>Feature sequence1 2489 1788 gene locus_tag LOCUS_00010 2489 1788 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230830.1 protein_id gnl|my_center|LOCUS_00010 2488 3225 gene locus_tag LOCUS_00020 2488 3225 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776560.1 protein_id gnl|my_center|LOCUS_00020 4278 3436 gene locus_tag LOCUS_00030 4278 3436 CDS product putative protein N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031408.1 protein_id gnl|my_center|LOCUS_00030 4352 5134 gene locus_tag LOCUS_00040 4352 5134 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862621.1 protein_id gnl|my_center|LOCUS_00040 5151 5666 gene locus_tag LOCUS_00050 5151 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5796 6821 gene locus_tag LOCUS_00060 gene fbaA 5796 6821 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029142.1 protein_id gnl|my_center|LOCUS_00060 6818 7894 gene locus_tag LOCUS_00070 6818 7894 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891444.1 protein_id gnl|my_center|LOCUS_00070 8201 7872 gene locus_tag LOCUS_00080 8201 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9121 8156 gene locus_tag LOCUS_00090 9121 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223951.1 protein_id gnl|my_center|LOCUS_00090 9945 9118 gene locus_tag LOCUS_00100 9945 9118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11870 9948 gene locus_tag LOCUS_00110 11870 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11987 12436 gene locus_tag LOCUS_00120 11987 12436 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_00120 12685 13974 gene locus_tag LOCUS_00130 12685 13974 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_00130 15246 13993 gene locus_tag LOCUS_00140 15246 13993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15319 16617 gene locus_tag LOCUS_00150 gene purD 15319 16617 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_00150 16614 18062 gene locus_tag LOCUS_00160 gene purB 16614 18062 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_00160 19681 18152 gene locus_tag LOCUS_00170 19681 18152 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030661.1 protein_id gnl|my_center|LOCUS_00170 19791 20720 gene locus_tag LOCUS_00180 19791 20720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 20717 21094 gene locus_tag LOCUS_00190 20717 21094 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223657.1 protein_id gnl|my_center|LOCUS_00190 21191 21985 gene locus_tag LOCUS_00200 21191 21985 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804600.1 protein_id gnl|my_center|LOCUS_00200 21978 22826 gene locus_tag LOCUS_00210 21978 22826 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804599.1 protein_id gnl|my_center|LOCUS_00210 22877 23827 gene locus_tag LOCUS_00220 22877 23827 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804598.1 protein_id gnl|my_center|LOCUS_00220 24103 23924 gene locus_tag LOCUS_00230 24103 23924 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974070.1 protein_id gnl|my_center|LOCUS_00230 24275 25207 gene locus_tag LOCUS_00240 24275 25207 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 protein_id gnl|my_center|LOCUS_00240 25275 25550 gene locus_tag LOCUS_00250 gene purS 25275 25550 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776336.1 protein_id gnl|my_center|LOCUS_00250 25547 26230 gene locus_tag LOCUS_00260 gene purQ 25547 26230 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974894.1 protein_id gnl|my_center|LOCUS_00260 26257 28386 gene locus_tag LOCUS_00270 26257 28386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 28416 30677 gene locus_tag LOCUS_00280 gene purL 28416 30677 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_00280 30933 31559 gene locus_tag LOCUS_00290 30933 31559 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898105.1 protein_id gnl|my_center|LOCUS_00290 31607 33817 gene locus_tag LOCUS_00300 31607 33817 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804792.1 protein_id gnl|my_center|LOCUS_00300 33910 34848 gene locus_tag LOCUS_00310 33910 34848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34945 36294 gene locus_tag LOCUS_00320 34945 36294 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412946.1 protein_id gnl|my_center|LOCUS_00320 36441 37391 gene locus_tag LOCUS_00330 36441 37391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38258 37395 gene locus_tag LOCUS_00340 38258 37395 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976274.1 protein_id gnl|my_center|LOCUS_00340 39222 38260 gene locus_tag LOCUS_00350 39222 38260 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392451.1 protein_id gnl|my_center|LOCUS_00350 40568 39219 gene locus_tag LOCUS_00360 40568 39219 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976276.1 protein_id gnl|my_center|LOCUS_00360 42427 40601 gene locus_tag LOCUS_00370 42427 40601 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225268.1 protein_id gnl|my_center|LOCUS_00370 42576 43607 gene locus_tag LOCUS_00380 42576 43607 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225264.1 protein_id gnl|my_center|LOCUS_00380 44421 43837 gene locus_tag LOCUS_00390 44421 43837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 45029 44586 gene locus_tag LOCUS_00400 45029 44586 CDS product OsmC family peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224811.1 protein_id gnl|my_center|LOCUS_00400 45154 45570 gene locus_tag LOCUS_00410 45154 45570 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224812.1 protein_id gnl|my_center|LOCUS_00410 45969 46139 gene locus_tag LOCUS_00420 45969 46139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 47055 46189 gene locus_tag LOCUS_00430 47055 46189 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975294.1 protein_id gnl|my_center|LOCUS_00430 47155 48705 gene locus_tag LOCUS_00440 gene purF 47155 48705 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_00440 48816 49802 gene locus_tag LOCUS_00450 gene purM 48816 49802 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974885.1 protein_id gnl|my_center|LOCUS_00450 49945 50154 gene locus_tag LOCUS_00460 49945 50154 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230732.1 protein_id gnl|my_center|LOCUS_00460 50213 51373 gene locus_tag LOCUS_00470 50213 51373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 51469 52488 gene locus_tag LOCUS_00480 51469 52488 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819405.1 protein_id gnl|my_center|LOCUS_00480 52664 52452 gene locus_tag LOCUS_00490 52664 52452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 52605 53858 gene locus_tag LOCUS_00500 52605 53858 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930303.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00500 54850 54113 gene locus_tag LOCUS_00510 54850 54113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 55400 54834 gene locus_tag LOCUS_00520 55400 54834 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026917.1 protein_id gnl|my_center|LOCUS_00520 55595 55520 gene locus_tag LOCUS_t00010 55595 55520 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 55736 55662 gene locus_tag LOCUS_t00020 55736 55662 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 56039 57556 gene locus_tag LOCUS_00530 56039 57556 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975714.1 protein_id gnl|my_center|LOCUS_00530 58100 57651 gene locus_tag LOCUS_00540 58100 57651 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224657.1 protein_id gnl|my_center|LOCUS_00540 58095 58538 gene locus_tag LOCUS_00550 58095 58538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 58604 59566 gene locus_tag LOCUS_00560 58604 59566 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226859.1 protein_id gnl|my_center|LOCUS_00560 59694 59978 gene locus_tag LOCUS_00570 59694 59978 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225091.1 protein_id gnl|my_center|LOCUS_00570 65785 60254 gene locus_tag LOCUS_00580 65785 60254 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226015.1 protein_id gnl|my_center|LOCUS_00580 65964 66365 gene locus_tag LOCUS_00590 65964 66365 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106807.1 protein_id gnl|my_center|LOCUS_00590 66418 66747 gene locus_tag LOCUS_00600 66418 66747 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429484.1 protein_id gnl|my_center|LOCUS_00600 66749 67117 gene locus_tag LOCUS_00610 66749 67117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 67468 68796 gene locus_tag LOCUS_00620 gene nhaA 67468 68796 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081951.1 protein_id gnl|my_center|LOCUS_00620 68872 70329 gene locus_tag LOCUS_00630 68872 70329 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227524.1 protein_id gnl|my_center|LOCUS_00630 71134 70394 gene locus_tag LOCUS_00640 71134 70394 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079514.1 protein_id gnl|my_center|LOCUS_00640 71994 71311 gene locus_tag LOCUS_00650 71994 71311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 72276 72908 gene locus_tag LOCUS_00660 72276 72908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 73125 74063 gene locus_tag LOCUS_00670 73125 74063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 74253 75074 gene locus_tag LOCUS_00680 74253 75074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 75071 76684 gene locus_tag LOCUS_00690 75071 76684 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417969.1 protein_id gnl|my_center|LOCUS_00690 77604 76681 gene locus_tag LOCUS_00700 77604 76681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 77963 77601 gene locus_tag LOCUS_00710 77963 77601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 78021 79808 gene locus_tag LOCUS_00720 78021 79808 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564050.1 protein_id gnl|my_center|LOCUS_00720 79805 80959 gene locus_tag LOCUS_00730 79805 80959 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013588.1 protein_id gnl|my_center|LOCUS_00730 81037 81936 gene locus_tag LOCUS_00740 81037 81936 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222871.1 protein_id gnl|my_center|LOCUS_00740 82723 81974 gene locus_tag LOCUS_00750 82723 81974 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224249.1 protein_id gnl|my_center|LOCUS_00750 82803 84287 gene locus_tag LOCUS_00760 82803 84287 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029391.1 protein_id gnl|my_center|LOCUS_00760 84729 84394 gene locus_tag LOCUS_00770 84729 84394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 85455 84760 gene locus_tag LOCUS_00780 85455 84760 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026982.1 protein_id gnl|my_center|LOCUS_00780 85653 85892 gene locus_tag LOCUS_00790 85653 85892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 85990 86214 gene locus_tag LOCUS_00800 85990 86214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 88383 86266 gene locus_tag LOCUS_00810 88383 86266 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876865.1 protein_id gnl|my_center|LOCUS_00810 88455 88886 gene locus_tag LOCUS_00820 88455 88886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 90205 89375 gene locus_tag LOCUS_00830 90205 89375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 91383 90709 gene locus_tag LOCUS_00840 91383 90709 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027261.1 protein_id gnl|my_center|LOCUS_00840 92594 91662 gene locus_tag LOCUS_00850 92594 91662 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224311.1 protein_id gnl|my_center|LOCUS_00850 93054 94601 gene locus_tag LOCUS_00860 93054 94601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 94598 96658 gene locus_tag LOCUS_00870 94598 96658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 96705 97694 gene locus_tag LOCUS_00880 96705 97694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 97961 98896 gene locus_tag LOCUS_00890 97961 98896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 98893 99570 gene locus_tag LOCUS_00900 98893 99570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 100068 100883 gene locus_tag LOCUS_00910 100068 100883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00910 100880 101248 gene locus_tag LOCUS_00920 100880 101248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 101639 102796 gene locus_tag LOCUS_00930 101639 102796 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_00930 102961 102886 gene locus_tag LOCUS_t00030 102961 102886 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 103011 103364 gene locus_tag LOCUS_00940 103011 103364 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222136.1 protein_id gnl|my_center|LOCUS_00940 103727 103416 gene locus_tag LOCUS_00950 103727 103416 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223737.1 protein_id gnl|my_center|LOCUS_00950 104107 103724 gene locus_tag LOCUS_00960 104107 103724 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857248.1 protein_id gnl|my_center|LOCUS_00960 105030 104104 gene locus_tag LOCUS_00970 105030 104104 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028478.1 protein_id gnl|my_center|LOCUS_00970 105768 105079 gene locus_tag LOCUS_00980 105768 105079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 106369 105800 gene locus_tag LOCUS_00990 106369 105800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 106629 107108 gene locus_tag LOCUS_01000 106629 107108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 108821 107115 gene locus_tag LOCUS_01010 108821 107115 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113016.1 protein_id gnl|my_center|LOCUS_01010 110497 108818 gene locus_tag LOCUS_01020 110497 108818 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803733.1 protein_id gnl|my_center|LOCUS_01020 111522 110524 gene locus_tag LOCUS_01030 111522 110524 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004124746.1 protein_id gnl|my_center|LOCUS_01030 112451 111519 gene locus_tag LOCUS_01040 112451 111519 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929818.1 protein_id gnl|my_center|LOCUS_01040 114047 112593 gene locus_tag LOCUS_01050 114047 112593 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122543.1 protein_id gnl|my_center|LOCUS_01050 114166 115911 gene locus_tag LOCUS_01060 114166 115911 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157683565.1 protein_id gnl|my_center|LOCUS_01060 115986 116060 gene locus_tag LOCUS_t00040 115986 116060 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 117060 116056 gene locus_tag LOCUS_01070 117060 116056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 116957 118264 gene locus_tag LOCUS_01080 116957 118264 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208608108.1 protein_id gnl|my_center|LOCUS_01080 118298 119317 gene locus_tag LOCUS_01090 118298 119317 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029972.1 protein_id gnl|my_center|LOCUS_01090 119964 119398 gene locus_tag LOCUS_01100 119964 119398 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223792.1 protein_id gnl|my_center|LOCUS_01100 120103 120528 gene locus_tag LOCUS_01110 120103 120528 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928468.1 protein_id gnl|my_center|LOCUS_01110 122113 121295 gene locus_tag LOCUS_01120 122113 121295 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223645.1 protein_id gnl|my_center|LOCUS_01120 122158 122793 gene locus_tag LOCUS_01130 122158 122793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 122863 123240 gene locus_tag LOCUS_01140 122863 123240 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228109.1 protein_id gnl|my_center|LOCUS_01140 124063 123272 gene locus_tag LOCUS_01150 124063 123272 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726808.1 protein_id gnl|my_center|LOCUS_01150 124477 124118 gene locus_tag LOCUS_01160 124477 124118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877697.1 protein_id gnl|my_center|LOCUS_01160 124556 125350 gene locus_tag LOCUS_01170 124556 125350 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026878.1 protein_id gnl|my_center|LOCUS_01170 126125 125370 gene locus_tag LOCUS_01180 126125 125370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 126573 126163 gene locus_tag LOCUS_01190 126573 126163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 126702 127271 gene locus_tag LOCUS_01200 126702 127271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 127930 127298 gene locus_tag LOCUS_01210 127930 127298 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166534399.1 protein_id gnl|my_center|LOCUS_01210 128523 127927 gene locus_tag LOCUS_01220 128523 127927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 128592 129095 gene locus_tag LOCUS_01230 128592 129095 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529229.1 protein_id gnl|my_center|LOCUS_01230 129151 129933 gene locus_tag LOCUS_01240 129151 129933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 129930 130325 gene locus_tag LOCUS_01250 129930 130325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 130369 130641 gene locus_tag LOCUS_01260 130369 130641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 130661 131569 gene locus_tag LOCUS_01270 130661 131569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 132160 131615 gene locus_tag LOCUS_01280 132160 131615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 132288 133118 gene locus_tag LOCUS_01290 132288 133118 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728098.1 protein_id gnl|my_center|LOCUS_01290 133186 134073 gene locus_tag LOCUS_01300 133186 134073 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328866.1 protein_id gnl|my_center|LOCUS_01300 134070 134636 gene locus_tag LOCUS_01310 134070 134636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 135545 134715 gene locus_tag LOCUS_01320 135545 134715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 135907 135629 gene locus_tag LOCUS_01330 135907 135629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 136140 135907 gene locus_tag LOCUS_01340 136140 135907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 136775 136284 gene locus_tag LOCUS_01350 136775 136284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 137089 136772 gene locus_tag LOCUS_01360 137089 136772 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804808.1 protein_id gnl|my_center|LOCUS_01360 137683 137141 gene locus_tag LOCUS_01370 137683 137141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 138006 138281 gene locus_tag LOCUS_01380 138006 138281 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511323.1 protein_id gnl|my_center|LOCUS_01380 139723 138455 gene locus_tag LOCUS_01390 139723 138455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 140333 139731 gene locus_tag LOCUS_01400 140333 139731 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209677908.1 protein_id gnl|my_center|LOCUS_01400 140559 141602 gene locus_tag LOCUS_01410 140559 141602 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976856.1 protein_id gnl|my_center|LOCUS_01410 141773 142048 gene locus_tag LOCUS_01420 141773 142048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 142130 142987 gene locus_tag LOCUS_01430 142130 142987 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 protein_id gnl|my_center|LOCUS_01430 144579 143155 gene locus_tag LOCUS_01440 144579 143155 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894065.1 protein_id gnl|my_center|LOCUS_01440 145558 144644 gene locus_tag LOCUS_01450 145558 144644 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049747239.1 protein_id gnl|my_center|LOCUS_01450 147183 145633 gene locus_tag LOCUS_01460 147183 145633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01460 148571 147180 gene locus_tag LOCUS_01470 148571 147180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 149281 148703 gene locus_tag LOCUS_01480 149281 148703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 149586 149278 gene locus_tag LOCUS_01490 149586 149278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 149714 151162 gene locus_tag LOCUS_01500 149714 151162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 151159 152175 gene locus_tag LOCUS_01510 151159 152175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 152366 154228 gene locus_tag LOCUS_01520 152366 154228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 155123 154278 gene locus_tag LOCUS_01530 155123 154278 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731346.1 protein_id gnl|my_center|LOCUS_01530 155316 156080 gene locus_tag LOCUS_01540 155316 156080 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228009.1 protein_id gnl|my_center|LOCUS_01540 156935 156126 gene locus_tag LOCUS_01550 156935 156126 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777089.1 protein_id gnl|my_center|LOCUS_01550 157501 156947 gene locus_tag LOCUS_01560 157501 156947 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112092.1 protein_id gnl|my_center|LOCUS_01560 158018 157707 gene locus_tag LOCUS_01570 158018 157707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 158198 159184 gene locus_tag LOCUS_01580 158198 159184 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877201.1 protein_id gnl|my_center|LOCUS_01580 159253 162642 gene locus_tag LOCUS_01590 gene fdh 159253 162642 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227547.1 transl_except (pos:159817..159819,aa:Sec) note codon on position 189 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_01590 162639 163598 gene locus_tag LOCUS_01600 162639 163598 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727951.1 protein_id gnl|my_center|LOCUS_01600 163696 164829 gene locus_tag LOCUS_01610 gene nrfD 163696 164829 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225065.1 protein_id gnl|my_center|LOCUS_01610 164880 165965 gene locus_tag LOCUS_01620 164880 165965 CDS product spore photoproduct lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971741.1 protein_id gnl|my_center|LOCUS_01620 165991 166911 gene locus_tag LOCUS_01630 165991 166911 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036279.1 protein_id gnl|my_center|LOCUS_01630 168012 167014 gene locus_tag LOCUS_01640 gene selD 168012 167014 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226944.1 protein_id gnl|my_center|LOCUS_01640 168069 168164 gene locus_tag LOCUS_t00050 168069 168164 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 168212 169516 gene locus_tag LOCUS_01650 gene selA 168212 169516 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226943.1 protein_id gnl|my_center|LOCUS_01650 169519 171309 gene locus_tag LOCUS_01660 gene selB 169519 171309 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804590.1 protein_id gnl|my_center|LOCUS_01660 172576 171425 gene locus_tag LOCUS_01670 172576 171425 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056294.1 protein_id gnl|my_center|LOCUS_01670 172733 173911 gene locus_tag LOCUS_01680 172733 173911 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234232.1 protein_id gnl|my_center|LOCUS_01680 175208 174090 gene locus_tag LOCUS_01690 175208 174090 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228701.1 protein_id gnl|my_center|LOCUS_01690 175401 176606 gene locus_tag LOCUS_01700 175401 176606 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894020.1 protein_id gnl|my_center|LOCUS_01700 176603 177793 gene locus_tag LOCUS_01710 176603 177793 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894021.1 protein_id gnl|my_center|LOCUS_01710 177790 178629 gene locus_tag LOCUS_01720 177790 178629 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728493.1 protein_id gnl|my_center|LOCUS_01720 178676 179611 gene locus_tag LOCUS_01730 178676 179611 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530304.1 protein_id gnl|my_center|LOCUS_01730 179670 180992 gene locus_tag LOCUS_01740 179670 180992 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920653.1 protein_id gnl|my_center|LOCUS_01740 181969 180965 gene locus_tag LOCUS_01750 181969 180965 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 protein_id gnl|my_center|LOCUS_01750 183220 181985 gene locus_tag LOCUS_01760 183220 181985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 183538 183260 gene locus_tag LOCUS_01770 183538 183260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 187320 183763 gene locus_tag LOCUS_01780 187320 183763 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728047.1 protein_id gnl|my_center|LOCUS_01780 188927 187482 gene locus_tag LOCUS_01790 188927 187482 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728048.1 protein_id gnl|my_center|LOCUS_01790 191453 189168 gene locus_tag LOCUS_01800 191453 189168 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_01800 192160 191510 gene locus_tag LOCUS_01810 192160 191510 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 protein_id gnl|my_center|LOCUS_01810 193713 192157 gene locus_tag LOCUS_01820 193713 192157 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 protein_id gnl|my_center|LOCUS_01820 194528 193710 gene locus_tag LOCUS_01830 194528 193710 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892015.1 protein_id gnl|my_center|LOCUS_01830 196059 194563 gene locus_tag LOCUS_01840 196059 194563 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727050.1 protein_id gnl|my_center|LOCUS_01840 198134 196056 gene locus_tag LOCUS_01850 198134 196056 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876809.1 protein_id gnl|my_center|LOCUS_01850 199373 198210 gene locus_tag LOCUS_01860 gene rhaI 199373 198210 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727048.1 protein_id gnl|my_center|LOCUS_01860 200280 199453 gene locus_tag LOCUS_01870 200280 199453 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971977.1 protein_id gnl|my_center|LOCUS_01870 201200 200277 gene locus_tag LOCUS_01880 201200 200277 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103759610.1 protein_id gnl|my_center|LOCUS_01880 202539 201208 gene locus_tag LOCUS_01890 202539 201208 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968416.1 protein_id gnl|my_center|LOCUS_01890 202842 205553 gene locus_tag LOCUS_01900 202842 205553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 205655 208189 gene locus_tag LOCUS_01910 205655 208189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 208379 208645 gene locus_tag LOCUS_01920 208379 208645 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119905.1 protein_id gnl|my_center|LOCUS_01920 209757 208669 gene locus_tag LOCUS_01930 209757 208669 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104251.1 protein_id gnl|my_center|LOCUS_01930 209696 210064 gene locus_tag LOCUS_01940 209696 210064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 210049 210585 gene locus_tag LOCUS_01950 210049 210585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 210650 211765 gene locus_tag LOCUS_01960 210650 211765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 211916 214252 gene locus_tag LOCUS_01970 gene helR 211916 214252 CDS product RNA polymerase recycling motor ATPase HelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081619.1 protein_id gnl|my_center|LOCUS_01970 215101 214265 gene locus_tag LOCUS_01980 215101 214265 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972097.1 protein_id gnl|my_center|LOCUS_01980 215913 215212 gene locus_tag LOCUS_01990 215913 215212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 216656 215937 gene locus_tag LOCUS_02000 216656 215937 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_02000 216915 218879 gene locus_tag LOCUS_02010 216915 218879 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110463.1 protein_id gnl|my_center|LOCUS_02010 220668 218956 gene locus_tag LOCUS_02020 220668 218956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 220938 221639 gene locus_tag LOCUS_02030 220938 221639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 221632 222549 gene locus_tag LOCUS_02040 221632 222549 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027262.1 protein_id gnl|my_center|LOCUS_02040 223900 222575 gene locus_tag LOCUS_02050 223900 222575 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027746.1 protein_id gnl|my_center|LOCUS_02050 223936 224613 gene locus_tag LOCUS_02060 223936 224613 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_02060 224687 225181 gene locus_tag LOCUS_02070 224687 225181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 225198 226538 gene locus_tag LOCUS_02080 225198 226538 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229204.1 protein_id gnl|my_center|LOCUS_02080 226535 227407 gene locus_tag LOCUS_02090 226535 227407 CDS product DUF3626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226733.1 protein_id gnl|my_center|LOCUS_02090 228069 227422 gene locus_tag LOCUS_02100 228069 227422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 229370 228378 gene locus_tag LOCUS_02110 229370 228378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 229421 229996 gene locus_tag LOCUS_02120 229421 229996 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225897.1 protein_id gnl|my_center|LOCUS_02120 231074 230007 gene locus_tag LOCUS_02130 231074 230007 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728115.1 protein_id gnl|my_center|LOCUS_02130 231385 231107 gene locus_tag LOCUS_02140 231385 231107 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119905.1 protein_id gnl|my_center|LOCUS_02140 231494 232177 gene locus_tag LOCUS_02150 231494 232177 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727699.1 protein_id gnl|my_center|LOCUS_02150 232387 233442 gene locus_tag LOCUS_02160 232387 233442 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895899.1 protein_id gnl|my_center|LOCUS_02160 233447 234307 gene locus_tag LOCUS_02170 gene cysT 233447 234307 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895898.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02170 234300 235256 gene locus_tag LOCUS_02180 gene cysW 234300 235256 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056131.1 protein_id gnl|my_center|LOCUS_02180 235259 236254 gene locus_tag LOCUS_02190 235259 236254 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060315.1 protein_id gnl|my_center|LOCUS_02190 237015 236458 gene locus_tag LOCUS_02200 237015 236458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 237108 237185 gene locus_tag LOCUS_t00060 237108 237185 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 237743 237138 gene locus_tag LOCUS_02210 237743 237138 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975821.1 protein_id gnl|my_center|LOCUS_02210 239023 237740 gene locus_tag LOCUS_02220 239023 237740 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223912.1 protein_id gnl|my_center|LOCUS_02220 239328 239020 gene locus_tag LOCUS_02230 239328 239020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 239377 240507 gene locus_tag LOCUS_02240 239377 240507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223257.1 protein_id gnl|my_center|LOCUS_02240 240504 241469 gene locus_tag LOCUS_02250 240504 241469 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223258.1 protein_id gnl|my_center|LOCUS_02250 241466 242290 gene locus_tag LOCUS_02260 241466 242290 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223259.1 protein_id gnl|my_center|LOCUS_02260 243126 242341 gene locus_tag LOCUS_02270 243126 242341 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852896.1 protein_id gnl|my_center|LOCUS_02270 243323 245305 gene locus_tag LOCUS_02280 243323 245305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 245179 245277 gene locus_tag LOCUS_t00070 245179 245277 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 246095 245319 gene locus_tag LOCUS_02290 246095 245319 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178283.1 protein_id gnl|my_center|LOCUS_02290 247095 246154 gene locus_tag LOCUS_02300 247095 246154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 248315 247383 gene locus_tag LOCUS_02310 248315 247383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 249637 248666 gene locus_tag LOCUS_02320 249637 248666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 250949 249888 gene locus_tag LOCUS_02330 250949 249888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 252094 251066 gene locus_tag LOCUS_02340 252094 251066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 253846 252290 gene locus_tag LOCUS_02350 253846 252290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 254796 253843 gene locus_tag LOCUS_02360 254796 253843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 257105 254793 gene locus_tag LOCUS_02370 257105 254793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 258237 257335 gene locus_tag LOCUS_02380 258237 257335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 259544 258219 gene locus_tag LOCUS_02390 259544 258219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 259960 259565 gene locus_tag LOCUS_02400 259960 259565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 261970 260792 gene locus_tag LOCUS_02410 261970 260792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 264320 261960 gene locus_tag LOCUS_02420 264320 261960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 265201 264317 gene locus_tag LOCUS_02430 265201 264317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 266683 265643 gene locus_tag LOCUS_02440 266683 265643 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413359.1 protein_id gnl|my_center|LOCUS_02440 266767 267249 gene locus_tag LOCUS_02450 266767 267249 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405633.1 protein_id gnl|my_center|LOCUS_02450 267322 268563 gene locus_tag LOCUS_02460 267322 268563 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729450.1 protein_id gnl|my_center|LOCUS_02460 268560 269879 gene locus_tag LOCUS_02470 268560 269879 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729451.1 protein_id gnl|my_center|LOCUS_02470 270458 269922 gene locus_tag LOCUS_02480 270458 269922 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495312.1 protein_id gnl|my_center|LOCUS_02480 272270 270591 gene locus_tag LOCUS_02490 gene sppA 272270 270591 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727691.1 protein_id gnl|my_center|LOCUS_02490 272370 273278 gene locus_tag LOCUS_02500 272370 273278 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728366.1 protein_id gnl|my_center|LOCUS_02500 274323 273307 gene locus_tag LOCUS_02510 274323 273307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 274653 275627 gene locus_tag LOCUS_02520 274653 275627 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337349.1 protein_id gnl|my_center|LOCUS_02520 276942 275671 gene locus_tag LOCUS_02530 276942 275671 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972378.1 protein_id gnl|my_center|LOCUS_02530 278098 276965 gene locus_tag LOCUS_02540 278098 276965 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803945.1 protein_id gnl|my_center|LOCUS_02540 278348 278803 gene locus_tag LOCUS_02550 278348 278803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 278800 279615 gene locus_tag LOCUS_02560 278800 279615 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803937.1 protein_id gnl|my_center|LOCUS_02560 279612 280049 gene locus_tag LOCUS_02570 279612 280049 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930108.1 protein_id gnl|my_center|LOCUS_02570 280293 284678 gene locus_tag LOCUS_02580 280293 284678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 284914 287211 gene locus_tag LOCUS_02590 284914 287211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 287460 289829 gene locus_tag LOCUS_02600 287460 289829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 290565 290002 gene locus_tag LOCUS_02610 290565 290002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 290468 290680 gene locus_tag LOCUS_02620 290468 290680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 290684 291664 gene locus_tag LOCUS_02630 290684 291664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 293120 291630 gene locus_tag LOCUS_02640 293120 291630 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730912.1 protein_id gnl|my_center|LOCUS_02640 294271 293117 gene locus_tag LOCUS_02650 294271 293117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 295655 294282 gene locus_tag LOCUS_02660 295655 294282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 296998 295652 gene locus_tag LOCUS_02670 296998 295652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803941.1 protein_id gnl|my_center|LOCUS_02670 297267 298655 gene locus_tag LOCUS_02680 297267 298655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 298968 301769 gene locus_tag LOCUS_02690 298968 301769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 303537 301948 gene locus_tag LOCUS_02700 303537 301948 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467238.1 protein_id gnl|my_center|LOCUS_02700 304580 304062 gene locus_tag LOCUS_02710 304580 304062 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532447.1 protein_id gnl|my_center|LOCUS_02710 304634 305014 gene locus_tag LOCUS_02720 304634 305014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 305073 306080 gene locus_tag LOCUS_02730 305073 306080 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972087.1 protein_id gnl|my_center|LOCUS_02730 307094 306087 gene locus_tag LOCUS_02740 307094 306087 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742064.1 protein_id gnl|my_center|LOCUS_02740 307676 307131 gene locus_tag LOCUS_02750 307676 307131 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_02750 307825 309312 gene locus_tag LOCUS_02760 gene dacB 307825 309312 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485148.1 protein_id gnl|my_center|LOCUS_02760 309663 310892 gene locus_tag LOCUS_02770 309663 310892 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929836.1 protein_id gnl|my_center|LOCUS_02770 311086 311667 gene locus_tag LOCUS_02780 311086 311667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 311670 313007 gene locus_tag LOCUS_02790 311670 313007 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227739.1 protein_id gnl|my_center|LOCUS_02790 313004 314029 gene locus_tag LOCUS_02800 313004 314029 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227740.1 protein_id gnl|my_center|LOCUS_02800 314121 315353 gene locus_tag LOCUS_02810 314121 315353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 315346 316131 gene locus_tag LOCUS_02820 gene vpsK 315346 316131 CDS product exopolysaccharide biosynthesis glycosyltransferase VpsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 protein_id gnl|my_center|LOCUS_02820 316128 317387 gene locus_tag LOCUS_02830 gene wecC 316128 317387 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776761.1 protein_id gnl|my_center|LOCUS_02830 318631 317468 gene locus_tag LOCUS_02840 gene wecB 318631 317468 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776765.1 protein_id gnl|my_center|LOCUS_02840 319269 318628 gene locus_tag LOCUS_02850 319269 318628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 319473 320465 gene locus_tag LOCUS_02860 319473 320465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 320462 321856 gene locus_tag LOCUS_02870 320462 321856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 321992 323587 gene locus_tag LOCUS_02880 321992 323587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 323988 325649 gene locus_tag LOCUS_02890 323988 325649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 326629 325712 gene locus_tag LOCUS_02900 326629 325712 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061716.1 protein_id gnl|my_center|LOCUS_02900 326701 327933 gene locus_tag LOCUS_02910 326701 327933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 329100 328051 gene locus_tag LOCUS_02920 329100 328051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 329259 330131 gene locus_tag LOCUS_02930 329259 330131 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043607342.1 protein_id gnl|my_center|LOCUS_02930 331299 330094 gene locus_tag LOCUS_02940 331299 330094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 332561 331296 gene locus_tag LOCUS_02950 332561 331296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 334024 332558 gene locus_tag LOCUS_02960 334024 332558 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141779.1 protein_id gnl|my_center|LOCUS_02960 335133 334021 gene locus_tag LOCUS_02970 335133 334021 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_02970 335804 335130 gene locus_tag LOCUS_02980 335804 335130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 336931 335801 gene locus_tag LOCUS_02990 336931 335801 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807055.1 protein_id gnl|my_center|LOCUS_02990 337950 336928 gene locus_tag LOCUS_03000 337950 336928 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061733.1 protein_id gnl|my_center|LOCUS_03000 338996 337947 gene locus_tag LOCUS_03010 338996 337947 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_03010 343804 339098 gene locus_tag LOCUS_03020 343804 339098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 345542 343806 gene locus_tag LOCUS_03030 345542 343806 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467238.1 protein_id gnl|my_center|LOCUS_03030 346054 345860 gene locus_tag LOCUS_03040 346054 345860 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_03040 346471 346067 gene locus_tag LOCUS_03050 346471 346067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 347277 346474 gene locus_tag LOCUS_03060 347277 346474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 347403 348383 gene locus_tag LOCUS_03070 gene speB 347403 348383 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 protein_id gnl|my_center|LOCUS_03070 348483 349946 gene locus_tag LOCUS_03080 348483 349946 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114861.1 protein_id gnl|my_center|LOCUS_03080 349979 351076 gene locus_tag LOCUS_03090 349979 351076 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_03090 351082 352134 gene locus_tag LOCUS_03100 gene tilS 351082 352134 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230474.1 protein_id gnl|my_center|LOCUS_03100 352145 352696 gene locus_tag LOCUS_03110 gene hpt 352145 352696 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_03110 352941 355199 gene locus_tag LOCUS_03120 gene ftsH 352941 355199 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_03120 355245 355874 gene locus_tag LOCUS_03130 gene folE 355245 355874 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_03130 356002 356850 gene locus_tag LOCUS_03140 gene folP 356002 356850 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_03140 357015 357419 gene locus_tag LOCUS_03150 gene folB 357015 357419 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028954.1 protein_id gnl|my_center|LOCUS_03150 357416 357979 gene locus_tag LOCUS_03160 gene folK 357416 357979 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975432.1 protein_id gnl|my_center|LOCUS_03160 358013 358612 gene locus_tag LOCUS_03170 358013 358612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 358701 359348 gene locus_tag LOCUS_03180 358701 359348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 360653 359394 gene locus_tag LOCUS_03190 360653 359394 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_03190 361690 360650 gene locus_tag LOCUS_03200 361690 360650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 361820 363508 gene locus_tag LOCUS_03210 361820 363508 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 protein_id gnl|my_center|LOCUS_03210 363338 363253 gene locus_tag LOCUS_t00080 363338 363253 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 363581 364540 gene locus_tag LOCUS_03220 gene nadC 363581 364540 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975452.1 protein_id gnl|my_center|LOCUS_03220 364611 364955 gene locus_tag LOCUS_03230 364611 364955 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975458.1 protein_id gnl|my_center|LOCUS_03230 365554 368109 gene locus_tag LOCUS_03240 365554 368109 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_03240 368223 369032 gene locus_tag LOCUS_03250 368223 369032 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728884.1 protein_id gnl|my_center|LOCUS_03250 369081 369995 gene locus_tag LOCUS_03260 369081 369995 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728884.1 protein_id gnl|my_center|LOCUS_03260 370053 370931 gene locus_tag LOCUS_03270 370053 370931 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974609.1 protein_id gnl|my_center|LOCUS_03270 371062 371562 gene locus_tag LOCUS_03280 371062 371562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 372584 371739 gene locus_tag LOCUS_03290 372584 371739 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_03290 373225 372761 gene locus_tag LOCUS_03300 373225 372761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 373110 373511 gene locus_tag LOCUS_03310 373110 373511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 374869 373817 gene locus_tag LOCUS_03320 gene disA 374869 373817 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_03320 376745 375258 gene locus_tag LOCUS_03330 gene radA 376745 375258 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_03330 377993 376908 gene locus_tag LOCUS_03340 gene hisC 377993 376908 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_03340 378677 378015 gene locus_tag LOCUS_03350 378677 378015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 379530 378763 gene locus_tag LOCUS_03360 379530 378763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_03360 379605 380525 gene locus_tag LOCUS_03370 379605 380525 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 protein_id gnl|my_center|LOCUS_03370 380581 381507 gene locus_tag LOCUS_03380 380581 381507 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_03380 382438 381533 gene locus_tag LOCUS_03390 382438 381533 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742057.1 protein_id gnl|my_center|LOCUS_03390 383319 382498 gene locus_tag LOCUS_03400 383319 382498 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027753.1 protein_id gnl|my_center|LOCUS_03400 383392 384438 gene locus_tag LOCUS_03410 383392 384438 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230597.1 protein_id gnl|my_center|LOCUS_03410 384435 385304 gene locus_tag LOCUS_03420 gene proC 384435 385304 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 protein_id gnl|my_center|LOCUS_03420 385301 386461 gene locus_tag LOCUS_03430 385301 386461 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326515.1 protein_id gnl|my_center|LOCUS_03430 386655 386885 gene locus_tag LOCUS_03440 386655 386885 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222402.1 protein_id gnl|my_center|LOCUS_03440 386938 387336 gene locus_tag LOCUS_03450 386938 387336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 387677 388741 gene locus_tag LOCUS_03460 387677 388741 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_03460 388734 390146 gene locus_tag LOCUS_03470 388734 390146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 391402 390293 gene locus_tag LOCUS_03480 391402 390293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 391504 391782 gene locus_tag LOCUS_03490 391504 391782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 391883 392494 gene locus_tag LOCUS_03500 391883 392494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081632.1 protein_id gnl|my_center|LOCUS_03500 392639 394147 gene locus_tag LOCUS_03510 392639 394147 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223445.1 protein_id gnl|my_center|LOCUS_03510 394206 395603 gene locus_tag LOCUS_03520 394206 395603 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731050.1 protein_id gnl|my_center|LOCUS_03520 395600 396622 gene locus_tag LOCUS_03530 395600 396622 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325683.1 protein_id gnl|my_center|LOCUS_03530 396728 397306 gene locus_tag LOCUS_03540 396728 397306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 398207 397314 gene locus_tag LOCUS_03550 398207 397314 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776415.1 protein_id gnl|my_center|LOCUS_03550 399394 398204 gene locus_tag LOCUS_03560 gene menE 399394 398204 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216843435.1 protein_id gnl|my_center|LOCUS_03560 399452 400465 gene locus_tag LOCUS_03570 399452 400465 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230276.1 protein_id gnl|my_center|LOCUS_03570 400462 402105 gene locus_tag LOCUS_03580 gene menD 400462 402105 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080340.1 protein_id gnl|my_center|LOCUS_03580 403691 402777 gene locus_tag LOCUS_03590 gene mmuM 403691 402777 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911868.1 protein_id gnl|my_center|LOCUS_03590 405709 403688 gene locus_tag LOCUS_03600 405709 403688 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284849.1 protein_id gnl|my_center|LOCUS_03600 406434 405706 gene locus_tag LOCUS_03610 406434 405706 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_03610 407430 406498 gene locus_tag LOCUS_03620 407430 406498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 408053 407427 gene locus_tag LOCUS_03630 408053 407427 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977103.1 protein_id gnl|my_center|LOCUS_03630 408331 409167 gene locus_tag LOCUS_03640 408331 409167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 409164 410798 gene locus_tag LOCUS_03650 409164 410798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 410911 411417 gene locus_tag LOCUS_03660 410911 411417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 412038 411430 gene locus_tag LOCUS_03670 412038 411430 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971863.1 protein_id gnl|my_center|LOCUS_03670 412697 412035 gene locus_tag LOCUS_03680 412697 412035 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971862.1 protein_id gnl|my_center|LOCUS_03680 413227 414609 gene locus_tag LOCUS_03690 413227 414609 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929999.1 protein_id gnl|my_center|LOCUS_03690 414767 415297 gene locus_tag LOCUS_03700 414767 415297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 416626 415358 gene locus_tag LOCUS_03710 416626 415358 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727437.1 protein_id gnl|my_center|LOCUS_03710 416931 417290 gene locus_tag LOCUS_03720 416931 417290 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_03720 417363 417923 gene locus_tag LOCUS_03730 417363 417923 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006133126.1 protein_id gnl|my_center|LOCUS_03730 417920 418795 gene locus_tag LOCUS_03740 417920 418795 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_03740 418792 420147 gene locus_tag LOCUS_03750 418792 420147 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_03750 420144 421130 gene locus_tag LOCUS_03760 gene nuoE 420144 421130 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974380.1 protein_id gnl|my_center|LOCUS_03760 421130 422455 gene locus_tag LOCUS_03770 gene nuoF 421130 422455 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080146.1 protein_id gnl|my_center|LOCUS_03770 422452 424983 gene locus_tag LOCUS_03780 422452 424983 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728121.1 protein_id gnl|my_center|LOCUS_03780 425006 426418 gene locus_tag LOCUS_03790 gene nuoH 425006 426418 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029736.1 protein_id gnl|my_center|LOCUS_03790 426405 427082 gene locus_tag LOCUS_03800 426405 427082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03800 427079 427924 gene locus_tag LOCUS_03810 427079 427924 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893423.1 protein_id gnl|my_center|LOCUS_03810 427938 428237 gene locus_tag LOCUS_03820 gene nuoK 427938 428237 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893422.1 protein_id gnl|my_center|LOCUS_03820 428245 430200 gene locus_tag LOCUS_03830 gene nuoL 428245 430200 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 protein_id gnl|my_center|LOCUS_03830 430214 431767 gene locus_tag LOCUS_03840 430214 431767 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974372.1 protein_id gnl|my_center|LOCUS_03840 431764 433383 gene locus_tag LOCUS_03850 gene nuoN 431764 433383 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_03850 433551 434555 gene locus_tag LOCUS_03860 433551 434555 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_03860 435739 435008 gene locus_tag LOCUS_03870 435739 435008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 436384 436034 gene locus_tag LOCUS_03880 436384 436034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 437641 436478 gene locus_tag LOCUS_03890 437641 436478 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484938.1 protein_id gnl|my_center|LOCUS_03890 439129 437777 gene locus_tag LOCUS_03900 439129 437777 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803780.1 protein_id gnl|my_center|LOCUS_03900 440075 439167 gene locus_tag LOCUS_03910 440075 439167 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803781.1 protein_id gnl|my_center|LOCUS_03910 441080 440094 gene locus_tag LOCUS_03920 441080 440094 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803782.1 protein_id gnl|my_center|LOCUS_03920 441332 442342 gene locus_tag LOCUS_03930 441332 442342 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803779.1 protein_id gnl|my_center|LOCUS_03930 442431 443444 gene locus_tag LOCUS_03940 442431 443444 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_03940 443697 444830 gene locus_tag LOCUS_03950 443697 444830 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186383115.1 protein_id gnl|my_center|LOCUS_03950 446835 444853 gene locus_tag LOCUS_03960 446835 444853 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726765.1 protein_id gnl|my_center|LOCUS_03960 448272 446914 gene locus_tag LOCUS_03970 448272 446914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 447928 448015 gene locus_tag LOCUS_t00090 447928 448015 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 449322 448453 gene locus_tag LOCUS_03980 gene rfbA 449322 448453 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726901.1 protein_id gnl|my_center|LOCUS_03980 449396 450394 gene locus_tag LOCUS_03990 gene rfbB 449396 450394 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803926.1 protein_id gnl|my_center|LOCUS_03990 450423 451814 gene locus_tag LOCUS_04000 450423 451814 CDS product bifunctional dTDP-4-dehydrorhamnose 3,5-epimerase family protein/NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803927.1 protein_id gnl|my_center|LOCUS_04000 452037 453095 gene locus_tag LOCUS_04010 452037 453095 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804166.1 protein_id gnl|my_center|LOCUS_04010 454050 453139 gene locus_tag LOCUS_04020 gene rarD 454050 453139 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_04020 455288 454188 gene locus_tag LOCUS_04030 455288 454188 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_04030 457204 455285 gene locus_tag LOCUS_04040 457204 455285 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_04040 457444 458262 gene locus_tag LOCUS_04050 457444 458262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 458265 459593 gene locus_tag LOCUS_04060 gene licH 458265 459593 CDS product 6-phospho-beta-glucosidase LicH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244285.1 protein_id gnl|my_center|LOCUS_04060 459590 460603 gene locus_tag LOCUS_04070 459590 460603 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866323.1 protein_id gnl|my_center|LOCUS_04070 461601 460969 gene locus_tag LOCUS_04080 461601 460969 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971475.1 protein_id gnl|my_center|LOCUS_04080 462452 461598 gene locus_tag LOCUS_04090 462452 461598 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775607.1 protein_id gnl|my_center|LOCUS_04090 463441 462548 gene locus_tag LOCUS_04100 463441 462548 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224326.1 protein_id gnl|my_center|LOCUS_04100 463651 463463 gene locus_tag LOCUS_04110 463651 463463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 464635 463721 gene locus_tag LOCUS_04120 464635 463721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 464731 465186 gene locus_tag LOCUS_04130 464731 465186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 465183 465869 gene locus_tag LOCUS_04140 465183 465869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04140 465866 466225 gene locus_tag LOCUS_04150 465866 466225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 466378 467439 gene locus_tag LOCUS_04160 466378 467439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 467646 467446 gene locus_tag LOCUS_04170 467646 467446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 468895 467672 gene locus_tag LOCUS_04180 468895 467672 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_04180 470478 468892 gene locus_tag LOCUS_04190 470478 468892 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028675.1 protein_id gnl|my_center|LOCUS_04190 471519 470539 gene locus_tag LOCUS_04200 471519 470539 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804319.