUS_57290 6298068 6297517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57290 6298454 6299086 gene locus_tag LOCUS_57300 6298454 6299086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57300 6299099 6299320 gene locus_tag LOCUS_57310 6299099 6299320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57310 6300221 6299586 gene locus_tag LOCUS_57320 6300221 6299586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57320 6301350 6301982 gene locus_tag LOCUS_57330 6301350 6301982 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043290.1 protein_id gnl|my_center|LOCUS_57330 6303027 6302431 gene locus_tag LOCUS_57340 6303027 6302431 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223996.1 protein_id gnl|my_center|LOCUS_57340 6303115 6303846 gene locus_tag LOCUS_57350 6303115 6303846 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028483.1 protein_id gnl|my_center|LOCUS_57350 6303902 6304360 gene locus_tag LOCUS_57360 6303902 6304360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57360 6304750 6304514 gene locus_tag LOCUS_57370 6304750 6304514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57370 6305221 6304784 gene locus_tag LOCUS_57380 6305221 6304784 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224958.1 protein_id gnl|my_center|LOCUS_57380 6306521 6305382 gene locus_tag LOCUS_57390 6306521 6305382 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027597.1 protein_id gnl|my_center|LOCUS_57390 6307896 6307000 gene locus_tag LOCUS_57400 6307896 6307000 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894933.1 protein_id gnl|my_center|LOCUS_57400 6308601 6309053 gene locus_tag LOCUS_57410 6308601 6309053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57410 6309060 6309344 gene locus_tag LOCUS_57420 6309060 6309344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57420 6309341 6309886 gene locus_tag LOCUS_57430 6309341 6309886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57430 6309903 6310118 gene locus_tag LOCUS_57440 6309903 6310118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57440 6310125 6310724 gene locus_tag LOCUS_57450 6310125 6310724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57450 6311727 6310834 gene locus_tag LOCUS_57460 6311727 6310834 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 protein_id gnl|my_center|LOCUS_57460 6314078 6311949 gene locus_tag LOCUS_57470 6314078 6311949 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027598.1 protein_id gnl|my_center|LOCUS_57470 6315082 6314075 gene locus_tag LOCUS_57480 6315082 6314075 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727119.1 protein_id gnl|my_center|LOCUS_57480 6315627 6315079 gene locus_tag LOCUS_57490 6315627 6315079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57490 6316979 6315666 gene locus_tag LOCUS_57500 6316979 6315666 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976318.1 protein_id gnl|my_center|LOCUS_57500 6318016 6317237 gene locus_tag LOCUS_57510 6318016 6317237 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031575.1 protein_id gnl|my_center|LOCUS_57510 6319115 6318153 gene locus_tag LOCUS_57520 6319115 6318153 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225890812.1 protein_id gnl|my_center|LOCUS_57520 6320432 6319461 gene locus_tag LOCUS_57530 6320432 6319461 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222265.1 protein_id gnl|my_center|LOCUS_57530 6321670 6322266 gene locus_tag LOCUS_57540 6321670 6322266 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892317.1 protein_id gnl|my_center|LOCUS_57540 6322699 6322358 gene locus_tag LOCUS_57550 6322699 6322358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57550 6323533 6323087 gene locus_tag LOCUS_57560 6323533 6323087 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_57560 6323838 6324143 gene locus_tag LOCUS_57570 6323838 6324143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57570 6325716 6324100 gene locus_tag LOCUS_57580 6325716 6324100 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085144103.1 protein_id gnl|my_center|LOCUS_57580 6326904 6326431 gene locus_tag LOCUS_57590 6326904 6326431 CDS product DUF5709 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027611.1 protein_id gnl|my_center|LOCUS_57590 6327992 6327036 gene locus_tag LOCUS_57600 6327992 6327036 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100771272.1 protein_id gnl|my_center|LOCUS_57600 6328733 6328131 gene locus_tag LOCUS_57610 gene wrbA 6328733 6328131 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228078.1 protein_id gnl|my_center|LOCUS_57610 6329406 6330377 gene locus_tag LOCUS_57620 6329406 6330377 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222265.1 protein_id gnl|my_center|LOCUS_57620 6330458 6330778 gene locus_tag LOCUS_57630 6330458 6330778 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031863.1 protein_id gnl|my_center|LOCUS_57630 6331143 6331616 gene locus_tag LOCUS_57640 6331143 6331616 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031862.1 protein_id gnl|my_center|LOCUS_57640 6331649 6333325 gene locus_tag LOCUS_57650 6331649 6333325 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971843.1 protein_id gnl|my_center|LOCUS_57650 6333337 6334779 gene locus_tag LOCUS_57660 6333337 6334779 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031573.1 protein_id gnl|my_center|LOCUS_57660 6334776 6335129 gene locus_tag LOCUS_57670 6334776 6335129 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971845.1 protein_id gnl|my_center|LOCUS_57670 6338547 6335764 gene locus_tag LOCUS_57680 6338547 6335764 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150935635.1 protein_id gnl|my_center|LOCUS_57680 6339826 6339038 gene locus_tag LOCUS_57690 6339826 6339038 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974415.1 protein_id gnl|my_center|LOCUS_57690 6341095 6340727 gene locus_tag LOCUS_57700 6341095 6340727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57700 6341419 6341703 gene locus_tag LOCUS_57710 6341419 6341703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57710 6342588 6341878 gene locus_tag LOCUS_57720 6342588 6341878 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729757.1 protein_id gnl|my_center|LOCUS_57720 6343342 6343941 gene locus_tag LOCUS_57730 6343342 6343941 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061267.1 protein_id gnl|my_center|LOCUS_57730 6343926 6344600 gene locus_tag LOCUS_57740 6343926 6344600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57740 6344710 6346251 gene locus_tag LOCUS_57750 6344710 6346251 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815226.1 protein_id gnl|my_center|LOCUS_57750 6346347 6347018 gene locus_tag LOCUS_57760 6346347 6347018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57760 6347276 6347611 gene locus_tag LOCUS_57770 6347276 6347611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57770 6347949 6348296 gene locus_tag LOCUS_57780 6347949 6348296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 6348408 6348626 gene locus_tag LOCUS_57790 6348408 6348626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57790 6350034 6349186 gene locus_tag LOCUS_57800 6350034 6349186 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_57800 6350174 6350953 gene locus_tag LOCUS_57810 6350174 6350953 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389403.1 protein_id gnl|my_center|LOCUS_57810 6351206 6351607 gene locus_tag LOCUS_57820 6351206 6351607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57820 6352312 6351953 gene locus_tag LOCUS_57830 6352312 6351953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57830 6352458 6352961 gene locus_tag LOCUS_57840 6352458 6352961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57840 6353963 6353418 gene locus_tag LOCUS_57850 6353963 6353418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57850 6354097 6354534 gene locus_tag LOCUS_57860 6354097 6354534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57860 6354747 6354977 gene locus_tag LOCUS_57870 6354747 6354977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57870 6355311 6355006 gene locus_tag LOCUS_57880 6355311 6355006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57880 6355863 6355381 gene locus_tag LOCUS_57890 6355863 6355381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57890 6356010 6356567 gene locus_tag LOCUS_57900 6356010 6356567 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326304.1 protein_id gnl|my_center|LOCUS_57900 6356715 6357035 gene locus_tag LOCUS_57910 6356715 6357035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57910 6358331 6357705 gene locus_tag LOCUS_57920 6358331 6357705 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486466.1 protein_id gnl|my_center|LOCUS_57920 6358958 6358434 gene locus_tag LOCUS_57930 6358958 6358434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57930 6359155 6359730 gene locus_tag LOCUS_57940 6359155 6359730 CDS product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487417.1 protein_id gnl|my_center|LOCUS_57940 6359804 6360091 gene locus_tag LOCUS_57950 6359804 6360091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 6360088 6360207 gene locus_tag LOCUS_57960 6360088 6360207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57960 6360843 6361148 gene locus_tag LOCUS_57970 6360843 6361148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57970 6361304 6361435 gene locus_tag LOCUS_57980 6361304 6361435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57980 6364491 6361516 gene locus_tag LOCUS_57990 6364491 6361516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57990 6364708 6364493 gene locus_tag LOCUS_58000 6364708 6364493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58000 6365352 6364705 gene locus_tag LOCUS_58010 6365352 6364705 CDS product DUF6338 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224786.1 protein_id gnl|my_center|LOCUS_58010 6365784 6365359 gene locus_tag LOCUS_58020 6365784 