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04200 471968 471516 gene locus_tag LOCUS_04210 471968 471516 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223630.1 protein_id gnl|my_center|LOCUS_04210 473322 471970 gene locus_tag LOCUS_04220 473322 471970 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811699.1 protein_id gnl|my_center|LOCUS_04220 474113 473319 gene locus_tag LOCUS_04230 474113 473319 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776543.1 protein_id gnl|my_center|LOCUS_04230 474224 475063 gene locus_tag LOCUS_04240 474224 475063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229827.1 protein_id gnl|my_center|LOCUS_04240 475384 475992 gene locus_tag LOCUS_04250 475384 475992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 476474 475983 gene locus_tag LOCUS_04260 476474 475983 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_04260 476630 476714 gene locus_tag LOCUS_t00100 476630 476714 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 478296 476908 gene locus_tag LOCUS_04270 478296 476908 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093952552.1 protein_id gnl|my_center|LOCUS_04270 478537 478289 gene locus_tag LOCUS_04280 478537 478289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 479241 478534 gene locus_tag LOCUS_04290 479241 478534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 479648 479238 gene locus_tag LOCUS_04300 479648 479238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 479838 480524 gene locus_tag LOCUS_04310 479838 480524 CDS product DUF5919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229650.1 protein_id gnl|my_center|LOCUS_04310 481130 480684 gene locus_tag LOCUS_04320 481130 480684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 481602 484730 gene locus_tag LOCUS_04330 gene drmD 481602 484730 CDS product DISARM system SNF2-like helicase DrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204890.1 protein_id gnl|my_center|LOCUS_04330 484727 488860 gene locus_tag LOCUS_04340 484727 488860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204891.1 protein_id gnl|my_center|LOCUS_04340 488857 492456 gene locus_tag LOCUS_04350 gene drmA 488857 492456 CDS product DISARM system helicase DrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204892.1 protein_id gnl|my_center|LOCUS_04350 492453 494297 gene locus_tag LOCUS_04360 492453 494297 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204893.1 protein_id gnl|my_center|LOCUS_04360 494294 495013 gene locus_tag LOCUS_04370 494294 495013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 495069 497357 gene locus_tag LOCUS_04380 495069 497357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 497765 497463 gene locus_tag LOCUS_04390 497765 497463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 499198 498101 gene locus_tag LOCUS_04400 499198 498101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04400 499435 499226 gene locus_tag LOCUS_04410 499435 499226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 499710 503303 gene locus_tag LOCUS_04420 gene mobF 499710 503303 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296243.1 protein_id gnl|my_center|LOCUS_04420 503329 503505 gene locus_tag LOCUS_04430 503329 503505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 503513 505612 gene locus_tag LOCUS_04440 503513 505612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 505621 505824 gene locus_tag LOCUS_04450 505621 505824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 505828 506955 gene locus_tag LOCUS_04460 505828 506955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 507355 507002 gene locus_tag LOCUS_04470 507355 507002 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_04470 507459 508610 gene locus_tag LOCUS_04480 507459 508610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 509201 508653 gene locus_tag LOCUS_04490 509201 508653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 511027 509198 gene locus_tag LOCUS_04500 511027 509198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 512406 511030 gene locus_tag LOCUS_04510 512406 511030 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170315952.1 protein_id gnl|my_center|LOCUS_04510 514100 512595 gene locus_tag LOCUS_04520 514100 512595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137309464.1 protein_id gnl|my_center|LOCUS_04520 515943 514093 gene locus_tag LOCUS_04530 515943 514093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 516739 515924 gene locus_tag LOCUS_04540 516739 515924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 517139 516768 gene locus_tag LOCUS_04550 517139 516768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 517830 517165 gene locus_tag LOCUS_04560 517830 517165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 518124 519383 gene locus_tag LOCUS_04570 518124 519383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776735.1 protein_id gnl|my_center|LOCUS_04570 519508 519951 gene locus_tag LOCUS_04580 519508 519951 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083487.1 protein_id gnl|my_center|LOCUS_04580 519948 520958 gene locus_tag LOCUS_04590 519948 520958 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167468068.1 protein_id gnl|my_center|LOCUS_04590 522578 521190 gene locus_tag LOCUS_04600 522578 521190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 522621 522974 gene locus_tag LOCUS_04610 522621 522974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 523058 524185 gene locus_tag LOCUS_04620 523058 524185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 524273 525376 gene locus_tag LOCUS_04630 524273 525376 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749584.1 protein_id gnl|my_center|LOCUS_04630 525842 526975 gene locus_tag LOCUS_04640 525842 526975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 528639 528232 gene locus_tag LOCUS_04650 528639 528232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 529609 530085 gene locus_tag LOCUS_04660 529609 530085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 530082 530825 gene locus_tag LOCUS_04670 530082 530825 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804515.1 protein_id gnl|my_center|LOCUS_04670 530822 531325 gene locus_tag LOCUS_04680 530822 531325 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224560.1 protein_id gnl|my_center|LOCUS_04680 531322 531693 gene locus_tag LOCUS_04690 531322 531693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 532787 532026 gene locus_tag LOCUS_04700 532787 532026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04700 532735 533016 gene locus_tag LOCUS_04710 532735 533016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 533495 534838 gene locus_tag LOCUS_04720 533495 534838 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110043.1 protein_id gnl|my_center|LOCUS_04720 535939 534884 gene locus_tag LOCUS_04730 535939 534884 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027576.1 protein_id gnl|my_center|LOCUS_04730 536316 535936 gene locus_tag LOCUS_04740 536316 535936 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225370.1 protein_id gnl|my_center|LOCUS_04740 537783 536377 gene locus_tag LOCUS_04750 gene fpoN 537783 536377 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_04750 539284 537797 gene locus_tag LOCUS_04760 539284 537797 CDS product NuoM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142531.1 protein_id gnl|my_center|LOCUS_04760 541178 539286 gene locus_tag LOCUS_04770 541178 539286 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029758.1 protein_id gnl|my_center|LOCUS_04770 541489 541175 gene locus_tag LOCUS_04780 gene nuoK 541489 541175 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_04780 542055 541486 gene locus_tag LOCUS_04790 542055 541486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 542978 542052 gene locus_tag LOCUS_04800 542978 542052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 544066 542975 gene locus_tag LOCUS_04810 544066 542975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 544401 544057 gene locus_tag LOCUS_04820 544401 544057 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_04820 544561 544770 gene locus_tag LOCUS_04830 544561 544770 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775998.1 protein_id gnl|my_center|LOCUS_04830 544776 547121 gene locus_tag LOCUS_04840 544776 547121 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776000.1 protein_id gnl|my_center|LOCUS_04840 547187 547513 gene locus_tag LOCUS_04850 547187 547513 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776001.1 protein_id gnl|my_center|LOCUS_04850 548037 547594 gene locus_tag LOCUS_04860 548037 547594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 548036 548278 gene locus_tag LOCUS_04870 548036 548278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 548754 548341 gene locus_tag LOCUS_04880 548754 548341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 548801 549091 gene locus_tag LOCUS_04890 548801 549091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 549088 550635 gene locus_tag LOCUS_04900 gene nrfD 549088 550635 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_04900 550685 553633 gene locus_tag LOCUS_04910 550685 553633 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_04910 553630 554658 gene locus_tag LOCUS_04920 553630 554658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 554655 555755 gene locus_tag LOCUS_04930 554655 555755 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_04930 555768 557036 gene locus_tag LOCUS_04940 555768 557036 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029253.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04940 557092 558465 gene locus_tag LOCUS_04950 557092 558465 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200855.1 protein_id gnl|my_center|LOCUS_04950 558706 558476 gene locus_tag LOCUS_04960 558706 558476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 558820 559758 gene locus_tag LOCUS_04970 558820 559758 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727027.1 protein_id gnl|my_center|LOCUS_04970 560397 559762 gene locus_tag LOCUS_04980 560397 559762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 560924 560394 gene locus_tag LOCUS_04990 560924 560394 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729811.1 protein_id gnl|my_center|LOCUS_04990 561034 562218 gene locus_tag LOCUS_05000 561034 562218 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728588.1 protein_id gnl|my_center|LOCUS_05000 562352 563359 gene locus_tag LOCUS_05010 562352 563359 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742152.1 protein_id gnl|my_center|LOCUS_05010 563604 563380 gene locus_tag LOCUS_05020 563604 563380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 563557 563736 gene locus_tag LOCUS_05030 563557 563736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 563766 565496 gene locus_tag LOCUS_05040 563766 565496 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227542.1 protein_id gnl|my_center|LOCUS_05040 565524 566276 gene locus_tag LOCUS_05050 565524 566276 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270384.1 protein_id gnl|my_center|LOCUS_05050 566305 567210 gene locus_tag LOCUS_05060 566305 567210 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804073.1 protein_id gnl|my_center|LOCUS_05060 567579 567220 gene locus_tag LOCUS_05070 567579 567220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 568180 567632 gene locus_tag LOCUS_05080 568180 567632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 568472 570115 gene locus_tag LOCUS_05090 568472 570115 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256246.1 protein_id gnl|my_center|LOCUS_05090 570112 571623 gene locus_tag LOCUS_05100 570112 571623 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256247.1 protein_id gnl|my_center|LOCUS_05100 573420 571678 gene locus_tag LOCUS_05110 573420 571678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 574721 573417 gene locus_tag LOCUS_05120 574721 573417 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227739.1 protein_id gnl|my_center|LOCUS_05120 574932 575570 gene locus_tag LOCUS_05130 574932 575570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 575567 575866 gene locus_tag LOCUS_05140 575567 575866 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846969.1 protein_id gnl|my_center|LOCUS_05140 575899 576405 gene locus_tag LOCUS_05150 575899 576405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 576800 577270 gene locus_tag LOCUS_05160 576800 577270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 577267 577530 gene locus_tag LOCUS_05170 577267 577530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 580848 578143 gene locus_tag LOCUS_05180 580848 578143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 582812 580833 gene locus_tag LOCUS_05190 582812 580833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 584125 582824 gene locus_tag LOCUS_05200 584125 582824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 585648 584122 gene locus_tag LOCUS_05210 585648 584122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 586475 585720 gene locus_tag LOCUS_05220 586475 585720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 588510 586459 gene locus_tag LOCUS_05230 588510 586459 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204893.1 protein_id gnl|my_center|LOCUS_05230 592258 588515 gene locus_tag LOCUS_05240 gene drmA 592258 588515 CDS product DISARM system helicase DrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204892.1 protein_id gnl|my_center|LOCUS_05240 596322 592255 gene locus_tag LOCUS_05250 596322 592255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204891.1 protein_id gnl|my_center|LOCUS_05250 599510 596322 gene locus_tag LOCUS_05260 gene drmD 599510 596322 CDS product DISARM system SNF2-like helicase DrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204890.1 protein_id gnl|my_center|LOCUS_05260 600232 601500 gene locus_tag LOCUS_05270 600232 601500 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929944.1 protein_id gnl|my_center|LOCUS_05270 601562 602836 gene locus_tag LOCUS_05280 601562 602836 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028249.1 protein_id gnl|my_center|LOCUS_05280 603623 602871 gene locus_tag LOCUS_05290 603623 602871 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224574.1 protein_id gnl|my_center|LOCUS_05290 605639 603648 gene locus_tag LOCUS_05300 605639 603648 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227897.1 protein_id gnl|my_center|LOCUS_05300 606893 605694 gene locus_tag LOCUS_05310 606893 605694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224630.1 protein_id gnl|my_center|LOCUS_05310 607735 606914 gene locus_tag LOCUS_05320 607735 606914 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646328.1 protein_id gnl|my_center|LOCUS_05320 608348 607746 gene locus_tag LOCUS_05330 608348 607746 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222489.1 protein_id gnl|my_center|LOCUS_05330 608860 608345 gene locus_tag LOCUS_05340 608860 608345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 609177 608857 gene locus_tag LOCUS_05350 609177 608857 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224368.1 protein_id gnl|my_center|LOCUS_05350 609359 610162 gene locus_tag LOCUS_05360 609359 610162 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030868.1 protein_id gnl|my_center|LOCUS_05360 610193 610957 gene locus_tag LOCUS_05370 610193 610957 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230830.1 protein_id gnl|my_center|LOCUS_05370 610954 611862 gene locus_tag LOCUS_05380 610954 611862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 613502 611979 gene locus_tag LOCUS_05390 613502 611979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 613904 615058 gene locus_tag LOCUS_05400 613904 615058 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776662.1 protein_id gnl|my_center|LOCUS_05400 615055 616632 gene locus_tag LOCUS_05410 615055 616632 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851586.1 protein_id gnl|my_center|LOCUS_05410 616629 617303 gene locus_tag LOCUS_05420 616629 617303 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_05420 617377 618774 gene locus_tag LOCUS_05430 617377 618774 CDS product gluconolaconase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726747.1 protein_id gnl|my_center|LOCUS_05430 618896 619315 gene locus_tag LOCUS_05440 618896 619315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 619440 620504 gene locus_tag LOCUS_05450 619440 620504 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186383115.1 protein_id gnl|my_center|LOCUS_05450 620925 620509 gene locus_tag LOCUS_05460 620925 620509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 621871 621005 gene locus_tag LOCUS_05470 621871 621005 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028933.1 protein_id gnl|my_center|LOCUS_05470 622053 623738 gene locus_tag LOCUS_05480 622053 623738 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228281.1 protein_id gnl|my_center|LOCUS_05480 623889 624386 gene locus_tag LOCUS_05490 623889 624386 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226547.1 protein_id gnl|my_center|LOCUS_05490 625475 624468 gene locus_tag LOCUS_05500 625475 624468 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776787.1 protein_id gnl|my_center|LOCUS_05500 626772 625528 gene locus_tag LOCUS_05510 626772 625528 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530725.1 protein_id gnl|my_center|LOCUS_05510 627533 626769 gene locus_tag LOCUS_05520 627533 626769 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530724.1 protein_id gnl|my_center|LOCUS_05520 628609 627545 gene locus_tag LOCUS_05530 628609 627545 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530723.1 protein_id gnl|my_center|LOCUS_05530 628773 629771 gene locus_tag LOCUS_05540 628773 629771 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226377.1 protein_id gnl|my_center|LOCUS_05540 629978 631099 gene locus_tag LOCUS_05550 629978 631099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 631213 631362 gene locus_tag LOCUS_05560 631213 631362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 631496 632593 gene locus_tag LOCUS_05570 631496 632593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 633622 632606 gene locus_tag LOCUS_05580 633622 632606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05580 633963 634661 gene locus_tag LOCUS_05590 633963 634661 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419265.1 protein_id gnl|my_center|LOCUS_05590 635340 634675 gene locus_tag LOCUS_05600 635340 634675 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257831.1 protein_id gnl|my_center|LOCUS_05600 637012 635378 gene locus_tag LOCUS_05610 637012 635378 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226038.1 protein_id gnl|my_center|LOCUS_05610 637148 637690 gene locus_tag LOCUS_05620 637148 637690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 637680 638303 gene locus_tag LOCUS_05630 637680 638303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 638311 639003 gene locus_tag LOCUS_05640 638311 639003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888589.1 protein_id gnl|my_center|LOCUS_05640 639019 639354 gene locus_tag LOCUS_05650 639019 639354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 639377 639784 gene locus_tag LOCUS_05660 639377 639784 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537794.1 protein_id gnl|my_center|LOCUS_05660 640922 640017 gene locus_tag LOCUS_05670 640922 640017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 641731 640919 gene locus_tag LOCUS_05680 641731 640919 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776917.1 protein_id gnl|my_center|LOCUS_05680 642765 641728 gene locus_tag LOCUS_05690 642765 641728 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907874.1 protein_id gnl|my_center|LOCUS_05690 644176 642848 gene locus_tag LOCUS_05700 644176 642848 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 protein_id gnl|my_center|LOCUS_05700 645066 644287 gene locus_tag LOCUS_05710 645066 644287 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728440.1 protein_id gnl|my_center|LOCUS_05710 646330 645110 gene locus_tag LOCUS_05720 646330 645110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 647621 646572 gene locus_tag LOCUS_05730 647621 646572 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284494.1 protein_id gnl|my_center|LOCUS_05730 647697 648107 gene locus_tag LOCUS_05740 647697 648107 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977952.1 protein_id gnl|my_center|LOCUS_05740 648502 648143 gene locus_tag LOCUS_05750 648502 648143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 649530 648832 gene locus_tag LOCUS_05760 649530 648832 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227810.1 protein_id gnl|my_center|LOCUS_05760 651244 649619 gene locus_tag LOCUS_05770 651244 649619 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459110.1 protein_id gnl|my_center|LOCUS_05770 652364 651294 gene locus_tag LOCUS_05780 652364 651294 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525885.1 protein_id gnl|my_center|LOCUS_05780 653232 652372 gene locus_tag LOCUS_05790 653232 652372 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066547.1 protein_id gnl|my_center|LOCUS_05790 654959 653232 gene locus_tag LOCUS_05800 654959 653232 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467722.1 protein_id gnl|my_center|LOCUS_05800 655897 654956 gene locus_tag LOCUS_05810 655897 654956 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729046.1 protein_id gnl|my_center|LOCUS_05810 657420 655894 gene locus_tag LOCUS_05820 657420 655894 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 protein_id gnl|my_center|LOCUS_05820 658177 657422 gene locus_tag LOCUS_05830 gene hpxA 658177 657422 CDS product allantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097230.1 protein_id gnl|my_center|LOCUS_05830 659115 658174 gene locus_tag LOCUS_05840 659115 658174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 660289 659102 gene locus_tag LOCUS_05850 660289 659102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 660654 661721 gene locus_tag LOCUS_05860 660654 661721 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804073.1 protein_id gnl|my_center|LOCUS_05860 661766 664003 gene locus_tag LOCUS_05870 661766 664003 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256285.1 protein_id gnl|my_center|LOCUS_05870 664220 665773 gene locus_tag LOCUS_05880 664220 665773 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_05880 665778 666899 gene locus_tag LOCUS_05890 665778 666899 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061884.1 protein_id gnl|my_center|LOCUS_05890 667077 667475 gene locus_tag LOCUS_05900 667077 667475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 668492 667593 gene locus_tag LOCUS_05910 668492 667593 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027042.1 protein_id gnl|my_center|LOCUS_05910 668604 669590 gene locus_tag LOCUS_05920 668604 669590 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804346.1 protein_id gnl|my_center|LOCUS_05920 670336 669617 gene locus_tag LOCUS_05930 670336 669617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 670884 670405 gene locus_tag LOCUS_05940 670884 670405 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776962.1 protein_id gnl|my_center|LOCUS_05940 671765 670935 gene locus_tag LOCUS_05950 671765 670935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 671797 672435 gene locus_tag LOCUS_05960 671797 672435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 672445 672705 gene locus_tag LOCUS_05970 672445 672705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 673403 672759 gene locus_tag LOCUS_05980 673403 672759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 674296 673406 gene locus_tag LOCUS_05990 674296 673406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 675247 674309 gene locus_tag LOCUS_06000 675247 674309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 676695 675244 gene locus_tag LOCUS_06010 676695 675244 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_06010 677969 676692 gene locus_tag LOCUS_06020 677969 676692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 678724 677966 gene locus_tag LOCUS_06030 678724 677966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 679750 678734 gene locus_tag LOCUS_06040 679750 678734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 680130 679738 gene locus_tag LOCUS_06050 680130 679738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 680418 680209 gene locus_tag LOCUS_06060 680418 680209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 680659 682518 gene locus_tag LOCUS_06070 680659 682518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 682686 683282 gene locus_tag LOCUS_06080 682686 683282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 685525 683261 gene locus_tag LOCUS_06090 gene katG 685525 683261 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111000.1 protein_id gnl|my_center|LOCUS_06090 685696 687021 gene locus_tag LOCUS_06100 685696 687021 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055512687.1 protein_id gnl|my_center|LOCUS_06100 687015 688700 gene locus_tag LOCUS_06110 687015 688700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06110 688697 689833 gene locus_tag LOCUS_06120 688697 689833 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227757.1 protein_id gnl|my_center|LOCUS_06120 689837 692254 gene locus_tag LOCUS_06130 689837 692254 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029876.1 protein_id gnl|my_center|LOCUS_06130 692251 693450 gene locus_tag LOCUS_06140 692251 693450 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495359.1 protein_id gnl|my_center|LOCUS_06140 694805 693669 gene locus_tag LOCUS_06150 694805 693669 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_06150 695140 694802 gene locus_tag LOCUS_06160 695140 694802 CDS product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173644.1 protein_id gnl|my_center|LOCUS_06160 695982 695140 gene locus_tag LOCUS_06170 695982 695140 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 protein_id gnl|my_center|LOCUS_06170 697261 695990 gene locus_tag LOCUS_06180 697261 695990 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_06180 698085 697258 gene locus_tag LOCUS_06190 698085 697258 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226189.1 protein_id gnl|my_center|LOCUS_06190 699034 698105 gene locus_tag LOCUS_06200 699034 698105 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226190.1 protein_id gnl|my_center|LOCUS_06200 700293 699031 gene locus_tag LOCUS_06210 700293 699031 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226191.1 protein_id gnl|my_center|LOCUS_06210 700505 701761 gene locus_tag LOCUS_06220 700505 701761 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868921.1 protein_id gnl|my_center|LOCUS_06220 702329 701796 gene locus_tag LOCUS_06230 702329 701796 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533080.1 protein_id gnl|my_center|LOCUS_06230 702539 703129 gene locus_tag LOCUS_06240 702539 703129 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115862.1 protein_id gnl|my_center|LOCUS_06240 703215 704336 gene locus_tag LOCUS_06250 703215 704336 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113360.1 protein_id gnl|my_center|LOCUS_06250 704503 704261 gene locus_tag LOCUS_06260 704503 704261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 704549 704962 gene locus_tag LOCUS_06270 704549 704962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 705055 706194 gene locus_tag LOCUS_06280 705055 706194 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104714.1 protein_id gnl|my_center|LOCUS_06280 706328 708325 gene locus_tag LOCUS_06290 706328 708325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 709463 708390 gene locus_tag LOCUS_06300 709463 708390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 709375 709566 gene locus_tag LOCUS_06310 709375 709566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 709736 710668 gene locus_tag LOCUS_06320 709736 710668 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893441.1 protein_id gnl|my_center|LOCUS_06320 712219 710753 gene locus_tag LOCUS_06330 712219 710753 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072542480.1 protein_id gnl|my_center|LOCUS_06330 712536 714596 gene locus_tag LOCUS_06340 712536 714596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 714724 714797 gene locus_tag LOCUS_t00110 714724 714797 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 714851 714926 gene locus_tag LOCUS_t00120 714851 714926 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 715002 715169 gene locus_tag LOCUS_06350 gene rpmG 715002 715169 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948671.1 protein_id gnl|my_center|LOCUS_06350 715226 715954 gene locus_tag LOCUS_06360 715226 715954 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412306.1 protein_id gnl|my_center|LOCUS_06360 715996 716427 gene locus_tag LOCUS_06370 715996 716427 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285884.1 protein_id gnl|my_center|LOCUS_06370 716424 716849 gene locus_tag LOCUS_06380 716424 716849 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_06380 716846 717889 gene locus_tag LOCUS_06390 716846 717889 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_06390 717981 719807 gene locus_tag LOCUS_06400 gene treZ 717981 719807 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224465.1 protein_id gnl|my_center|LOCUS_06400 719855 721387 gene locus_tag LOCUS_06410 719855 721387 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930183.1 protein_id gnl|my_center|LOCUS_06410 723286 721730 gene locus_tag LOCUS_06420 723286 721730 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_06420 723418 724743 gene locus_tag LOCUS_06430 723418 724743 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_06430 724856 724929 gene locus_tag LOCUS_t00130 724856 724929 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 725023 725616 gene locus_tag LOCUS_06440 725023 725616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 725734 726783 gene locus_tag LOCUS_06450 gene nusG 725734 726783 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029791.1 protein_id gnl|my_center|LOCUS_06450 726842 727273 gene locus_tag LOCUS_06460 gene rplK 726842 727273 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974315.1 protein_id gnl|my_center|LOCUS_06460 727375 728085 gene locus_tag LOCUS_06470 gene rplA 727375 728085 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892735.1 protein_id gnl|my_center|LOCUS_06470 729551 728190 gene locus_tag LOCUS_06480 729551 728190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 730123 729548 gene locus_tag LOCUS_06490 730123 729548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 730195 731787 gene locus_tag LOCUS_06500 730195 731787 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_06500 732287 731784 gene locus_tag LOCUS_06510 732287 731784 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088503.1 protein_id gnl|my_center|LOCUS_06510 733443 732397 gene locus_tag LOCUS_06520 733443 732397 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776609.1 protein_id gnl|my_center|LOCUS_06520 734123 734779 gene locus_tag LOCUS_06530 gene rplJ 734123 734779 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_06530 734795 735190 gene locus_tag LOCUS_06540 gene rplL 734795 735190 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892753.1 protein_id gnl|my_center|LOCUS_06540 735696 739196 gene locus_tag LOCUS_06550 gene rpoB 735696 739196 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_06550 739297 743151 gene locus_tag LOCUS_06560 739297 743151 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_06560 744348 743545 gene locus_tag LOCUS_06570 744348 743545 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226033.1 protein_id gnl|my_center|LOCUS_06570 745668 744403 gene locus_tag LOCUS_06580 745668 744403 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804568.1 protein_id gnl|my_center|LOCUS_06580 746088 747278 gene locus_tag LOCUS_06590 746088 747278 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893748.1 protein_id gnl|my_center|LOCUS_06590 747406 748977 gene locus_tag LOCUS_06600 747406 748977 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226438.1 protein_id gnl|my_center|LOCUS_06600 748980 749819 gene locus_tag LOCUS_06610 748980 749819 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363315.1 protein_id gnl|my_center|LOCUS_06610 749855 751738 gene locus_tag LOCUS_06620 749855 751738 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545360.1 protein_id gnl|my_center|LOCUS_06620 751735 752571 gene locus_tag LOCUS_06630 751735 752571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 752608 753006 gene locus_tag LOCUS_06640 752608 753006 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467790.1 protein_id gnl|my_center|LOCUS_06640 753003 753812 gene locus_tag LOCUS_06650 gene modA 753003 753812 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029176.1 protein_id gnl|my_center|LOCUS_06650 753902 754663 gene locus_tag LOCUS_06660 753902 754663 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06660 754657 755745 gene locus_tag LOCUS_06670 754657 755745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_06670 755765 756436 gene locus_tag LOCUS_06680 755765 756436 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894928.1 protein_id gnl|my_center|LOCUS_06680 759210 756532 gene locus_tag LOCUS_06690 759210 756532 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225596.1 protein_id gnl|my_center|LOCUS_06690 760132 759221 gene locus_tag LOCUS_06700 760132 759221 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729048.1 protein_id gnl|my_center|LOCUS_06700 760172 761044 gene locus_tag LOCUS_06710 760172 761044 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618835.1 protein_id gnl|my_center|LOCUS_06710 761379 761750 gene locus_tag LOCUS_06720 gene rpsL 761379 761750 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102113.1 protein_id gnl|my_center|LOCUS_06720 761750 762220 gene locus_tag LOCUS_06730 gene rpsG 761750 762220 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776385.1 protein_id gnl|my_center|LOCUS_06730 762286 764382 gene locus_tag LOCUS_06740 gene fusA 762286 764382 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974302.1 protein_id gnl|my_center|LOCUS_06740 764552 765748 gene locus_tag LOCUS_06750 gene tuf 764552 765748 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 protein_id gnl|my_center|LOCUS_06750 765988 767244 gene locus_tag LOCUS_06760 765988 767244 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391912.1 protein_id gnl|my_center|LOCUS_06760 769536 767263 gene locus_tag LOCUS_06770 gene treY 769536 767263 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224464.1 protein_id gnl|my_center|LOCUS_06770 770422 769604 gene locus_tag LOCUS_06780 770422 769604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 771563 770436 gene locus_tag LOCUS_06790 771563 770436 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932102.1 protein_id gnl|my_center|LOCUS_06790 772802 771573 gene locus_tag LOCUS_06800 772802 771573 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_06800 773588 773160 gene locus_tag LOCUS_06810 773588 773160 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977610.1 protein_id gnl|my_center|LOCUS_06810 773652 774581 gene locus_tag LOCUS_06820 773652 774581 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083453073.1 protein_id gnl|my_center|LOCUS_06820 774578 775861 gene locus_tag LOCUS_06830 gene rocD 774578 775861 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727654.1 protein_id gnl|my_center|LOCUS_06830 777275 775899 gene locus_tag LOCUS_06840 777275 775899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 777429 778793 gene locus_tag LOCUS_06850 777429 778793 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804273.1 protein_id gnl|my_center|LOCUS_06850 778798 779409 gene locus_tag LOCUS_06860 778798 779409 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804274.1 protein_id gnl|my_center|LOCUS_06860 781180 779438 gene locus_tag LOCUS_06870 781180 779438 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100342827.1 protein_id gnl|my_center|LOCUS_06870 781559 781867 gene locus_tag LOCUS_06880 gene rpsJ 781559 781867 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_06880 781876 782571 gene locus_tag LOCUS_06890 gene rplC 781876 782571 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776377.1 protein_id gnl|my_center|LOCUS_06890 782571 783491 gene locus_tag LOCUS_06900 gene rplD 782571 783491 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776376.1 protein_id gnl|my_center|LOCUS_06900 783488 783787 gene locus_tag LOCUS_06910 783488 783787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 783825 784661 gene locus_tag LOCUS_06920 gene rplB 783825 784661 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055646.1 protein_id gnl|my_center|LOCUS_06920 784679 784960 gene locus_tag LOCUS_06930 gene rpsS 784679 784960 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055647.1 protein_id gnl|my_center|LOCUS_06930 784980 785381 gene locus_tag LOCUS_06940 gene rplV 784980 785381 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222606.1 protein_id gnl|my_center|LOCUS_06940 785385 786218 gene locus_tag LOCUS_06950 785385 786218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 786202 786639 gene locus_tag LOCUS_06960 gene rplP 786202 786639 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974260.1 protein_id gnl|my_center|LOCUS_06960 786639 786893 gene locus_tag LOCUS_06970 gene rpmC 786639 786893 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_06970 786896 787234 gene locus_tag LOCUS_06980 gene rpsQ 786896 787234 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_06980 787347 787715 gene locus_tag LOCUS_06990 gene rplN 787347 787715 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403649.1 protein_id gnl|my_center|LOCUS_06990 787717 788127 gene locus_tag LOCUS_07000 gene rplX 787717 788127 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974256.1 protein_id gnl|my_center|LOCUS_07000 788127 788714 gene locus_tag LOCUS_07010 gene rplE 788127 788714 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776364.1 protein_id gnl|my_center|LOCUS_07010 788734 788919 gene locus_tag LOCUS_07020 788734 788919 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_07020 789032 789439 gene locus_tag LOCUS_07030 gene rpsH 789032 789439 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854344.1 protein_id gnl|my_center|LOCUS_07030 789467 790009 gene locus_tag LOCUS_07040 gene rplF 789467 790009 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222612.1 protein_id gnl|my_center|LOCUS_07040 790006 790410 gene locus_tag LOCUS_07050 gene rplR 790006 790410 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854346.1 protein_id gnl|my_center|LOCUS_07050 790550 791038 gene locus_tag LOCUS_07060 790550 791038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 791038 791220 gene locus_tag LOCUS_07070 gene rpmD 791038 791220 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776359.1 protein_id gnl|my_center|LOCUS_07070 791225 791701 gene locus_tag LOCUS_07080 gene rplO 791225 791701 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974249.1 protein_id gnl|my_center|LOCUS_07080 791917 793224 gene locus_tag LOCUS_07090 gene secY 791917 793224 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_07090 793224 793811 gene locus_tag LOCUS_07100 793224 793811 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776356.1 protein_id gnl|my_center|LOCUS_07100 793834 794670 gene locus_tag LOCUS_07110 gene map 793834 794670 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 protein_id gnl|my_center|LOCUS_07110 795118 796107 gene locus_tag LOCUS_07120 795118 796107 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849145.1 protein_id gnl|my_center|LOCUS_07120 796203 797525 gene locus_tag LOCUS_07130 796203 797525 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093094.1 protein_id gnl|my_center|LOCUS_07130 797567 799678 gene locus_tag LOCUS_07140 797567 799678 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_07140 800150 799728 gene locus_tag LOCUS_07150 800150 799728 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976191.1 protein_id gnl|my_center|LOCUS_07150 800284 801375 gene locus_tag LOCUS_07160 800284 801375 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079794.1 protein_id gnl|my_center|LOCUS_07160 802309 801404 gene locus_tag LOCUS_07170 802309 801404 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_07170 802358 802741 gene locus_tag LOCUS_07180 802358 802741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 802804 803157 gene locus_tag LOCUS_07190 802804 803157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 803210 804091 gene locus_tag LOCUS_07200 803210 804091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 804291 804512 gene locus_tag LOCUS_07210 gene infA 804291 804512 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558881.1 protein_id gnl|my_center|LOCUS_07210 804911 805285 gene locus_tag LOCUS_07220 gene rpsM 804911 805285 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776352.1 protein_id gnl|my_center|LOCUS_07220 805330 805734 gene locus_tag LOCUS_07230 gene rpsK 805330 805734 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_07230 805771 806376 gene locus_tag LOCUS_07240 gene rpsD 805771 806376 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892911.1 protein_id gnl|my_center|LOCUS_07240 806504 807529 gene locus_tag LOCUS_07250 806504 807529 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_07250 807595 808275 gene locus_tag LOCUS_07260 807595 808275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 808378 809034 gene locus_tag LOCUS_07270 808378 809034 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049746304.1 protein_id gnl|my_center|LOCUS_07270 809387 809061 gene locus_tag LOCUS_07280 809387 809061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 810630 809476 gene locus_tag LOCUS_07290 810630 809476 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973189.1 protein_id gnl|my_center|LOCUS_07290 810776 812083 gene locus_tag LOCUS_07300 810776 812083 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973190.1 protein_id gnl|my_center|LOCUS_07300 812139 813023 gene locus_tag LOCUS_07310 812139 813023 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532943.1 protein_id gnl|my_center|LOCUS_07310 813055 813486 gene locus_tag LOCUS_07320 813055 813486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 813556 815133 gene locus_tag LOCUS_07330 813556 815133 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027650.1 protein_id gnl|my_center|LOCUS_07330 815384 816316 gene locus_tag LOCUS_07340 815384 816316 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776805.1 protein_id gnl|my_center|LOCUS_07340 816324 817229 gene locus_tag LOCUS_07350 816324 817229 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110222.1 protein_id gnl|my_center|LOCUS_07350 817226 818623 gene locus_tag LOCUS_07360 817226 818623 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804375.1 protein_id gnl|my_center|LOCUS_07360 819071 818637 gene locus_tag LOCUS_07370 819071 818637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 819807 819181 gene locus_tag LOCUS_07380 819807 819181 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399735.1 protein_id gnl|my_center|LOCUS_07380 823047 819952 gene locus_tag LOCUS_07390 823047 819952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 823295 824164 gene locus_tag LOCUS_07400 823295 824164 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776310.1 protein_id gnl|my_center|LOCUS_07400 824140 825729 gene locus_tag LOCUS_07410 824140 825729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776311.1 protein_id gnl|my_center|LOCUS_07410 826031 825837 gene locus_tag LOCUS_07420 gene csbD 826031 825837 CDS product stress response protein CsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227718.1 protein_id gnl|my_center|LOCUS_07420 826779 826180 gene locus_tag LOCUS_07430 826779 826180 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804681.1 protein_id gnl|my_center|LOCUS_07430 827780 826776 gene locus_tag LOCUS_07440 gene truA 827780 826776 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974242.1 protein_id gnl|my_center|LOCUS_07440 828502 827777 gene locus_tag LOCUS_07450 gene trmB 828502 827777 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804561.1 protein_id gnl|my_center|LOCUS_07450 828744 828499 gene locus_tag LOCUS_07460 828744 828499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 829655 828768 gene locus_tag LOCUS_07470 829655 828768 