6365359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58020 6367327 6366371 gene locus_tag LOCUS_58030 6367327 6366371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58030 6368626 6367808 gene locus_tag LOCUS_58040 6368626 6367808 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971940.1 protein_id gnl|my_center|LOCUS_58040 6369013 6368837 gene locus_tag LOCUS_58050 6369013 6368837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58050 6369281 6369078 gene locus_tag LOCUS_58060 6369281 6369078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58060 6370635 6372266 gene locus_tag LOCUS_58070 gene uppS 6370635 6372266 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079172237.1 protein_id gnl|my_center|LOCUS_58070 6372446 6372318 gene locus_tag LOCUS_58080 6372446 6372318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58080 6372592 6372464 gene locus_tag LOCUS_58090 6372592 6372464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58090 6372877 6372686 gene locus_tag LOCUS_58100 6372877 6372686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_58100 6373415 6374011 gene locus_tag LOCUS_58110 6373415 6374011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58110 6374810 6374253 gene locus_tag LOCUS_58120 6374810 6374253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971403.1 protein_id gnl|my_center|LOCUS_58120 6377057 6374823 gene locus_tag LOCUS_58130 6377057 6374823 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031868.1 protein_id gnl|my_center|LOCUS_58130 6377420 6377893 gene locus_tag LOCUS_58140 6377420 6377893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58140 6378324 6378067 gene locus_tag LOCUS_58150 6378324 6378067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58150 6378373 6379758 gene locus_tag LOCUS_58160 6378373 6379758 CDS product ISL3-like element IS469 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029007.1 protein_id gnl|my_center|LOCUS_58160 6380264 6379767 gene locus_tag LOCUS_58170 6380264 6379767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58170 6380770 6380210 gene locus_tag LOCUS_58180 6380770 6380210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58180 6381032 6380757 gene locus_tag LOCUS_58190 6381032 6380757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58190 6381607 6381176 gene locus_tag LOCUS_58200 6381607 6381176 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530912.1 protein_id gnl|my_center|LOCUS_58200 6382432 6381785 gene locus_tag LOCUS_58210 6382432 6381785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58210 6383937 6382954 gene locus_tag LOCUS_58220 6383937 6382954 CDS product clavaminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028519.1 protein_id gnl|my_center|LOCUS_58220 6383821 6384312 gene locus_tag LOCUS_58230 6383821 6384312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58230 6384872 6385342 gene locus_tag LOCUS_58240 6384872 6385342 CDS product MSMEG_6728 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971750.1 protein_id gnl|my_center|LOCUS_58240 6385575 6387179 gene locus_tag LOCUS_58250 6385575 6387179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58250 6387686 6387513 gene locus_tag LOCUS_58260 6387686 6387513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58260 6388438 6387683 gene locus_tag LOCUS_58270 6388438 6387683 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031096.1 protein_id gnl|my_center|LOCUS_58270 6389307 6388435 gene locus_tag LOCUS_58280 6389307 6388435 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_58280 6391177 6389321 gene locus_tag LOCUS_58290 6391177 6389321 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_58290 6392975 6391218 gene locus_tag LOCUS_58300 6392975 6391218 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_58300 6393251 6394282 gene locus_tag LOCUS_58310 gene gmd 6393251 6394282 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284917.1 protein_id gnl|my_center|LOCUS_58310 6394465 6422943 gene locus_tag LOCUS_58320 6394465 6422943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58320 6422966 6439258 gene locus_tag LOCUS_58330 6422966 6439258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58330 6439309 6445476 gene locus_tag LOCUS_58340 6439309 6445476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58340 6445578 6446762 gene locus_tag LOCUS_58350 6445578 6446762 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112110.1 protein_id gnl|my_center|LOCUS_58350 6446978 6446784 gene locus_tag LOCUS_58360 6446978 6446784 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229193.1 protein_id gnl|my_center|LOCUS_58360 6448240 6447065 gene locus_tag LOCUS_58370 6448240 6447065 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222787.1 protein_id gnl|my_center|LOCUS_58370 6449327 6448272 gene locus_tag LOCUS_58380 6449327 6448272 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_58380 6450743 6449340 gene locus_tag LOCUS_58390 6450743 6449340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58390 