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867471.1 protein_id gnl|my_center|LOCUS_07470 830715 829642 gene locus_tag LOCUS_07480 830715 829642 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974362.1 protein_id gnl|my_center|LOCUS_07480 831880 830720 gene locus_tag LOCUS_07490 831880 830720 CDS product sigma-E factor regulatory protein RseB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229771.1 protein_id gnl|my_center|LOCUS_07490 832034 833731 gene locus_tag LOCUS_07500 832034 833731 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114333.1 protein_id gnl|my_center|LOCUS_07500 834811 833810 gene locus_tag LOCUS_07510 834811 833810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 837068 834936 gene locus_tag LOCUS_07520 837068 834936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 837924 837061 gene locus_tag LOCUS_07530 837924 837061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 839219 837993 gene locus_tag LOCUS_07540 839219 837993 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222426.1 protein_id gnl|my_center|LOCUS_07540 839979 839227 gene locus_tag LOCUS_07550 839979 839227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141998.1 protein_id gnl|my_center|LOCUS_07550 841472 839976 gene locus_tag LOCUS_07560 841472 839976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 842259 841642 gene locus_tag LOCUS_07570 842259 841642 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 protein_id gnl|my_center|LOCUS_07570 843563 842259 gene locus_tag LOCUS_07580 843563 842259 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408560.1 protein_id gnl|my_center|LOCUS_07580 844900 843737 gene locus_tag LOCUS_07590 844900 843737 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222515.1 protein_id gnl|my_center|LOCUS_07590 846227 844947 gene locus_tag LOCUS_07600 846227 844947 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_07600 846541 846996 gene locus_tag LOCUS_07610 gene rplM 846541 846996 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560141.1 protein_id gnl|my_center|LOCUS_07610 847059 847568 gene locus_tag LOCUS_07620 847059 847568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 847595 848947 gene locus_tag LOCUS_07630 gene glmM 847595 848947 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_07630 849142 848951 gene locus_tag LOCUS_07640 849142 848951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 849846 849211 gene locus_tag LOCUS_07650 849846 849211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 850378 849836 gene locus_tag LOCUS_07660 850378 849836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 853395 850504 gene locus_tag LOCUS_07670 853395 850504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 853946 854374 gene locus_tag LOCUS_07680 853946 854374 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_07680 855203 854430 gene locus_tag LOCUS_07690 855203 854430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 855256 856329 gene locus_tag LOCUS_07700 855256 856329 CDS product DUF2183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930149.1 protein_id gnl|my_center|LOCUS_07700 857325 856351 gene locus_tag LOCUS_07710 gene coaA 857325 856351 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974235.1 protein_id gnl|my_center|LOCUS_07710 858761 857454 gene locus_tag LOCUS_07720 858761 857454 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929927.1 protein_id gnl|my_center|LOCUS_07720 858941 860833 gene locus_tag LOCUS_07730 gene glmS 858941 860833 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_07730 860886 861236 gene locus_tag LOCUS_07740 860886 861236 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_07740 861233 862657 gene locus_tag LOCUS_07750 861233 862657 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 protein_id gnl|my_center|LOCUS_07750 862654 863871 gene locus_tag LOCUS_07760 gene alr 862654 863871 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_07760 863871 864965 gene locus_tag LOCUS_07770 863871 864965 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327056.1 protein_id gnl|my_center|LOCUS_07770 865059 866153 gene locus_tag LOCUS_07780 865059 866153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 866146 866823 gene locus_tag LOCUS_07790 gene tsaB 866146 866823 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_07790 866820 867440 gene locus_tag LOCUS_07800 866820 867440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 867437 868489 gene locus_tag LOCUS_07810 gene tsaD 867437 868489 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222664.1 protein_id gnl|my_center|LOCUS_07810 868597 869865 gene locus_tag LOCUS_07820 868597 869865 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104331.1 protein_id gnl|my_center|LOCUS_07820 870015 872024 gene locus_tag LOCUS_07830 870015 872024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 872120 873199 gene locus_tag LOCUS_07840 872120 873199 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803789.1 protein_id gnl|my_center|LOCUS_07840 873196 874047 gene locus_tag LOCUS_07850 873196 874047 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980619.1 protein_id gnl|my_center|LOCUS_07850 874044 875135 gene locus_tag LOCUS_07860 874044 875135 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250752.1 protein_id gnl|my_center|LOCUS_07860 875132 876247 gene locus_tag LOCUS_07870 875132 876247 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027033306.1 protein_id gnl|my_center|LOCUS_07870 876195 876461 gene locus_tag LOCUS_07880 876195 876461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 877798 876488 gene locus_tag LOCUS_07890 877798 876488 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037352.1 protein_id gnl|my_center|LOCUS_07890 878973 877831 gene locus_tag LOCUS_07900 878973 877831 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804479.1 protein_id gnl|my_center|LOCUS_07900 880354 879473 gene locus_tag LOCUS_07910 880354 879473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 880515 880784 gene locus_tag LOCUS_07920 880515 880784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 880921 882837 gene locus_tag LOCUS_07930 880921 882837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 882871 883248 gene locus_tag LOCUS_07940 882871 883248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 883569 883264 gene locus_tag LOCUS_07950 883569 883264 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225986.1 protein_id gnl|my_center|LOCUS_07950 883734 884030 gene locus_tag LOCUS_07960 gene groES 883734 884030 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_07960 884045 885655 gene locus_tag LOCUS_07970 gene groL 884045 885655 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_07970 885891 887447 gene locus_tag LOCUS_07980 gene guaB 885891 887447 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974203.1 protein_id gnl|my_center|LOCUS_07980 887502 888608 gene locus_tag LOCUS_07990 887502 888608 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_07990 889985 889044 gene locus_tag LOCUS_08000 889985 889044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148043383.1 protein_id gnl|my_center|LOCUS_08000 890099 890305 gene locus_tag LOCUS_08010 890099 890305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 890997 890194 gene locus_tag LOCUS_08020 890997 890194 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287292.1 protein_id gnl|my_center|LOCUS_08020 891905 891012 gene locus_tag LOCUS_08030 891905 891012 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027842956.1 protein_id gnl|my_center|LOCUS_08030 893206 891902 gene locus_tag LOCUS_08040 893206 891902 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929854.1 protein_id gnl|my_center|LOCUS_08040 895790 893697 gene locus_tag LOCUS_08050 895790 893697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 896524 895787 gene locus_tag LOCUS_08060 896524 895787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 898491 896521 gene locus_tag LOCUS_08070 898491 896521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 899057 900073 gene locus_tag LOCUS_08080 899057 900073 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027205.1 protein_id gnl|my_center|LOCUS_08080 900083 900397 gene locus_tag LOCUS_08090 900083 900397 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976797.1 protein_id gnl|my_center|LOCUS_08090 902412 900748 gene locus_tag LOCUS_08100 902412 900748 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730832.1 protein_id gnl|my_center|LOCUS_08100 902558 904132 gene locus_tag LOCUS_08110 gene guaA 902558 904132 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893015.1 protein_id gnl|my_center|LOCUS_08110 904615 904157 gene locus_tag LOCUS_08120 904615 904157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 904868 904689 gene locus_tag LOCUS_08130 904868 904689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 906232 904865 gene locus_tag LOCUS_08140 906232 904865 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111981.1 protein_id gnl|my_center|LOCUS_08140 906486 907916 gene locus_tag LOCUS_08150 906486 907916 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222700.1 protein_id gnl|my_center|LOCUS_08150 907913 908626 gene locus_tag LOCUS_08160 907913 908626 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029866.1 protein_id gnl|my_center|LOCUS_08160 908724 909170 gene locus_tag LOCUS_08170 908724 909170 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406624.1 protein_id gnl|my_center|LOCUS_08170 909238 910125 gene locus_tag LOCUS_08180 909238 910125 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729296.1 protein_id gnl|my_center|LOCUS_08180 911371 910178 gene locus_tag LOCUS_08190 911371 910178 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804912.1 protein_id gnl|my_center|LOCUS_08190 912623 911391 gene locus_tag LOCUS_08200 912623 911391 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168581903.1 protein_id gnl|my_center|LOCUS_08200 912738 915320 gene locus_tag LOCUS_08210 gene pcrA 912738 915320 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222711.1 protein_id gnl|my_center|LOCUS_08210 916565 915519 gene locus_tag LOCUS_08220 916565 915519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 917982 916930 gene locus_tag LOCUS_08230 917982 916930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 919454 918396 gene locus_tag LOCUS_08240 919454 918396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 919526 920002 gene locus_tag LOCUS_08250 919526 920002 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_08250 920111 921292 gene locus_tag LOCUS_08260 gene sucC 920111 921292 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804537.1 protein_id gnl|my_center|LOCUS_08260 921308 922186 gene locus_tag LOCUS_08270 gene sucD 921308 922186 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974163.1 protein_id gnl|my_center|LOCUS_08270 922199 922756 gene locus_tag LOCUS_08280 922199 922756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 922812 923086 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gactcacgcgcactgagcttgtcgaagtgc 924796 923171 gene locus_tag LOCUS_08290 924796 923171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 924956 926248 gene locus_tag LOCUS_08300 924956 926248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 926342 926929 gene locus_tag LOCUS_08310 gene purN 926342 926929 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878360.1 protein_id gnl|my_center|LOCUS_08310 926956 928572 gene locus_tag LOCUS_08320 gene purH 926956 928572 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222720.1 protein_id gnl|my_center|LOCUS_08320 928682 929695 gene locus_tag LOCUS_08330 928682 929695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 930765 929659 gene locus_tag LOCUS_08340 930765 929659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 930837 932078 gene locus_tag LOCUS_08350 930837 932078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 933466 932102 gene locus_tag LOCUS_08360 933466 932102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 934792 933470 gene locus_tag LOCUS_08370 934792 933470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 935439 934789 gene locus_tag LOCUS_08380 935439 934789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 936757 935450 gene locus_tag LOCUS_08390 936757 935450 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037175.1 protein_id gnl|my_center|LOCUS_08390 937341 936754 gene locus_tag LOCUS_08400 gene rfbC 937341 936754 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142202.1 protein_id gnl|my_center|LOCUS_08400 938363 937338 gene locus_tag LOCUS_08410 938363 937338 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257100.1 protein_id gnl|my_center|LOCUS_08410 939263 938436 gene locus_tag LOCUS_08420 gene rfbF 939263 938436 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937383.1 protein_id gnl|my_center|LOCUS_08420 940777 939308 gene locus_tag LOCUS_08430 940777 939308 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229159.1 protein_id gnl|my_center|LOCUS_08430 942277 941060 gene locus_tag LOCUS_08440 gene lhgO 942277 941060 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_08440 942722 943960 gene locus_tag LOCUS_08450 942722 943960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 945126 943939 gene locus_tag LOCUS_08460 945126 943939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 946148 945123 gene locus_tag LOCUS_08470 946148 945123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 947419 946145 gene locus_tag LOCUS_08480 947419 946145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978468.1 protein_id gnl|my_center|LOCUS_08480 948968 947634 gene locus_tag LOCUS_08490 948968 947634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 949408 949794 gene locus_tag LOCUS_08500 949408 949794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 950202 949831 gene locus_tag LOCUS_08510 950202 949831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 950835 950281 gene locus_tag LOCUS_08520 950835 950281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 952455 950980 gene locus_tag LOCUS_08530 952455 950980 CDS product S10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480502.1 protein_id gnl|my_center|LOCUS_08530 953465 952473 gene locus_tag LOCUS_08540 953465 952473 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406301.1 protein_id gnl|my_center|LOCUS_08540 953658 955901 gene locus_tag LOCUS_08550 953658 955901 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031369.1 protein_id gnl|my_center|LOCUS_08550 955998 957392 gene locus_tag LOCUS_08560 955998 957392 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 protein_id gnl|my_center|LOCUS_08560 957469 958959 gene locus_tag LOCUS_08570 957469 958959 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803904.1 protein_id gnl|my_center|LOCUS_08570 959014 960021 gene locus_tag LOCUS_08580 gene trpS 959014 960021 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222753.1 protein_id gnl|my_center|LOCUS_08580 962173 960266 gene locus_tag LOCUS_08590 962173 960266 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951984.1 protein_id gnl|my_center|LOCUS_08590 962292 963536 gene locus_tag LOCUS_08600 962292 963536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 964216 963461 gene locus_tag LOCUS_08610 964216 963461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 965332 964334 gene locus_tag LOCUS_08620 965332 964334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 965488 966795 gene locus_tag LOCUS_08630 965488 966795 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029925.1 protein_id gnl|my_center|LOCUS_08630 967038 968177 gene locus_tag LOCUS_08640 967038 968177 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776144.1 protein_id gnl|my_center|LOCUS_08640 968208 969800 gene locus_tag LOCUS_08650 968208 969800 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776143.1 protein_id gnl|my_center|LOCUS_08650 969797 971011 gene locus_tag LOCUS_08660 969797 971011 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776142.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08660 971008 972330 gene locus_tag LOCUS_08670 971008 972330 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776141.1 protein_id gnl|my_center|LOCUS_08670 972333 972764 gene locus_tag LOCUS_08680 972333 972764 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974083.1 protein_id gnl|my_center|LOCUS_08680 972820 973896 gene locus_tag LOCUS_08690 972820 973896 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_08690 975098 973875 gene locus_tag LOCUS_08700 975098 973875 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844744.1 protein_id gnl|my_center|LOCUS_08700 975364 977397 gene locus_tag LOCUS_08710 975364 977397 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777008.1 protein_id gnl|my_center|LOCUS_08710 977624 984457 gene locus_tag LOCUS_08720 977624 984457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 984688 986679 gene locus_tag LOCUS_08730 984688 986679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 986761 988563 gene locus_tag LOCUS_08740 gene metG 986761 988563 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467759.1 protein_id gnl|my_center|LOCUS_08740 988981 989346 gene locus_tag LOCUS_08750 988981 989346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 989387 991402 gene locus_tag LOCUS_08760 989387 991402 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222257.1 protein_id gnl|my_center|LOCUS_08760 991603 993960 gene locus_tag LOCUS_08770 991603 993960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 994443 994066 gene locus_tag LOCUS_08780 994443 994066 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531287.1 protein_id gnl|my_center|LOCUS_08780 995362 994475 gene locus_tag LOCUS_08790 995362 994475 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_08790 996846 995359 gene locus_tag LOCUS_08800 996846 995359 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222793.1 protein_id gnl|my_center|LOCUS_08800 997833 996865 gene locus_tag LOCUS_08810 gene deoC 997833 996865 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222794.1 protein_id gnl|my_center|LOCUS_08810 997900 998364 gene locus_tag LOCUS_08820 997900 998364 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729159.1 protein_id gnl|my_center|LOCUS_08820 998433 999278 gene locus_tag LOCUS_08830 998433 999278 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228840.1 protein_id gnl|my_center|LOCUS_08830 999580 1001439 gene locus_tag LOCUS_08840 999580 1001439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1002504 1001788 gene locus_tag LOCUS_08850 1002504 1001788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1002494 1002838 gene locus_tag LOCUS_08860 1002494 1002838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1003631 1002861 gene locus_tag LOCUS_08870 1003631 1002861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1004712 1003702 gene locus_tag LOCUS_08880 1004712 1003702 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976409.1 protein_id gnl|my_center|LOCUS_08880 1005653 1004763 gene locus_tag LOCUS_08890 1005653 1004763 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896545.1 protein_id gnl|my_center|LOCUS_08890 1006590 1005655 gene locus_tag LOCUS_08900 1006590 1005655 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026993.1 protein_id gnl|my_center|LOCUS_08900 1007987 1006587 gene locus_tag LOCUS_08910 1007987 1006587 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730345.1 protein_id gnl|my_center|LOCUS_08910 1008257 1010767 gene locus_tag LOCUS_08920 1008257 1010767 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730344.1 protein_id gnl|my_center|LOCUS_08920 1010805 1011899 gene locus_tag LOCUS_08930 1010805 1011899 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896541.1 protein_id gnl|my_center|LOCUS_08930 1011947 1013059 gene locus_tag LOCUS_08940 1011947 1013059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1014293 1013070 gene locus_tag LOCUS_08950 1014293 1013070 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731461.1 protein_id gnl|my_center|LOCUS_08950 1016502 1014295 gene locus_tag LOCUS_08960 1016502 1014295 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728359.1 protein_id gnl|my_center|LOCUS_08960 1018021 1016525 gene locus_tag LOCUS_08970 1018021 1016525 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384516.1 protein_id gnl|my_center|LOCUS_08970 1019433 1018102 gene locus_tag LOCUS_08980 gene lat 1019433 1018102 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893146.1 protein_id gnl|my_center|LOCUS_08980 1019738 1021579 gene locus_tag LOCUS_08990 1019738 1021579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1023364 1021613 gene locus_tag LOCUS_09000 1023364 1021613 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_09000 1024167 1023361 gene locus_tag LOCUS_09010 1024167 1023361 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776134.1 protein_id gnl|my_center|LOCUS_09010 1024718 1024269 gene locus_tag LOCUS_09020 1024718 1024269 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417219.1 protein_id gnl|my_center|LOCUS_09020 1025381 1024752 gene locus_tag LOCUS_09030 1025381 1024752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 1026826 1025378 gene locus_tag LOCUS_09040 1026826 1025378 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225068.1 protein_id gnl|my_center|LOCUS_09040 1026921 1027940 gene locus_tag LOCUS_09050 1026921 1027940 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891902.1 protein_id gnl|my_center|LOCUS_09050 1027933 1028445 gene locus_tag LOCUS_09060 1027933 1028445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1029798 1028575 gene locus_tag LOCUS_09070 1029798 1028575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1030429 1029821 gene locus_tag LOCUS_09080 1030429 1029821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1030505 1031149 gene locus_tag LOCUS_09090 1030505 1031149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1031265 1032677 gene locus_tag LOCUS_09100 1031265 1032677 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 protein_id gnl|my_center|LOCUS_09100 1032674 1033621 gene locus_tag LOCUS_09110 1032674 1033621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729967.1 protein_id gnl|my_center|LOCUS_09110 1034725 1033880 gene locus_tag LOCUS_09120 1034725 1033880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 1036761 1034899 gene locus_tag LOCUS_09130 1036761 1034899 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029950.1 protein_id gnl|my_center|LOCUS_09130 1037741 1036842 gene locus_tag LOCUS_09140 1037741 1036842 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230725.1 protein_id gnl|my_center|LOCUS_09140 1038457 1037738 gene locus_tag LOCUS_09150 1038457 1037738 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079953.1 protein_id gnl|my_center|LOCUS_09150 1039190 1038459 gene locus_tag LOCUS_09160 1039190 1038459 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113150.1 protein_id gnl|my_center|LOCUS_09160 1039291 1039845 gene locus_tag LOCUS_09170 1039291 1039845 CDS product maleylpyruvate isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728747.1 protein_id gnl|my_center|LOCUS_09170 1039842 1041161 gene locus_tag LOCUS_09180 1039842 1041161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 1041816 1041328 gene locus_tag LOCUS_09190 1041816 1041328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1041901 1043154 gene locus_tag LOCUS_09200 1041901 1043154 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896109.1 protein_id gnl|my_center|LOCUS_09200 1043151 1044740 gene locus_tag LOCUS_09210 1043151 1044740 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566963.1 protein_id gnl|my_center|LOCUS_09210 1044794 1045153 gene locus_tag LOCUS_09220 1044794 1045153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1045189 1045953 gene locus_tag LOCUS_09230 1045189 1045953 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029015.1 protein_id gnl|my_center|LOCUS_09230 1045991 1046599 gene locus_tag LOCUS_09240 1045991 1046599 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886969.1 protein_id gnl|my_center|LOCUS_09240 1046596 1047528 gene locus_tag LOCUS_09250 1046596 1047528 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932401.1 protein_id gnl|my_center|LOCUS_09250 1048390 1047584 gene locus_tag LOCUS_09260 1048390 1047584 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976046.1 protein_id gnl|my_center|LOCUS_09260 1049188 1048433 gene locus_tag LOCUS_09270 1049188 1048433 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222179.1 protein_id gnl|my_center|LOCUS_09270 1050671 1049205 gene locus_tag LOCUS_09280 gene dprE1 1050671 1049205 CDS product decaprenylphospho-beta-D-ribofuranose 2-dehydrogenase DprE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420630.1 protein_id gnl|my_center|LOCUS_09280 1051609 1050674 gene locus_tag LOCUS_09290 1051609 1050674 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907518.1 protein_id gnl|my_center|LOCUS_09290 1051825 1052307 gene locus_tag LOCUS_09300 1051825 1052307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1052315 1053574 gene locus_tag LOCUS_09310 1052315 1053574 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730641.1 protein_id gnl|my_center|LOCUS_09310 1054237 1053608 gene locus_tag LOCUS_09320 1054237 1053608 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 protein_id gnl|my_center|LOCUS_09320 1055964 1054234 gene locus_tag LOCUS_09330 1055964 1054234 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742099.1 protein_id gnl|my_center|LOCUS_09330 1057452 1056019 gene locus_tag LOCUS_09340 1057452 1056019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 1057494 1058327 gene locus_tag LOCUS_09350 1057494 1058327 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_09350 1058934 1058386 gene locus_tag LOCUS_09360 1058934 1058386 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226099.1 protein_id gnl|my_center|LOCUS_09360 1059857 1058931 gene locus_tag LOCUS_09370 1059857 1058931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 1060610 1059921 gene locus_tag LOCUS_09380 1060610 1059921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1062898 1060706 gene locus_tag LOCUS_09390 1062898 1060706 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776195.1 protein_id gnl|my_center|LOCUS_09390 1063106 1063774 gene locus_tag LOCUS_09400 1063106 1063774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1063771 1064946 gene locus_tag LOCUS_09410 1063771 1064946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1065700 1064927 gene locus_tag LOCUS_09420 1065700 1064927 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893951.1 protein_id gnl|my_center|LOCUS_09420 1066491 1065724 gene locus_tag LOCUS_09430 1066491 1065724 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223704.1 protein_id gnl|my_center|LOCUS_09430 1067951 1066593 gene locus_tag LOCUS_09440 1067951 1066593 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223703.1 protein_id gnl|my_center|LOCUS_09440 1069345 1067954 gene locus_tag LOCUS_09450 gene glnA4 1069345 1067954 CDS product gamma-glutamylethanolamide synthetase GlnA4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027883.1 protein_id gnl|my_center|LOCUS_09450 1070160 1069420 gene locus_tag LOCUS_09460 1070160 1069420 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466719.1 protein_id gnl|my_center|LOCUS_09460 1071715 1070171 gene locus_tag LOCUS_09470 1071715 1070171 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230797.1 protein_id gnl|my_center|LOCUS_09470 1071916 1072842 gene locus_tag LOCUS_09480 1071916 1072842 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486295.1 protein_id gnl|my_center|LOCUS_09480 1072921 1074078 gene locus_tag LOCUS_09490 1072921 1074078 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975751.1 protein_id gnl|my_center|LOCUS_09490 1074123 1074635 gene locus_tag LOCUS_09500 gene purE 1074123 1074635 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_09500 1074668 1075438 gene locus_tag LOCUS_09510 1074668 1075438 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028326.1 protein_id gnl|my_center|LOCUS_09510 1075527 1077281 gene locus_tag LOCUS_09520 1075527 1077281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 1077406 1078596 gene locus_tag LOCUS_09530 1077406 1078596 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence2 <1 920 gene locus_tag LOCUS_09540 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027494.1:5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase 1865 960 gene locus_tag LOCUS_09550 1865 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 2853 1909 gene locus_tag LOCUS_09560 2853 1909 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_09560 3657 2890 gene locus_tag LOCUS_09570 3657 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 3836 4537 gene locus_tag LOCUS_09580 3836 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 5176 4610 gene locus_tag LOCUS_09590 gene pyrE 5176 4610 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230857.1 protein_id gnl|my_center|LOCUS_09590 5837 5187 gene locus_tag LOCUS_09600 5837 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 7145 5895 gene locus_tag LOCUS_09610 7145 5895 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225591.1 protein_id gnl|my_center|LOCUS_09610 8054 7215 gene locus_tag LOCUS_09620 8054 7215 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 protein_id gnl|my_center|LOCUS_09620 9102 8197 gene locus_tag LOCUS_09630 9102 8197 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 protein_id gnl|my_center|LOCUS_09630 11934 9319 gene locus_tag LOCUS_09640 gene clpB 11934 9319 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975278.1 protein_id gnl|my_center|LOCUS_09640 12898 12065 gene locus_tag LOCUS_09650 12898 12065 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074041.1 protein_id gnl|my_center|LOCUS_09650 13712 12987 gene locus_tag LOCUS_09660 13712 12987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 13693 14058 gene locus_tag LOCUS_09670 13693 14058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 14189 15763 gene locus_tag LOCUS_09680 14189 15763 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853689.1 protein_id gnl|my_center|LOCUS_09680 16304 15744 gene locus_tag LOCUS_09690 16304 15744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231066.1 protein_id gnl|my_center|LOCUS_09690 16398 16619 gene locus_tag LOCUS_09700 16398 16619 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 protein_id gnl|my_center|LOCUS_09700 16616 17005 gene locus_tag LOCUS_09710 16616 17005 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_09710 17121 18053 gene locus_tag LOCUS_09720 17121 18053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 18050 18538 gene locus_tag LOCUS_09730 18050 18538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 19471 18560 gene locus_tag LOCUS_09740 19471 18560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 21122 19413 gene locus_tag LOCUS_09750 gene cydC 21122 19413 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775860.1 protein_id gnl|my_center|LOCUS_09750 22834 21119 gene locus_tag LOCUS_09760 22834 21119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09760 23877 22834 gene locus_tag LOCUS_09770 gene cydB 23877 22834 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029331.1 protein_id gnl|my_center|LOCUS_09770 25410 23902 gene locus_tag LOCUS_09780 25410 23902 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_09780 25520 25894 gene locus_tag LOCUS_09790 25520 25894 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058519.1 protein_id gnl|my_center|LOCUS_09790 25965 26930 gene locus_tag LOCUS_09800 25965 26930 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908696.1 protein_id gnl|my_center|LOCUS_09800 26944 27546 gene locus_tag LOCUS_09810 26944 27546 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193598.1 protein_id gnl|my_center|LOCUS_09810 27642 28091 gene locus_tag LOCUS_09820 27642 28091 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066940.1 protein_id gnl|my_center|LOCUS_09820 28735 28085 gene locus_tag LOCUS_09830 28735 28085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 29675 28887 gene locus_tag LOCUS_09840 29675 28887 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228020.1 protein_id gnl|my_center|LOCUS_09840 29755 30642 gene locus_tag LOCUS_09850 29755 30642 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043688023.1 protein_id gnl|my_center|LOCUS_09850 31959 30646 gene locus_tag LOCUS_09860 31959 30646 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973743.1 protein_id gnl|my_center|LOCUS_09860 32188 32604 gene locus_tag LOCUS_09870 32188 32604 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974357.1 protein_id gnl|my_center|LOCUS_09870 32651 34060 gene locus_tag LOCUS_09880 32651 34060 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256548.1 protein_id gnl|my_center|LOCUS_09880 34026 34166 gene locus_tag LOCUS_09890 34026 34166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 34789 34352 gene locus_tag LOCUS_09900 34789 34352 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467870.1 protein_id gnl|my_center|LOCUS_09900 35970 34789 gene locus_tag LOCUS_09910 gene dnaJ 35970 34789 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975270.1 protein_id gnl|my_center|LOCUS_09910 36802 36107 gene locus_tag LOCUS_09920 36802 36107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 38682 36799 gene locus_tag LOCUS_09930 gene dnaK 38682 36799 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_09930 38991 39491 gene locus_tag LOCUS_09940 38991 39491 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286612.1 protein_id gnl|my_center|LOCUS_09940 39602 40339 gene locus_tag LOCUS_09950 39602 40339 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863629.1 protein_id gnl|my_center|LOCUS_09950 40663 42102 gene locus_tag LOCUS_09960 40663 42102 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228517.1 protein_id gnl|my_center|LOCUS_09960 42594 42226 gene locus_tag LOCUS_09970 42594 42226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 44459 42744 gene locus_tag LOCUS_09980 44459 42744 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930206.1 protein_id gnl|my_center|LOCUS_09980 44600 46705 gene locus_tag LOCUS_09990 44600 46705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 46734 48128 gene locus_tag LOCUS_10000 46734 48128 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029389.1 protein_id gnl|my_center|LOCUS_10000 48208 49821 gene locus_tag LOCUS_10010 48208 49821 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_10010 51067 49844 gene locus_tag LOCUS_10020 51067 49844 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229955.1 protein_id gnl|my_center|LOCUS_10020 52125 51184 gene locus_tag LOCUS_10030 52125 51184 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020544063.1 protein_id gnl|my_center|LOCUS_10030 52951 52259 gene locus_tag LOCUS_10040 52951 52259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 53604 52948 gene locus_tag LOCUS_10050 53604 52948 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229697.1 protein_id gnl|my_center|LOCUS_10050 55268 53601 gene locus_tag LOCUS_10060 55268 53601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 55625 57895 gene locus_tag LOCUS_10070 55625 57895 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029156.1 protein_id gnl|my_center|LOCUS_10070 57968 58876 gene locus_tag LOCUS_10080 57968 58876 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973953.1 protein_id gnl|my_center|LOCUS_10080 58968 59663 gene locus_tag LOCUS_10090 58968 59663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 59660 60424 gene locus_tag LOCUS_10100 59660 60424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 61361 60786 gene locus_tag LOCUS_10110 gene dcd 61361 60786 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_10110 62935 61424 gene locus_tag LOCUS_10120 62935 61424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 64212 62932 gene locus_tag LOCUS_10130 64212 62932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10130 65207 64209 gene locus_tag LOCUS_10140 65207 64209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 66252 65281 gene locus_tag LOCUS_10150 66252 65281 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977203.1 protein_id gnl|my_center|LOCUS_10150 66315 67451 gene locus_tag LOCUS_10160 66315 67451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 67596 67456 gene locus_tag LOCUS_10170 67596 67456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 68077 67748 gene locus_tag LOCUS_10180 68077 67748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 68245 69618 gene locus_tag LOCUS_10190 68245 69618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 69615 70274 gene locus_tag LOCUS_10200 69615 70274 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_10200 70629 70297 gene locus_tag LOCUS_10210 70629 70297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 71000 70626 gene locus_tag LOCUS_10220 71000 70626 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_10220 71486 71295 gene locus_tag LOCUS_10230 71486 71295 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892186.1 protein_id gnl|my_center|LOCUS_10230 72775 71483 gene locus_tag LOCUS_10240 72775 71483 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727175.1 protein_id gnl|my_center|LOCUS_10240 73956 72967 gene locus_tag LOCUS_10250 73956 72967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 74290 74949 gene locus_tag LOCUS_10260 74290 74949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 75092 77197 gene locus_tag LOCUS_10270 75092 77197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 78596 77343 gene locus_tag LOCUS_10280 78596 77343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 78505 78702 gene locus_tag LOCUS_10290 78505 78702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 80359 78767 gene locus_tag LOCUS_10300 80359 78767 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027201.1 protein_id gnl|my_center|LOCUS_10300 81164 80454 gene locus_tag LOCUS_10310 81164 80454 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978224.1 protein_id gnl|my_center|LOCUS_10310 82135 81272 gene locus_tag LOCUS_10320 82135 81272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 83355 82162 gene locus_tag LOCUS_10330 83355 82162 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742146.1 protein_id gnl|my_center|LOCUS_10330 83494 85149 gene locus_tag LOCUS_10340 83494 85149 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777117.1 protein_id gnl|my_center|LOCUS_10340 85210 85704 gene locus_tag LOCUS_10350 85210 85704 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731384.1 protein_id gnl|my_center|LOCUS_10350 85739 88069 gene locus_tag LOCUS_10360 85739 88069 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203206.1 protein_id gnl|my_center|LOCUS_10360 88742 88077 gene locus_tag LOCUS_10370 88742 88077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 88838 89440 gene locus_tag LOCUS_10380 88838 89440 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387916.1 protein_id gnl|my_center|LOCUS_10380 89810 89463 gene locus_tag LOCUS_10390 89810 89463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 90137 90064 gene locus_tag LOCUS_t00140 90137 90064 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 90326 91102 gene locus_tag LOCUS_10400 90326 91102 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030020.1 protein_id gnl|my_center|LOCUS_10400 91186 91689 gene locus_tag LOCUS_10410 91186 91689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 91695 94055 gene locus_tag LOCUS_10420 91695 94055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 94520 94083 gene locus_tag LOCUS_10430 94520 94083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 94624 95193 gene locus_tag LOCUS_10440 94624 95193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 95294 96121 gene locus_tag LOCUS_10450 95294 96121 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887469.1 protein_id gnl|my_center|LOCUS_10450 98916 96277 gene locus_tag LOCUS_10460 98916 96277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 100649 99012 gene locus_tag LOCUS_10470 gene argS 100649 99012 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804295.1 protein_id gnl|my_center|LOCUS_10470 100724 101545 gene locus_tag LOCUS_10480 100724 101545 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893773.1 protein_id gnl|my_center|LOCUS_10480 102227 101730 gene locus_tag LOCUS_10490 102227 101730 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892281.1 protein_id gnl|my_center|LOCUS_10490 103053 102259 gene locus_tag LOCUS_10500 103053 102259 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_10500 103162 103701 gene locus_tag LOCUS_10510 103162 103701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 104324 103686 gene locus_tag LOCUS_10520 104324 103686 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531936.1 protein_id gnl|my_center|LOCUS_10520 104442 105746 gene locus_tag LOCUS_10530 104442 105746 CDS product sialate:H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900427.1 protein_id gnl|my_center|LOCUS_10530 105759 106436 gene locus_tag LOCUS_10540 105759 106436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 106675 107316 gene locus_tag LOCUS_10550 gene abmR 106675 107316 CDS product transcriptional regulator AbmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406375.1 protein_id gnl|my_center|LOCUS_10550 107512 108552 gene locus_tag LOCUS_10560 107512 108552 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974028.1 protein_id gnl|my_center|LOCUS_10560 110297 108624 gene locus_tag LOCUS_10570 gene pgi 110297 108624 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804725.1 protein_id gnl|my_center|LOCUS_10570 110413 111945 gene locus_tag LOCUS_10580 gene dgt 110413 111945 CDS product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224725.1 protein_id gnl|my_center|LOCUS_10580 112030 112755 gene locus_tag LOCUS_10590 112030 112755 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 protein_id gnl|my_center|LOCUS_10590 113032 112886 gene locus_tag LOCUS_10600 113032 112886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 113683 113195 gene locus_tag LOCUS_10610 113683 113195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 114770 113790 gene locus_tag LOCUS_10620 114770 113790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 115095 116459 gene locus_tag LOCUS_10630 115095 116459 CDS product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982254.1 protein_id gnl|my_center|LOCUS_10630 117224 116595 gene locus_tag LOCUS_10640 117224 116595 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227827.1 protein_id gnl|my_center|LOCUS_10640 119842 117221 gene locus_tag LOCUS_10650 119842 117221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 120934 119945 gene locus_tag LOCUS_10660 120934 119945 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730839.1 protein_id gnl|my_center|LOCUS_10660 122208 121072 gene locus_tag LOCUS_10670 122208 121072 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_10670 122284 122955 gene locus_tag LOCUS_10680 122284 122955 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225438.1 protein_id gnl|my_center|LOCUS_10680 122952 124427 gene locus_tag LOCUS_10690 122952 124427 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225439.1 protein_id gnl|my_center|LOCUS_10690 124950 124465 gene locus_tag LOCUS_10700 124950 124465 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_10700 124996 125952 gene locus_tag LOCUS_10710 124996 125952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 128132 125991 gene locus_tag LOCUS_10720 128132 125991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 128374 128730 gene locus_tag LOCUS_10730 128374 128730 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978264.1 protein_id gnl|my_center|LOCUS_10730 131124 128809 gene locus_tag LOCUS_10740 gene secA2 131124 128809 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223120.1 protein_id gnl|my_center|LOCUS_10740 131554 131279 gene locus_tag LOCUS_10750 131554 131279 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079645.1 protein_id gnl|my_center|LOCUS_10750 132021 131572 gene locus_tag LOCUS_10760 132021 131572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 134133 132193 gene locus_tag LOCUS_10770 134133 132193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 136212 134341 gene locus_tag LOCUS_10780 136212 134341 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726920.1 protein_id gnl|my_center|LOCUS_10780 136661 136320 gene locus_tag LOCUS_10790 136661 136320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 136721 137290 gene locus_tag LOCUS_10800 136721 137290 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030978.1 protein_id gnl|my_center|LOCUS_10800 138207 137395 gene locus_tag LOCUS_10810 138207 137395 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775801.1 protein_id gnl|my_center|LOCUS_10810 139301 138204 gene locus_tag LOCUS_10820 139301 138204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 140287 139298 gene locus_tag LOCUS_10830 140287 139298 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775803.1 protein_id gnl|my_center|LOCUS_10830 141314 140304 gene locus_tag LOCUS_10840 141314 140304 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775804.1 protein_id gnl|my_center|LOCUS_10840 143250 141409 gene locus_tag LOCUS_10850 143250 141409 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775805.1 protein_id gnl|my_center|LOCUS_10850 144767 143709 gene locus_tag LOCUS_10860 144767 143709 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972694.1 protein_id gnl|my_center|LOCUS_10860 145022 145774 gene locus_tag LOCUS_10870 145022 145774 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227640.1 protein_id gnl|my_center|LOCUS_10870 145774 146892 gene locus_tag LOCUS_10880 145774 146892 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804036.1 protein_id gnl|my_center|LOCUS_10880 147181 146987 gene locus_tag LOCUS_10890 147181 146987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 147403 147185 gene locus_tag LOCUS_10900 147403 147185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 149150 147615 gene locus_tag LOCUS_10910 149150 147615 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776523.1 protein_id gnl|my_center|LOCUS_10910 150237 149263 gene locus_tag LOCUS_10920 150237 149263 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_10920 151412 150234 gene locus_tag LOCUS_10930 gene pdhA 151412 150234 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_10930 151699 152673 gene locus_tag LOCUS_10940 151699 152673 CDS product RIO kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223947.1 protein_id gnl|my_center|LOCUS_10940 153906 152725 gene locus_tag LOCUS_10950 153906 152725 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031359.1 protein_id gnl|my_center|LOCUS_10950 154814 154269 gene locus_tag LOCUS_10960 154814 154269 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080565.1 protein_id gnl|my_center|LOCUS_10960 154910 155911 gene locus_tag LOCUS_10970 154910 155911 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111996.1 protein_id gnl|my_center|LOCUS_10970 155937 157037 gene locus_tag LOCUS_10980 155937 157037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 157081 157560 gene locus_tag LOCUS_10990 157081 157560 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729728.1 protein_id gnl|my_center|LOCUS_10990 157557 158171 gene locus_tag LOCUS_11000 157557 158171 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226078.1 protein_id gnl|my_center|LOCUS_11000 158240 158653 gene locus_tag LOCUS_11010 158240 158653 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974289.1 protein_id gnl|my_center|LOCUS_11010 159104 158679 gene locus_tag LOCUS_11020 159104 158679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978009.1 protein_id gnl|my_center|LOCUS_11020 161103 159205 gene locus_tag LOCUS_11030 161103 159205 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730690.1 protein_id gnl|my_center|LOCUS_11030 163130 161100 gene locus_tag LOCUS_11040 163130 161100 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730691.1 protein_id gnl|my_center|LOCUS_11040 164084 163455 gene locus_tag LOCUS_11050 164084 163455 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207760114.1 protein_id gnl|my_center|LOCUS_11050 164189 165367 gene locus_tag LOCUS_11060 gene xylA 164189 165367 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803826.1 protein_id gnl|my_center|LOCUS_11060 165518 166111 gene locus_tag LOCUS_11070 165518 166111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 166137 166754 gene locus_tag LOCUS_11080 166137 166754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 166818 167972 gene locus_tag LOCUS_11090 166818 167972 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_11090 167969 168571 gene locus_tag LOCUS_11100 167969 168571 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229801.1 protein_id gnl|my_center|LOCUS_11100 168700 168912 gene locus_tag LOCUS_11110 168700 168912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 169576 168938 gene locus_tag LOCUS_11120 169576 168938 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227659.1 protein_id gnl|my_center|LOCUS_11120 169665 170141 gene locus_tag LOCUS_11130 169665 170141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 170265 171407 gene locus_tag LOCUS_11140 170265 171407 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225761.1 protein_id gnl|my_center|LOCUS_11140 172423 171449 gene locus_tag LOCUS_11150 172423 171449 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810847.1 protein_id gnl|my_center|LOCUS_11150 173334 172459 gene locus_tag LOCUS_11160 173334 172459 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 protein_id gnl|my_center|LOCUS_11160 173462 173863 gene locus_tag LOCUS_11170 173462 173863 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_11170 173860 174387 gene locus_tag LOCUS_11180 173860 174387 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223074.1 protein_id gnl|my_center|LOCUS_11180 174461 174676 gene locus_tag LOCUS_11190 174461 174676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 177008 174759 gene locus_tag LOCUS_11200 177008 174759 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805172.1 protein_id gnl|my_center|LOCUS_11200 179875 177080 gene locus_tag LOCUS_11210 179875 177080 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805171.1 protein_id gnl|my_center|LOCUS_11210 180036 180662 gene locus_tag LOCUS_11220 180036 180662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 181823 180792 gene locus_tag LOCUS_11230 gene mgrA 181823 180792 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_11230 181975 182670 gene locus_tag LOCUS_11240 181975 182670 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878347.1 protein_id gnl|my_center|LOCUS_11240 182781 184211 gene locus_tag LOCUS_11250 182781 184211 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230060.1 protein_id gnl|my_center|LOCUS_11250 184300 185955 gene locus_tag LOCUS_11260 184300 185955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 186954 185995 gene locus_tag LOCUS_11270 186954 185995 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400956.1 protein_id gnl|my_center|LOCUS_11270 187748 186951 gene locus_tag LOCUS_11280 gene yaaA 187748 186951 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_11280 187909 189447 gene locus_tag LOCUS_11290 187909 189447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 189543 190007 gene locus_tag LOCUS_11300 189543 190007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 190004 190438 gene locus_tag LOCUS_11310 190004 190438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 190460 190969 gene locus_tag LOCUS_11320 190460 190969 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614581.1 protein_id gnl|my_center|LOCUS_11320 191401 190979 gene locus_tag LOCUS_11330 191401 190979 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325767.1 protein_id gnl|my_center|LOCUS_11330 192948 191404 gene locus_tag LOCUS_11340 gene lysS 192948 191404 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230454.1 protein_id gnl|my_center|LOCUS_11340 193678 193013 gene locus_tag LOCUS_11350 193678 193013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 193781 194692 gene locus_tag LOCUS_11360 193781 194692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 194709 194906 gene locus_tag LOCUS_11370 194709 194906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 195886 195212 gene locus_tag LOCUS_11380 195886 195212 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027849.1 protein_id gnl|my_center|LOCUS_11380 198078 195919 gene locus_tag LOCUS_11390 198078 195919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 198183 198914 gene locus_tag LOCUS_11400 198183 198914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 198914 200650 gene locus_tag LOCUS_11410 198914 200650 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976341.1 protein_id gnl|my_center|LOCUS_11410 200647 202707 gene locus_tag LOCUS_11420 200647 202707 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_11420 203787 202720 gene locus_tag LOCUS_11430 203787 202720 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306915.1 protein_id gnl|my_center|LOCUS_11430 204893 203784 gene locus_tag LOCUS_11440 204893 203784 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230097.1 protein_id gnl|my_center|LOCUS_11440 205858 204890 gene locus_tag LOCUS_11450 205858 204890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230098.1 protein_id gnl|my_center|LOCUS_11450 206876 205890 gene locus_tag LOCUS_11460 206876 205890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230099.1 protein_id gnl|my_center|LOCUS_11460 208671 207022 gene locus_tag LOCUS_11470 208671 207022 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706882.1 protein_id gnl|my_center|LOCUS_11470 210023 208668 gene locus_tag LOCUS_11480 210023 208668 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208195.1 protein_id gnl|my_center|LOCUS_11480 210193 211017 gene locus_tag LOCUS_11490 210193 211017 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892748.1 protein_id gnl|my_center|LOCUS_11490 213466 211175 gene locus_tag LOCUS_11500 213466 211175 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728432.1 protein_id gnl|my_center|LOCUS_11500 213627 215222 gene locus_tag LOCUS_11510 213627 215222 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728275.1 protein_id gnl|my_center|LOCUS_11510 215375 216547 gene locus_tag LOCUS_11520 215375 216547 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063775.1 protein_id gnl|my_center|LOCUS_11520 216544 216918 gene locus_tag LOCUS_11530 216544 216918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 216915 218315 gene locus_tag LOCUS_11540 216915 218315 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223979.1 protein_id gnl|my_center|LOCUS_11540 219768 218323 gene locus_tag LOCUS_11550 219768 218323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556091.1 protein_id gnl|my_center|LOCUS_11550 220217 219912 gene locus_tag LOCUS_11560 220217 219912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 220984 220214 gene locus_tag LOCUS_11570 220984 220214 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190991.1 protein_id gnl|my_center|LOCUS_11570 221333 221019 gene locus_tag LOCUS_11580 221333 221019 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152231551.1 protein_id gnl|my_center|LOCUS_11580 221465 222028 gene locus_tag LOCUS_11590 221465 222028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 222805 222041 gene locus_tag LOCUS_11600 gene map 222805 222041 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084151.1 protein_id gnl|my_center|LOCUS_11600 223290 222841 gene locus_tag LOCUS_11610 gene derI1 223290 222841 CDS product D-erythrulose 4-phosphate isomerase DerI1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728942.1 protein_id gnl|my_center|LOCUS_11610 225098 223347 gene locus_tag LOCUS_11620 gene derK 225098 223347 CDS product D-erythrulose 4-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728941.1 protein_id gnl|my_center|LOCUS_11620 226247 225165 gene locus_tag LOCUS_11630 gene eltD 226247 225165 CDS product erythritol/L-threitol dehyrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728938.1 protein_id gnl|my_center|LOCUS_11630 227173 226541 gene locus_tag LOCUS_11640 227173 226541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 228417 227335 gene locus_tag LOCUS_11650 228417 227335 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284299.1 protein_id gnl|my_center|LOCUS_11650 228543 229304 gene locus_tag LOCUS_11660 228543 229304 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803996.1 protein_id gnl|my_center|LOCUS_11660 230379 229318 gene locus_tag LOCUS_11670 230379 229318 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 protein_id gnl|my_center|LOCUS_11670 230816 230391 gene locus_tag LOCUS_11680 230816 230391 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730357.1 protein_id gnl|my_center|LOCUS_11680 230974 232299 gene locus_tag LOCUS_11690 230974 232299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 232334 232630 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gatcgcgcttcgacaggctcagcgcacggctcgggg 233087 232650 gene locus_tag LOCUS_11700 233087 232650 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086970.1 protein_id gnl|my_center|LOCUS_11700 235617 233143 gene locus_tag LOCUS_11710 235617 233143 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_11710 235604 236368 gene locus_tag LOCUS_11720 235604 236368 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030841.1 protein_id gnl|my_center|LOCUS_11720 237542 236412 gene locus_tag LOCUS_11730 gene menC 237542 236412 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_11730 238357 237539 gene locus_tag LOCUS_11740 238357 237539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225316.1 protein_id gnl|my_center|LOCUS_11740 240369 238354 gene locus_tag LOCUS_11750 240369 238354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 241972 240404 gene locus_tag LOCUS_11760 241972 240404 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225314.1 protein_id gnl|my_center|LOCUS_11760 243000 242077 gene locus_tag LOCUS_11770 243000 242077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 243078 245210 gene locus_tag LOCUS_11780 243078 245210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 245654 245319 gene locus_tag LOCUS_11790 245654 245319 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226694.1 protein_id gnl|my_center|LOCUS_11790 246264 245788 gene locus_tag LOCUS_11800 246264 245788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 247141 246335 gene locus_tag LOCUS_11810 gene lieB 247141 246335 CDS product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 protein_id gnl|my_center|LOCUS_11810 247974 247138 gene locus_tag LOCUS_11820 247974 247138 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072134.1 protein_id gnl|my_center|LOCUS_11820 248351 247971 gene locus_tag LOCUS_11830 248351 247971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 248484 249917 gene locus_tag LOCUS_11840 248484 249917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776735.1 protein_id gnl|my_center|LOCUS_11840 251371 249953 gene locus_tag LOCUS_11850 gene dnaB 251371 249953 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975021.1 protein_id gnl|my_center|LOCUS_11850 256292 252081 gene locus_tag LOCUS_11860 256292 252081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 256726 256292 gene locus_tag LOCUS_11870 256726 256292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 257103 256723 gene locus_tag LOCUS_11880 257103 256723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228854.1 protein_id gnl|my_center|LOCUS_11880 257603 257175 gene locus_tag LOCUS_11890 257603 257175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 257871 257686 gene locus_tag LOCUS_11900 257871 257686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 258901 257993 gene locus_tag LOCUS_11910 258901 257993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 259779 258898 gene locus_tag LOCUS_11920 259779 258898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 261143 259776 gene locus_tag LOCUS_11930 261143 259776 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029708.1 protein_id gnl|my_center|LOCUS_11930 262276 261422 gene locus_tag LOCUS_11940 262276 261422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 262843 262280 gene locus_tag LOCUS_11950 262843 262280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 263952 263194 gene locus_tag LOCUS_11960 263952 263194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 264734 265309 gene locus_tag LOCUS_11970 264734 265309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 265519 266418 gene locus_tag LOCUS_11980 265519 266418 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930031.1 protein_id gnl|my_center|LOCUS_11980 266456 267298 gene locus_tag LOCUS_11990 266456 267298 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776621.1 protein_id gnl|my_center|LOCUS_11990 267725 267336 gene locus_tag LOCUS_12000 267725 267336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 267817 269169 gene locus_tag LOCUS_12010 267817 269169 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029300.1 protein_id gnl|my_center|LOCUS_12010 270712 269207 gene locus_tag LOCUS_12020 270712 269207 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_12020 270941 273004 gene locus_tag LOCUS_12030 270941 273004 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029298.1 protein_id gnl|my_center|LOCUS_12030 272997 277061 gene locus_tag LOCUS_12040 272997 277061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12040 277202 277819 gene locus_tag LOCUS_12050 277202 277819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12050 277987 278457 gene locus_tag LOCUS_12060 277987 278457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 278454 279284 gene locus_tag LOCUS_12070 278454 279284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 279744 279301 gene locus_tag LOCUS_12080 279744 279301 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261186.1 protein_id gnl|my_center|LOCUS_12080 279668 279880 gene locus_tag LOCUS_12090 279668 279880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 279922 280938 gene locus_tag LOCUS_12100 gene trxB 279922 280938 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145866307.1 protein_id gnl|my_center|LOCUS_12100 280989 281312 gene locus_tag LOCUS_12110 gene trxA 280989 281312 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_12110 282002 281391 gene locus_tag LOCUS_12120 282002 281391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 282354 283685 gene locus_tag LOCUS_12130 282354 283685 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_12130 283768 284754 gene locus_tag LOCUS_12140 283768 284754 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_12140 284751 285602 gene locus_tag LOCUS_12150 284751 285602 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872966.1 protein_id gnl|my_center|LOCUS_12150 285612 285947 gene locus_tag LOCUS_12160 285612 285947 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666291.1 protein_id gnl|my_center|LOCUS_12160 287420 286452 gene locus_tag LOCUS_12170 287420 286452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12170 288652 287420 gene locus_tag LOCUS_12180 288652 287420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 289599 288985 gene locus_tag LOCUS_12190 gene rsmG 289599 288985 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231065.1 protein_id gnl|my_center|LOCUS_12190 290280 289603 gene locus_tag LOCUS_12200 290280 289603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 291422 290382 gene locus_tag LOCUS_12210 291422 290382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 291828 291508 gene locus_tag LOCUS_12220 gene yidD 291828 291508 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106504.1 protein_id gnl|my_center|LOCUS_12220 292202 291825 gene locus_tag LOCUS_12230 gene rnpA 292202 291825 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029288.1 protein_id gnl|my_center|LOCUS_12230 292356 292219 gene locus_tag LOCUS_12240 292356 292219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 292878 294659 gene locus_tag LOCUS_12250 gene dnaA 292878 294659 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221955.1 protein_id gnl|my_center|LOCUS_12250 295368 296537 gene locus_tag LOCUS_12260 gene dnaN 295368 296537 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_12260 296646 297713 gene locus_tag LOCUS_12270 gene gnd 296646 297713 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_12270 297849 299534 gene locus_tag LOCUS_12280 297849 299534 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803976.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12280 300275 299640 gene locus_tag LOCUS_12290 300275 299640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 300637 300272 gene locus_tag LOCUS_12300 300637 300272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 304688 300627 gene locus_tag LOCUS_12310 304688 300627 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030426.1 protein_id gnl|my_center|LOCUS_12310 305683 304685 gene locus_tag LOCUS_12320 305683 304685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 307041 305680 gene locus_tag LOCUS_12330 307041 305680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 308041 307109 gene locus_tag LOCUS_12340 308041 307109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 309299 308028 gene locus_tag LOCUS_12350 309299 308028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 310209 309292 gene locus_tag LOCUS_12360 310209 309292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 310809 311156 gene locus_tag LOCUS_12370 310809 311156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 311200 311514 gene locus_tag LOCUS_12380 311200 311514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 311593 311940 gene locus_tag LOCUS_12390 311593 311940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 311982 314072 gene locus_tag LOCUS_12400 311982 314072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 314101 314751 gene locus_tag LOCUS_12410 314101 314751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 315640 314774 gene locus_tag LOCUS_12420 315640 314774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 315954 316433 gene locus_tag LOCUS_12430 315954 316433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 316564 317040 gene locus_tag LOCUS_12440 316564 317040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 317099 318247 gene locus_tag LOCUS_12450 gene recF 317099 318247 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_12450 318240 318866 gene locus_tag LOCUS_12460 318240 318866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 318929 320374 gene locus_tag LOCUS_12470 318929 320374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110852.1 protein_id gnl|my_center|LOCUS_12470 320371 321021 gene locus_tag LOCUS_12480 320371 321021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 321018 321581 gene locus_tag LOCUS_12490 321018 321581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 322284 321589 gene locus_tag LOCUS_12500 322284 321589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 322350 322613 gene locus_tag LOCUS_12510 322350 322613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 322676 324775 gene locus_tag LOCUS_12520 gene gyrB 322676 324775 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029285.1 protein_id gnl|my_center|LOCUS_12520 324820 327450 gene locus_tag LOCUS_12530 gene gyrA 324820 327450 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_12530 327443 328420 gene locus_tag LOCUS_12540 327443 328420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 328497 328572 gene locus_tag LOCUS_t00150 328497 328572 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 329824 328664 gene locus_tag LOCUS_12550 329824 328664 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_12550 330018 329827 gene locus_tag LOCUS_12560 330018 329827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 331747 330209 gene locus_tag LOCUS_12570 331747 330209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227708.1 protein_id gnl|my_center|LOCUS_12570 332805 331747 gene locus_tag LOCUS_12580 332805 331747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 333635 333231 gene locus_tag LOCUS_12590 333635 333231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043777067.1 protein_id gnl|my_center|LOCUS_12590 333940 334692 gene locus_tag LOCUS_12600 333940 334692 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030186.1 protein_id gnl|my_center|LOCUS_12600 335180 334689 gene locus_tag LOCUS_12610 gene ispF 335180 334689 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929316.1 protein_id gnl|my_center|LOCUS_12610 335767 335180 gene locus_tag LOCUS_12620 335767 335180 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110615.1 protein_id gnl|my_center|LOCUS_12620 337038 338081 gene locus_tag LOCUS_12630 337038 338081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 338471 339823 gene locus_tag LOCUS_12640 338471 339823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 340568 340164 gene locus_tag LOCUS_12650 340568 340164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 342097 340565 gene locus_tag LOCUS_12660 342097 340565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 342670 342101 gene locus_tag LOCUS_12670 342670 342101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 344777 342657 gene locus_tag LOCUS_12680 344777 342657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 347560 344774 gene locus_tag LOCUS_12690 347560 344774 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223090.1 protein_id gnl|my_center|LOCUS_12690 348009 347557 gene locus_tag LOCUS_12700 348009 347557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 348241 348014 gene locus_tag LOCUS_12710 348241 348014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 349274 348825 gene locus_tag LOCUS_12720 349274 348825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 350748 349753 gene locus_tag LOCUS_12730 350748 349753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 350979 351986 gene locus_tag LOCUS_12740 350979 351986 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804968.1 protein_id gnl|my_center|LOCUS_12740 351983 352939 gene locus_tag LOCUS_12750 351983 352939 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804969.1 protein_id gnl|my_center|LOCUS_12750 353003 354673 gene locus_tag LOCUS_12760 353003 354673 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179748936.1 protein_id gnl|my_center|LOCUS_12760 354670 356520 gene locus_tag LOCUS_12770 354670 356520 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225053.1 protein_id gnl|my_center|LOCUS_12770 358435 356744 gene locus_tag LOCUS_12780 358435 356744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 359414 358419 gene locus_tag LOCUS_12790 359414 358419 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972764.1 protein_id gnl|my_center|LOCUS_12790 361265 359502 gene locus_tag LOCUS_12800 361265 359502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 362386 361262 gene locus_tag LOCUS_12810 362386 361262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 362509 362390 gene locus_tag LOCUS_12820 362509 362390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 364785 362509 gene locus_tag LOCUS_12830 364785 362509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 365022 366293 gene locus_tag LOCUS_12840 gene larA 365022 366293 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224947.1 protein_id gnl|my_center|LOCUS_12840 368737 366329 gene locus_tag LOCUS_12850 368737 366329 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259698.1 protein_id gnl|my_center|LOCUS_12850 370932 368755 gene locus_tag LOCUS_12860 370932 368755 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259699.1 protein_id gnl|my_center|LOCUS_12860 371227 372930 gene locus_tag LOCUS_12870 371227 372930 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383105.1 protein_id gnl|my_center|LOCUS_12870 372959 373948 gene locus_tag LOCUS_12880 372959 373948 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803789.1 protein_id gnl|my_center|LOCUS_12880 374010 374936 gene locus_tag LOCUS_12890 374010 374936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12890 374940 376862 gene locus_tag LOCUS_12900 374940 376862 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406602.1 protein_id gnl|my_center|LOCUS_12900 377291 378274 gene locus_tag LOCUS_12910 377291 378274 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974629.1 protein_id gnl|my_center|LOCUS_12910 378268 379137 gene locus_tag LOCUS_12920 378268 379137 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971490.1 protein_id gnl|my_center|LOCUS_12920 379257 379856 gene locus_tag LOCUS_12930 379257 379856 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079604.1 protein_id gnl|my_center|LOCUS_12930 380687 379938 gene locus_tag LOCUS_12940 380687 379938 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971784.1 protein_id gnl|my_center|LOCUS_12940 381759 380860 gene locus_tag LOCUS_12950 381759 380860 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971873.1 protein_id gnl|my_center|LOCUS_12950 383291 381822 gene locus_tag LOCUS_12960 383291 381822 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225439.1 protein_id gnl|my_center|LOCUS_12960 383972 383301 gene locus_tag LOCUS_12970 383972 383301 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225438.1 protein_id gnl|my_center|LOCUS_12970 384143 384784 gene locus_tag LOCUS_12980 384143 384784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 384860 385273 gene locus_tag LOCUS_12990 384860 385273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 386215 385967 gene locus_tag LOCUS_13000 386215 385967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 388989 386311 gene locus_tag LOCUS_13010 388989 386311 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 protein_id gnl|my_center|LOCUS_13010 389587 389018 gene locus_tag LOCUS_13020 389587 389018 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089516.1 protein_id gnl|my_center|LOCUS_13020 391808 389625 gene locus_tag LOCUS_13030 gene kdpB 391808 389625 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223786.1 protein_id gnl|my_center|LOCUS_13030 393466 391805 gene locus_tag LOCUS_13040 gene kdpA 393466 391805 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223785.1 protein_id gnl|my_center|LOCUS_13040 394518 393664 gene locus_tag LOCUS_13050 394518 393664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030873.1 protein_id gnl|my_center|LOCUS_13050 394634 396922 gene locus_tag LOCUS_13060 394634 396922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 397378 396935 gene locus_tag LOCUS_13070 397378 396935 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528863.1 protein_id gnl|my_center|LOCUS_13070 398656 397541 gene locus_tag LOCUS_13080 398656 397541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 399146 398838 gene locus_tag LOCUS_13090 399146 398838 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776001.1 protein_id gnl|my_center|LOCUS_13090 400269 399208 gene locus_tag LOCUS_13100 400269 399208 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_13100 401218 400334 gene locus_tag LOCUS_13110 401218 400334 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777129.1 protein_id gnl|my_center|LOCUS_13110 402423 401215 gene locus_tag LOCUS_13120 402423 401215 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930079.1 protein_id gnl|my_center|LOCUS_13120 402824 402492 gene locus_tag LOCUS_13130 402824 402492 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727722.1 protein_id gnl|my_center|LOCUS_13130 403699 402884 gene locus_tag LOCUS_13140 403699 402884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 403892 404938 gene locus_tag LOCUS_13150 403892 404938 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026966.1 protein_id gnl|my_center|LOCUS_13150 404938 405717 gene locus_tag LOCUS_13160 404938 405717 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026967.1 protein_id gnl|my_center|LOCUS_13160 405714 406745 gene locus_tag LOCUS_13170 405714 406745 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728056.1 protein_id gnl|my_center|LOCUS_13170 408228 406837 gene locus_tag LOCUS_13180 408228 406837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446567.1 protein_id gnl|my_center|LOCUS_13180 410788 408290 gene locus_tag LOCUS_13190 410788 408290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 411537 410785 gene locus_tag LOCUS_13200 411537 410785 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028774.1 protein_id gnl|my_center|LOCUS_13200 412442 411783 gene locus_tag LOCUS_13210 412442 411783 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975444.1 protein_id gnl|my_center|LOCUS_13210 413710 412439 gene locus_tag LOCUS_13220 413710 412439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 413842 413988 gene locus_tag LOCUS_13230 413842 413988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 415609 414083 gene locus_tag LOCUS_13240 415609 414083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 415854 417134 gene locus_tag LOCUS_13250 415854 417134 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767567.1 protein_id gnl|my_center|LOCUS_13250 417651 417298 gene locus_tag LOCUS_13260 417651 417298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 417716 418171 gene locus_tag LOCUS_13270 417716 418171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 419378 418131 gene locus_tag LOCUS_13280 419378 418131 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028932.1 protein_id gnl|my_center|LOCUS_13280 420096 419398 gene locus_tag LOCUS_13290 gene cseB 420096 419398 CDS product two-component system response regulator CseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975477.1 protein_id gnl|my_center|LOCUS_13290 421563 420196 gene locus_tag LOCUS_13300 421563 420196 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876247.1 protein_id gnl|my_center|LOCUS_13300 422274 421837 gene locus_tag LOCUS_13310 422274 421837 CDS product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073432.1 protein_id gnl|my_center|LOCUS_13310 422401 423747 gene locus_tag LOCUS_13320 422401 423747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141950.1 protein_id gnl|my_center|LOCUS_13320 424417 423764 gene locus_tag LOCUS_13330 424417 423764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 425262 424669 gene locus_tag LOCUS_13340 425262 424669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 425875 425381 gene locus_tag LOCUS_13350 425875 425381 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223356.1 protein_id gnl|my_center|LOCUS_13350 425956 426825 gene locus_tag LOCUS_13360 425956 426825 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014872.1 protein_id gnl|my_center|LOCUS_13360 427759 426911 gene locus_tag LOCUS_13370 gene ygiD 427759 426911 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104467.1 protein_id gnl|my_center|LOCUS_13370 427885 429126 gene locus_tag LOCUS_13380 427885 429126 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966602.1 protein_id gnl|my_center|LOCUS_13380 429136 429288 gene locus_tag LOCUS_13390 429136 429288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 429972 429679 gene locus_tag LOCUS_13400 429972 429679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 430083 430009 gene locus_tag LOCUS_t00160 430083 430009 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 430271 430690 gene locus_tag LOCUS_13410 430271 430690 CDS product DUF5318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230992.1 protein_id gnl|my_center|LOCUS_13410 430683 432989 gene locus_tag LOCUS_13420 430683 432989 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390331.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13420 432989 434464 gene locus_tag LOCUS_13430 432989 434464 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_13430 434454 435704 gene locus_tag LOCUS_13440 434454 435704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 435701 436300 gene locus_tag LOCUS_13450 435701 436300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 437283 436321 gene locus_tag LOCUS_13460 gene pip 437283 436321 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226797.1 protein_id gnl|my_center|LOCUS_13460 437320 438117 gene locus_tag LOCUS_13470 437320 438117 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203150.1 protein_id gnl|my_center|LOCUS_13470 438729 438145 gene locus_tag LOCUS_13480 438729 438145 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328266.1 protein_id gnl|my_center|LOCUS_13480 438793 439377 gene locus_tag LOCUS_13490 438793 439377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 440458 439388 gene locus_tag LOCUS_13500 440458 439388 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975028.1 protein_id gnl|my_center|LOCUS_13500 441614 440502 gene locus_tag LOCUS_13510 441614 440502 CDS product peptidoglycan bridge formation peptidyltransferase VanK-Sc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029108.1 protein_id gnl|my_center|LOCUS_13510 442398 441625 gene locus_tag LOCUS_13520 442398 441625 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030303.1 protein_id gnl|my_center|LOCUS_13520 443201 442395 gene locus_tag LOCUS_13530 443201 442395 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974266.1 protein_id gnl|my_center|LOCUS_13530 443619 443236 gene locus_tag LOCUS_13540 443619 443236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 444164 443616 gene locus_tag LOCUS_13550 444164 443616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 445321 444362 gene locus_tag LOCUS_13560 445321 444362 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230608.1 protein_id gnl|my_center|LOCUS_13560 445449 445622 gene locus_tag LOCUS_13570 445449 445622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 445760 446488 gene locus_tag LOCUS_13580 445760 446488 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031666.1 protein_id gnl|my_center|LOCUS_13580 447138 446557 gene locus_tag LOCUS_13590 447138 446557 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878054.1 protein_id gnl|my_center|LOCUS_13590 447259 448488 gene locus_tag LOCUS_13600 447259 448488 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084375.1 protein_id gnl|my_center|LOCUS_13600 449804 448566 gene locus_tag LOCUS_13610 449804 448566 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222244.1 protein_id gnl|my_center|LOCUS_13610 451569 449842 gene locus_tag LOCUS_13620 451569 449842 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776685.1 protein_id gnl|my_center|LOCUS_13620 452420 451566 gene locus_tag LOCUS_13630 452420 451566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 453349 452534 gene locus_tag LOCUS_13640 453349 452534 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776687.1 protein_id gnl|my_center|LOCUS_13640 454555 453392 gene locus_tag LOCUS_13650 454555 453392 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727188.1 protein_id gnl|my_center|LOCUS_13650 456698 454557 gene locus_tag LOCUS_13660 gene pta 456698 454557 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446556.1 protein_id gnl|my_center|LOCUS_13660 456954 458657 gene locus_tag LOCUS_13670 456954 458657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 460109 458913 gene locus_tag LOCUS_13680 460109 458913 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049749196.1 protein_id gnl|my_center|LOCUS_13680 460999 460211 gene locus_tag LOCUS_13690 460999 460211 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403419.1 protein_id gnl|my_center|LOCUS_13690 461227 462354 gene locus_tag LOCUS_13700 461227 462354 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731336.1 protein_id gnl|my_center|LOCUS_13700 462374 463231 gene locus_tag LOCUS_13710 462374 463231 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897937.1 protein_id gnl|my_center|LOCUS_13710 463251 464108 gene locus_tag LOCUS_13720 463251 464108 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897936.1 protein_id gnl|my_center|LOCUS_13720 464146 465195 gene locus_tag LOCUS_13730 464146 465195 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897935.1 protein_id gnl|my_center|LOCUS_13730 465240 465821 gene locus_tag LOCUS_13740 465240 465821 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328266.1 protein_id gnl|my_center|LOCUS_13740 465975 465841 gene locus_tag LOCUS_13750 465975 465841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 467048 465975 gene locus_tag LOCUS_13760 467048 465975 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224099.1 protein_id gnl|my_center|LOCUS_13760 467422 467147 gene locus_tag LOCUS_13770 467422 467147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 467834 467559 gene locus_tag LOCUS_13780 467834 467559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 468121 469110 gene locus_tag LOCUS_13790 468121 469110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 469172 470326 gene locus_tag LOCUS_13800 469172 470326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 470352 471293 gene locus_tag LOCUS_13810 470352 471293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 471746 471306 gene locus_tag LOCUS_13820 471746 471306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 471993 472283 gene locus_tag LOCUS_13830 gene rpsF 471993 472283 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 protein_id gnl|my_center|LOCUS_13830 472442 473029 gene locus_tag LOCUS_13840 472442 473029 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400534.1 protein_id gnl|my_center|LOCUS_13840 473108 473344 gene locus_tag LOCUS_13850 gene rpsR 473108 473344 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105399.1 protein_id gnl|my_center|LOCUS_13850 473368 473814 gene locus_tag LOCUS_13860 gene rplI 473368 473814 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_13860 474047 475705 gene locus_tag LOCUS_13870 474047 475705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 477008 475731 gene locus_tag LOCUS_13880 477008 475731 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_13880 477923 477195 gene locus_tag LOCUS_13890 477923 477195 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640897.1 protein_id gnl|my_center|LOCUS_13890 478326 478051 gene locus_tag LOCUS_13900 gene crgA 478326 478051 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975080.1 protein_id gnl|my_center|LOCUS_13900 478492 479325 gene locus_tag LOCUS_13910 478492 479325 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485254.1 protein_id gnl|my_center|LOCUS_13910 479374 480021 gene locus_tag LOCUS_13920 479374 480021 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029271.1 protein_id gnl|my_center|LOCUS_13920 480056 480421 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcccttcgacaggctcaggg 481081 480452 gene locus_tag LOCUS_13930 481081 480452 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225286.1 protein_id gnl|my_center|LOCUS_13930 482929 481142 gene locus_tag LOCUS_13940 gene pknB 482929 481142 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029269.1 protein_id gnl|my_center|LOCUS_13940 484484 483048 gene locus_tag LOCUS_13950 484484 483048 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029268.1 protein_id gnl|my_center|LOCUS_13950 485899 484481 gene locus_tag LOCUS_13960 485899 484481 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222006.1 protein_id gnl|my_center|LOCUS_13960 487521 485896 gene locus_tag LOCUS_13970 487521 485896 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029266.1 protein_id gnl|my_center|LOCUS_13970 488006 487521 gene locus_tag LOCUS_13980 gene fhaB 488006 487521 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_13980 488859 488026 gene locus_tag LOCUS_13990 gene fhaA 488859 488026 CDS product antibiotic biosynthesis regulator FhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975091.1 protein_id gnl|my_center|LOCUS_13990 489068 489152 gene locus_tag LOCUS_t00170 489068 489152 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 489216 491048 gene locus_tag LOCUS_14000 489216 491048 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_14000 492150 491431 gene locus_tag LOCUS_14010 492150 491431 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776490.1 protein_id gnl|my_center|LOCUS_14010 492929 492147 gene locus_tag LOCUS_14020 492929 492147 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776489.1 protein_id gnl|my_center|LOCUS_14020 492997 495381 gene locus_tag LOCUS_14030 492997 495381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 495468 496082 gene locus_tag LOCUS_14040 495468 496082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 496082 497068 gene locus_tag LOCUS_14050 496082 497068 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259109.1 protein_id gnl|my_center|LOCUS_14050 497533 497090 gene locus_tag LOCUS_14060 497533 497090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 498128 497526 gene locus_tag LOCUS_14070 498128 497526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230855.1 protein_id gnl|my_center|LOCUS_14070 498754 498119 gene locus_tag LOCUS_14080 498754 498119 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230856.1 protein_id gnl|my_center|LOCUS_14080 499014 499460 gene locus_tag LOCUS_14090 499014 499460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 500170 499664 gene locus_tag LOCUS_14100 500170 499664 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031562.1 protein_id gnl|my_center|LOCUS_14100 500279 500983 gene locus_tag LOCUS_14110 500279 500983 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813870.1 protein_id gnl|my_center|LOCUS_14110 500980 501594 gene locus_tag LOCUS_14120 500980 501594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14120 501648 502247 gene locus_tag LOCUS_14130 501648 502247 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968895.1 protein_id gnl|my_center|LOCUS_14130 502639 502343 gene locus_tag LOCUS_14140 502639 502343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 504669 502792 gene locus_tag LOCUS_14150 gene asnB 504669 502792 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223784.1 protein_id gnl|my_center|LOCUS_14150 504762 505370 gene locus_tag LOCUS_14160 504762 505370 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729576.1 protein_id gnl|my_center|LOCUS_14160 505667 505413 gene locus_tag LOCUS_14170 505667 505413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 507027 505789 gene locus_tag LOCUS_14180 507027 505789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 507187 507963 gene locus_tag LOCUS_14190 507187 507963 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729258.1 protein_id gnl|my_center|LOCUS_14190 507973 509025 gene locus_tag LOCUS_14200 507973 509025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 509119 509385 gene locus_tag LOCUS_14210 509119 509385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 510814 509393 gene locus_tag LOCUS_14220 gene efeB 510814 509393 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073925.1 protein_id gnl|my_center|LOCUS_14220 511998 510811 gene locus_tag LOCUS_14230 511998 510811 CDS product peptidase M75 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229934.1 protein_id gnl|my_center|LOCUS_14230 512948 511995 gene locus_tag LOCUS_14240 512948 511995 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_14240 513136 514005 gene locus_tag LOCUS_14250 513136 514005 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228742.1 protein_id gnl|my_center|LOCUS_14250 514137 514628 gene locus_tag LOCUS_14260 514137 514628 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226534.1 protein_id gnl|my_center|LOCUS_14260 515365 514667 gene locus_tag LOCUS_14270 515365 514667 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483174.1 protein_id gnl|my_center|LOCUS_14270 515504 516181 gene locus_tag LOCUS_14280 gene aat 515504 516181 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390189.1 protein_id gnl|my_center|LOCUS_14280 516260 517123 gene locus_tag LOCUS_14290 516260 517123 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_14290 517161 517475 gene locus_tag LOCUS_14300 517161 517475 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975095.1 protein_id gnl|my_center|LOCUS_14300 518054 517512 gene locus_tag LOCUS_14310 518054 517512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 518773 518159 gene locus_tag LOCUS_14320 gene lysE 518773 518159 CDS product L-lysine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726966.1 protein_id gnl|my_center|LOCUS_14320 518855 519751 gene locus_tag LOCUS_14330 518855 519751 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971834.1 protein_id gnl|my_center|LOCUS_14330 520680 519877 gene locus_tag LOCUS_14340 520680 519877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 522538 520880 gene locus_tag LOCUS_14350 522538 520880 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223405.1 protein_id gnl|my_center|LOCUS_14350 522702 523523 gene locus_tag LOCUS_14360 522702 523523 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974967.1 protein_id gnl|my_center|LOCUS_14360 525094 523553 gene locus_tag LOCUS_14370 525094 523553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 525593 525102 gene locus_tag LOCUS_14380 525593 525102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 527050 525839 gene locus_tag LOCUS_14390 gene arcA 527050 525839 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082883.1 protein_id gnl|my_center|LOCUS_14390 527080 528327 gene locus_tag LOCUS_14400 gene ilvA 527080 528327 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223532.1 protein_id gnl|my_center|LOCUS_14400 528417 529208 gene locus_tag LOCUS_14410 528417 529208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 529740 529198 gene locus_tag LOCUS_14420 529740 529198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 530106 529750 gene locus_tag LOCUS_14430 530106 529750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 530547 530329 gene locus_tag LOCUS_14440 530547 530329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 533030 530865 gene locus_tag LOCUS_14450 533030 530865 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440634.1 protein_id gnl|my_center|LOCUS_14450 533788 533027 gene locus_tag LOCUS_14460 533788 533027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 534414 533785 gene locus_tag LOCUS_14470 534414 533785 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085145692.1 protein_id gnl|my_center|LOCUS_14470 534556 535740 gene locus_tag LOCUS_14480 534556 535740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 535814 536755 gene locus_tag LOCUS_14490 gene pheA 535814 536755 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_14490 538122 537010 gene locus_tag LOCUS_14500 538122 537010 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775809.1 protein_id gnl|my_center|LOCUS_14500 538940 538119 gene locus_tag LOCUS_14510 538940 538119 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775810.1 protein_id gnl|my_center|LOCUS_14510 540731 538998 gene locus_tag LOCUS_14520 540731 538998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 540875 542182 gene locus_tag LOCUS_14530 540875 542182 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930304.1 protein_id gnl|my_center|LOCUS_14530 542215 543489 gene locus_tag LOCUS_14540 gene serS 542215 543489 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974982.1 protein_id gnl|my_center|LOCUS_14540 543602 544396 gene locus_tag LOCUS_14550 543602 544396 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804321.1 protein_id gnl|my_center|LOCUS_14550 545074 544448 gene locus_tag LOCUS_14560 545074 544448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 545975 545379 gene locus_tag LOCUS_14570 545975 545379 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_14570 546099 548186 gene locus_tag LOCUS_14580 546099 548186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230756.1 protein_id gnl|my_center|LOCUS_14580 548179 550143 gene locus_tag LOCUS_14590 548179 550143 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027610.1 protein_id gnl|my_center|LOCUS_14590 550166 550705 gene locus_tag LOCUS_14600 550166 550705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 550713 551204 gene locus_tag LOCUS_14610 550713 551204 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027329.1 protein_id gnl|my_center|LOCUS_14610 551454 552425 gene locus_tag LOCUS_14620 551454 552425 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222193.1 protein_id gnl|my_center|LOCUS_14620 552439 552523 gene locus_tag LOCUS_t00180 552439 552523 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 552570 553019 gene locus_tag LOCUS_14630 552570 553019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 554709 553033 gene locus_tag LOCUS_14640 554709 553033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14640 554956 555049 gene locus_tag LOCUS_t00190 554956 555049 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 556266 555097 gene locus_tag LOCUS_14650 556266 555097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 557403 556441 gene locus_tag LOCUS_14660 557403 556441 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113228.1 protein_id gnl|my_center|LOCUS_14660 557537 558052 gene locus_tag LOCUS_14670 557537 558052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 558145 558219 gene locus_tag LOCUS_t00200 558145 558219 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 558603 558340 gene locus_tag LOCUS_14680 558603 558340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 558756 559895 gene locus_tag LOCUS_14690 558756 559895 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027039.1 protein_id gnl|my_center|LOCUS_14690 560906 560178 gene locus_tag LOCUS_14700 560906 560178 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977652.1 protein_id gnl|my_center|LOCUS_14700 561490 560984 gene locus_tag LOCUS_14710 561490 560984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 562540 561644 gene locus_tag LOCUS_14720 562540 561644 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222841.1 protein_id gnl|my_center|LOCUS_14720 562624 563190 gene locus_tag LOCUS_14730 562624 563190 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222840.1 protein_id gnl|my_center|LOCUS_14730 563742 563320 gene locus_tag LOCUS_14740 563742 563320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 563923 564210 gene locus_tag LOCUS_14750 563923 564210 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084855.1 protein_id gnl|my_center|LOCUS_14750 565358 564216 gene locus_tag LOCUS_14760 565358 564216 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704846.1 protein_id gnl|my_center|LOCUS_14760 566226 565462 gene locus_tag LOCUS_14770 566226 565462 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896974.1 protein_id gnl|my_center|LOCUS_14770 566565 566293 gene locus_tag LOCUS_14780 566565 566293 CDS product DUF4235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776729.1 protein_id gnl|my_center|LOCUS_14780 566663 567382 gene locus_tag LOCUS_14790 566663 567382 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031654.1 protein_id gnl|my_center|LOCUS_14790 568508 567402 gene locus_tag LOCUS_14800 568508 567402 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228346.1 protein_id gnl|my_center|LOCUS_14800 568731 569900 gene locus_tag LOCUS_14810 568731 569900 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225393.1 protein_id gnl|my_center|LOCUS_14810 569925 570692 gene locus_tag LOCUS_14820 569925 570692 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_14820 570893 571288 gene locus_tag LOCUS_14830 570893 571288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 571281 571679 gene locus_tag LOCUS_14840 571281 571679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 571722 573944 gene locus_tag LOCUS_14850 571722 573944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 575092 573971 gene locus_tag LOCUS_14860 gene ald 575092 573971 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894041.1 protein_id gnl|my_center|LOCUS_14860 577127 575262 gene locus_tag LOCUS_14870 577127 575262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14870 577409 579448 gene locus_tag LOCUS_14880 577409 579448 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729900.1 protein_id gnl|my_center|LOCUS_14880 579722 581251 gene locus_tag LOCUS_14890 579722 581251 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486261.1 protein_id gnl|my_center|LOCUS_14890 582241 581390 gene locus_tag LOCUS_14900 582241 581390 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230275.1 protein_id gnl|my_center|LOCUS_14900 582367 583257 gene locus_tag LOCUS_14910 582367 583257 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111761.1 protein_id gnl|my_center|LOCUS_14910 583704 583258 gene locus_tag LOCUS_14920 583704 583258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 583937 586474 gene locus_tag LOCUS_14930 583937 586474 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 protein_id gnl|my_center|LOCUS_14930 586507 587577 gene locus_tag LOCUS_14940 586507 587577 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402911.1 protein_id gnl|my_center|LOCUS_14940 587719 589185 gene locus_tag LOCUS_14950 587719 589185 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411955.1 protein_id gnl|my_center|LOCUS_14950 589188 590072 gene locus_tag LOCUS_14960 589188 590072 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727652.1 protein_id gnl|my_center|LOCUS_14960 590863 590084 gene locus_tag LOCUS_14970 gene ddaH 590863 590084 CDS product N(G),N(G)-dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972278.1 