6450953 6455080 gene locus_tag LOCUS_58400 6450953 6455080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58400 6455124 6464738 gene locus_tag LOCUS_58410 6455124 6464738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58410 6464828 6497575 gene locus_tag LOCUS_58420 6464828 6497575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58420 6489898 6489990 gene locus_tag LOCUS_t00820 6489898 6489990 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6497649 6497936 gene locus_tag LOCUS_58430 6497649 6497936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58430 6497951 6498706 gene locus_tag LOCUS_58440 6497951 6498706 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229866.1 protein_id gnl|my_center|LOCUS_58440 6499074 6501977 gene locus_tag LOCUS_58450 6499074 6501977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58450 6502725 6505505 gene locus_tag LOCUS_58460 6502725 6505505 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156089687.1 protein_id gnl|my_center|LOCUS_58460 6505885 6506568 gene locus_tag LOCUS_58470 6505885 6506568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58470 6506858 6506502 gene locus_tag LOCUS_58480 6506858 6506502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58480 6507240 6507488 gene locus_tag LOCUS_58490 6507240 6507488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58490 6507977 6508747 gene locus_tag LOCUS_58500 6507977 6508747 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976922.1 protein_id gnl|my_center|LOCUS_58500 6508833 6510200 gene locus_tag LOCUS_58510 6508833 6510200 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976921.1 protein_id gnl|my_center|LOCUS_58510 6510197 6511180 gene locus_tag LOCUS_58520 6510197 6511180 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976920.1 protein_id gnl|my_center|LOCUS_58520 6511177 6512061 gene locus_tag LOCUS_58530 6511177 6512061 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028038.1 protein_id gnl|my_center|LOCUS_58530 6512058 6513047 gene locus_tag LOCUS_58540 6512058 6513047 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976918.1 protein_id gnl|my_center|LOCUS_58540 6513044 6513994 gene locus_tag LOCUS_58550 6513044 6513994 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028065.1 protein_id gnl|my_center|LOCUS_58550 6514265 6514564 gene locus_tag LOCUS_58560 6514265 6514564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58560 6514686 6515381 gene locus_tag LOCUS_58570 6514686 6515381 CDS product IS5/IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006130399.1 protein_id gnl|my_center|LOCUS_58570 6515771 6516148 gene locus_tag LOCUS_58580 6515771 6516148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58580 6516145 6516654 gene locus_tag LOCUS_58590 6516145 6516654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58590 6518245 6516902 gene locus_tag LOCUS_58600 6518245 6516902 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466931.1 protein_id gnl|my_center|LOCUS_58600 6518414 6518713 gene locus_tag LOCUS_58610 6518414 6518713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58610 6519077 6518760 gene locus_tag LOCUS_58620 6519077 6518760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58620 6519595 6519245 gene locus_tag LOCUS_58630 6519595 6519245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58630 6519754 6520026 gene locus_tag LOCUS_58640 6519754 6520026 CDS product DUF3253 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035426.1 protein_id gnl|my_center|LOCUS_58640 6520041 6520571 gene locus_tag LOCUS_58650 6520041 6520571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58650 6521237 6520899 gene locus_tag LOCUS_58660 6521237 6520899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58660 6521643 6521368 gene locus_tag LOCUS_58670 6521643 6521368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58670 6522445 6521747 gene locus_tag LOCUS_58680 6522445 6521747 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170061.1 protein_id gnl|my_center|LOCUS_58680 6522654 6523523 gene locus_tag LOCUS_58690 6522654 6523523 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204051675.1 protein_id gnl|my_center|LOCUS_58690 6523748 6524251 gene locus_tag LOCUS_58700 6523748 6524251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_58700 6524464 6524679 gene locus_tag LOCUS_58710 6524464 6524679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58710 6525525 6525872 gene locus_tag LOCUS_58720 6525525 6525872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 6525869 6526225 gene locus_tag LOCUS_58730 6525869 6526225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58730 6527308 6526475 gene locus_tag LOCUS_58740 6527308 6526475 CDS product IS5/IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006130399.1 protein_id gnl|my_center|LOCUS_58740 6527836 6527381 gene locus_tag LOCUS_58750 6527836 6527381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58750 6528731 6527931 gene locus_tag LOCUS_58760 