protein_id gnl|my_center|LOCUS_14970 591707 590907 gene locus_tag LOCUS_14980 591707 590907 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093305.1 protein_id gnl|my_center|LOCUS_14980 592417 591713 gene locus_tag LOCUS_14990 gene upp 592417 591713 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_14990 592538 593173 gene locus_tag LOCUS_15000 592538 593173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 593166 593654 gene locus_tag LOCUS_15010 gene tadA 593166 593654 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803986.1 protein_id gnl|my_center|LOCUS_15010 593709 593796 gene locus_tag LOCUS_t00210 593709 593796 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 594101 593871 gene locus_tag LOCUS_15020 594101 593871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 594380 594739 gene locus_tag LOCUS_15030 594380 594739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 594736 595476 gene locus_tag LOCUS_15040 594736 595476 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974780.1 protein_id gnl|my_center|LOCUS_15040 596610 595618 gene locus_tag LOCUS_15050 596610 595618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 597943 598377 gene locus_tag LOCUS_15060 597943 598377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 599077 598775 gene locus_tag LOCUS_15070 599077 598775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 599179 600192 gene locus_tag LOCUS_15080 599179 600192 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162273421.1 protein_id gnl|my_center|LOCUS_15080 600763 600182 gene locus_tag LOCUS_15090 600763 600182 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888704.1 protein_id gnl|my_center|LOCUS_15090 600905 602467 gene locus_tag LOCUS_15100 600905 602467 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029115.1 protein_id gnl|my_center|LOCUS_15100 602994 602464 gene locus_tag LOCUS_15110 602994 602464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 603284 602991 gene locus_tag LOCUS_15120 603284 602991 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003999914.1 protein_id gnl|my_center|LOCUS_15120 603447 605012 gene locus_tag LOCUS_15130 603447 605012 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730039.1 protein_id gnl|my_center|LOCUS_15130 605067 605378 gene locus_tag LOCUS_15140 605067 605378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 606026 605583 gene locus_tag LOCUS_15150 606026 605583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 606903 606064 gene locus_tag LOCUS_15160 606903 606064 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950166.1 protein_id gnl|my_center|LOCUS_15160 607882 606968 gene locus_tag LOCUS_15170 607882 606968 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223242.1 protein_id gnl|my_center|LOCUS_15170 608409 610532 gene locus_tag LOCUS_15180 608409 610532 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612392.1 protein_id gnl|my_center|LOCUS_15180 610637 611008 gene locus_tag LOCUS_15190 610637 611008 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226457.1 protein_id gnl|my_center|LOCUS_15190 611834 611031 gene locus_tag LOCUS_15200 611834 611031 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065489.1 protein_id gnl|my_center|LOCUS_15200 612387 611905 gene locus_tag LOCUS_15210 612387 611905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 613534 612428 gene locus_tag LOCUS_15220 613534 612428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 615516 613522 gene locus_tag LOCUS_15230 615516 613522 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225268.1 protein_id gnl|my_center|LOCUS_15230 616352 615822 gene locus_tag LOCUS_15240 616352 615822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 616497 616410 gene locus_tag LOCUS_t00220 616497 616410 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 617312 616710 gene locus_tag LOCUS_15250 617312 616710 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886938.1 protein_id gnl|my_center|LOCUS_15250 617413 619956 gene locus_tag LOCUS_15260 617413 619956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15260 620082 620492 gene locus_tag LOCUS_15270 620082 620492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 620527 621126 gene locus_tag LOCUS_15280 gene recR 620527 621126 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_15280 621693 621157 gene locus_tag LOCUS_15290 621693 621157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 622691 621690 gene locus_tag LOCUS_15300 622691 621690 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110811.1 protein_id gnl|my_center|LOCUS_15300 623220 622735 gene locus_tag LOCUS_15310 623220 622735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 623369 624646 gene locus_tag LOCUS_15320 623369 624646 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897679.1 protein_id gnl|my_center|LOCUS_15320 624648 624998 gene locus_tag LOCUS_15330 624648 624998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 625620 624988 gene locus_tag LOCUS_15340 625620 624988 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031118.1 protein_id gnl|my_center|LOCUS_15340 626435 625617 gene locus_tag LOCUS_15350 626435 625617 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412786.1 protein_id gnl|my_center|LOCUS_15350 627714 626887 gene locus_tag LOCUS_15360 627714 626887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 627849 629048 gene locus_tag LOCUS_15370 627849 629048 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028750.1 protein_id gnl|my_center|LOCUS_15370 629045 630406 gene locus_tag LOCUS_15380 629045 630406 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223170.1 protein_id gnl|my_center|LOCUS_15380 630403 631560 gene locus_tag LOCUS_15390 gene hutI 630403 631560 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892542.1 protein_id gnl|my_center|LOCUS_15390 631588 632310 gene locus_tag LOCUS_15400 631588 632310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531677.1 protein_id gnl|my_center|LOCUS_15400 632307 633227 gene locus_tag LOCUS_15410 632307 633227 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222982.1 protein_id gnl|my_center|LOCUS_15410 633635 633240 gene locus_tag LOCUS_15420 633635 633240 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804499.1 protein_id gnl|my_center|LOCUS_15420 634032 633679 gene locus_tag LOCUS_15430 634032 633679 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976333.1 protein_id gnl|my_center|LOCUS_15430 634611 634081 gene locus_tag LOCUS_15440 634611 634081 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968015.1 protein_id gnl|my_center|LOCUS_15440 635500 634625 gene locus_tag LOCUS_15450 635500 634625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 635568 636044 gene locus_tag LOCUS_15460 635568 636044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 637138 636176 gene locus_tag LOCUS_15470 637138 636176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 637518 637135 gene locus_tag LOCUS_15480 637518 637135 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229165.1 protein_id gnl|my_center|LOCUS_15480 638416 637550 gene locus_tag LOCUS_15490 638416 637550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 639164 638448 gene locus_tag LOCUS_15500 639164 638448 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054642.1 protein_id gnl|my_center|LOCUS_15500 639281 640489 gene locus_tag LOCUS_15510 639281 640489 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876933.1 protein_id gnl|my_center|LOCUS_15510 640546 640971 gene locus_tag LOCUS_15520 640546 640971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 641632 640976 gene locus_tag LOCUS_15530 641632 640976 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230054.1 protein_id gnl|my_center|LOCUS_15530 642342 641629 gene locus_tag LOCUS_15540 642342 641629 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230053.1 protein_id gnl|my_center|LOCUS_15540 643082 642339 gene locus_tag LOCUS_15550 643082 642339 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727342.1 protein_id gnl|my_center|LOCUS_15550 643185 644786 gene locus_tag LOCUS_15560 643185 644786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230051.1 protein_id gnl|my_center|LOCUS_15560 644783 645592 gene locus_tag LOCUS_15570 644783 645592 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230050.1 protein_id gnl|my_center|LOCUS_15570 645589 646599 gene locus_tag LOCUS_15580 645589 646599 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230049.1 protein_id gnl|my_center|LOCUS_15580 647750 646668 gene locus_tag LOCUS_15590 647750 646668 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284184.1 protein_id gnl|my_center|LOCUS_15590 648633 647782 gene locus_tag LOCUS_15600 648633 647782 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_15600 648553 648921 gene locus_tag LOCUS_15610 648553 648921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 649315 649115 gene locus_tag LOCUS_15620 649315 649115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15620 650040 649228 gene locus_tag LOCUS_15630 650040 649228 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027325.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15630 651226 650141 gene locus_tag LOCUS_15640 651226 650141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 652517 651930 gene locus_tag LOCUS_15650 652517 651930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 652887 652546 gene locus_tag LOCUS_15660 652887 652546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 653939 653178 gene locus_tag LOCUS_15670 653939 653178 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258710.1 protein_id gnl|my_center|LOCUS_15670 655038 654013 gene locus_tag LOCUS_15680 655038 654013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 654919 655263 gene locus_tag LOCUS_15690 654919 655263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 655391 656086 gene locus_tag LOCUS_15700 655391 656086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 656639 656564 gene locus_tag LOCUS_t00230 656639 656564 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 657653 656736 gene locus_tag LOCUS_15710 657653 656736 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975354.1 protein_id gnl|my_center|LOCUS_15710 657742 658215 gene locus_tag LOCUS_15720 657742 658215 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_15720 660753 658312 gene locus_tag LOCUS_15730 660753 658312 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_15730 660971 661252 gene locus_tag LOCUS_15740 660971 661252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 662341 661214 gene locus_tag LOCUS_15750 662341 661214 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_15750 663330 662338 gene locus_tag LOCUS_15760 663330 662338 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029095.1 protein_id gnl|my_center|LOCUS_15760 664003 663320 gene locus_tag LOCUS_15770 gene npdG 664003 663320 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_15770 664068 664478 gene locus_tag LOCUS_15780 664068 664478 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028740.1 protein_id gnl|my_center|LOCUS_15780 664560 664733 gene locus_tag LOCUS_15790 664560 664733 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776605.1 protein_id gnl|my_center|LOCUS_15790 664741 665226 gene locus_tag LOCUS_15800 664741 665226 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092109.1 protein_id gnl|my_center|LOCUS_15800 665244 665960 gene locus_tag LOCUS_15810 665244 665960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_15810 665957 666787 gene locus_tag LOCUS_15820 665957 666787 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_15820 666868 668427 gene locus_tag LOCUS_15830 666868 668427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 669171 668494 gene locus_tag LOCUS_15840 669171 668494 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_15840 669365 670156 gene locus_tag LOCUS_15850 669365 670156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 670153 670782 gene locus_tag LOCUS_15860 670153 670782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 670779 671561 gene locus_tag LOCUS_15870 670779 671561 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_15870 671579 672244 gene locus_tag LOCUS_15880 671579 672244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974662.1 protein_id gnl|my_center|LOCUS_15880 672247 673995 gene locus_tag LOCUS_15890 gene malL 672247 673995 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415176.1 protein_id gnl|my_center|LOCUS_15890 674692 674183 gene locus_tag LOCUS_15900 674692 674183 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889092.1 protein_id gnl|my_center|LOCUS_15900 675209 674715 gene locus_tag LOCUS_15910 675209 674715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 676515 675391 gene locus_tag LOCUS_15920 676515 675391 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977752.1 protein_id gnl|my_center|LOCUS_15920 676697 677911 gene locus_tag LOCUS_15930 676697 677911 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797749.1 protein_id gnl|my_center|LOCUS_15930 679929 677971 gene locus_tag LOCUS_15940 gene acs 679929 677971 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_15940 680094 683621 gene locus_tag LOCUS_15950 680094 683621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 684385 683624 gene locus_tag LOCUS_15960 684385 683624 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727800.1 protein_id gnl|my_center|LOCUS_15960 684453 685232 gene locus_tag LOCUS_15970 684453 685232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419692.1 protein_id gnl|my_center|LOCUS_15970 686496 685732 gene locus_tag LOCUS_15980 686496 685732 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 protein_id gnl|my_center|LOCUS_15980 686641 687921 gene locus_tag LOCUS_15990 686641 687921 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029084.1 protein_id gnl|my_center|LOCUS_15990 687945 689165 gene locus_tag LOCUS_16000 687945 689165 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_16000 689162 690031 gene locus_tag LOCUS_16010 689162 690031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 690031 690930 gene locus_tag LOCUS_16020 690031 690930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 691485 690973 gene locus_tag LOCUS_16030 691485 690973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 691888 692211 gene locus_tag LOCUS_16040 691888 692211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 692280 692657 gene locus_tag LOCUS_16050 692280 692657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 692654 693103 gene locus_tag LOCUS_16060 692654 693103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 693526 693149 gene locus_tag LOCUS_16070 693526 693149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 696727 694256 gene locus_tag LOCUS_16080 696727 694256 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776588.1 protein_id gnl|my_center|LOCUS_16080 696987 699320 gene locus_tag LOCUS_16090 696987 699320 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776267.1 protein_id gnl|my_center|LOCUS_16090 699419 700633 gene locus_tag LOCUS_16100 699419 700633 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803896.1 protein_id gnl|my_center|LOCUS_16100 701586 700612 gene locus_tag LOCUS_16110 701586 700612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 701630 703180 gene locus_tag LOCUS_16120 gene hutH 701630 703180 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727479.1 protein_id gnl|my_center|LOCUS_16120 703230 704885 gene locus_tag LOCUS_16130 703230 704885 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727477.1 protein_id gnl|my_center|LOCUS_16130 704950 706035 gene locus_tag LOCUS_16140 704950 706035 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 protein_id gnl|my_center|LOCUS_16140 706032 707135 gene locus_tag LOCUS_16150 706032 707135 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455028.1 protein_id gnl|my_center|LOCUS_16150 707138 707992 gene locus_tag LOCUS_16160 707138 707992 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339288.1 protein_id gnl|my_center|LOCUS_16160 708040 709542 gene locus_tag LOCUS_16170 708040 709542 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975390.1 protein_id gnl|my_center|LOCUS_16170 709627 712380 gene locus_tag LOCUS_16180 gene topA 709627 712380 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029075.1 protein_id gnl|my_center|LOCUS_16180 712400 713884 gene locus_tag LOCUS_16190 712400 713884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 713881 714513 gene locus_tag LOCUS_16200 713881 714513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 715806 714799 gene locus_tag LOCUS_16210 715806 714799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 715991 717175 gene locus_tag LOCUS_16220 715991 717175 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 protein_id gnl|my_center|LOCUS_16220 717644 718261 gene locus_tag LOCUS_16230 717644 718261 CDS product transglycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230245.1 protein_id gnl|my_center|LOCUS_16230 718383 719291 gene locus_tag LOCUS_16240 718383 719291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 719286 719401 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccctgagcctgtcgaagggc 719457 721088 gene locus_tag LOCUS_16250 719457 721088 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 protein_id gnl|my_center|LOCUS_16250 721159 721232 gene locus_tag LOCUS_t00240 721159 721232 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 722471 721266 gene locus_tag LOCUS_16260 722471 721266 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_16260 722650 722468 gene locus_tag LOCUS_16270 722650 722468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 724358 722838 gene locus_tag LOCUS_16280 724358 722838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227708.1 protein_id gnl|my_center|LOCUS_16280 725839 724355 gene locus_tag LOCUS_16290 725839 724355 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110627.1 protein_id gnl|my_center|LOCUS_16290 726039 725842 gene locus_tag LOCUS_16300 726039 725842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 726503 726036 gene locus_tag LOCUS_16310 726503 726036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 726931 726506 gene locus_tag LOCUS_16320 726931 726506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 727033 728301 gene locus_tag LOCUS_16330 727033 728301 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227700.1 protein_id gnl|my_center|LOCUS_16330 728298 728843 gene locus_tag LOCUS_16340 728298 728843 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227701.1 protein_id gnl|my_center|LOCUS_16340 729135 728953 gene locus_tag LOCUS_16350 729135 728953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 729834 730490 gene locus_tag LOCUS_16360 729834 730490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 730946 730566 gene locus_tag LOCUS_16370 730946 730566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 731648 731079 gene locus_tag LOCUS_16380 731648 731079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 733097 731892 gene locus_tag LOCUS_16390 733097 731892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 733505 733176 gene locus_tag LOCUS_16400 733505 733176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 733628 733927 gene locus_tag LOCUS_16410 733628 733927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 734356 734144 gene locus_tag LOCUS_16420 734356 734144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 734252 734971 gene locus_tag LOCUS_16430 734252 734971 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803903.1 protein_id gnl|my_center|LOCUS_16430 735116 735913 gene locus_tag LOCUS_16440 735116 735913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 736534 736031 gene locus_tag LOCUS_16450 736534 736031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 737329 737027 gene locus_tag LOCUS_16460 737329 737027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 737627 738115 gene locus_tag LOCUS_16470 737627 738115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 738875 738342 gene locus_tag LOCUS_16480 738875 738342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 740142 739123 gene locus_tag LOCUS_16490 740142 739123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 740669 740178 gene locus_tag LOCUS_16500 740669 740178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 741164 740745 gene locus_tag LOCUS_16510 741164 740745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 741847 741566 gene locus_tag LOCUS_16520 741847 741566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 742471 742115 gene locus_tag LOCUS_16530 742471 742115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 742558 743130 gene locus_tag LOCUS_16540 742558 743130 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222431.1 protein_id gnl|my_center|LOCUS_16540 743671 743330 gene locus_tag LOCUS_16550 743671 743330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 744761 744069 gene locus_tag LOCUS_16560 744761 744069 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015485.1 protein_id gnl|my_center|LOCUS_16560 745303 744779 gene locus_tag LOCUS_16570 745303 744779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 746022 745576 gene locus_tag LOCUS_16580 746022 745576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 746628 746305 gene locus_tag LOCUS_16590 746628 746305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 746919 747767 gene locus_tag LOCUS_16600 746919 747767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 748670 748134 gene locus_tag LOCUS_16610 748670 748134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 749037 748789 gene locus_tag LOCUS_16620 749037 748789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 749540 749187 gene locus_tag LOCUS_16630 749540 749187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 749645 750334 gene locus_tag LOCUS_16640 749645 750334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 752298 750403 gene locus_tag LOCUS_16650 752298 750403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 752585 753055 gene locus_tag LOCUS_16660 752585 753055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 753690 754355 gene locus_tag LOCUS_16670 753690 754355 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026982.1 protein_id gnl|my_center|LOCUS_16670 755323 754544 gene locus_tag LOCUS_16680 755323 754544 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730500.1 protein_id gnl|my_center|LOCUS_16680 755928 755320 gene locus_tag LOCUS_16690 755928 755320 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730499.1 protein_id gnl|my_center|LOCUS_16690 756308 755940 gene locus_tag LOCUS_16700 756308 755940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 757687 756305 gene locus_tag LOCUS_16710 757687 756305 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_16710 757845 758255 gene locus_tag LOCUS_16720 757845 758255 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026896.1 protein_id gnl|my_center|LOCUS_16720 758255 758518 gene locus_tag LOCUS_16730 758255 758518 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013354.1 protein_id gnl|my_center|LOCUS_16730 759831 758533 gene locus_tag LOCUS_16740 759831 758533 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_16740 760603 759860 gene locus_tag LOCUS_16750 760603 759860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 762920 760596 gene locus_tag LOCUS_16760 762920 760596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 763461 762925 gene locus_tag LOCUS_16770 763461 762925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 764536 763514 gene locus_tag LOCUS_16780 764536 763514 CDS product Brp/Blh family beta-carotene 15,15'-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404936.1 protein_id gnl|my_center|LOCUS_16780 765393 764539 gene locus_tag LOCUS_16790 765393 764539 CDS product bacteriorhodopsin-like inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_16790 766202 765465 gene locus_tag LOCUS_16800 766202 765465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 766681 766199 gene locus_tag LOCUS_16810 766681 766199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 767269 766796 gene locus_tag LOCUS_16820 767269 766796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 767836 767582 gene locus_tag LOCUS_16830 767836 767582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 768549 768019 gene locus_tag LOCUS_16840 768549 768019 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487439.1 protein_id gnl|my_center|LOCUS_16840 768648 769022 gene locus_tag LOCUS_16850 768648 769022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 769075 769632 gene locus_tag LOCUS_16860 769075 769632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 769737 770747 gene locus_tag LOCUS_16870 769737 770747 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742152.1 protein_id gnl|my_center|LOCUS_16870 770744 771103 gene locus_tag LOCUS_16880 770744 771103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 771100 772857 gene locus_tag LOCUS_16890 771100 772857 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227542.1 protein_id gnl|my_center|LOCUS_16890 772858 773577 gene locus_tag LOCUS_16900 772858 773577 CDS product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227530.1 protein_id gnl|my_center|LOCUS_16900 773574 774077 gene locus_tag LOCUS_16910 773574 774077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 775395 774877 gene locus_tag LOCUS_16920 775395 774877 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888554.1 protein_id gnl|my_center|LOCUS_16920 775717 776292 gene locus_tag LOCUS_16930 775717 776292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 777342 776311 gene locus_tag LOCUS_16940 777342 776311 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213192.1 protein_id gnl|my_center|LOCUS_16940 778136 777369 gene locus_tag LOCUS_16950 778136 777369 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895059.1 protein_id gnl|my_center|LOCUS_16950 779272 778292 gene locus_tag LOCUS_16960 779272 778292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 782085 779269 gene locus_tag LOCUS_16970 782085 779269 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487609.1 protein_id gnl|my_center|LOCUS_16970 782261 782974 gene locus_tag LOCUS_16980 782261 782974 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972011.1 protein_id gnl|my_center|LOCUS_16980 783064 784026 gene locus_tag LOCUS_16990 783064 784026 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222265.1 protein_id gnl|my_center|LOCUS_16990 784837 784127 gene locus_tag LOCUS_17000 784837 784127 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072477587.1 protein_id gnl|my_center|LOCUS_17000 786815 784860 gene locus_tag LOCUS_17010 786815 784860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 786889 787932 gene locus_tag LOCUS_17020 786889 787932 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142495.1 protein_id gnl|my_center|LOCUS_17020 788986 787958 gene locus_tag LOCUS_17030 788986 787958 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972694.1 protein_id gnl|my_center|LOCUS_17030 789146 791749 gene locus_tag LOCUS_17040 789146 791749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 791836 792192 gene locus_tag LOCUS_17050 791836 792192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 792527 792255 gene locus_tag LOCUS_17060 792527 792255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 793662 792709 gene locus_tag LOCUS_17070 793662 792709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 793736 794716 gene locus_tag LOCUS_17080 793736 794716 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 protein_id gnl|my_center|LOCUS_17080 794713 795240 gene locus_tag LOCUS_17090 794713 795240 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030665.1 protein_id gnl|my_center|LOCUS_17090 796246 795269 gene locus_tag LOCUS_17100 796246 795269 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803888.1 protein_id gnl|my_center|LOCUS_17100 796426 797139 gene locus_tag LOCUS_17110 796426 797139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 797816 797220 gene locus_tag LOCUS_17120 797816 797220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 798802 798053 gene locus_tag LOCUS_17130 798802 798053 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223914.1 protein_id gnl|my_center|LOCUS_17130 798828 799541 gene locus_tag LOCUS_17140 798828 799541 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978722.1 protein_id gnl|my_center|LOCUS_17140 799555 800136 gene locus_tag LOCUS_17150 799555 800136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 800451 800170 gene locus_tag LOCUS_17160 800451 800170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 800548 801252 gene locus_tag LOCUS_17170 800548 801252 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630294.1 protein_id gnl|my_center|LOCUS_17170 802110 801268 gene locus_tag LOCUS_17180 802110 801268 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026945.1 protein_id gnl|my_center|LOCUS_17180 802309 803250 gene locus_tag LOCUS_17190 802309 803250 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026947.1 protein_id gnl|my_center|LOCUS_17190 803935 803372 gene locus_tag LOCUS_17200 gene wrbA 803935 803372 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728300.1 protein_id gnl|my_center|LOCUS_17200 804047 804706 gene locus_tag LOCUS_17210 804047 804706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 805223 804690 gene locus_tag LOCUS_17220 805223 804690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 805801 805301 gene locus_tag LOCUS_17230 805801 805301 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225292.1 protein_id gnl|my_center|LOCUS_17230 805846 806157 gene locus_tag LOCUS_17240 805846 806157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 806163 807107 gene locus_tag LOCUS_17250 806163 807107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 808372 807131 gene locus_tag LOCUS_17260 808372 807131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17260 808509 808940 gene locus_tag LOCUS_17270 808509 808940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 809017 809673 gene locus_tag LOCUS_17280 809017 809673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 810114 809791 gene locus_tag LOCUS_17290 810114 809791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 811027 810146 gene locus_tag LOCUS_17300 811027 810146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 811156 811974 gene locus_tag LOCUS_17310 811156 811974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 812018 814558 gene locus_tag LOCUS_17320 812018 814558 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_17320 815571 814597 gene locus_tag LOCUS_17330 815571 814597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 815768 817078 gene locus_tag LOCUS_17340 815768 817078 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776937.1 protein_id gnl|my_center|LOCUS_17340 817096 818052 gene locus_tag LOCUS_17350 817096 818052 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776936.1 protein_id gnl|my_center|LOCUS_17350 818045 818983 gene locus_tag LOCUS_17360 818045 818983 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776935.1 protein_id gnl|my_center|LOCUS_17360 819087 820415 gene locus_tag LOCUS_17370 819087 820415 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776934.1 protein_id gnl|my_center|LOCUS_17370 820412 822931 gene locus_tag LOCUS_17380 820412 822931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 823600 822956 gene locus_tag LOCUS_17390 823600 822956 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229467.1 protein_id gnl|my_center|LOCUS_17390 824772 823597 gene locus_tag LOCUS_17400 824772 823597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 825875 824769 gene locus_tag LOCUS_17410 825875 824769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 826050 827030 gene locus_tag LOCUS_17420 826050 827030 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530858.1 protein_id gnl|my_center|LOCUS_17420 827027 829330 gene locus_tag LOCUS_17430 827027 829330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 829327 830436 gene locus_tag LOCUS_17440 829327 830436 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582708.1 protein_id gnl|my_center|LOCUS_17440 830925 830449 gene locus_tag LOCUS_17450 830925 830449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 832225 830960 gene locus_tag LOCUS_17460 832225 830960 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230103.1 protein_id gnl|my_center|LOCUS_17460 833229 832321 gene locus_tag LOCUS_17470 833229 832321 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230136.1 protein_id gnl|my_center|LOCUS_17470 834182 833226 gene locus_tag LOCUS_17480 834182 833226 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230135.1 protein_id gnl|my_center|LOCUS_17480 835506 834184 gene locus_tag LOCUS_17490 835506 834184 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230134.1 protein_id gnl|my_center|LOCUS_17490 836732 835626 gene locus_tag LOCUS_17500 836732 835626 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893107.1 protein_id gnl|my_center|LOCUS_17500 836929 837603 gene locus_tag LOCUS_17510 836929 837603 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226246.1 protein_id gnl|my_center|LOCUS_17510 837654 839141 gene locus_tag LOCUS_17520 gene araA 837654 839141 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226247.1 protein_id gnl|my_center|LOCUS_17520 839138 839989 gene locus_tag LOCUS_17530 839138 839989 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969391.1 protein_id gnl|my_center|LOCUS_17530 839986 840942 gene locus_tag LOCUS_17540 839986 840942 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804906.1 protein_id gnl|my_center|LOCUS_17540 841014 842684 gene locus_tag LOCUS_17550 841014 842684 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 protein_id gnl|my_center|LOCUS_17550 843113 842700 gene locus_tag LOCUS_17560 843113 842700 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973876.1 protein_id gnl|my_center|LOCUS_17560 844300 843134 gene locus_tag LOCUS_17570 844300 843134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 846271 844400 gene locus_tag LOCUS_17580 846271 844400 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225751.1 protein_id gnl|my_center|LOCUS_17580 847534 846329 gene locus_tag LOCUS_17590 847534 846329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 848175 847786 gene locus_tag LOCUS_17600 848175 847786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 849323 848175 gene locus_tag LOCUS_17610 849323 848175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 849970 849452 gene locus_tag LOCUS_17620 849970 849452 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029420.1 protein_id gnl|my_center|LOCUS_17620 850285 849974 gene locus_tag LOCUS_17630 850285 849974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 850185 851843 gene locus_tag LOCUS_17640 850185 851843 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957525.1 protein_id gnl|my_center|LOCUS_17640 853009 852137 gene locus_tag LOCUS_17650 853009 852137 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090078.1 protein_id gnl|my_center|LOCUS_17650 854484 853006 gene locus_tag LOCUS_17660 854484 853006 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115383.1 protein_id gnl|my_center|LOCUS_17660 854607 855851 gene locus_tag LOCUS_17670 854607 855851 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486041.1 protein_id gnl|my_center|LOCUS_17670 855839 856735 gene locus_tag LOCUS_17680 855839 856735 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079927.1 protein_id gnl|my_center|LOCUS_17680 856898 857134 gene locus_tag LOCUS_17690 856898 857134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 857137 857556 gene locus_tag LOCUS_17700 857137 857556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 861393 857566 gene locus_tag LOCUS_17710 861393 857566 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229685.1 protein_id gnl|my_center|LOCUS_17710 862672 861734 gene locus_tag LOCUS_17720 862672 861734 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776907.1 protein_id gnl|my_center|LOCUS_17720 863622 862672 gene locus_tag LOCUS_17730 863622 862672 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776908.1 protein_id gnl|my_center|LOCUS_17730 865072 863699 gene locus_tag LOCUS_17740 865072 863699 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776909.1 protein_id gnl|my_center|LOCUS_17740 865192 866169 gene locus_tag LOCUS_17750 865192 866169 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977764.1 protein_id gnl|my_center|LOCUS_17750 866231 867751 gene locus_tag LOCUS_17760 866231 867751 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976375.1 protein_id gnl|my_center|LOCUS_17760 867967 868926 gene locus_tag LOCUS_17770 867967 868926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 868957 870060 gene locus_tag LOCUS_17780 gene mraY 868957 870060 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804699.1 protein_id gnl|my_center|LOCUS_17780 873222 870079 gene locus_tag LOCUS_17790 873222 870079 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026825.1 protein_id gnl|my_center|LOCUS_17790 874467 873358 gene locus_tag LOCUS_17800 874467 873358 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803814.1 protein_id gnl|my_center|LOCUS_17800 875177 874464 gene locus_tag LOCUS_17810 875177 874464 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803815.1 protein_id gnl|my_center|LOCUS_17810 875774 875271 gene locus_tag LOCUS_17820 875774 875271 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030939.1 protein_id gnl|my_center|LOCUS_17820 876785 875838 gene locus_tag LOCUS_17830 876785 875838 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085601.1 protein_id gnl|my_center|LOCUS_17830 876872 877072 gene locus_tag LOCUS_17840 876872 877072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 877053 877580 gene locus_tag LOCUS_17850 877053 877580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 879669 877603 gene locus_tag LOCUS_17860 879669 877603 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485975.1 protein_id gnl|my_center|LOCUS_17860 879747 880274 gene locus_tag LOCUS_17870 879747 880274 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082774477.1 protein_id gnl|my_center|LOCUS_17870 880271 881125 gene locus_tag LOCUS_17880 gene larE 880271 881125 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777075.1 protein_id gnl|my_center|LOCUS_17880 881122 881874 gene locus_tag LOCUS_17890 gene larB 881122 881874 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777074.1 protein_id gnl|my_center|LOCUS_17890 881871 883067 gene locus_tag LOCUS_17900 gene larC 881871 883067 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015146.1 protein_id gnl|my_center|LOCUS_17900 883184 883951 gene locus_tag LOCUS_17910 883184 883951 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805180.1 protein_id gnl|my_center|LOCUS_17910 884663 883968 gene locus_tag LOCUS_17920 884663 883968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 884900 886495 gene locus_tag LOCUS_17930 884900 886495 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086928.1 protein_id gnl|my_center|LOCUS_17930 886507 887919 gene locus_tag LOCUS_17940 886507 887919 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681425.1 protein_id gnl|my_center|LOCUS_17940 887916 888857 gene locus_tag LOCUS_17950 887916 888857 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419701.1 protein_id gnl|my_center|LOCUS_17950 888850 889749 gene locus_tag LOCUS_17960 888850 889749 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113015.1 protein_id gnl|my_center|LOCUS_17960 889751 891139 gene locus_tag LOCUS_17970 889751 891139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 891153 891725 gene locus_tag LOCUS_17980 891153 891725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 891722 893374 gene locus_tag LOCUS_17990 891722 893374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775830.1 protein_id gnl|my_center|LOCUS_17990 893446 894456 gene locus_tag LOCUS_18000 893446 894456 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726612.1 protein_id gnl|my_center|LOCUS_18000 895899 894565 gene locus_tag LOCUS_18010 895899 894565 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083032.1 protein_id gnl|my_center|LOCUS_18010 896019 897179 gene locus_tag LOCUS_18020 896019 897179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 898122 897190 gene locus_tag LOCUS_18030 898122 897190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 898198 899271 gene locus_tag LOCUS_18040 898198 899271 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519595.1 protein_id gnl|my_center|LOCUS_18040 899314 900351 gene locus_tag LOCUS_18050 899314 900351 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027915.1 protein_id gnl|my_center|LOCUS_18050 900446 901495 gene locus_tag LOCUS_18060 900446 901495 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729196.1 protein_id gnl|my_center|LOCUS_18060 902230 901499 gene locus_tag LOCUS_18070 902230 901499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 903049 902516 gene locus_tag LOCUS_18080 903049 902516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062827.1 protein_id gnl|my_center|LOCUS_18080 903272 904735 gene locus_tag LOCUS_18090 903272 904735 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_18090 905789 904743 gene locus_tag LOCUS_18100 905789 904743 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968456.1 protein_id gnl|my_center|LOCUS_18100 906895 905813 gene locus_tag LOCUS_18110 906895 905813 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092074.1 protein_id gnl|my_center|LOCUS_18110 907010 907732 gene locus_tag LOCUS_18120 907010 907732 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973740.1 protein_id gnl|my_center|LOCUS_18120 907913 909283 gene locus_tag LOCUS_18130 907913 909283 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929854.1 protein_id gnl|my_center|LOCUS_18130 909280 910215 gene locus_tag LOCUS_18140 909280 910215 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721883.1 protein_id gnl|my_center|LOCUS_18140 910215 911105 gene locus_tag LOCUS_18150 910215 911105 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_18150 912119 911178 gene locus_tag LOCUS_18160 912119 911178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 912739 912116 gene locus_tag LOCUS_18170 912739 912116 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026917.1 protein_id gnl|my_center|LOCUS_18170 913629 912853 gene locus_tag LOCUS_18180 913629 912853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 914507 913626 gene locus_tag LOCUS_18190 914507 913626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence3 900 130 gene locus_tag LOCUS_18200 gene fabI 900 130 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_18200 1690 965 gene locus_tag LOCUS_18210 gene fabG 1690 965 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_18210 1865 2329 gene locus_tag LOCUS_18220 1865 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 2370 2540 gene locus_tag LOCUS_18230 2370 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 3357 2548 gene locus_tag LOCUS_18240 3357 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 4457 3453 gene locus_tag LOCUS_18250 gene moaA 4457 3453 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106977887.1 protein_id gnl|my_center|LOCUS_18250 5313 4474 gene locus_tag LOCUS_18260 gene fdhD 5313 4474 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876561.1 protein_id gnl|my_center|LOCUS_18260 5278 5583 gene locus_tag LOCUS_18270 5278 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18270 5594 6496 gene locus_tag LOCUS_18280 5594 6496 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411514.1 protein_id gnl|my_center|LOCUS_18280 6643 7077 gene locus_tag LOCUS_18290 6643 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 7172 7933 gene locus_tag LOCUS_18300 7172 7933 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 protein_id gnl|my_center|LOCUS_18300 7956 8795 gene locus_tag LOCUS_18310 7956 8795 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014130.1 protein_id gnl|my_center|LOCUS_18310 10746 8818 gene locus_tag LOCUS_18320 10746 8818 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_18320 11743 10922 gene locus_tag LOCUS_18330 11743 10922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 13529 11931 gene locus_tag LOCUS_18340 13529 11931 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_18340 14057 13632 gene locus_tag LOCUS_18350 14057 13632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 14494 14054 gene locus_tag LOCUS_18360 14494 14054 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_18360 15858 14521 gene locus_tag LOCUS_18370 15858 14521 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 protein_id gnl|my_center|LOCUS_18370 16637 15858 gene locus_tag LOCUS_18380 gene sufC 16637 15858 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976897.1 protein_id gnl|my_center|LOCUS_18380 16991 16671 gene locus_tag LOCUS_18390 16991 16671 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_18390 18217 16991 gene locus_tag LOCUS_18400 gene sufD 18217 16991 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_18400 20047 18527 gene locus_tag LOCUS_18410 gene sufB 20047 18527 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_18410 20847 20044 gene locus_tag LOCUS_18420 20847 20044 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976893.1 protein_id gnl|my_center|LOCUS_18420 20998 21831 gene locus_tag LOCUS_18430 20998 21831 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_18430 21832 23064 gene locus_tag LOCUS_18440 21832 23064 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_18440 23798 23100 gene locus_tag LOCUS_18450 23798 23100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18450 25450 23831 gene locus_tag LOCUS_18460 25450 23831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 25708 26685 gene locus_tag LOCUS_18470 25708 26685 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_18470 26682 27674 gene locus_tag LOCUS_18480 26682 27674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 28773 27691 gene locus_tag LOCUS_18490 28773 27691 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005121850.1 protein_id gnl|my_center|LOCUS_18490 28851 29600 gene locus_tag LOCUS_18500 28851 29600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 29597 30373 gene locus_tag LOCUS_18510 29597 30373 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_18510 30361 31263 gene locus_tag LOCUS_18520 30361 31263 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_18520 31400 33439 gene locus_tag LOCUS_18530 31400 33439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 34220 33372 gene locus_tag LOCUS_18540 34220 33372 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776878.1 protein_id gnl|my_center|LOCUS_18540 34292 35113 gene locus_tag LOCUS_18550 34292 35113 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776877.1 protein_id gnl|my_center|LOCUS_18550 35361 37604 gene locus_tag LOCUS_18560 35361 37604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 37645 38742 gene locus_tag LOCUS_18570 37645 38742 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_18570 39457 38924 gene locus_tag LOCUS_18580 39457 38924 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407809.1 protein_id gnl|my_center|LOCUS_18580 39892 39458 gene locus_tag LOCUS_18590 39892 39458 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224900.1 protein_id gnl|my_center|LOCUS_18590 41100 40084 gene locus_tag LOCUS_18600 41100 40084 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 protein_id gnl|my_center|LOCUS_18600 41594 43813 gene locus_tag LOCUS_18610 gene tkt 41594 43813 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022841.1 protein_id gnl|my_center|LOCUS_18610 43875 44987 gene locus_tag LOCUS_18620 gene tal 43875 44987 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224676.1 protein_id gnl|my_center|LOCUS_18620 44995 45750 gene locus_tag LOCUS_18630 gene pgl 44995 45750 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_18630 46159 45851 gene locus_tag LOCUS_18640 46159 45851 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976875.1 protein_id gnl|my_center|LOCUS_18640 46568 46320 gene locus_tag LOCUS_18650 gene secG 46568 46320 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325957.1 protein_id gnl|my_center|LOCUS_18650 47460 46669 gene locus_tag LOCUS_18660 gene tpiA 47460 46669 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_18660 48722 47532 gene locus_tag LOCUS_18670 48722 47532 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930207.1 protein_id gnl|my_center|LOCUS_18670 48928 48719 gene locus_tag LOCUS_18680 48928 48719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 49960 48956 gene locus_tag LOCUS_18690 gene gap 49960 48956 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_18690 51211 50228 gene locus_tag LOCUS_18700 gene whiA 51211 50228 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 protein_id gnl|my_center|LOCUS_18700 52250 51288 gene locus_tag LOCUS_18710 gene yvcK 52250 51288 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 protein_id gnl|my_center|LOCUS_18710 53272 52247 gene locus_tag LOCUS_18720 gene rapZ 53272 52247 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_18720 55306 53321 gene locus_tag LOCUS_18730 gene uvrC 55306 53321 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831611.1 protein_id gnl|my_center|LOCUS_18730 56008 55391 gene locus_tag LOCUS_18740 56008 55391 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226951.1 protein_id gnl|my_center|LOCUS_18740 56698 56084 gene locus_tag LOCUS_18750 56698 56084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 56834 58717 gene locus_tag LOCUS_18760 56834 58717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 62267 59160 gene locus_tag LOCUS_18770 gene uvrA 62267 59160 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_18770 62302 63081 gene locus_tag LOCUS_18780 62302 63081 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222689.1 protein_id gnl|my_center|LOCUS_18780 63168 63830 gene locus_tag LOCUS_18790 63168 63830 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227876.1 protein_id gnl|my_center|LOCUS_18790 63841 65193 gene locus_tag LOCUS_18800 63841 65193 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 protein_id gnl|my_center|LOCUS_18800 66229 65219 gene locus_tag LOCUS_18810 66229 65219 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113122.1 protein_id gnl|my_center|LOCUS_18810 68635 66506 gene locus_tag LOCUS_18820 gene uvrB 68635 66506 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_18820 69667 68663 gene locus_tag LOCUS_18830 69667 68663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 71052 69664 gene locus_tag LOCUS_18840 71052 69664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 71791 71180 gene locus_tag LOCUS_18850 gene coaE 71791 71180 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_18850 71745 71915 gene locus_tag LOCUS_18860 71745 71915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 73402 71909 gene locus_tag LOCUS_18870 gene rpsA 73402 71909 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 protein_id gnl|my_center|LOCUS_18870 73799 74131 gene locus_tag LOCUS_18880 73799 74131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 74842 74138 gene locus_tag LOCUS_18890 74842 74138 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029605.1 protein_id gnl|my_center|LOCUS_18890 76221 74839 gene locus_tag LOCUS_18900 76221 74839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 76883 76365 gene locus_tag LOCUS_18910 76883 76365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 79975 77162 gene locus_tag LOCUS_18920 gene polA 79975 77162 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_18920 80041 81090 gene locus_tag LOCUS_18930 80041 81090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 81779 81072 gene locus_tag LOCUS_18940 81779 81072 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028095.1 protein_id gnl|my_center|LOCUS_18940 82638 81781 gene locus_tag LOCUS_18950 82638 81781 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976806.1 protein_id gnl|my_center|LOCUS_18950 84362 82635 gene locus_tag LOCUS_18960 84362 82635 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028094.1 protein_id gnl|my_center|LOCUS_18960 85303 84359 gene locus_tag LOCUS_18970 85303 84359 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028093.1 protein_id gnl|my_center|LOCUS_18970 86641 85409 gene locus_tag LOCUS_18980 86641 85409 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976809.1 protein_id gnl|my_center|LOCUS_18980 87508 86780 gene locus_tag LOCUS_18990 87508 86780 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_18990 87652 87737 gene locus_tag LOCUS_t00250 87652 87737 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 88486 87755 gene locus_tag LOCUS_19000 88486 87755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 89938 88523 gene locus_tag LOCUS_19010 gene pyk 89938 88523 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805095.1 protein_id gnl|my_center|LOCUS_19010 90948 90025 gene locus_tag LOCUS_19020 90948 90025 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224836.1 protein_id gnl|my_center|LOCUS_19020 91562 90945 gene locus_tag LOCUS_19030 91562 90945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 92122 91598 gene locus_tag LOCUS_19040 92122 91598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 92028 92684 gene locus_tag LOCUS_19050 92028 92684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 93707 92811 gene locus_tag LOCUS_19060 93707 92811 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080209.1 protein_id gnl|my_center|LOCUS_19060 94224 93928 gene locus_tag LOCUS_19070 94224 93928 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804708.1 protein_id gnl|my_center|LOCUS_19070 94895 94311 gene locus_tag LOCUS_19080 gene sepF 94895 94311 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976736.1 protein_id gnl|my_center|LOCUS_19080 96372 95128 gene locus_tag LOCUS_19090 gene ftsZ 96372 95128 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_19090 97537 96794 gene locus_tag LOCUS_19100 97537 96794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19100 99111 97534 gene locus_tag LOCUS_19110 gene murC 99111 97534 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_19110 100292 99108 gene locus_tag LOCUS_19120 gene murG 100292 99108 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729656.1 protein_id gnl|my_center|LOCUS_19120 101599 100289 gene locus_tag LOCUS_19130 gene ftsW 101599 100289 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976730.1 protein_id gnl|my_center|LOCUS_19130 103129 101639 gene locus_tag LOCUS_19140 gene murD 103129 101639 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_19140 104229 103141 gene locus_tag LOCUS_19150 gene mraY 104229 103141 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 protein_id gnl|my_center|LOCUS_19150 105692 104226 gene locus_tag LOCUS_19160 105692 104226 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_19160 107392 105689 gene locus_tag LOCUS_19170 107392 105689 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_19170 109640 107475 gene locus_tag LOCUS_19180 gene ftsI 109640 107475 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_19180 110286 109645 gene locus_tag LOCUS_19190 110286 109645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 111442 110378 gene locus_tag LOCUS_19200 gene rsmH 111442 110378 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976723.1 protein_id gnl|my_center|LOCUS_19200 112156 111728 gene locus_tag LOCUS_19210 gene mraZ 112156 111728 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467434.1 protein_id gnl|my_center|LOCUS_19210 112424 113434 gene locus_tag LOCUS_19220 112424 113434 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_19220 113446 114735 gene locus_tag LOCUS_19230 113446 114735 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228053.1 protein_id gnl|my_center|LOCUS_19230 114767 117013 gene locus_tag LOCUS_19240 114767 117013 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_19240 117844 117419 gene locus_tag LOCUS_19250 117844 117419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 119309 118113 gene locus_tag LOCUS_19260 gene dinB 119309 118113 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_19260 120102 119386 gene locus_tag LOCUS_19270 120102 119386 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028138.1 protein_id gnl|my_center|LOCUS_19270 120878 120330 gene locus_tag LOCUS_19280 120878 120330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 121968 121249 gene locus_tag LOCUS_19290 121968 121249 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978056.1 protein_id gnl|my_center|LOCUS_19290 122095 123390 gene locus_tag LOCUS_19300 122095 123390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 123573 125810 gene locus_tag LOCUS_19310 123573 125810 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223681.1 protein_id gnl|my_center|LOCUS_19310 126798 125746 gene locus_tag LOCUS_19320 gene metF 126798 125746 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 protein_id gnl|my_center|LOCUS_19320 126784 127953 gene locus_tag LOCUS_19330 126784 127953 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_19330 128160 129710 gene locus_tag LOCUS_19340 128160 129710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 129843 132095 gene locus_tag LOCUS_19350 129843 132095 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390081.1 protein_id gnl|my_center|LOCUS_19350 132217 133197 gene locus_tag LOCUS_19360 132217 133197 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889019.1 protein_id gnl|my_center|LOCUS_19360 133876 133205 gene locus_tag LOCUS_19370 133876 133205 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897237.1 protein_id gnl|my_center|LOCUS_19370 134944 133919 gene locus_tag LOCUS_19380 134944 133919 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_19380 136460 134979 gene locus_tag LOCUS_19390 136460 134979 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_19390 137365 136529 gene locus_tag LOCUS_19400 137365 136529 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 protein_id gnl|my_center|LOCUS_19400 138150 137362 gene locus_tag LOCUS_19410 138150 137362 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 protein_id gnl|my_center|LOCUS_19410 138356 139186 gene locus_tag LOCUS_19420 138356 139186 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_19420 139183 139731 gene locus_tag LOCUS_19430 139183 139731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 141090 139984 gene locus_tag LOCUS_19440 141090 139984 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_19440 141523 141095 gene locus_tag LOCUS_19450 141523 141095 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 protein_id gnl|my_center|LOCUS_19450 142799 141570 gene locus_tag LOCUS_19460 142799 141570 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_19460 143794 142796 gene locus_tag LOCUS_19470 143794 142796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869422.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19470 145383 144250 gene locus_tag LOCUS_19480 145383 144250 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028159.1 protein_id gnl|my_center|LOCUS_19480 146075 145779 gene locus_tag LOCUS_19490 146075 145779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 146561 146244 gene locus_tag LOCUS_19500 146561 146244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 146542 147006 gene locus_tag LOCUS_19510 146542 147006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 147183 149114 gene locus_tag LOCUS_19520 147183 149114 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_19520 149124 149402 gene locus_tag LOCUS_19530 149124 149402 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_19530 149435 149830 gene locus_tag LOCUS_19540 149435 149830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 150834 149905 gene locus_tag LOCUS_19550 150834 149905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 151476 150934 gene locus_tag LOCUS_19560 151476 150934 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878080.1 protein_id gnl|my_center|LOCUS_19560 151638 152690 gene locus_tag LOCUS_19570 151638 152690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 152753 153370 gene locus_tag LOCUS_19580 152753 153370 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776661.1 protein_id gnl|my_center|LOCUS_19580 154399 153500 gene locus_tag LOCUS_19590 154399 153500 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775955.1 protein_id gnl|my_center|LOCUS_19590 155490 154396 gene locus_tag LOCUS_19600 155490 154396 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 protein_id gnl|my_center|LOCUS_19600 156809 155490 gene locus_tag LOCUS_19610 156809 155490 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775953.1 protein_id gnl|my_center|LOCUS_19610 157094 159142 gene locus_tag LOCUS_19620 157094 159142 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775952.1 protein_id gnl|my_center|LOCUS_19620 159156 160199 gene locus_tag LOCUS_19630 159156 160199 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775951.1 protein_id gnl|my_center|LOCUS_19630 163739 160386 gene locus_tag LOCUS_19640 163739 160386 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777059.1 protein_id gnl|my_center|LOCUS_19640 164330 163794 gene locus_tag LOCUS_19650 164330 163794 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256497.1 protein_id gnl|my_center|LOCUS_19650 166213 164378 gene locus_tag LOCUS_19660 166213 164378 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495724.1 protein_id gnl|my_center|LOCUS_19660 168146 166365 gene locus_tag LOCUS_19670 168146 166365 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728459.1 protein_id gnl|my_center|LOCUS_19670 170801 168189 gene locus_tag LOCUS_19680 170801 168189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 171025 171597 gene locus_tag LOCUS_19690 171025 171597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 171648 172373 gene locus_tag LOCUS_19700 171648 172373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 172878 172435 gene locus_tag LOCUS_19710 172878 172435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 174052 173039 gene locus_tag LOCUS_19720 gene trpD 174052 173039 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_19720 174569 174084 gene locus_tag LOCUS_19730 174569 174084 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893433.1 protein_id gnl|my_center|LOCUS_19730 174821 175531 gene locus_tag LOCUS_19740 174821 175531 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_19740 175662 176432 gene locus_tag LOCUS_19750 175662 176432 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976665.1 protein_id gnl|my_center|LOCUS_19750 176429 177568 gene locus_tag LOCUS_19760 176429 177568 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_19760 177568 179403 gene locus_tag LOCUS_19770 177568 179403 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 protein_id gnl|my_center|LOCUS_19770 179768 180784 gene locus_tag LOCUS_19780 179768 180784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 182087 180903 gene locus_tag LOCUS_19790 182087 180903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 183203 182193 gene locus_tag LOCUS_19800 183203 182193 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776829.1 protein_id gnl|my_center|LOCUS_19800 184305 183262 gene locus_tag LOCUS_19810 184305 183262 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878423.1 protein_id gnl|my_center|LOCUS_19810 186679 184343 gene locus_tag LOCUS_19820 gene treS 186679 184343 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401001.1 protein_id gnl|my_center|LOCUS_19820 187553 186882 gene locus_tag LOCUS_19830 187553 186882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230700.1 protein_id gnl|my_center|LOCUS_19830 187658 188233 gene locus_tag LOCUS_19840 gene padR 187658 188233 CDS product transcriptional regulator PadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233588.1 protein_id gnl|my_center|LOCUS_19840 188316 189770 gene locus_tag LOCUS_19850 188316 189770 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279790.1 protein_id gnl|my_center|LOCUS_19850 190451 189834 gene locus_tag LOCUS_19860 190451 189834 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831548.1 protein_id gnl|my_center|LOCUS_19860 190765 190490 gene locus_tag LOCUS_19870 190765 190490 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967020.1 protein_id gnl|my_center|LOCUS_19870 191107 192171 gene locus_tag LOCUS_19880 191107 192171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 192231 193139 gene locus_tag LOCUS_19890 gene cysD 192231 193139 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466878.1 protein_id gnl|my_center|LOCUS_19890 193142 194401 gene locus_tag LOCUS_19900 193142 194401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19900 196243 194690 gene locus_tag LOCUS_19910 196243 194690 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775824.1 protein_id gnl|my_center|LOCUS_19910 196788 196228 gene locus_tag LOCUS_19920 196788 196228 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223522.1 protein_id gnl|my_center|LOCUS_19920 197333 196938 gene locus_tag LOCUS_19930 197333 196938 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224074.1 protein_id gnl|my_center|LOCUS_19930 199117 197330 gene locus_tag LOCUS_19940 gene ctaD 199117 197330 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_19940 199938 199117 gene locus_tag LOCUS_19950 gene coxB 199938 199117 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805014.1 protein_id gnl|my_center|LOCUS_19950 200227 201414 gene locus_tag LOCUS_19960 200227 201414 CDS product cysteine desulfurase/sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028169.1 protein_id gnl|my_center|LOCUS_19960 201474 201965 gene locus_tag LOCUS_19970 201474 201965 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976947.1 protein_id gnl|my_center|LOCUS_19970 202522 202160 gene locus_tag LOCUS_19980 202522 202160 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_19980 202769 204043 gene locus_tag LOCUS_19990 202769 204043 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715516.1 protein_id gnl|my_center|LOCUS_19990 204125 205180 gene locus_tag LOCUS_20000 204125 205180 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085331.1 protein_id gnl|my_center|LOCUS_20000 205247 205822 gene locus_tag LOCUS_20010 205247 205822 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092983.1 protein_id gnl|my_center|LOCUS_20010 205868 207025 gene locus_tag LOCUS_20020 gene nadA 205868 207025 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_20020 207417 207133 gene locus_tag LOCUS_20030 207417 207133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 208220 207417 gene locus_tag LOCUS_20040 208220 207417 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_20040 208478 209053 gene locus_tag LOCUS_20050 208478 209053 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805010.1 protein_id gnl|my_center|LOCUS_20050 209116 210126 gene locus_tag LOCUS_20060 209116 210126 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776829.1 protein_id gnl|my_center|LOCUS_20060 210128 210340 gene locus_tag LOCUS_20070 210128 210340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976644.1 protein_id gnl|my_center|LOCUS_20070 211362 210421 gene locus_tag LOCUS_20080 211362 210421 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225136.1 protein_id gnl|my_center|LOCUS_20080 211488 212177 gene locus_tag LOCUS_20090 211488 212177 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230648.1 protein_id gnl|my_center|LOCUS_20090 212224 212691 gene locus_tag LOCUS_20100 212224 212691 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977815.1 protein_id gnl|my_center|LOCUS_20100 213045 212710 gene locus_tag LOCUS_20110 213045 212710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 214217 213042 gene locus_tag LOCUS_20120 gene gcvT 214217 213042 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085318.1 protein_id gnl|my_center|LOCUS_20120 214369 215901 gene locus_tag LOCUS_20130 214369 215901 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224057.1 protein_id gnl|my_center|LOCUS_20130 215976 216260 gene locus_tag LOCUS_20140 215976 216260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 216565 216227 gene locus_tag LOCUS_20150 216565 216227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466777.1 protein_id gnl|my_center|LOCUS_20150 216704 218125 gene locus_tag LOCUS_20160 gene lpdA 216704 218125 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_20160 218284 220131 gene locus_tag LOCUS_20170 gene sucB 218284 220131 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775679.1 protein_id gnl|my_center|LOCUS_20170 220166 221086 gene locus_tag LOCUS_20180 220166 221086 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729703.1 protein_id gnl|my_center|LOCUS_20180 221106 221840 gene locus_tag LOCUS_20190 gene lipB 221106 221840 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224047.1 protein_id gnl|my_center|LOCUS_20190 222005 223048 gene locus_tag LOCUS_20200 222005 223048 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_20200 223045 224049 gene locus_tag LOCUS_20210 223045 224049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 224119 225030 gene locus_tag LOCUS_20220 gene lipA 224119 225030 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466774.1 protein_id gnl|my_center|LOCUS_20220 225048 225821 gene locus_tag LOCUS_20230 225048 225821 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_20230 225826 226194 gene locus_tag LOCUS_20240 225826 226194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 228588 226777 gene locus_tag LOCUS_20250 228588 226777 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729311.1 protein_id gnl|my_center|LOCUS_20250 229566 228655 gene locus_tag LOCUS_20260 229566 228655 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229983.1 protein_id gnl|my_center|LOCUS_20260 230537 229566 gene locus_tag LOCUS_20270 230537 229566 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229982.1 protein_id gnl|my_center|LOCUS_20270 231382 230720 gene locus_tag LOCUS_20280 231382 230720 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229981.1 protein_id gnl|my_center|LOCUS_20280 231415 232779 gene locus_tag LOCUS_20290 231415 232779 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730270.1 protein_id gnl|my_center|LOCUS_20290 233296 232832 gene locus_tag LOCUS_20300 233296 232832 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411466.1 protein_id gnl|my_center|LOCUS_20300 233578 234999 gene locus_tag LOCUS_20310 gene glnA 233578 234999 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976617.1 protein_id gnl|my_center|LOCUS_20310 236200 235109 gene locus_tag LOCUS_20320 236200 235109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 236290 237279 gene locus_tag LOCUS_20330 236290 237279 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112329.1 protein_id gnl|my_center|LOCUS_20330 237282 237812 gene locus_tag LOCUS_20340 237282 237812 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226552.1 protein_id gnl|my_center|LOCUS_20340 239404 237839 gene locus_tag LOCUS_20350 239404 237839 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_20350 239537 240769 gene locus_tag LOCUS_20360 gene mshA 239537 240769 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_20360 242038 241028 gene locus_tag LOCUS_20370 242038 241028 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028601.1 protein_id gnl|my_center|LOCUS_20370 245193 242197 gene locus_tag LOCUS_20380 245193 242197 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093251335.1 protein_id gnl|my_center|LOCUS_20380 245381 246676 gene locus_tag LOCUS_20390 245381 246676 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742199.1 protein_id gnl|my_center|LOCUS_20390 247041 247823 gene locus_tag LOCUS_20400 247041 247823 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974888.1 protein_id gnl|my_center|LOCUS_20400 249177 247840 gene locus_tag LOCUS_20410 gene glnA 249177 247840 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_20410 250753 249239 gene locus_tag LOCUS_20420 gene zwf 250753 249239 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_20420 250951 252744 gene locus_tag LOCUS_20430 250951 252744 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208946.1 protein_id gnl|my_center|LOCUS_20430 253223 253924 gene locus_tag LOCUS_20440 253223 253924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 253945 254262 gene locus_tag LOCUS_20450 253945 254262 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726762.1 protein_id gnl|my_center|LOCUS_20450 254288 255250 gene locus_tag LOCUS_20460 254288 255250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 255272 256189 gene locus_tag LOCUS_20470 255272 256189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 257928 256387 gene locus_tag LOCUS_20480 257928 256387 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971553.1 protein_id gnl|my_center|LOCUS_20480 258504 258061 gene locus_tag LOCUS_20490 gene furA3 258504 258061 CDS product fur family transcriptional regulator FurA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731162.1 protein_id gnl|my_center|LOCUS_20490 258759 258571 gene locus_tag LOCUS_20500 258759 258571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 258781 259686 gene locus_tag LOCUS_20510 gene map 258781 259686 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_20510 260801 259977 gene locus_tag LOCUS_20520 260801 259977 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816565.1 protein_id gnl|my_center|LOCUS_20520 261605 261865 gene locus_tag LOCUS_20530 261605 261865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 261862 263370 gene locus_tag LOCUS_20540 261862 263370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 263367 264149 gene locus_tag LOCUS_20550 263367 264149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 265002 264202 gene locus_tag LOCUS_20560 265002 264202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 265040 265357 gene locus_tag LOCUS_20570 265040 265357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 265396 266169 gene locus_tag LOCUS_20580 265396 266169 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891742.1 protein_id gnl|my_center|LOCUS_20580 267810 266452 gene locus_tag LOCUS_20590 267810 266452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 270092 267897 gene locus_tag LOCUS_20600 270092 267897 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918421.1 protein_id gnl|my_center|LOCUS_20600 271774 270269 gene locus_tag LOCUS_20610 271774 270269 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223097.1 protein_id gnl|my_center|LOCUS_20610 272287 271787 gene locus_tag LOCUS_20620 272287 271787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20620 272886 272296 gene locus_tag LOCUS_20630 272886 272296 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223078.1 protein_id gnl|my_center|LOCUS_20630 272938 273348 gene locus_tag LOCUS_20640 272938 273348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 273391 274710 gene locus_tag LOCUS_20650 273391 274710 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084531.1 protein_id gnl|my_center|LOCUS_20650 274836 275534 gene locus_tag LOCUS_20660 274836 275534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 276087 275593 gene locus_tag LOCUS_20670 276087 275593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227671.1 protein_id gnl|my_center|LOCUS_20670 276662 276084 gene locus_tag LOCUS_20680 276662 276084 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229706.1 protein_id gnl|my_center|LOCUS_20680 277783 276659 gene locus_tag LOCUS_20690 277783 276659 CDS product acyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804514.1 protein_id gnl|my_center|LOCUS_20690 277710 279266 gene locus_tag LOCUS_20700 277710 279266 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930178.1 protein_id gnl|my_center|LOCUS_20700 279335 280483 gene locus_tag LOCUS_20710 gene corA 279335 280483 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916789.1 protein_id gnl|my_center|LOCUS_20710 280981 280484 gene locus_tag LOCUS_20720 280981 280484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 282015 281068 gene locus_tag LOCUS_20730 282015 281068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20730 282636 282040 gene locus_tag LOCUS_20740 282636 282040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20740 283345 282743 gene locus_tag LOCUS_20750 283345 282743 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225458.1 protein_id gnl|my_center|LOCUS_20750 283515 284246 gene locus_tag LOCUS_20760 283515 284246 CDS product DUF899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803748.1 protein_id gnl|my_center|LOCUS_20760 284243 284413 gene locus_tag LOCUS_20770 284243 284413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 285275 284640 gene locus_tag LOCUS_20780 285275 284640 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110169.1 protein_id gnl|my_center|LOCUS_20780 286348 285389 gene locus_tag LOCUS_20790 286348 285389 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969289.1 protein_id gnl|my_center|LOCUS_20790 286502 287911 gene locus_tag LOCUS_20800 gene zwf 286502 287911 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056390.1 protein_id gnl|my_center|LOCUS_20800 288024 289307 gene locus_tag LOCUS_20810 288024 289307 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_20810 289307 289906 gene locus_tag LOCUS_20820 289307 289906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 290006 291181 gene locus_tag LOCUS_20830 290006 291181 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_20830 291379 291203 gene locus_tag LOCUS_20840 291379 291203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 291903 291430 gene locus_tag LOCUS_20850 291903 291430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 293417 291900 gene locus_tag LOCUS_20860 293417 291900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 295086 293476 gene locus_tag LOCUS_20870 295086 293476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 295796 295083 gene locus_tag LOCUS_20880 gene sigE 295796 295083 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973830.1 protein_id gnl|my_center|LOCUS_20880 296965 296066 gene locus_tag LOCUS_20890 gene dapA 296965 296066 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_20890 297042 297713 gene locus_tag LOCUS_20900 297042 297713 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469700.1 protein_id gnl|my_center|LOCUS_20900 298974 297766 gene locus_tag LOCUS_20910 gene glgC 298974 297766 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467118.1 protein_id gnl|my_center|LOCUS_20910 299125 300312 gene locus_tag LOCUS_20920 gene glgA 299125 300312 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730300.1 protein_id gnl|my_center|LOCUS_20920 300535 300368 gene locus_tag LOCUS_20930 300535 300368 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222969.1 protein_id gnl|my_center|LOCUS_20930 300638 301477 gene locus_tag LOCUS_20940 300638 301477 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030081.1 protein_id gnl|my_center|LOCUS_20940 302171 301575 gene locus_tag LOCUS_20950 gene tag 302171 301575 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896489.1 protein_id gnl|my_center|LOCUS_20950 302633 302175 gene locus_tag LOCUS_20960 302633 302175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 302992 302630 gene locus_tag LOCUS_20970 302992 302630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 303755 303027 gene locus_tag LOCUS_20980 303755 303027 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222950.1 protein_id gnl|my_center|LOCUS_20980 304909 303809 gene locus_tag LOCUS_20990 gene dapE 304909 303809 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_20990 305167 304919 gene locus_tag LOCUS_21000 305167 304919 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639890.1 protein_id gnl|my_center|LOCUS_21000 305784 305167 gene locus_tag LOCUS_21010 305784 305167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 305867 306793 gene locus_tag LOCUS_21020 gene dapD 305867 306793 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898768.1 protein_id gnl|my_center|LOCUS_21020 306891 307769 gene locus_tag LOCUS_21030 306891 307769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804736.1 protein_id gnl|my_center|LOCUS_21030 309032 307866 gene locus_tag LOCUS_21040 309032 307866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 310296 309085 gene locus_tag LOCUS_21050 310296 309085 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230529.1 protein_id gnl|my_center|LOCUS_21050 311974 310277 gene locus_tag LOCUS_21060 311974 310277 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028566.1 protein_id gnl|my_center|LOCUS_21060 313229 312111 gene locus_tag LOCUS_21070 gene dapC 313229 312111 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730331.1 protein_id gnl|my_center|LOCUS_21070 313552 313226 gene locus_tag LOCUS_21080 313552 313226 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_21080 313660 314706 gene locus_tag LOCUS_21090 313660 314706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 315212 314694 gene locus_tag LOCUS_21100 315212 314694 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224396.1 protein_id gnl|my_center|LOCUS_21100 316162 315248 gene locus_tag LOCUS_21110 gene mshB 316162 315248 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089212260.1 protein_id gnl|my_center|LOCUS_21110 317294 316275 gene locus_tag LOCUS_21120 317294 316275 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229920.1 protein_id gnl|my_center|LOCUS_21120 318493 317291 gene locus_tag LOCUS_21130 318493 317291 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_21130 319499 318543 gene locus_tag LOCUS_21140 319499 318543 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229922.1 protein_id gnl|my_center|LOCUS_21140 320412 319492 gene locus_tag LOCUS_21150 320412 319492 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973859.1 protein_id gnl|my_center|LOCUS_21150 322166 320535 gene locus_tag LOCUS_21160 322166 320535 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014806.1 protein_id gnl|my_center|LOCUS_21160 324881 322392 gene locus_tag LOCUS_21170 gene pepN 324881 322392 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283751.1 protein_id gnl|my_center|LOCUS_21170 324975 326222 gene locus_tag LOCUS_21180 324975 326222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 326331 326699 gene locus_tag LOCUS_21190 326331 326699 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088462.1 protein_id gnl|my_center|LOCUS_21190 327918 326866 gene locus_tag LOCUS_21200 327918 326866 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777114.1 protein_id gnl|my_center|LOCUS_21200 329447 327915 gene locus_tag LOCUS_21210 329447 327915 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777115.1 protein_id gnl|my_center|LOCUS_21210 330180 329533 gene locus_tag LOCUS_21220 330180 329533 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728478.1 protein_id gnl|my_center|LOCUS_21220 331423 330248 gene locus_tag LOCUS_21230 331423 330248 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892417.1 protein_id gnl|my_center|LOCUS_21230 331549 331986 gene locus_tag LOCUS_21240 331549 331986 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222358.1 protein_id gnl|my_center|LOCUS_21240 332911 332003 gene locus_tag LOCUS_21250 332911 332003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 333963 332917 gene locus_tag LOCUS_21260 gene bchC 333963 332917 CDS product chlorophyll synthesis pathway protein BchC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390729.1 protein_id gnl|my_center|LOCUS_21260 334109 334954 gene locus_tag LOCUS_21270 334109 334954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228707.1 protein_id gnl|my_center|LOCUS_21270 336062 334989 gene locus_tag LOCUS_21280 gene ychF 336062 334989 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 protein_id gnl|my_center|LOCUS_21280 337398 336106 gene locus_tag LOCUS_21290 337398 336106 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285177.1 protein_id gnl|my_center|LOCUS_21290 337495 339048 gene locus_tag LOCUS_21300 337495 339048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 340384 339368 gene locus_tag LOCUS_21310 340384 339368 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296404.1 protein_id gnl|my_center|LOCUS_21310 340500 341714 gene locus_tag LOCUS_21320 gene xseA 340500 341714 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030027.1 protein_id gnl|my_center|LOCUS_21320 341721 341981 gene locus_tag LOCUS_21330 341721 341981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 343186 342215 gene locus_tag LOCUS_21340 343186 342215 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092179.1 protein_id gnl|my_center|LOCUS_21340 343272 343448 gene locus_tag LOCUS_21350 343272 343448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 343989 343435 gene locus_tag LOCUS_21360 343989 343435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 344078 345445 gene locus_tag LOCUS_21370 344078 345445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 346027 345473 gene locus_tag LOCUS_21380 346027 345473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 346602 346024 gene locus_tag LOCUS_21390 346602 346024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 347195 346599 gene locus_tag LOCUS_21400 347195 346599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 347326 348732 gene locus_tag LOCUS_21410 347326 348732 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_21410 349749 349042 gene locus_tag LOCUS_21420 349749 349042 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973948.1 protein_id gnl|my_center|LOCUS_21420 351175 349838 gene locus_tag LOCUS_21430 351175 349838 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_21430 352211 351444 gene locus_tag LOCUS_21440 352211 351444 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_21440 353186 352332 gene locus_tag LOCUS_21450 353186 352332 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270384.1 protein_id gnl|my_center|LOCUS_21450 353173 353325 gene locus_tag LOCUS_21460 353173 353325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 353559 354278 gene locus_tag LOCUS_21470 353559 354278 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_21470 356390 354306 gene locus_tag LOCUS_21480 356390 354306 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284173.1 protein_id gnl|my_center|LOCUS_21480 357219 356434 gene locus_tag LOCUS_21490 357219 356434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 357721 357410 gene locus_tag LOCUS_21500 357721 357410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 358684 357731 gene locus_tag LOCUS_21510 gene mca 358684 357731 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_21510 358798 359223 gene locus_tag LOCUS_21520 358798 359223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 359286 359798 gene locus_tag LOCUS_21530 gene greA 359286 359798 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974011.1 protein_id gnl|my_center|LOCUS_21530 360314 359901 gene locus_tag LOCUS_21540 360314 359901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 361354 360314 gene locus_tag LOCUS_21550 361354 360314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 361527 362045 gene locus_tag LOCUS_21560 361527 362045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 362045 363805 gene locus_tag LOCUS_21570 362045 363805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 364435 364217 gene locus_tag LOCUS_21580 364435 364217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 364320 365366 gene locus_tag LOCUS_21590 364320 365366 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084773.1 protein_id gnl|my_center|LOCUS_21590 366593 365454 gene locus_tag LOCUS_21600 366593 365454 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231015.1 protein_id gnl|my_center|LOCUS_21600 366723 368000 gene locus_tag LOCUS_21610 366723 368000 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728183.1 protein_id gnl|my_center|LOCUS_21610 367997 368719 gene locus_tag LOCUS_21620 367997 368719 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804387.1 protein_id gnl|my_center|LOCUS_21620 370130 368979 gene locus_tag LOCUS_21630 370130 368979 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229838.1 protein_id gnl|my_center|LOCUS_21630 370214 370897 gene locus_tag LOCUS_21640 gene msrA 370214 370897 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056729.1 protein_id gnl|my_center|LOCUS_21640 370900 371610 gene locus_tag LOCUS_21650 370900 371610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 372037 371615 gene locus_tag LOCUS_21660 372037 371615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775675.1 protein_id gnl|my_center|LOCUS_21660 372392 372030 gene locus_tag LOCUS_21670 372392 372030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 372631 372918 gene locus_tag LOCUS_21680 372631 372918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 372952 373638 gene locus_tag LOCUS_21690 372952 373638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 375012 373645 gene locus_tag LOCUS_21700 375012 373645 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229841.1 protein_id gnl|my_center|LOCUS_21700 376016 375138 gene locus_tag LOCUS_21710 376016 375138 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975728.1 protein_id gnl|my_center|LOCUS_21710 376824 376117 gene locus_tag LOCUS_21720 376824 376117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 377046 376973 gene locus_tag LOCUS_t00260 377046 376973 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 377141 378514 gene locus_tag LOCUS_21730 377141 378514 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388984.1 protein_id gnl|my_center|LOCUS_21730 380366 378552 gene locus_tag LOCUS_21740 380366 378552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 381546 380617 gene locus_tag LOCUS_21750 381546 380617 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_21750 382109 381543 gene locus_tag LOCUS_21760 382109 381543 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_21760 382827 382135 gene locus_tag LOCUS_21770 382827 382135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 384196 382916 gene locus_tag LOCUS_21780 gene eno 384196 382916 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_21780 384914 384690 gene locus_tag LOCUS_21790 384914 384690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 384802 385758 gene locus_tag LOCUS_21800 384802 385758 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229676.1 protein_id gnl|my_center|LOCUS_21800 385958 385737 gene locus_tag LOCUS_21810 385958 385737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 386017 387663 gene locus_tag LOCUS_21820 386017 387663 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223371.1 protein_id gnl|my_center|LOCUS_21820 387764 389290 gene locus_tag LOCUS_21830 387764 389290 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223372.1 protein_id gnl|my_center|LOCUS_21830 389385 389612 gene locus_tag LOCUS_21840 389385 389612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877644.1 protein_id gnl|my_center|LOCUS_21840 390075 391490 gene locus_tag LOCUS_21850 390075 391490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_21850 392139 391510 gene locus_tag LOCUS_21860 392139 391510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 392654 392136 gene locus_tag LOCUS_21870 392654 392136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 396387 392773 gene locus_tag LOCUS_21880 gene mfd 396387 392773 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_21880 396798 400592 gene locus_tag LOCUS_21890 396798 400592 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028569.1 protein_id gnl|my_center|LOCUS_21890 401333 400746 gene locus_tag LOCUS_21900 gene pth 401333 400746 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975689.1 protein_id gnl|my_center|LOCUS_21900 402075 401383 gene locus_tag LOCUS_21910 402075 401383 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405254.1 protein_id gnl|my_center|LOCUS_21910 403308 402331 gene locus_tag LOCUS_21920 403308 402331 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_21920 404924 403305 gene locus_tag LOCUS_21930 gene glmU 404924 403305 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929929.1 protein_id gnl|my_center|LOCUS_21930 405064 404985 gene locus_tag LOCUS_t00270 405064 404985 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 405228 405875 gene locus_tag LOCUS_21940 405228 405875 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 protein_id gnl|my_center|LOCUS_21940 405981 407219 gene locus_tag LOCUS_21950 405981 407219 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067341.1 protein_id gnl|my_center|LOCUS_21950 407235 407816 gene locus_tag LOCUS_21960 gene tamR 407235 407816 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_21960 409056 407839 gene locus_tag LOCUS_21970 409056 407839 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224039.1 protein_id gnl|my_center|LOCUS_21970 409993 409097 gene locus_tag LOCUS_21980 409993 409097 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405199.1 protein_id gnl|my_center|LOCUS_21980 410538 410098 gene locus_tag LOCUS_21990 410538 410098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 410854 410549 gene locus_tag LOCUS_22000 410854 410549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 411743 410877 gene locus_tag LOCUS_22010 gene rsmA 411743 410877 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_22010 412986 411847 gene locus_tag LOCUS_22020 412986 411847 CDS product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229978.1 protein_id gnl|my_center|LOCUS_22020 413826 413158 gene locus_tag LOCUS_22030 413826 413158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 414759 413839 gene locus_tag LOCUS_22040 414759 413839 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_22040 415034 414807 gene locus_tag LOCUS_22050 415034 414807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 416071 415199 gene locus_tag LOCUS_22060 gene rsmI 416071 415199 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_22060 416176 417816 gene locus_tag LOCUS_22070 416176 417816 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_22070 417992 418975 gene locus_tag LOCUS_22080 417992 418975 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138444.1 protein_id gnl|my_center|LOCUS_22080 419025 419984 gene locus_tag LOCUS_22090 419025 419984 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406607.1 protein_id gnl|my_center|LOCUS_22090 419981 422116 gene locus_tag LOCUS_22100 419981 422116 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_22100 422305 423984 gene locus_tag LOCUS_22110 422305 423984 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051713212.1 protein_id gnl|my_center|LOCUS_22110 424285 424797 gene locus_tag LOCUS_22120 424285 424797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 427927 424805 gene locus_tag LOCUS_22130 427927 424805 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226436.1 protein_id gnl|my_center|LOCUS_22130 428162 428995 gene locus_tag LOCUS_22140 428162 428995 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226372.1 protein_id gnl|my_center|LOCUS_22140 429752 429312 gene locus_tag LOCUS_22150 429752 429312 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223318.1 protein_id gnl|my_center|LOCUS_22150 429636 430340 gene locus_tag LOCUS_22160 429636 430340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 431130 430366 gene locus_tag LOCUS_22170 431130 430366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 431288 431587 gene locus_tag LOCUS_22180 431288 431587 CDS product ClpX C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226927.1 protein_id gnl|my_center|LOCUS_22180 431669 432055 gene locus_tag LOCUS_22190 431669 432055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 432173 433003 gene locus_tag LOCUS_22200 432173 433003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 433694 433008 gene locus_tag LOCUS_22210 433694 433008 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386325.1 protein_id gnl|my_center|LOCUS_22210 433968 433687 gene locus_tag LOCUS_22220 433968 433687 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973932.1 protein_id gnl|my_center|LOCUS_22220 435445 434039 gene locus_tag LOCUS_22230 435445 434039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 436388 435759 gene locus_tag LOCUS_22240 436388 435759 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223996.1 protein_id gnl|my_center|LOCUS_22240 436478 437224 gene locus_tag LOCUS_22250 436478 437224 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223997.1 protein_id gnl|my_center|LOCUS_22250 437727 437239 gene locus_tag LOCUS_22260 437727 437239 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728351.1 protein_id gnl|my_center|LOCUS_22260 438605 437775 gene locus_tag LOCUS_22270 438605 437775 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731321.1 protein_id gnl|my_center|LOCUS_22270 438535 439164 gene locus_tag LOCUS_22280 438535 439164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 440123 439194 gene locus_tag LOCUS_22290 440123 439194 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338360.1 protein_id gnl|my_center|LOCUS_22290 440857 440312 gene locus_tag LOCUS_22300 440857 440312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22300 440744 440965 gene locus_tag LOCUS_22310 440744 440965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 441139 441528 gene locus_tag LOCUS_22320 441139 441528 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229003.1 protein_id gnl|my_center|LOCUS_22320 441633 442058 gene locus_tag LOCUS_22330 441633 442058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 442504 442055 gene locus_tag LOCUS_22340 442504 442055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 443921 445588 gene locus_tag LOCUS_22350 443921 445588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 445684 446478 gene locus_tag LOCUS_22360 445684 446478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 446773 446698 gene locus_tag LOCUS_t00280 446773 446698 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 447668 446868 gene locus_tag LOCUS_22370 447668 446868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 448424 447786 gene locus_tag LOCUS_22380 448424 447786 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_22380 448915 448421 gene locus_tag LOCUS_22390 448915 448421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 449426 448908 gene locus_tag LOCUS_22400 gene moaC 449426 448908 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_22400 450758 449430 gene locus_tag LOCUS_22410 450758 449430 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_22410 450927 450769 gene locus_tag LOCUS_22420 450927 450769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 450863 451825 gene locus_tag LOCUS_22430 gene ligD 450863 451825 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226451.1 protein_id gnl|my_center|LOCUS_22430 452583 452032 gene locus_tag LOCUS_22440 452583 452032 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216858026.1 protein_id gnl|my_center|LOCUS_22440 452613 453038 gene locus_tag LOCUS_22450 452613 453038 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027487.1 protein_id gnl|my_center|LOCUS_22450 453044 453859 gene locus_tag LOCUS_22460 gene panB 453044 453859 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085258.1 protein_id gnl|my_center|LOCUS_22460 453867 454712 gene locus_tag LOCUS_22470 gene panC 453867 454712 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804902.1 protein_id gnl|my_center|LOCUS_22470 454709 455311 gene locus_tag LOCUS_22480 454709 455311 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028815.1 protein_id gnl|my_center|LOCUS_22480 456482 455379 gene locus_tag LOCUS_22490 456482 455379 CDS product ScyD/ScyE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092108067.1 protein_id gnl|my_center|LOCUS_22490 459956 456681 gene locus_tag LOCUS_22500 gene ileS 459956 456681 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224829.1 protein_id gnl|my_center|LOCUS_22500 460243 460947 gene locus_tag LOCUS_22510 460243 460947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 461523 461014 gene locus_tag LOCUS_22520 461523 461014 CDS product DUF664 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224874.1 protein_id gnl|my_center|LOCUS_22520 461665 462366 gene locus_tag LOCUS_22530 461665 462366 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532931.1 protein_id gnl|my_center|LOCUS_22530 465049 462419 gene locus_tag LOCUS_22540 465049 462419 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_22540 465171 465527 gene locus_tag LOCUS_22550 465171 465527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 465642 466331 gene locus_tag LOCUS_22560 465642 466331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 466489 466977 gene locus_tag LOCUS_22570 gene mscL 466489 466977 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063375.1 protein_id gnl|my_center|LOCUS_22570 467506 467135 gene locus_tag LOCUS_22580 467506 467135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 467602 468009 gene locus_tag LOCUS_22590 467602 468009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 468006 468629 gene locus_tag LOCUS_22600 468006 468629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 468685 469329 gene locus_tag LOCUS_22610 468685 469329 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015571.1 protein_id gnl|my_center|LOCUS_22610 470978 469599 gene locus_tag LOCUS_22620 