6528731 6527931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58760 6530912 6529044 gene locus_tag LOCUS_58770 6530912 6529044 CDS product glycoside hydrolase family 18 chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030211.1 protein_id gnl|my_center|LOCUS_58770 6531076 6531351 gene locus_tag LOCUS_58780 6531076 6531351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58780 6531588 6531944 gene locus_tag LOCUS_58790 6531588 6531944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58790 6532269 6532090 gene locus_tag LOCUS_58800 6532269 6532090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58800 6532544 6532275 gene locus_tag LOCUS_58810 6532544 6532275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58810 6533105 6532812 gene locus_tag LOCUS_58820 6533105 6532812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58820 6533038 6533643 gene locus_tag LOCUS_58830 6533038 6533643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58830 6534020 6533766 gene locus_tag LOCUS_58840 6534020 6533766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_58840 6534794 6534090 gene locus_tag LOCUS_58850 6534794 6534090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029884.1 protein_id gnl|my_center|LOCUS_58850 6535184 6534846 gene locus_tag LOCUS_58860 6535184 6534846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873079.1 protein_id gnl|my_center|LOCUS_58860 6537400 6535199 gene locus_tag LOCUS_58870 6537400 6535199 CDS product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067017469.1 protein_id gnl|my_center|LOCUS_58870 6537986 6538834 gene locus_tag LOCUS_58880 6537986 6538834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_58880 6539402 6539157 gene locus_tag LOCUS_58890 6539402 6539157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58890 6539394 6539639 gene locus_tag LOCUS_58900 6539394 6539639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58900 6539725 6541428 gene locus_tag LOCUS_58910 6539725 6541428 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031941.1 protein_id gnl|my_center|LOCUS_58910 6541377 6541793 gene locus_tag LOCUS_58920 6541377 6541793 CDS product DUF4259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887029.1 protein_id gnl|my_center|LOCUS_58920 6542044 6542466 gene locus_tag LOCUS_58930 6542044 6542466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58930 6542990 6542574 gene locus_tag LOCUS_58940 6542990 6542574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58940 6543776 6543591 gene locus_tag LOCUS_58950 6543776 6543591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58950 6544790 6543870 gene locus_tag LOCUS_58960 6544790 6543870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58960 6544886 6545596 gene locus_tag LOCUS_58970 6544886 6545596 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228563.1 protein_id gnl|my_center|LOCUS_58970 6547436 6546153 gene locus_tag LOCUS_58980 6547436 6546153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58980 6547673 6548212 gene locus_tag LOCUS_58990 6547673 6548212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58990 6548582 6548112 gene locus_tag LOCUS_59000 6548582 6548112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59000 6549136 6548960 gene locus_tag LOCUS_59010 6549136 6548960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59010 6549202 6549399 gene locus_tag LOCUS_59020 6549202 6549399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59020 6549853 6550215 gene locus_tag LOCUS_59030 6549853 6550215 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107426074.1 protein_id gnl|my_center|LOCUS_59030 6551169 6550537 gene locus_tag LOCUS_59040 6551169 6550537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59040 6553304 6551223 gene locus_tag LOCUS_59050 6553304 6551223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59050 6554331 6553534 gene locus_tag LOCUS_59060 6554331 6553534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59060 6555126 6554437 gene locus_tag LOCUS_59070 6555126 6554437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59070 6555759 6555142 gene locus_tag LOCUS_59080 6555759 6555142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59080 6557027 6555897 gene locus_tag LOCUS_59090 6557027 6555897 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169733975.1 protein_id gnl|my_center|LOCUS_59090 6557195 6557028 gene locus_tag LOCUS_59100 6557195 6557028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59100 6557640 6557921 gene locus_tag LOCUS_59110 6557640 6557921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59110 6558173 6558427 gene locus_tag LOCUS_59120 6558173 6558427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59120 6559002 6558592 gene locus_tag LOCUS_59130 6559002 6558592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59130 6565765 6559109 gene locus_tag LOCUS_59140 6565765 6559109 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030747.1 protein_id gnl|my_center|LOCUS_59140 