470978 469599 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775783.1 protein_id gnl|my_center|LOCUS_22620 472119 471022 gene locus_tag LOCUS_22630 472119 471022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 472164 473498 gene locus_tag LOCUS_22640 472164 473498 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729172.1 protein_id gnl|my_center|LOCUS_22640 473575 473501 gene locus_tag LOCUS_t00290 473575 473501 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 474066 473689 gene locus_tag LOCUS_22650 gene trxA 474066 473689 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861174.1 protein_id gnl|my_center|LOCUS_22650 474420 474199 gene locus_tag LOCUS_22660 474420 474199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079856.1 protein_id gnl|my_center|LOCUS_22660 475283 474510 gene locus_tag LOCUS_22670 475283 474510 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211039796.1 protein_id gnl|my_center|LOCUS_22670 476078 475377 gene locus_tag LOCUS_22680 476078 475377 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_22680 476165 477571 gene locus_tag LOCUS_22690 476165 477571 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230152.1 protein_id gnl|my_center|LOCUS_22690 478593 477766 gene locus_tag LOCUS_22700 478593 477766 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225774.1 protein_id gnl|my_center|LOCUS_22700 479747 478590 gene locus_tag LOCUS_22710 gene nagA 479747 478590 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029554.1 protein_id gnl|my_center|LOCUS_22710 480721 479744 gene locus_tag LOCUS_22720 480721 479744 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228804.1 protein_id gnl|my_center|LOCUS_22720 481118 481783 gene locus_tag LOCUS_22730 481118 481783 CDS product acVLRF1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224727.1 protein_id gnl|my_center|LOCUS_22730 481893 482432 gene locus_tag LOCUS_22740 481893 482432 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223648.1 protein_id gnl|my_center|LOCUS_22740 483406 482756 gene locus_tag LOCUS_22750 gene pdxH 483406 482756 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_22750 483446 484582 gene locus_tag LOCUS_22760 gene serC 483446 484582 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897096.1 protein_id gnl|my_center|LOCUS_22760 484654 486321 gene locus_tag LOCUS_22770 484654 486321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 487673 486648 gene locus_tag LOCUS_22780 487673 486648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 488014 488676 gene locus_tag LOCUS_22790 488014 488676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 489579 488695 gene locus_tag LOCUS_22800 489579 488695 CDS product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729101.1 protein_id gnl|my_center|LOCUS_22800 491921 489684 gene locus_tag LOCUS_22810 491921 489684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 495452 492051 gene locus_tag LOCUS_22820 495452 492051 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027194.1 protein_id gnl|my_center|LOCUS_22820 496709 495924 gene locus_tag LOCUS_22830 496709 495924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 498210 496813 gene locus_tag LOCUS_22840 498210 496813 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_22840 498710 498207 gene locus_tag LOCUS_22850 498710 498207 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404606.1 protein_id gnl|my_center|LOCUS_22850 500417 499413 gene locus_tag LOCUS_22860 500417 499413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 501020 500511 gene locus_tag LOCUS_22870 gene tamR 501020 500511 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_22870 501873 501067 gene locus_tag LOCUS_22880 501873 501067 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974645.1 protein_id gnl|my_center|LOCUS_22880 502327 501944 gene locus_tag LOCUS_22890 502327 501944 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974650.1 protein_id gnl|my_center|LOCUS_22890 503406 502537 gene locus_tag LOCUS_22900 503406 502537 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972425.1 protein_id gnl|my_center|LOCUS_22900 503662 503438 gene locus_tag LOCUS_22910 503662 503438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 503613 505025 gene locus_tag LOCUS_22920 503613 505025 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_22920 505090 505458 gene locus_tag LOCUS_22930 505090 505458 CDS product CHY zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405189.1 protein_id gnl|my_center|LOCUS_22930 505505 506455 gene locus_tag LOCUS_22940 505505 506455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 506452 508674 gene locus_tag LOCUS_22950 506452 508674 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230251.1 protein_id gnl|my_center|LOCUS_22950 509083 508730 gene locus_tag LOCUS_22960 509083 508730 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971845.1 protein_id gnl|my_center|LOCUS_22960 509170 510816 gene locus_tag LOCUS_22970 509170 510816 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063651.1 protein_id gnl|my_center|LOCUS_22970 511056 510817 gene locus_tag LOCUS_22980 511056 510817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 511113 511394 gene locus_tag LOCUS_22990 511113 511394 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377064.1 protein_id gnl|my_center|LOCUS_22990 514308 511663 gene locus_tag LOCUS_23000 514308 511663 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_23000 514435 515073 gene locus_tag LOCUS_23010 514435 515073 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095879.1 protein_id gnl|my_center|LOCUS_23010 515391 515119 gene locus_tag LOCUS_23020 515391 515119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 515865 515605 gene locus_tag LOCUS_23030 515865 515605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 516439 515888 gene locus_tag LOCUS_23040 516439 515888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 516548 518653 gene locus_tag LOCUS_23050 516548 518653 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 protein_id gnl|my_center|LOCUS_23050 520109 519123 gene locus_tag LOCUS_23060 520109 519123 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226156.1 protein_id gnl|my_center|LOCUS_23060 520220 521605 gene locus_tag LOCUS_23070 520220 521605 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918269.1 protein_id gnl|my_center|LOCUS_23070 523019 522081 gene locus_tag LOCUS_23080 523019 522081 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863161.1 protein_id gnl|my_center|LOCUS_23080 523285 523016 gene locus_tag LOCUS_23090 523285 523016 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974664.1 protein_id gnl|my_center|LOCUS_23090 524015 523305 gene locus_tag LOCUS_23100 524015 523305 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029574.1 protein_id gnl|my_center|LOCUS_23100 525220 524012 gene locus_tag LOCUS_23110 525220 524012 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230328.1 protein_id gnl|my_center|LOCUS_23110 527045 525426 gene locus_tag LOCUS_23120 gene groL 527045 525426 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892307.1 protein_id gnl|my_center|LOCUS_23120 527327 528799 gene locus_tag LOCUS_23130 527327 528799 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_23130 529019 530308 gene locus_tag LOCUS_23140 529019 530308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 530363 530644 gene locus_tag LOCUS_23150 530363 530644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 531598 530693 gene locus_tag LOCUS_23160 531598 530693 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805101.1 protein_id gnl|my_center|LOCUS_23160 531588 532964 gene locus_tag LOCUS_23170 531588 532964 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975885.1 protein_id gnl|my_center|LOCUS_23170 532961 534484 gene locus_tag LOCUS_23180 532961 534484 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030033.1 protein_id gnl|my_center|LOCUS_23180 538062 534856 gene locus_tag LOCUS_23190 538062 534856 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053885.1 protein_id gnl|my_center|LOCUS_23190 539338 538106 gene locus_tag LOCUS_23200 539338 538106 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228178.1 protein_id gnl|my_center|LOCUS_23200 539458 541038 gene locus_tag LOCUS_23210 539458 541038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 541553 541359 gene locus_tag LOCUS_23220 541553 541359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 543717 541663 gene locus_tag LOCUS_23230 543717 541663 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228470.1 protein_id gnl|my_center|LOCUS_23230 544943 544044 gene locus_tag LOCUS_23240 544943 544044 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_23240 545669 544947 gene locus_tag LOCUS_23250 545669 544947 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_23250 546187 545669 gene locus_tag LOCUS_23260 546187 545669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 546081 546752 gene locus_tag LOCUS_23270 546081 546752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 547387 546770 gene locus_tag LOCUS_23280 547387 546770 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403741.1 protein_id gnl|my_center|LOCUS_23280 547487 548440 gene locus_tag LOCUS_23290 547487 548440 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223035.1 protein_id gnl|my_center|LOCUS_23290 548970 548431 gene locus_tag LOCUS_23300 548970 548431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816512.1 protein_id gnl|my_center|LOCUS_23300 549311 549036 gene locus_tag LOCUS_23310 549311 549036 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_23310 550600 549308 gene locus_tag LOCUS_23320 gene thrC 550600 549308 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228462.1 protein_id gnl|my_center|LOCUS_23320 551650 550856 gene locus_tag LOCUS_23330 551650 550856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 551745 552215 gene locus_tag LOCUS_23340 551745 552215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 553279 552191 gene locus_tag LOCUS_23350 553279 552191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 554088 553396 gene locus_tag LOCUS_23360 554088 553396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 554840 554124 gene locus_tag LOCUS_23370 gene ureG 554840 554124 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803979.1 protein_id gnl|my_center|LOCUS_23370 555653 554943 gene locus_tag LOCUS_23380 555653 554943 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729212.1 protein_id gnl|my_center|LOCUS_23380 557343 555640 gene locus_tag LOCUS_23390 557343 555640 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230175.1 protein_id gnl|my_center|LOCUS_23390 557728 557354 gene locus_tag LOCUS_23400 557728 557354 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230176.1 protein_id gnl|my_center|LOCUS_23400 558035 557730 gene locus_tag LOCUS_23410 558035 557730 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007605424.1 protein_id gnl|my_center|LOCUS_23410 558212 558979 gene locus_tag LOCUS_23420 558212 558979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 558976 559533 gene locus_tag LOCUS_23430 558976 559533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 559530 560555 gene locus_tag LOCUS_23440 559530 560555 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804471.1 protein_id gnl|my_center|LOCUS_23440 560552 561955 gene locus_tag LOCUS_23450 560552 561955 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804470.1 protein_id gnl|my_center|LOCUS_23450 561952 562605 gene locus_tag LOCUS_23460 561952 562605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 563355 562639 gene locus_tag LOCUS_23470 563355 562639 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081641.1 protein_id gnl|my_center|LOCUS_23470 564344 563373 gene locus_tag LOCUS_23480 564344 563373 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189232996.1 protein_id gnl|my_center|LOCUS_23480 564460 565050 gene locus_tag LOCUS_23490 564460 565050 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027648.1 protein_id gnl|my_center|LOCUS_23490 565443 565129 gene locus_tag LOCUS_23500 565443 565129 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402188.1 protein_id gnl|my_center|LOCUS_23500 565609 566661 gene locus_tag LOCUS_23510 565609 566661 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_23510 566671 567849 gene locus_tag LOCUS_23520 gene manA 566671 567849 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975786.1 protein_id gnl|my_center|LOCUS_23520 567947 568020 gene locus_tag LOCUS_t00300 567947 568020 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 568285 568034 gene locus_tag LOCUS_23530 568285 568034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 568709 568320 gene locus_tag LOCUS_23540 568709 568320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 569288 568914 gene locus_tag LOCUS_23550 569288 568914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 569377 569547 gene locus_tag LOCUS_23560 569377 569547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 569595 570191 gene locus_tag LOCUS_23570 569595 570191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 571160 570192 gene locus_tag LOCUS_23580 571160 570192 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029688.1 protein_id gnl|my_center|LOCUS_23580 571265 571696 gene locus_tag LOCUS_23590 571265 571696 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730388.1 protein_id gnl|my_center|LOCUS_23590 571823 572992 gene locus_tag LOCUS_23600 571823 572992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 573601 573032 gene locus_tag LOCUS_23610 gene erm(41) 573601 573032 CDS product 23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(41) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296532.1 protein_id gnl|my_center|LOCUS_23610 573735 575666 gene locus_tag LOCUS_23620 573735 575666 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_23620 575684 576892 gene locus_tag LOCUS_23630 575684 576892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 577535 576885 gene locus_tag LOCUS_23640 577535 576885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 577655 578260 gene locus_tag LOCUS_23650 577655 578260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 578337 579677 gene locus_tag LOCUS_23660 578337 579677 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200855.1 protein_id gnl|my_center|LOCUS_23660 580257 579790 gene locus_tag LOCUS_23670 580257 579790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 581404 580343 gene locus_tag LOCUS_23680 581404 580343 CDS product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775736.1 protein_id gnl|my_center|LOCUS_23680 581501 581854 gene locus_tag LOCUS_23690 581501 581854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 582190 581882 gene locus_tag LOCUS_23700 582190 581882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 582362 583135 gene locus_tag LOCUS_23710 582362 583135 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222671.1 protein_id gnl|my_center|LOCUS_23710 583132 584265 gene locus_tag LOCUS_23720 gene arsB 583132 584265 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265970.1 protein_id gnl|my_center|LOCUS_23720 584262 584684 gene locus_tag LOCUS_23730 584262 584684 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112739.1 protein_id gnl|my_center|LOCUS_23730 585654 584704 gene locus_tag LOCUS_23740 585654 584704 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225105.1 protein_id gnl|my_center|LOCUS_23740 586454 585651 gene locus_tag LOCUS_23750 586454 585651 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_23750 587998 586565 gene locus_tag LOCUS_23760 587998 586565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 588138 589055 gene locus_tag LOCUS_23770 588138 589055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 589146 590015 gene locus_tag LOCUS_23780 589146 590015 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803678.1 protein_id gnl|my_center|LOCUS_23780 590589 590020 gene locus_tag LOCUS_23790 590589 590020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 591091 590735 gene locus_tag LOCUS_23800 591091 590735 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028740.1 protein_id gnl|my_center|LOCUS_23800 594030 591232 gene locus_tag LOCUS_23810 594030 591232 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223297.1 protein_id gnl|my_center|LOCUS_23810 595426 594074 gene locus_tag LOCUS_23820 595426 594074 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223296.1 protein_id gnl|my_center|LOCUS_23820 596472 595423 gene locus_tag LOCUS_23830 596472 595423 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223295.1 protein_id gnl|my_center|LOCUS_23830 597910 596615 gene locus_tag LOCUS_23840 597910 596615 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_23840 599259 597907 gene locus_tag LOCUS_23850 599259 597907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 599421 599942 gene locus_tag LOCUS_23860 599421 599942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 600003 601148 gene locus_tag LOCUS_23870 gene iroB 600003 601148 CDS product salmochelin biosynthesis C-glycosyltransferase IroB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703469.1 protein_id gnl|my_center|LOCUS_23870 601188 601658 gene locus_tag LOCUS_23880 601188 601658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 601860 601645 gene locus_tag LOCUS_23890 601860 601645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 602138 601857 gene locus_tag LOCUS_23900 602138 601857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 602232 602924 gene locus_tag LOCUS_23910 602232 602924 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027476.1 protein_id gnl|my_center|LOCUS_23910 603017 604303 gene locus_tag LOCUS_23920 603017 604303 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026817.1 protein_id gnl|my_center|LOCUS_23920 604305 606539 gene locus_tag LOCUS_23930 604305 606539 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027130.1 protein_id gnl|my_center|LOCUS_23930 606584 607390 gene locus_tag LOCUS_23940 606584 607390 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894754.1 protein_id gnl|my_center|LOCUS_23940 607541 609700 gene locus_tag LOCUS_23950 607541 609700 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225566.1 protein_id gnl|my_center|LOCUS_23950 610599 609757 gene locus_tag LOCUS_23960 gene thiD 610599 609757 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534771.1 protein_id gnl|my_center|LOCUS_23960 611258 610596 gene locus_tag LOCUS_23970 gene thiE 611258 610596 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338387.1 protein_id gnl|my_center|LOCUS_23970 612091 611255 gene locus_tag LOCUS_23980 gene thiM 612091 611255 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014383.1 protein_id gnl|my_center|LOCUS_23980 613285 612251 gene locus_tag LOCUS_23990 613285 612251 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226304.1 protein_id gnl|my_center|LOCUS_23990 614628 613357 gene locus_tag LOCUS_24000 614628 613357 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479765.1 protein_id gnl|my_center|LOCUS_24000 615812 614646 gene locus_tag LOCUS_24010 615812 614646 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224293.1 protein_id gnl|my_center|LOCUS_24010 616988 615840 gene locus_tag LOCUS_24020 gene dgoD 616988 615840 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731095.1 protein_id gnl|my_center|LOCUS_24020 617901 617002 gene locus_tag LOCUS_24030 gene hpaI 617901 617002 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228326.1 protein_id gnl|my_center|LOCUS_24030 618830 617898 gene locus_tag LOCUS_24040 gene kdgK 618830 617898 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229211.1 protein_id gnl|my_center|LOCUS_24040 620337 618913 gene locus_tag LOCUS_24050 620337 618913 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088030.1 protein_id gnl|my_center|LOCUS_24050 620508 622046 gene locus_tag LOCUS_24060 620508 622046 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804270.1 protein_id gnl|my_center|LOCUS_24060 623233 622166 gene locus_tag LOCUS_24070 623233 622166 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804511.1 protein_id gnl|my_center|LOCUS_24070 623568 623245 gene locus_tag LOCUS_24080 623568 623245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803871.1 protein_id gnl|my_center|LOCUS_24080 623621 625063 gene locus_tag LOCUS_24090 623621 625063 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404498.1 protein_id gnl|my_center|LOCUS_24090 625874 625101 gene locus_tag LOCUS_24100 625874 625101 CDS product D-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729199.1 protein_id gnl|my_center|LOCUS_24100 626809 625931 gene locus_tag LOCUS_24110 626809 625931 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172171.1 protein_id gnl|my_center|LOCUS_24110 627712 626816 gene locus_tag LOCUS_24120 627712 626816 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930125.1 protein_id gnl|my_center|LOCUS_24120 627976 629469 gene locus_tag LOCUS_24130 627976 629469 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030610791.1 protein_id gnl|my_center|LOCUS_24130 629466 631943 gene locus_tag LOCUS_24140 gene xdhB 629466 631943 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974005.1 protein_id gnl|my_center|LOCUS_24140 631954 632958 gene locus_tag LOCUS_24150 gene xdhC 631954 632958 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029981.1 protein_id gnl|my_center|LOCUS_24150 632955 634307 gene locus_tag LOCUS_24160 gene guaD 632955 634307 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889440.1 protein_id gnl|my_center|LOCUS_24160 634304 635707 gene locus_tag LOCUS_24170 634304 635707 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889443.1 protein_id gnl|my_center|LOCUS_24170 635895 636755 gene locus_tag LOCUS_24180 635895 636755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 637717 636836 gene locus_tag LOCUS_24190 637717 636836 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812528.1 protein_id gnl|my_center|LOCUS_24190 638579 637740 gene locus_tag LOCUS_24200 638579 637740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 639760 638576 gene locus_tag LOCUS_24210 639760 638576 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_24210 639895 640932 gene locus_tag LOCUS_24220 639895 640932 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168512796.1 protein_id gnl|my_center|LOCUS_24220 641140 643302 gene locus_tag LOCUS_24230 641140 643302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 645100 643256 gene locus_tag LOCUS_24240 645100 643256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 645315 645437 gene locus_tag LOCUS_24250 gene ykgO 645315 645437 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857945.1 protein_id gnl|my_center|LOCUS_24250 646700 645519 gene locus_tag LOCUS_24260 646700 645519 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_24260 647730 646702 gene locus_tag LOCUS_24270 gene tdh 647730 646702 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031190.1 protein_id gnl|my_center|LOCUS_24270 649126 647786 gene locus_tag LOCUS_24280 649126 647786 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 protein_id gnl|my_center|LOCUS_24280 649237 650673 gene locus_tag LOCUS_24290 gene uxaC 649237 650673 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777068.1 protein_id gnl|my_center|LOCUS_24290 650670 652049 gene locus_tag LOCUS_24300 650670 652049 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538275.1 protein_id gnl|my_center|LOCUS_24300 653074 652073 gene locus_tag LOCUS_24310 653074 652073 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168512796.1 protein_id gnl|my_center|LOCUS_24310 653139 654977 gene locus_tag LOCUS_24320 gene uidA 653139 654977 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945897.1 protein_id gnl|my_center|LOCUS_24320 655018 655662 gene locus_tag LOCUS_24330 655018 655662 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727949.1 protein_id gnl|my_center|LOCUS_24330 655794 657968 gene locus_tag LOCUS_24340 655794 657968 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228529.1 protein_id gnl|my_center|LOCUS_24340 658134 659957 gene locus_tag LOCUS_24350 658134 659957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 660019 661416 gene locus_tag LOCUS_24360 660019 661416 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223712.1 protein_id gnl|my_center|LOCUS_24360 661544 662635 gene locus_tag LOCUS_24370 gene ugpC 661544 662635 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804887.1 protein_id gnl|my_center|LOCUS_24370 662724 664100 gene locus_tag LOCUS_24380 662724 664100 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804886.1 protein_id gnl|my_center|LOCUS_24380 664216 665112 gene locus_tag LOCUS_24390 664216 665112 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031009.1 protein_id gnl|my_center|LOCUS_24390 665273 666076 gene locus_tag LOCUS_24400 665273 666076 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224195.1 protein_id gnl|my_center|LOCUS_24400 666100 667107 gene locus_tag LOCUS_24410 666100 667107 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027928.1 protein_id gnl|my_center|LOCUS_24410 668215 666992 gene locus_tag LOCUS_24420 668215 666992 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031767.1 protein_id gnl|my_center|LOCUS_24420 668602 668324 gene locus_tag LOCUS_24430 668602 668324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 669479 668706 gene locus_tag LOCUS_24440 669479 668706 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_24440 670671 669460 gene locus_tag LOCUS_24450 670671 669460 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230156.1 protein_id gnl|my_center|LOCUS_24450 670800 671486 gene locus_tag LOCUS_24460 670800 671486 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230155.1 protein_id gnl|my_center|LOCUS_24460 671544 671963 gene locus_tag LOCUS_24470 671544 671963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 672040 673470 gene locus_tag LOCUS_24480 gene cysS 672040 673470 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_24480 673473 674444 gene locus_tag LOCUS_24490 gene rlmB 673473 674444 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230407.1 protein_id gnl|my_center|LOCUS_24490 674538 676184 gene locus_tag LOCUS_24500 674538 676184 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246447.1 protein_id gnl|my_center|LOCUS_24500 676239 677705 gene locus_tag LOCUS_24510 676239 677705 CDS product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171512914.1 protein_id gnl|my_center|LOCUS_24510 678796 678023 gene locus_tag LOCUS_24520 678796 678023 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229721.1 protein_id gnl|my_center|LOCUS_24520 679321 678878 gene locus_tag LOCUS_24530 679321 678878 CDS product DUF4188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030304.1 protein_id gnl|my_center|LOCUS_24530 679437 680060 gene locus_tag LOCUS_24540 679437 680060 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312123.1 protein_id gnl|my_center|LOCUS_24540 680162 680545 gene locus_tag LOCUS_24550 680162 680545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 680646 682175 gene locus_tag LOCUS_24560 680646 682175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 683654 682188 gene locus_tag LOCUS_24570 683654 682188 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484182.1 protein_id gnl|my_center|LOCUS_24570 685469 683703 gene locus_tag LOCUS_24580 685469 683703 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223053.1 protein_id gnl|my_center|LOCUS_24580 685601 686635 gene locus_tag LOCUS_24590 685601 686635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 686755 686907 gene locus_tag LOCUS_24600 686755 686907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 687440 686964 gene locus_tag LOCUS_24610 gene ispF 687440 686964 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731018.1 protein_id gnl|my_center|LOCUS_24610 688146 687433 gene locus_tag LOCUS_24620 gene ispD 688146 687433 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029521.1 protein_id gnl|my_center|LOCUS_24620 688718 688233 gene locus_tag LOCUS_24630 688718 688233 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003953493.1 protein_id gnl|my_center|LOCUS_24630 688925 689506 gene locus_tag LOCUS_24640 688925 689506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 690481 689522 gene locus_tag LOCUS_24650 690481 689522 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027351.1 protein_id gnl|my_center|LOCUS_24650 690558 691370 gene locus_tag LOCUS_24660 690558 691370 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531321.1 protein_id gnl|my_center|LOCUS_24660 <691988 691433 gene locus_tag LOCUS_24670 <691988 691433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011742113.1:two-component sensory transduction protein RegX >Feature sequence4 349 2358 gene locus_tag LOCUS_24680 349 2358 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093687.1 protein_id gnl|my_center|LOCUS_24680 2355 3581 gene locus_tag LOCUS_24690 2355 3581 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224485.1 protein_id gnl|my_center|LOCUS_24690 3816 4109 gene locus_tag LOCUS_24700 3816 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 4120 4830 gene locus_tag LOCUS_24710 4120 4830 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229800.1 protein_id gnl|my_center|LOCUS_24710 4802 6277 gene locus_tag LOCUS_24720 4802 6277 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230391.1 protein_id gnl|my_center|LOCUS_24720 7276 6302 gene locus_tag LOCUS_24730 7276 6302 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_24730 7427 10216 gene locus_tag LOCUS_24740 gene acnA 7427 10216 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_24740 10563 10339 gene locus_tag LOCUS_24750 10563 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 10665 11180 gene locus_tag LOCUS_24760 10665 11180 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002136.1 protein_id gnl|my_center|LOCUS_24760 11451 11152 gene locus_tag LOCUS_24770 11451 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 13148 11478 gene locus_tag LOCUS_24780 13148 11478 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_24780 13767 13297 gene locus_tag LOCUS_24790 13767 13297 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_24790 13896 14081 gene locus_tag LOCUS_24800 13896 14081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 14078 14848 gene locus_tag LOCUS_24810 14078 14848 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026914.1 protein_id gnl|my_center|LOCUS_24810 14845 16503 gene locus_tag LOCUS_24820 14845 16503 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225919.1 protein_id gnl|my_center|LOCUS_24820 17557 16508 gene locus_tag LOCUS_24830 17557 16508 CDS product DUF5914 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026912.1 protein_id gnl|my_center|LOCUS_24830 18555 17554 gene locus_tag LOCUS_24840 18555 17554 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026911.1 protein_id gnl|my_center|LOCUS_24840 20030 18552 gene locus_tag LOCUS_24850 gene crtI 20030 18552 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728283.1 protein_id gnl|my_center|LOCUS_24850 21423 20206 gene locus_tag LOCUS_24860 21423 20206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 22141 21428 gene locus_tag LOCUS_24870 22141 21428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 22268 22657 gene locus_tag LOCUS_24880 22268 22657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 22683 24626 gene locus_tag LOCUS_24890 gene dxs 22683 24626 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081956.1 protein_id gnl|my_center|LOCUS_24890 24640 25056 gene locus_tag LOCUS_24900 24640 25056 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229329.1 protein_id gnl|my_center|LOCUS_24900 26081 25311 gene locus_tag LOCUS_24910 26081 25311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 27010 26153 gene locus_tag LOCUS_24920 27010 26153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 29297 27144 gene locus_tag LOCUS_24930 29297 27144 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030602.1 protein_id gnl|my_center|LOCUS_24930 30487 29294 gene locus_tag LOCUS_24940 30487 29294 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224501.1 protein_id gnl|my_center|LOCUS_24940 31921 30563 gene locus_tag LOCUS_24950 31921 30563 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_24950 32526 31918 gene locus_tag LOCUS_24960 32526 31918 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030605.1 protein_id gnl|my_center|LOCUS_24960 32643 33758 gene locus_tag LOCUS_24970 gene hemE 32643 33758 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_24970 33778 35247 gene locus_tag LOCUS_24980 gene hemG 33778 35247 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_24980 35285 35983 gene locus_tag LOCUS_24990 35285 35983 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 protein_id gnl|my_center|LOCUS_24990 36541 36104 gene locus_tag LOCUS_25000 gene msrB 36541 36104 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224520.1 protein_id gnl|my_center|LOCUS_25000 36655 37737 gene locus_tag LOCUS_25010 gene ligD 36655 37737 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_25010 39041 37881 gene locus_tag LOCUS_25020 39041 37881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 39264 40064 gene locus_tag LOCUS_25030 39264 40064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 40081 40635 gene locus_tag LOCUS_25040 40081 40635 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284042.1 protein_id gnl|my_center|LOCUS_25040 40815 41711 gene locus_tag LOCUS_25050 40815 41711 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114171.1 protein_id gnl|my_center|LOCUS_25050 42519 41716 gene locus_tag LOCUS_25060 42519 41716 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224546.1 protein_id gnl|my_center|LOCUS_25060 42604 43482 gene locus_tag LOCUS_25070 42604 43482 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112196.1 protein_id gnl|my_center|LOCUS_25070 44428 43610 gene locus_tag LOCUS_25080 44428 43610 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084991.1 protein_id gnl|my_center|LOCUS_25080 45094 44444 gene locus_tag LOCUS_25090 gene cysC 45094 44444 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164276380.1 protein_id gnl|my_center|LOCUS_25090 45879 45076 gene locus_tag LOCUS_25100 45879 45076 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084994.1 protein_id gnl|my_center|LOCUS_25100 47773 46076 gene locus_tag LOCUS_25110 47773 46076 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228431.1 protein_id gnl|my_center|LOCUS_25110 49196 48036 gene locus_tag LOCUS_25120 49196 48036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 51361 49550 gene locus_tag LOCUS_25130 51361 49550 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157683565.1 protein_id gnl|my_center|LOCUS_25130 53466 51631 gene locus_tag LOCUS_25140 53466 51631 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157683565.1 protein_id gnl|my_center|LOCUS_25140 54660 53698 gene locus_tag LOCUS_25150 54660 53698 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082376.1 protein_id gnl|my_center|LOCUS_25150 54775 55374 gene locus_tag LOCUS_25160 54775 55374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 56174 55398 gene locus_tag LOCUS_25170 56174 55398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 56673 57350 gene locus_tag LOCUS_25180 56673 57350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 57418 58137 gene locus_tag LOCUS_25190 57418 58137 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062896.1 protein_id gnl|my_center|LOCUS_25190 58936 58181 gene locus_tag LOCUS_25200 58936 58181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 59582 58941 gene locus_tag LOCUS_25210 59582 58941 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970091.1 protein_id gnl|my_center|LOCUS_25210 59765 60919 gene locus_tag LOCUS_25220 59765 60919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25220 61030 61785 gene locus_tag LOCUS_25230 61030 61785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 62020 61775 gene locus_tag LOCUS_25240 62020 61775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 61917 63194 gene locus_tag LOCUS_25250 61917 63194 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029671.1 protein_id gnl|my_center|LOCUS_25250 65129 63222 gene locus_tag LOCUS_25260 65129 63222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 65294 67879 gene locus_tag LOCUS_25270 65294 67879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 68000 68572 gene locus_tag LOCUS_25280 68000 68572 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258313.1 protein_id gnl|my_center|LOCUS_25280 68604 69527 gene locus_tag LOCUS_25290 68604 69527 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957882.1 protein_id gnl|my_center|LOCUS_25290 69670 69597 gene locus_tag LOCUS_t00310 69670 69597 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 69787 69716 gene locus_tag LOCUS_t00320 69787 69716 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 69897 69824 gene locus_tag LOCUS_t00330 69897 69824 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 70023 70949 gene locus_tag LOCUS_25300 70023 70949 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_25300 71046 71119 gene locus_tag LOCUS_t00340 71046 71119 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 71286 71585 gene locus_tag LOCUS_25310 71286 71585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 71605 71811 gene locus_tag LOCUS_25320 71605 71811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 71811 72521 gene locus_tag LOCUS_25330 71811 72521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 73501 73058 gene locus_tag LOCUS_25340 73501 73058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 77852 73506 gene locus_tag LOCUS_25350 77852 73506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 78434 78051 gene locus_tag LOCUS_25360 78434 78051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 78700 78431 gene locus_tag LOCUS_25370 78700 78431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 79689 78715 gene locus_tag LOCUS_25380 79689 78715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 80069 79686 gene locus_tag LOCUS_25390 80069 79686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 80437 80066 gene locus_tag LOCUS_25400 80437 80066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 81474 80434 gene locus_tag LOCUS_25410 81474 80434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 81719 81471 gene locus_tag LOCUS_25420 81719 81471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 82111 81716 gene locus_tag LOCUS_25430 82111 81716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 82296 82108 gene locus_tag LOCUS_25440 82296 82108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 83858 82629 gene locus_tag LOCUS_25450 83858 82629 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_25450 84149 85216 gene locus_tag LOCUS_25460 84149 85216 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081140.1 protein_id gnl|my_center|LOCUS_25460 85248 86444 gene locus_tag LOCUS_25470 85248 86444 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013383.1 protein_id gnl|my_center|LOCUS_25470 86473 87228 gene locus_tag LOCUS_25480 86473 87228 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359767.1 protein_id gnl|my_center|LOCUS_25480 88265 87411 gene locus_tag LOCUS_25490 88265 87411 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225947.1 protein_id gnl|my_center|LOCUS_25490 88419 89822 gene locus_tag LOCUS_25500 88419 89822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 89940 91964 gene locus_tag LOCUS_25510 gene thrS 89940 91964 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804992.1 protein_id gnl|my_center|LOCUS_25510 91964 92521 gene locus_tag LOCUS_25520 91964 92521 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804993.1 protein_id gnl|my_center|LOCUS_25520 92521 93147 gene locus_tag LOCUS_25530 92521 93147 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_25530 93140 94141 gene locus_tag LOCUS_25540 93140 94141 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_25540 94138 95547 gene locus_tag LOCUS_25550 94138 95547 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_25550 95544 96362 gene locus_tag LOCUS_25560 95544 96362 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977439.1 protein_id gnl|my_center|LOCUS_25560 96359 96691 gene locus_tag LOCUS_25570 96359 96691 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977440.1 protein_id gnl|my_center|LOCUS_25570 96684 97580 gene locus_tag LOCUS_25580 96684 97580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 97717 98109 gene locus_tag LOCUS_25590 gene gcvH 97717 98109 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079361.1 protein_id gnl|my_center|LOCUS_25590 98244 98621 gene locus_tag LOCUS_25600 98244 98621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 98720 99502 gene locus_tag LOCUS_25610 98720 99502 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027756.1 protein_id gnl|my_center|LOCUS_25610 99609 100136 gene locus_tag LOCUS_25620 99609 100136 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_25620 100198 101163 gene locus_tag LOCUS_25630 100198 101163 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296810.1 protein_id gnl|my_center|LOCUS_25630 101443 102048 gene locus_tag LOCUS_25640 101443 102048 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_25640 102294 105329 gene locus_tag LOCUS_25650 gene gcvP 102294 105329 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_25650 105730 105449 gene locus_tag LOCUS_25660 105730 105449 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057662.1 protein_id gnl|my_center|LOCUS_25660 105899 106873 gene locus_tag LOCUS_25670 105899 106873 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227663.1 protein_id gnl|my_center|LOCUS_25670 106966 107631 gene locus_tag LOCUS_25680 106966 107631 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730369.1 protein_id gnl|my_center|LOCUS_25680 107714 108799 gene locus_tag LOCUS_25690 107714 108799 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104175.1 protein_id gnl|my_center|LOCUS_25690 108858 109310 gene locus_tag LOCUS_25700 108858 109310 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085555.1 protein_id gnl|my_center|LOCUS_25700 109396 110586 gene locus_tag LOCUS_25710 gene yhjD 109396 110586 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157374.1 protein_id gnl|my_center|LOCUS_25710 112029 110824 gene locus_tag LOCUS_25720 112029 110824 CDS product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922349.1 protein_id gnl|my_center|LOCUS_25720 111935 112159 gene locus_tag LOCUS_25730 111935 112159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 112753 112178 gene locus_tag LOCUS_25740 gene soxR 112753 112178 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224136.1 protein_id gnl|my_center|LOCUS_25740 112746 113579 gene locus_tag LOCUS_25750 112746 113579 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027324.1 protein_id gnl|my_center|LOCUS_25750 113603 114280 gene locus_tag LOCUS_25760 113603 114280 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479568.1 protein_id gnl|my_center|LOCUS_25760 114303 114923 gene locus_tag LOCUS_25770 114303 114923 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328048.1 protein_id gnl|my_center|LOCUS_25770 116441 114954 gene locus_tag LOCUS_25780 116441 114954 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224038.1 protein_id gnl|my_center|LOCUS_25780 116498 117307 gene locus_tag LOCUS_25790 116498 117307 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417461.1 protein_id gnl|my_center|LOCUS_25790 118820 117309 gene locus_tag LOCUS_25800 118820 117309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 119031 119807 gene locus_tag LOCUS_25810 119031 119807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 119804 121798 gene locus_tag LOCUS_25820 119804 121798 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_25820 121958 122800 gene locus_tag LOCUS_25830 121958 122800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 124085 122715 gene locus_tag LOCUS_25840 124085 122715 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227373.1 protein_id gnl|my_center|LOCUS_25840 124529 124191 gene locus_tag LOCUS_25850 124529 124191 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112420.1 protein_id gnl|my_center|LOCUS_25850 124692 126575 gene locus_tag LOCUS_25860 124692 126575 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971639.1 protein_id gnl|my_center|LOCUS_25860 127748 126606 gene locus_tag LOCUS_25870 127748 126606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 129642 127900 gene locus_tag LOCUS_25880 129642 127900 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528172.1 protein_id gnl|my_center|LOCUS_25880 129743 130168 gene locus_tag LOCUS_25890 129743 130168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 130181 130681 gene locus_tag LOCUS_25900 130181 130681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 130681 131598 gene locus_tag LOCUS_25910 130681 131598 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803914.1 protein_id gnl|my_center|LOCUS_25910 131616 132338 gene locus_tag LOCUS_25920 131616 132338 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975536.1 protein_id gnl|my_center|LOCUS_25920 133280 132441 gene locus_tag LOCUS_25930 133280 132441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 135746 133347 gene locus_tag LOCUS_25940 135746 133347 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224401.1 protein_id gnl|my_center|LOCUS_25940 135828 136349 gene locus_tag LOCUS_25950 135828 136349 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119171.1 protein_id gnl|my_center|LOCUS_25950 137139 136375 gene locus_tag LOCUS_25960 137139 136375 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897426.1 protein_id gnl|my_center|LOCUS_25960 137230 137628 gene locus_tag LOCUS_25970 137230 137628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 138515 137625 gene locus_tag LOCUS_25980 138515 137625 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222911.1 protein_id gnl|my_center|LOCUS_25980 140284 138602 gene locus_tag LOCUS_25990 140284 138602 CDS product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950891.1 protein_id gnl|my_center|LOCUS_25990 141011 140427 gene locus_tag LOCUS_26000 141011 140427 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406064.1 protein_id gnl|my_center|LOCUS_26000 141269 142702 gene locus_tag LOCUS_26010 141269 142702 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_26010 142713 143768 gene locus_tag LOCUS_26020 142713 143768 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031126.1 protein_id gnl|my_center|LOCUS_26020 145308 143917 gene locus_tag LOCUS_26030 gene lpdA 145308 143917 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283919.1 protein_id gnl|my_center|LOCUS_26030 145618 145295 gene locus_tag LOCUS_26040 145618 145295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 145502 147028 gene locus_tag LOCUS_26050 145502 147028 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972925.1 protein_id gnl|my_center|LOCUS_26050 147974 147120 gene locus_tag LOCUS_26060 gene pdxY 147974 147120 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_26060 148044 148940 gene locus_tag LOCUS_26070 148044 148940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 149289 149963 gene locus_tag LOCUS_26080 149289 149963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 150049 150855 gene locus_tag LOCUS_26090 150049 150855 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180933263.1 protein_id gnl|my_center|LOCUS_26090 150852 152201 gene locus_tag LOCUS_26100 150852 152201 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015250.1 protein_id gnl|my_center|LOCUS_26100 152267 152662 gene locus_tag LOCUS_26110 152267 152662 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977404.1 protein_id gnl|my_center|LOCUS_26110 153317 152748 gene locus_tag LOCUS_26120 153317 152748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 154217 153432 gene locus_tag LOCUS_26130 154217 153432 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_26130 156049 154214 gene locus_tag LOCUS_26140 gene lnt 156049 154214 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109789858.1 protein_id gnl|my_center|LOCUS_26140 156562 156059 gene locus_tag LOCUS_26150 156562 156059 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_26150 156588 157553 gene locus_tag LOCUS_26160 156588 157553 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_26160 159527 157929 gene locus_tag LOCUS_26170 159527 157929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 163378 159524 gene locus_tag LOCUS_26180 163378 159524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 165050 163470 gene locus_tag LOCUS_26190 165050 163470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 165484 169227 gene locus_tag LOCUS_26200 165484 169227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 169391 173290 gene locus_tag LOCUS_26210 169391 173290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 176121 173587 gene locus_tag LOCUS_26220 176121 173587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 176290 177774 gene locus_tag LOCUS_26230 176290 177774 CDS product bifunctional cytidylyltransferase/SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107920.1 protein_id gnl|my_center|LOCUS_26230 179253 177844 gene locus_tag LOCUS_26240 179253 177844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 180081 179467 gene locus_tag LOCUS_26250 180081 179467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 180564 180115 gene locus_tag LOCUS_26260 180564 180115 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226091.1 protein_id gnl|my_center|LOCUS_26260 180807 181409 gene locus_tag LOCUS_26270 180807 181409 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721280.1 protein_id gnl|my_center|LOCUS_26270 182749 181454 gene locus_tag LOCUS_26280 182749 181454 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229595.1 protein_id gnl|my_center|LOCUS_26280 182813 183265 gene locus_tag LOCUS_26290 182813 183265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 183593 184780 gene locus_tag LOCUS_26300 183593 184780 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226129.1 protein_id gnl|my_center|LOCUS_26300 184777 185748 gene locus_tag LOCUS_26310 184777 185748 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123665.1 protein_id gnl|my_center|LOCUS_26310 185809 186702 gene locus_tag LOCUS_26320 185809 186702 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036279.1 protein_id gnl|my_center|LOCUS_26320 187909 186881 gene locus_tag LOCUS_26330 187909 186881 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030720.1 protein_id gnl|my_center|LOCUS_26330 188086 189468 gene locus_tag LOCUS_26340 188086 189468 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225106.1 