6569519 6565824 gene locus_tag LOCUS_59150 6569519 6565824 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184834092.1 protein_id gnl|my_center|LOCUS_59150 6569832 6570149 gene locus_tag LOCUS_59160 6569832 6570149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59160 6570146 6571237 gene locus_tag LOCUS_59170 6570146 6571237 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486832.1 protein_id gnl|my_center|LOCUS_59170 6572184 6571789 gene locus_tag LOCUS_59180 6572184 6571789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59180 6573078 6572557 gene locus_tag LOCUS_59190 6573078 6572557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59190 6573337 6573657 gene locus_tag LOCUS_59200 6573337 6573657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59200 6573597 6573812 gene locus_tag LOCUS_59210 6573597 6573812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59210 6577958 6574026 gene locus_tag LOCUS_59220 6577958 6574026 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157166402.1 protein_id gnl|my_center|LOCUS_59220 6578178 6578657 gene locus_tag LOCUS_59230 6578178 6578657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59230 6579291 6578845 gene locus_tag LOCUS_59240 6579291 6578845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59240 6579531 6579926 gene locus_tag LOCUS_59250 6579531 6579926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59250 6580096 6579923 gene locus_tag LOCUS_59260 6580096 6579923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59260 6580117 6580662 gene locus_tag LOCUS_59270 6580117 6580662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59270 6582030 6582410 gene locus_tag LOCUS_59280 6582030 6582410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974081.1 protein_id gnl|my_center|LOCUS_59280 6582719 6583156 gene locus_tag LOCUS_59290 6582719 6583156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59290 6583442 6584449 gene locus_tag LOCUS_59300 6583442 6584449 CDS product ISAs1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043791004.1 protein_id gnl|my_center|LOCUS_59300 6584680 6584976 gene locus_tag LOCUS_59310 6584680 6584976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59310 6585558 6585370 gene locus_tag LOCUS_59320 6585558 6585370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59320 6586438 6585914 gene locus_tag LOCUS_59330 6586438 6585914 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027861.1 protein_id gnl|my_center|LOCUS_59330 6586920 6587231 gene locus_tag LOCUS_59340 6586920 6587231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59340 6587584 6587267 gene locus_tag LOCUS_59350 6587584 6587267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59350 6588011 6588559 gene locus_tag LOCUS_59360 6588011 6588559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59360 6589284 6589751 gene locus_tag LOCUS_59370 6589284 6589751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59370 6590530 6589835 gene locus_tag LOCUS_59380 6590530 6589835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59380 6591353 6591598 gene locus_tag LOCUS_59390 6591353 6591598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59390 6591747 6591941 gene locus_tag LOCUS_59400 6591747 6591941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59400 6592247 6593326 gene locus_tag LOCUS_59410 6592247 6593326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59410 6593305 6593910 gene locus_tag LOCUS_59420 6593305 6593910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59420 6593907 6595895 gene locus_tag LOCUS_59430 6593907 6595895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59430 6597150 6596182 gene locus_tag LOCUS_59440 6597150 6596182 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104311.1 protein_id gnl|my_center|LOCUS_59440 6599402 6597267 gene locus_tag LOCUS_59450 6599402 6597267 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079184950.1 protein_id gnl|my_center|LOCUS_59450 6600214 6599399 gene locus_tag LOCUS_59460 6600214 6599399 CDS product TnsA-like heteromeric transposase endonuclease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073792743.1 protein_id gnl|my_center|LOCUS_59460 6601790 6600387 gene locus_tag LOCUS_59470 6601790 6600387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59470 6602217 6602471 gene locus_tag LOCUS_59480 6602217 6602471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59480 6602468 6602992 gene locus_tag LOCUS_59490 6602468 6602992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59490 6602989 6603624 gene locus_tag LOCUS_59500 6602989 6603624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59500 6605219 6604167 gene locus_tag LOCUS_59510 6605219 6604167 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_59510 6605688 6605356 gene locus_tag LOCUS_59520 6605688 6605356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59520 6605779 6605970 gene locus_tag LOCUS_59530 6605779 6605970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59530 6605988 6606326 gene locus_tag LOCUS_59540 6605988 6606326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59540 >Feature sequence2 1385 18 gene locus_tag LOCUS_59550 gene dnaB 1385 18 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975021.1 protein_id gnl|my_center|LOCUS_59550 2417 1467 gene locus_tag LOCUS_59560 2417 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59560 2926 2672 gene locus_tag LOCUS_59570 2926 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59570 3858 3121 gene locus_tag LOCUS_59580 3858 3121 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392825.1 protein_id gnl|my_center|LOCUS_59580 4028 4573 gene locus_tag LOCUS_59590 4028 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59590 4570 4815 gene locus_tag LOCUS_59600 4570 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59600 4815 5090 gene locus_tag LOCUS_59610 4815 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59610 5090 5851 gene locus_tag LOCUS_59620 5090 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59620 5988 8102 gene locus_tag LOCUS_59630 gene traB 5988 8102 CDS product plasmid transfer protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029769.1 protein_id gnl|my_center|LOCUS_59630 8289 8780 gene locus_tag LOCUS_59640 8289 8780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59640 8777 9154 gene locus_tag LOCUS_59650 8777 9154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59650 9227 9400 gene locus_tag LOCUS_59660 9227 9400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59660 9731 9465 gene locus_tag LOCUS_59670 9731 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59670 9835 10269 gene locus_tag LOCUS_59680 9835 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59680 10350 12353 gene locus_tag LOCUS_59690 10350 12353 CDS product DUF2637 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011005823.1 protein_id gnl|my_center|LOCUS_59690 12658 13512 gene locus_tag LOCUS_59700 12658 13512 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805154.1 protein_id gnl|my_center|LOCUS_59700 13515 13760 gene locus_tag LOCUS_59710 13515 13760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59710 15143 15316 gene locus_tag LOCUS_59720 15143 15316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59720 15599 16036 gene locus_tag LOCUS_59730 15599 16036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59730 16550 16068 gene locus_tag LOCUS_59740 16550 16068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59740 16706 18796 gene locus_tag LOCUS_59750 16706 18796 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023543993.1 protein_id gnl|my_center|LOCUS_59750 18849 19865 gene locus_tag LOCUS_59760 18849 19865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59760 19887 20126 gene locus_tag LOCUS_59770 19887 20126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59770 20126 20692 gene locus_tag LOCUS_59780 20126 20692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59780 20689 23211 gene locus_tag LOCUS_59790 20689 23211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59790 23208 23717 gene locus_tag LOCUS_59800 23208 23717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59800 23714 25606 gene locus_tag LOCUS_59810 23714 25606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59810 25621 26340 gene locus_tag LOCUS_59820 25621 26340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59820 26340 27497 gene locus_tag LOCUS_59830 26340 27497 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029047.1 protein_id gnl|my_center|LOCUS_59830 27497 28153 gene locus_tag LOCUS_59840 27497 28153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59840 28749 28444 gene locus_tag LOCUS_59850 28749 28444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027204.1 protein_id gnl|my_center|LOCUS_59850 29135 28842 gene locus_tag LOCUS_59860 29135 28842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59860 29259 29504 gene locus_tag LOCUS_59870 29259 29504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59870 30026 29640 gene locus_tag LOCUS_59880 30026 29640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59880 30597 30169 gene locus_tag LOCUS_59890 30597 30169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59890 30890 30594 gene locus_tag LOCUS_59900 30890 30594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59900 33580 30887 gene locus_tag LOCUS_59910 33580 30887 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201843320.1 protein_id gnl|my_center|LOCUS_59910 33617 35308 gene locus_tag LOCUS_59920 33617 35308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59920 35308 35883 gene locus_tag LOCUS_59930 35308 35883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59930 35966 37162 gene locus_tag LOCUS_59940 35966 37162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59940 37369 38358 gene locus_tag LOCUS_59950 37369 38358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749452.1 protein_id gnl|my_center|LOCUS_59950