protein_id gnl|my_center|LOCUS_26340 189572 190465 gene locus_tag LOCUS_26350 189572 190465 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225105.1 protein_id gnl|my_center|LOCUS_26350 190462 191421 gene locus_tag LOCUS_26360 190462 191421 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150923540.1 protein_id gnl|my_center|LOCUS_26360 191471 191959 gene locus_tag LOCUS_26370 191471 191959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 194464 191999 gene locus_tag LOCUS_26380 194464 191999 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729203.1 protein_id gnl|my_center|LOCUS_26380 194805 195389 gene locus_tag LOCUS_26390 194805 195389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 195907 195500 gene locus_tag LOCUS_26400 195907 195500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 197415 195904 gene locus_tag LOCUS_26410 197415 195904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 197846 198865 gene locus_tag LOCUS_26420 197846 198865 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775776.1 protein_id gnl|my_center|LOCUS_26420 198862 201534 gene locus_tag LOCUS_26430 198862 201534 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775775.1 protein_id gnl|my_center|LOCUS_26430 201645 202631 gene locus_tag LOCUS_26440 201645 202631 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775774.1 protein_id gnl|my_center|LOCUS_26440 202628 203710 gene locus_tag LOCUS_26450 gene splB 202628 203710 CDS product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879610.1 protein_id gnl|my_center|LOCUS_26450 205083 203743 gene locus_tag LOCUS_26460 205083 203743 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729999.1 protein_id gnl|my_center|LOCUS_26460 205988 205083 gene locus_tag LOCUS_26470 205988 205083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 207637 205985 gene locus_tag LOCUS_26480 207637 205985 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227481.1 protein_id gnl|my_center|LOCUS_26480 208022 207750 gene locus_tag LOCUS_26490 208022 207750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 209284 208019 gene locus_tag LOCUS_26500 209284 208019 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027336.1 protein_id gnl|my_center|LOCUS_26500 210313 209555 gene locus_tag LOCUS_26510 210313 209555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 210551 212365 gene locus_tag LOCUS_26520 210551 212365 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225166.1 protein_id gnl|my_center|LOCUS_26520 213481 212669 gene locus_tag LOCUS_26530 213481 212669 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_26530 214369 213491 gene locus_tag LOCUS_26540 214369 213491 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971907.1 protein_id gnl|my_center|LOCUS_26540 214469 215065 gene locus_tag LOCUS_26550 214469 215065 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028034.1 protein_id gnl|my_center|LOCUS_26550 216346 215444 gene locus_tag LOCUS_26560 216346 215444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 216663 217445 gene locus_tag LOCUS_26570 216663 217445 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085771.1 protein_id gnl|my_center|LOCUS_26570 217654 218616 gene locus_tag LOCUS_26580 217654 218616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26580 218613 219071 gene locus_tag LOCUS_26590 218613 219071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 219068 219631 gene locus_tag LOCUS_26600 219068 219631 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224979.1 protein_id gnl|my_center|LOCUS_26600 219806 220747 gene locus_tag LOCUS_26610 219806 220747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 221330 220782 gene locus_tag LOCUS_26620 221330 220782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 222016 221381 gene locus_tag LOCUS_26630 222016 221381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225444.1 protein_id gnl|my_center|LOCUS_26630 222179 222673 gene locus_tag LOCUS_26640 222179 222673 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705530.1 protein_id gnl|my_center|LOCUS_26640 223565 222804 gene locus_tag LOCUS_26650 223565 222804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 223827 223753 gene locus_tag LOCUS_t00350 223827 223753 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 225272 223884 gene locus_tag LOCUS_26660 gene der 225272 223884 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_26660 226060 225272 gene locus_tag LOCUS_26670 226060 225272 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977065.1 protein_id gnl|my_center|LOCUS_26670 226760 226098 gene locus_tag LOCUS_26680 226760 226098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 228015 226912 gene locus_tag LOCUS_26690 228015 226912 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 protein_id gnl|my_center|LOCUS_26690 228887 228012 gene locus_tag LOCUS_26700 gene prcA 228887 228012 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_26700 229455 228955 gene locus_tag LOCUS_26710 229455 228955 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971886.1 protein_id gnl|my_center|LOCUS_26710 230354 229482 gene locus_tag LOCUS_26720 gene prcB 230354 229482 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_26720 230551 230351 gene locus_tag LOCUS_26730 230551 230351 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_26730 231243 230653 gene locus_tag LOCUS_26740 231243 230653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 232811 231240 gene locus_tag LOCUS_26750 gene dop 232811 231240 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_26750 232961 233452 gene locus_tag LOCUS_26760 232961 233452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 234378 233515 gene locus_tag LOCUS_26770 234378 233515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 234514 235428 gene locus_tag LOCUS_26780 234514 235428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 237690 235948 gene locus_tag LOCUS_26790 gene arc 237690 235948 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_26790 239057 238083 gene locus_tag LOCUS_26800 239057 238083 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_26800 240585 239050 gene locus_tag LOCUS_26810 240585 239050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 241324 240578 gene locus_tag LOCUS_26820 241324 240578 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467175.1 protein_id gnl|my_center|LOCUS_26820 244952 241410 gene locus_tag LOCUS_26830 gene metH 244952 241410 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_26830 245052 245915 gene locus_tag LOCUS_26840 gene parJ 245052 245915 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_26840 246138 247400 gene locus_tag LOCUS_26850 246138 247400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 247413 248354 gene locus_tag LOCUS_26860 247413 248354 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721883.1 protein_id gnl|my_center|LOCUS_26860 248351 249289 gene locus_tag LOCUS_26870 248351 249289 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083318.1 protein_id gnl|my_center|LOCUS_26870 249294 251078 gene locus_tag LOCUS_26880 249294 251078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 251780 251118 gene locus_tag LOCUS_26890 gene rpe 251780 251118 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_26890 253216 251831 gene locus_tag LOCUS_26900 253216 251831 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_26900 254139 253213 gene locus_tag LOCUS_26910 gene fmt 254139 253213 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_26910 256416 254191 gene locus_tag LOCUS_26920 256416 254191 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027807.1 protein_id gnl|my_center|LOCUS_26920 256501 257829 gene locus_tag LOCUS_26930 256501 257829 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123082.1 protein_id gnl|my_center|LOCUS_26930 257826 258803 gene locus_tag LOCUS_26940 257826 258803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 260368 258935 gene locus_tag LOCUS_26950 260368 258935 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963751.1 protein_id gnl|my_center|LOCUS_26950 261249 260365 gene locus_tag LOCUS_26960 261249 260365 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635946.1 protein_id gnl|my_center|LOCUS_26960 262172 261249 gene locus_tag LOCUS_26970 262172 261249 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963749.1 protein_id gnl|my_center|LOCUS_26970 263501 262290 gene locus_tag LOCUS_26980 gene metK 263501 262290 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_26980 264800 263544 gene locus_tag LOCUS_26990 gene coaBC 264800 263544 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_26990 265173 264841 gene locus_tag LOCUS_27000 265173 264841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 265844 265170 gene locus_tag LOCUS_27010 gene gmk 265844 265170 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805082.1 protein_id gnl|my_center|LOCUS_27010 266178 265867 gene locus_tag LOCUS_27020 gene mihF 266178 265867 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_27020 267322 266426 gene locus_tag LOCUS_27030 gene pyrF 267322 266426 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224621.1 protein_id gnl|my_center|LOCUS_27030 268380 267319 gene locus_tag LOCUS_27040 268380 267319 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228062.1 protein_id gnl|my_center|LOCUS_27040 271815 268411 gene locus_tag LOCUS_27050 gene carB 271815 268411 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_27050 272960 271815 gene locus_tag LOCUS_27060 gene carA 272960 271815 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_27060 273172 273606 gene locus_tag LOCUS_27070 273172 273606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 273706 274251 gene locus_tag LOCUS_27080 273706 274251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 274248 276392 gene locus_tag LOCUS_27090 274248 276392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 276968 276501 gene locus_tag LOCUS_27100 gene nusB 276968 276501 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224611.1 protein_id gnl|my_center|LOCUS_27100 277528 276965 gene locus_tag LOCUS_27110 gene efp 277528 276965 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_27110 277625 278293 gene locus_tag LOCUS_27120 277625 278293 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235430.1 protein_id gnl|my_center|LOCUS_27120 278290 279477 gene locus_tag LOCUS_27130 278290 279477 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436463.1 protein_id gnl|my_center|LOCUS_27130 280039 279680 gene locus_tag LOCUS_27140 280039 279680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 281166 280078 gene locus_tag LOCUS_27150 gene aroB 281166 280078 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224604.1 protein_id gnl|my_center|LOCUS_27150 281675 281163 gene locus_tag LOCUS_27160 gene aroK 281675 281163 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413021.1 protein_id gnl|my_center|LOCUS_27160 282984 281788 gene locus_tag LOCUS_27170 gene aroC 282984 281788 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_27170 283822 282998 gene locus_tag LOCUS_27180 283822 282998 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_27180 284990 283857 gene locus_tag LOCUS_27190 gene mltG 284990 283857 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775669.1 protein_id gnl|my_center|LOCUS_27190 285627 285139 gene locus_tag LOCUS_27200 gene ruvX 285627 285139 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_27200 288395 285666 gene locus_tag LOCUS_27210 gene alaS 288395 285666 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728764.1 protein_id gnl|my_center|LOCUS_27210 288678 288451 gene locus_tag LOCUS_27220 288678 288451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 289076 288675 gene locus_tag LOCUS_27230 289076 288675 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224580.1 protein_id gnl|my_center|LOCUS_27230 289237 289617 gene locus_tag LOCUS_27240 289237 289617 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031798.1 protein_id gnl|my_center|LOCUS_27240 289715 289897 gene locus_tag LOCUS_27250 289715 289897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 290426 290001 gene locus_tag LOCUS_27260 290426 290001 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727277.1 protein_id gnl|my_center|LOCUS_27260 292169 290646 gene locus_tag LOCUS_27270 292169 290646 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776830.1 protein_id gnl|my_center|LOCUS_27270 293691 292318 gene locus_tag LOCUS_27280 293691 292318 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111336.1 protein_id gnl|my_center|LOCUS_27280 295236 293830 gene locus_tag LOCUS_27290 295236 293830 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_27290 296464 295313 gene locus_tag LOCUS_27300 296464 295313 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226330.1 protein_id gnl|my_center|LOCUS_27300 297943 296534 gene locus_tag LOCUS_27310 297943 296534 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230584.1 protein_id gnl|my_center|LOCUS_27310 298045 298896 gene locus_tag LOCUS_27320 298045 298896 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405636.1 protein_id gnl|my_center|LOCUS_27320 300803 298989 gene locus_tag LOCUS_27330 gene aspS 300803 298989 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082377.1 protein_id gnl|my_center|LOCUS_27330 300991 301959 gene locus_tag LOCUS_27340 300991 301959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 302830 302006 gene locus_tag LOCUS_27350 302830 302006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 303066 303929 gene locus_tag LOCUS_27360 303066 303929 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730550.1 protein_id gnl|my_center|LOCUS_27360 304586 304005 gene locus_tag LOCUS_27370 304586 304005 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093953615.1 protein_id gnl|my_center|LOCUS_27370 308351 304665 gene locus_tag LOCUS_27380 308351 304665 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156997904.1 protein_id gnl|my_center|LOCUS_27380 309959 308427 gene locus_tag LOCUS_27390 309959 308427 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727778.1 protein_id gnl|my_center|LOCUS_27390 310611 310081 gene locus_tag LOCUS_27400 310611 310081 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239004.1 protein_id gnl|my_center|LOCUS_27400 311426 310608 gene locus_tag LOCUS_27410 311426 310608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 311489 312109 gene locus_tag LOCUS_27420 311489 312109 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222272.1 protein_id gnl|my_center|LOCUS_27420 312882 312157 gene locus_tag LOCUS_27430 312882 312157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222725.1 protein_id gnl|my_center|LOCUS_27430 313016 313222 gene locus_tag LOCUS_27440 313016 313222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 313234 314076 gene locus_tag LOCUS_27450 313234 314076 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_27450 315274 314120 gene locus_tag LOCUS_27460 315274 314120 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223214.1 protein_id gnl|my_center|LOCUS_27460 315354 316073 gene locus_tag LOCUS_27470 315354 316073 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948152.1 protein_id gnl|my_center|LOCUS_27470 316734 316066 gene locus_tag LOCUS_27480 316734 316066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 317402 316893 gene locus_tag LOCUS_27490 317402 316893 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228353.1 protein_id gnl|my_center|LOCUS_27490 318104 317463 gene locus_tag LOCUS_27500 gene pdxT 318104 317463 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111403.1 protein_id gnl|my_center|LOCUS_27500 319051 318155 gene locus_tag LOCUS_27510 gene pdxS 319051 318155 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_27510 320310 319117 gene locus_tag LOCUS_27520 320310 319117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 321548 320514 gene locus_tag LOCUS_27530 321548 320514 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066709.1 protein_id gnl|my_center|LOCUS_27530 322891 321548 gene locus_tag LOCUS_27540 gene hisS 322891 321548 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805006.1 protein_id gnl|my_center|LOCUS_27540 323682 322966 gene locus_tag LOCUS_27550 323682 322966 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_27550 323713 324993 gene locus_tag LOCUS_27560 323713 324993 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_27560 325182 325619 gene locus_tag LOCUS_27570 325182 325619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 328471 325739 gene locus_tag LOCUS_27580 gene relA 328471 325739 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_27580 329736 328669 gene locus_tag LOCUS_27590 329736 328669 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975108.1 protein_id gnl|my_center|LOCUS_27590 330349 329762 gene locus_tag LOCUS_27600 330349 329762 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 protein_id gnl|my_center|LOCUS_27600 331717 330410 gene locus_tag LOCUS_27610 gene secF 331717 330410 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_27610 333462 331717 gene locus_tag LOCUS_27620 gene secD 333462 331717 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805000.1 protein_id gnl|my_center|LOCUS_27620 334010 333489 gene locus_tag LOCUS_27630 334010 333489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 335349 334189 gene locus_tag LOCUS_27640 gene ruvB 335349 334189 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_27640 336001 335396 gene locus_tag LOCUS_27650 gene ruvA 336001 335396 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_27650 336567 335998 gene locus_tag LOCUS_27660 gene ruvC 336567 335998 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 protein_id gnl|my_center|LOCUS_27660 338186 337140 gene locus_tag LOCUS_27670 338186 337140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 339075 338317 gene locus_tag LOCUS_27680 339075 338317 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057545.1 protein_id gnl|my_center|LOCUS_27680 339987 339100 gene locus_tag LOCUS_27690 339987 339100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 341485 339977 gene locus_tag LOCUS_27700 341485 339977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 343961 341487 gene locus_tag LOCUS_27710 343961 341487 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776688.1 protein_id gnl|my_center|LOCUS_27710 344740 343958 gene locus_tag LOCUS_27720 gene priA 344740 343958 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104322.1 protein_id gnl|my_center|LOCUS_27720 345954 344836 gene locus_tag LOCUS_27730 345954 344836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974090.1 protein_id gnl|my_center|LOCUS_27730 347052 346018 gene locus_tag LOCUS_27740 347052 346018 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974091.1 protein_id gnl|my_center|LOCUS_27740 347197 348285 gene locus_tag LOCUS_27750 347197 348285 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974094.1 protein_id gnl|my_center|LOCUS_27750 348282 349796 gene locus_tag LOCUS_27760 348282 349796 CDS product alpha-2,8-polysialyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029922.1 protein_id gnl|my_center|LOCUS_27760 350781 349771 gene locus_tag LOCUS_27770 350781 349771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 351407 350778 gene locus_tag LOCUS_27780 gene hisH 351407 350778 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224143.1 protein_id gnl|my_center|LOCUS_27780 352039 351404 gene locus_tag LOCUS_27790 gene hisB 352039 351404 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052519.1 protein_id gnl|my_center|LOCUS_27790 353193 352036 gene locus_tag LOCUS_27800 353193 352036 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929983.1 protein_id gnl|my_center|LOCUS_27800 354545 353190 gene locus_tag LOCUS_27810 gene hisD 354545 353190 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028117.1 protein_id gnl|my_center|LOCUS_27810 355191 354625 gene locus_tag LOCUS_27820 355191 354625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 355347 356066 gene locus_tag LOCUS_27830 355347 356066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 356063 356374 gene locus_tag LOCUS_27840 356063 356374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 356402 356899 gene locus_tag LOCUS_27850 gene ybaK 356402 356899 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 protein_id gnl|my_center|LOCUS_27850 357418 356945 gene locus_tag LOCUS_27860 357418 356945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225541.1 protein_id gnl|my_center|LOCUS_27860 357505 358011 gene locus_tag LOCUS_27870 357505 358011 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061267.1 protein_id gnl|my_center|LOCUS_27870 358008 358787 gene locus_tag LOCUS_27880 358008 358787 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224601.1 protein_id gnl|my_center|LOCUS_27880 359828 358989 gene locus_tag LOCUS_27890 359828 358989 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_27890 360825 359833 gene locus_tag LOCUS_27900 360825 359833 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878394.1 protein_id gnl|my_center|LOCUS_27900 360884 363460 gene locus_tag LOCUS_27910 360884 363460 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804342.1 protein_id gnl|my_center|LOCUS_27910 365143 363920 gene locus_tag LOCUS_27920 365143 363920 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027323.1 protein_id gnl|my_center|LOCUS_27920 365153 365374 gene locus_tag LOCUS_27930 365153 365374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 365352 365993 gene locus_tag LOCUS_27940 365352 365993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 366582 366097 gene locus_tag LOCUS_27950 366582 366097 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891973.1 protein_id gnl|my_center|LOCUS_27950 367214 366579 gene locus_tag LOCUS_27960 367214 366579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 370836 367258 gene locus_tag LOCUS_27970 gene dnaE 370836 367258 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804720.1 protein_id gnl|my_center|LOCUS_27970 371085 372047 gene locus_tag LOCUS_27980 371085 372047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 372704 372075 gene locus_tag LOCUS_27990 372704 372075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 373978 372812 gene locus_tag LOCUS_28000 373978 372812 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537580.1 protein_id gnl|my_center|LOCUS_28000 374553 374023 gene locus_tag LOCUS_28010 374553 374023 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531326.1 protein_id gnl|my_center|LOCUS_28010 374774 376324 gene locus_tag LOCUS_28020 374774 376324 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727675.1 protein_id gnl|my_center|LOCUS_28020 376642 376379 gene locus_tag LOCUS_28030 376642 376379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 377898 376717 gene locus_tag LOCUS_28040 377898 376717 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156192226.1 protein_id gnl|my_center|LOCUS_28040 379498 378032 gene locus_tag LOCUS_28050 379498 378032 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976791.1 protein_id gnl|my_center|LOCUS_28050 384077 379491 gene locus_tag LOCUS_28060 gene gltB 384077 379491 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_28060 385718 384456 gene locus_tag LOCUS_28070 385718 384456 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706082.1 protein_id gnl|my_center|LOCUS_28070 386804 385794 gene locus_tag LOCUS_28080 gene lgt 386804 385794 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976782.1 protein_id gnl|my_center|LOCUS_28080 387478 386831 gene locus_tag LOCUS_28090 387478 386831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 388437 387475 gene locus_tag LOCUS_28100 gene trpA 388437 387475 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075867.1 protein_id gnl|my_center|LOCUS_28100 389843 388434 gene locus_tag LOCUS_28110 gene trpB 389843 388434 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930205.1 protein_id gnl|my_center|LOCUS_28110 390753 389947 gene locus_tag LOCUS_28120 gene trpC 390753 389947 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_28120 391166 390798 gene locus_tag LOCUS_28130 391166 390798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 392016 391207 gene locus_tag LOCUS_28140 392016 391207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 393548 392013 gene locus_tag LOCUS_28150 393548 392013 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224165.1 protein_id gnl|my_center|LOCUS_28150 393943 393545 gene locus_tag LOCUS_28160 gene hisI 393943 393545 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976772.1 protein_id gnl|my_center|LOCUS_28160 394049 394705 gene locus_tag LOCUS_28170 394049 394705 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_28170 394908 395099 gene locus_tag LOCUS_28180 394908 395099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 397953 395122 gene locus_tag LOCUS_28190 397953 395122 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860863.1 protein_id gnl|my_center|LOCUS_28190 398516 398043 gene locus_tag LOCUS_28200 398516 398043 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867895.1 protein_id gnl|my_center|LOCUS_28200 399421 398582 gene locus_tag LOCUS_28210 399421 398582 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228167.1 protein_id gnl|my_center|LOCUS_28210 400961 399453 gene locus_tag LOCUS_28220 gene gatB 400961 399453 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223571.1 protein_id gnl|my_center|LOCUS_28220 402514 400958 gene locus_tag LOCUS_28230 gene gatA 402514 400958 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223570.1 protein_id gnl|my_center|LOCUS_28230 402807 402511 gene locus_tag LOCUS_28240 gene gatC 402807 402511 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_28240 404161 402920 gene locus_tag LOCUS_28250 404161 402920 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_28250 404429 405097 gene locus_tag LOCUS_28260 404429 405097 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519583.1 protein_id gnl|my_center|LOCUS_28260 405149 405667 gene locus_tag LOCUS_28270 405149 405667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 405955 405716 gene locus_tag LOCUS_28280 405955 405716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 408139 405983 gene locus_tag LOCUS_28290 gene ligA 408139 405983 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415263.1 protein_id gnl|my_center|LOCUS_28290 409977 408190 gene locus_tag LOCUS_28300 409977 408190 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_28300 410101 410481 gene locus_tag LOCUS_28310 410101 410481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 411008 410478 gene locus_tag LOCUS_28320 411008 410478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 411679 411005 gene locus_tag LOCUS_28330 411679 411005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 411760 412206 gene locus_tag LOCUS_28340 411760 412206 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079901.1 protein_id gnl|my_center|LOCUS_28340 413278 412262 gene locus_tag LOCUS_28350 413278 412262 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_28350 414381 413299 gene locus_tag LOCUS_28360 gene mnmA 414381 413299 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_28360 415327 414494 gene locus_tag LOCUS_28370 gene allR 415327 414494 CDS product allantoin degradation transcriptional regulator AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972681.1 protein_id gnl|my_center|LOCUS_28370 415429 416238 gene locus_tag LOCUS_28380 415429 416238 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804445.1 protein_id gnl|my_center|LOCUS_28380 416277 417170 gene locus_tag LOCUS_28390 416277 417170 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804444.1 protein_id gnl|my_center|LOCUS_28390 417238 419031 gene locus_tag LOCUS_28400 gene gcl 417238 419031 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730561.1 protein_id gnl|my_center|LOCUS_28400 419045 420250 gene locus_tag LOCUS_28410 419045 420250 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804442.1 protein_id gnl|my_center|LOCUS_28410 420247 421755 gene locus_tag LOCUS_28420 gene allB 420247 421755 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804441.1 protein_id gnl|my_center|LOCUS_28420 422833 421910 gene locus_tag LOCUS_28430 422833 421910 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226502.1 protein_id gnl|my_center|LOCUS_28430 423091 424128 gene locus_tag LOCUS_28440 423091 424128 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069332797.1 protein_id gnl|my_center|LOCUS_28440 424256 425281 gene locus_tag LOCUS_28450 424256 425281 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532703.1 protein_id gnl|my_center|LOCUS_28450 425278 426099 gene locus_tag LOCUS_28460 425278 426099 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974317.1 protein_id gnl|my_center|LOCUS_28460 426140 426544 gene locus_tag LOCUS_28470 426140 426544 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805036.1 protein_id gnl|my_center|LOCUS_28470 426648 427244 gene locus_tag LOCUS_28480 426648 427244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 427247 428881 gene locus_tag LOCUS_28490 427247 428881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 430643 428907 gene locus_tag LOCUS_28500 gene ilvD 430643 428907 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079804.1 protein_id gnl|my_center|LOCUS_28500 431988 430654 gene locus_tag LOCUS_28510 431988 430654 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840295.1 protein_id gnl|my_center|LOCUS_28510 432410 431985 gene locus_tag LOCUS_28520 432410 431985 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937702.1 protein_id gnl|my_center|LOCUS_28520 432617 435622 gene locus_tag LOCUS_28530 432617 435622 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725349.1 protein_id gnl|my_center|LOCUS_28530 436365 435817 gene locus_tag LOCUS_28540 436365 435817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 436247 436549 gene locus_tag LOCUS_28550 436247 436549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 436612 436827 gene locus_tag LOCUS_28560 436612 436827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 437018 436743 gene locus_tag LOCUS_28570 437018 436743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 437065 437247 gene locus_tag LOCUS_28580 437065 437247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 438321 437560 gene locus_tag LOCUS_28590 gene hisF 438321 437560 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856413.1 protein_id gnl|my_center|LOCUS_28590 438450 439529 gene locus_tag LOCUS_28600 438450 439529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 442499 439557 gene locus_tag LOCUS_28610 442499 439557 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805199.1 protein_id gnl|my_center|LOCUS_28610 443378 442542 gene locus_tag LOCUS_28620 443378 442542 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284355.1 protein_id gnl|my_center|LOCUS_28620 444333 443413 gene locus_tag LOCUS_28630 444333 443413 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112080.1 protein_id gnl|my_center|LOCUS_28630 445384 444341 gene locus_tag LOCUS_28640 445384 444341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 445907 445425 gene locus_tag LOCUS_28650 445907 445425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 446125 445895 gene locus_tag LOCUS_28660 446125 445895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 447271 446234 gene locus_tag LOCUS_28670 447271 446234 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_28670 448347 447268 gene locus_tag LOCUS_28680 448347 447268 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226715.1 protein_id gnl|my_center|LOCUS_28680 448421 449002 gene locus_tag LOCUS_28690 448421 449002 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972438.1 protein_id gnl|my_center|LOCUS_28690 448995 449960 gene locus_tag LOCUS_28700 gene gluQRS 448995 449960 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803860.1 protein_id gnl|my_center|LOCUS_28700 450064 451200 gene locus_tag LOCUS_28710 450064 451200 CDS product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805204.1 protein_id gnl|my_center|LOCUS_28710 451236 451853 gene locus_tag LOCUS_28720 451236 451853 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929057.1 protein_id gnl|my_center|LOCUS_28720 452997 451933 gene locus_tag LOCUS_28730 452997 451933 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977187.1 protein_id gnl|my_center|LOCUS_28730 454479 453109 gene locus_tag LOCUS_28740 gene pafA 454479 453109 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_28740 455302 454487 gene locus_tag LOCUS_28750 455302 454487 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895185.1 protein_id gnl|my_center|LOCUS_28750 456030 455299 gene locus_tag LOCUS_28760 gene scpB 456030 455299 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_28760 456994 456017 gene locus_tag LOCUS_28770 456994 456017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 457434 457045 gene locus_tag LOCUS_28780 457434 457045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227803.1 protein_id gnl|my_center|LOCUS_28780 458726 457419 gene locus_tag LOCUS_28790 458726 457419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 459978 458899 gene locus_tag LOCUS_28800 gene xerD 459978 458899 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 protein_id gnl|my_center|LOCUS_28800 460305 459997 gene locus_tag LOCUS_28810 460305 459997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 460362 461111 gene locus_tag LOCUS_28820 460362 461111 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583026.1 protein_id gnl|my_center|LOCUS_28820 462545 461169 gene locus_tag LOCUS_28830 462545 461169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 463421 462735 gene locus_tag LOCUS_28840 463421 462735 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_28840 465079 463418 gene locus_tag LOCUS_28850 465079 463418 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063606961.1 protein_id gnl|my_center|LOCUS_28850 466233 465178 gene locus_tag LOCUS_28860 466233 465178 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666770.1 protein_id gnl|my_center|LOCUS_28860 467912 466233 gene locus_tag LOCUS_28870 467912 466233 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804979.1 protein_id gnl|my_center|LOCUS_28870 468774 467926 gene locus_tag LOCUS_28880 468774 467926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 469717 468791 gene locus_tag LOCUS_28890 469717 468791 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227815.1 protein_id gnl|my_center|LOCUS_28890 470907 469714 gene locus_tag LOCUS_28900 gene steA 470907 469714 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_28900 472687 470981 gene locus_tag LOCUS_28910 gene recN 472687 470981 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_28910 473726 472695 gene locus_tag LOCUS_28920 473726 472695 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_28920 474543 473776 gene locus_tag LOCUS_28930 474543 473776 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729305.1 protein_id gnl|my_center|LOCUS_28930 474749 474540 gene locus_tag LOCUS_28940 474749 474540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 475534 474746 gene locus_tag LOCUS_28950 475534 474746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 477494 475593 gene locus_tag LOCUS_28960 477494 475593 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887578.1 protein_id gnl|my_center|LOCUS_28960 478613 477591 gene locus_tag LOCUS_28970 478613 477591 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027978.1 protein_id gnl|my_center|LOCUS_28970 479653 478610 gene locus_tag LOCUS_28980 479653 478610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 479585 482338 gene locus_tag LOCUS_28990 479585 482338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 482335 482877 gene locus_tag LOCUS_29000 482335 482877 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976722.1 protein_id gnl|my_center|LOCUS_29000 484292 482898 gene locus_tag LOCUS_29010 484292 482898 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124874314.1 protein_id gnl|my_center|LOCUS_29010 484612 484501 gene locus_tag LOCUS_r00010 484612 484501 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 487831 484725 gene locus_tag LOCUS_r00020 487831 484725 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 489691 488177 gene locus_tag LOCUS_r00030 489691 488177 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 491559 490288 gene locus_tag LOCUS_29020 gene tyrS 491559 490288 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_29020 493014 491569 gene locus_tag LOCUS_29030 gene argH 493014 491569 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408180.1 protein_id gnl|my_center|LOCUS_29030 493565 493011 gene locus_tag LOCUS_29040 493565 493011 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_29040 494497 493562 gene locus_tag LOCUS_29050 gene argF 494497 493562 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110847.1 protein_id gnl|my_center|LOCUS_29050 495753 494494 gene locus_tag LOCUS_29060 495753 494494 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729315.1 protein_id gnl|my_center|LOCUS_29060 496760 495750 gene locus_tag LOCUS_29070 gene argB 496760 495750 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_29070 497908 496757 gene locus_tag LOCUS_29080 gene argJ 497908 496757 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_29080 498321 497905 gene locus_tag LOCUS_29090 498321 497905 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392516.1 protein_id gnl|my_center|LOCUS_29090 499346 498318 gene locus_tag LOCUS_29100 gene argC 499346 498318 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 protein_id gnl|my_center|LOCUS_29100 499450 500424 gene locus_tag LOCUS_29110 499450 500424 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325683.1 protein_id gnl|my_center|LOCUS_29110 502982 500448 gene locus_tag LOCUS_29120 gene pheT 502982 500448 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776192.1 protein_id gnl|my_center|LOCUS_29120 504091 502979 gene locus_tag LOCUS_29130 gene pheS 504091 502979 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977229.1 protein_id gnl|my_center|LOCUS_29130 505026 504220 gene locus_tag LOCUS_29140 505026 504220 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_29140 505492 505115 gene locus_tag LOCUS_29150 gene rplT 505492 505115 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_29150 505830 505636 gene locus_tag LOCUS_29160 gene rpmI 505830 505636 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 protein_id gnl|my_center|LOCUS_29160 506487 505915 gene locus_tag LOCUS_29170 gene infC 506487 505915 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_29170 507488 506895 gene locus_tag LOCUS_29180 507488 506895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 507593 508117 gene locus_tag LOCUS_29190 507593 508117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 508678 508163 gene locus_tag LOCUS_29200 508678 508163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 509532 508687 gene locus_tag LOCUS_29210 gene hisG 509532 508687 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_29210 509891 509622 gene locus_tag LOCUS_29220 509891 509622 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895567.1 protein_id gnl|my_center|LOCUS_29220 510662 509934 gene locus_tag LOCUS_29230 gene pnuC 510662 509934 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013360.1 protein_id gnl|my_center|LOCUS_29230 511410 510655 gene locus_tag LOCUS_29240 511410 510655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 512214 511414 gene locus_tag LOCUS_29250 512214 511414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 512105 513256 gene locus_tag LOCUS_29260 512105 513256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 513368 513823 gene locus_tag LOCUS_29270 513368 513823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 515542 514277 gene locus_tag LOCUS_29280 gene mshC 515542 514277 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729628.1 protein_id gnl|my_center|LOCUS_29280 516582 515758 gene locus_tag LOCUS_29290 516582 515758 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080175.1 protein_id gnl|my_center|LOCUS_29290 517212 516616 gene locus_tag LOCUS_29300 517212 516616 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_29300 517970 517242 gene locus_tag LOCUS_29310 517970 517242 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226474.1 protein_id gnl|my_center|LOCUS_29310 518620 518099 gene locus_tag LOCUS_29320 518620 518099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 519677 518628 gene locus_tag LOCUS_29330 519677 518628 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_29330 519924 520898 gene locus_tag LOCUS_29340 519924 520898 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977155.1 protein_id gnl|my_center|LOCUS_29340 521138 520938 gene locus_tag LOCUS_29350 521138 520938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 521928 521167 gene locus_tag LOCUS_29360 521928 521167 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728017.1 protein_id gnl|my_center|LOCUS_29360 522806 521925 gene locus_tag LOCUS_29370 522806 521925 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973816.1 protein_id gnl|my_center|LOCUS_29370 527761 522821 gene locus_tag LOCUS_29380 527761 522821 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_29380 527942 528415 gene locus_tag LOCUS_29390 527942 528415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 530114 528486 gene locus_tag LOCUS_29400 gene pruA 530114 528486 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 protein_id gnl|my_center|LOCUS_29400 530971 530168 gene locus_tag LOCUS_29410 530971 530168 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227088.1 protein_id gnl|my_center|LOCUS_29410 531547 531062 gene locus_tag LOCUS_29420 531547 531062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 533433 531547 gene locus_tag LOCUS_29430 533433 531547 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_29430 533861 533439 gene locus_tag LOCUS_29440 533861 533439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 533848 534105 gene locus_tag LOCUS_29450 533848 534105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 534149 535570 gene locus_tag LOCUS_29460 534149 535570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084962.1 protein_id gnl|my_center|LOCUS_29460 535653 536405 gene locus_tag LOCUS_29470 535653 536405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 539379 536464 gene locus_tag LOCUS_29480 gene secA 539379 536464 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_29480 540859 539528 gene locus_tag LOCUS_29490 540859 539528 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 protein_id gnl|my_center|LOCUS_29490 541555 540911 gene locus_tag LOCUS_29500 gene raiA 541555 540911 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975803.1 protein_id gnl|my_center|LOCUS_29500 542691 541822 gene locus_tag LOCUS_29510 542691 541822 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028713.1 protein_id gnl|my_center|LOCUS_29510 544652 542874 gene locus_tag LOCUS_29520 544652 542874 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028714.1 protein_id gnl|my_center|LOCUS_29520 >Feature sequence5 1 189 gene locus_tag LOCUS_29530 1 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 334 2226 gene locus_tag LOCUS_29540 334 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223760.1 protein_id gnl|my_center|LOCUS_29540 4264 2255 gene locus_tag LOCUS_29550 4264 2255 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730584.1 protein_id gnl|my_center|LOCUS_29550 5684 4275 gene locus_tag LOCUS_29560 5684 4275 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226764.1 protein_id gnl|my_center|LOCUS_29560 5929 7431 gene locus_tag LOCUS_29570 5929 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 8268 7462 gene locus_tag LOCUS_29580 8268 7462 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016724.1 protein_id gnl|my_center|LOCUS_29580 9014 8265 gene locus_tag LOCUS_29590 9014 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 10201 9185 gene locus_tag LOCUS_29600 10201 9185 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228513.1 protein_id gnl|my_center|LOCUS_29600 11252 10392 gene locus_tag LOCUS_29610 11252 10392 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803928.1 protein_id gnl|my_center|LOCUS_29610 11375 11875 gene locus_tag LOCUS_29620 11375 11875 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230535.1 protein_id gnl|my_center|LOCUS_29620 13076 12150 gene locus_tag LOCUS_29630 13076 12150 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224290.1 protein_id gnl|my_center|LOCUS_29630 13060 14568 gene locus_tag LOCUS_29640 13060 14568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 15713 14904 gene locus_tag LOCUS_29650 15713 14904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 17006 15732 gene locus_tag LOCUS_29660 17006 15732 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_29660 17594 17013 gene locus_tag LOCUS_29670 17594 17013 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_29670 19098 17665 gene locus_tag LOCUS_29680 19098 17665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 22194 19531 gene locus_tag LOCUS_29690 22194 19531 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_29690 22417 23694 gene locus_tag LOCUS_29700 22417 23694 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104242.1 protein_id gnl|my_center|LOCUS_29700 23751 24398 gene locus_tag LOCUS_29710 23751 24398 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726958.1 protein_id gnl|my_center|LOCUS_29710 24395 24952 gene locus_tag LOCUS_29720 24395 24952 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027568.1 protein_id gnl|my_center|LOCUS_29720 25026 26543 gene locus_tag LOCUS_29730 gene glpK 25026 26543 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731139.1 protein_id gnl|my_center|LOCUS_29730 26649 28361 gene locus_tag LOCUS_29740 26649 28361 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878744.1 protein_id gnl|my_center|LOCUS_29740 28817 28386 gene locus_tag LOCUS_29750 28817 28386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 29061 30833 gene locus_tag LOCUS_29760 29061 30833 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226824.1 protein_id gnl|my_center|LOCUS_29760 30849 31811 gene locus_tag LOCUS_29770 30849 31811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 32663 31842 gene locus_tag LOCUS_29780 32663 31842 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762776.1 protein_id gnl|my_center|LOCUS_29780 32703 35168 gene locus_tag LOCUS_29790 32703 35168 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030487.1 protein_id gnl|my_center|LOCUS_29790 37740 35875 gene locus_tag LOCUS_29800 37740 35875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 37943 37737 gene locus_tag LOCUS_29810 37943 37737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 39010 37940 gene locus_tag LOCUS_29820 39010 37940 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868866.1 protein_id gnl|my_center|LOCUS_29820 40091 39003 gene locus_tag LOCUS_29830 40091 39003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230097.1 protein_id gnl|my_center|LOCUS_29830 41005 40091 gene locus_tag LOCUS_29840 41005 40091 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980619.1 protein_id gnl|my_center|LOCUS_29840 42096 41005 gene locus_tag LOCUS_29850 42096 41005 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803789.1 protein_id gnl|my_center|LOCUS_29850 43065 42313 gene locus_tag LOCUS_29860 43065 42313 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013899.1 protein_id gnl|my_center|LOCUS_29860 43167 43787 gene locus_tag LOCUS_29870 43167 43787 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035721.1 protein_id gnl|my_center|LOCUS_29870 45950 43833 gene locus_tag LOCUS_29880 45950 43833 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973199.1 protein_id gnl|my_center|LOCUS_29880 46474 46644 gene locus_tag LOCUS_29890 46474 46644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805039.1 protein_id gnl|my_center|LOCUS_29890 47258 46737 gene locus_tag LOCUS_29900 47258 46737 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226322.1 protein_id gnl|my_center|LOCUS_29900 47347 47772 gene locus_tag LOCUS_29910 47347 47772 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226321.1 protein_id gnl|my_center|LOCUS_29910 47769 49121 gene locus_tag LOCUS_29920 47769 49121 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226320.1 protein_id gnl|my_center|LOCUS_29920 49336 49034 gene locus_tag LOCUS_29930 49336 49034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 49221 50816 gene locus_tag LOCUS_29940 49221 50816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 51888 50857 gene locus_tag LOCUS_29950 51888 50857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 51916 52701 gene locus_tag LOCUS_29960 51916 52701 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191609.1 protein_id gnl|my_center|LOCUS_29960 54573 52735 gene locus_tag LOCUS_29970 54573 52735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 55643 54618 gene locus_tag LOCUS_29980 55643 54618 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_29980 57069 55666 gene locus_tag LOCUS_29990 57069 55666 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122964585.1 protein_id gnl|my_center|LOCUS_29990 58025 57066 gene locus_tag LOCUS_30000 58025 57066 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_30000 58987 58022 gene locus_tag LOCUS_30010 58987 58022 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114399.1 protein_id gnl|my_center|LOCUS_30010 59147 59989 gene locus_tag LOCUS_30020 59147 59989 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065249.1 protein_id gnl|my_center|LOCUS_30020 60064 61200 gene locus_tag LOCUS_30030 60064 61200 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970668.1 protein_id gnl|my_center|LOCUS_30030 61190 62182 gene locus_tag LOCUS_30040 61190 62182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 62179 63426 gene locus_tag LOCUS_30050 62179 63426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 64621 63467 gene locus_tag LOCUS_30060 64621 63467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 66131 64794 gene locus_tag LOCUS_30070 66131 64794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 66837 66424 gene locus_tag LOCUS_30080 66837 66424 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729640.1 protein_id gnl|my_center|LOCUS_30080 68312 66834 gene locus_tag LOCUS_30090 68312 66834 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031712.1 protein_id gnl|my_center|LOCUS_30090 68380 69246 gene locus_tag LOCUS_30100 68380 69246 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027387.1 protein_id gnl|my_center|LOCUS_30100 69271 71517 gene locus_tag LOCUS_30110 69271 71517 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803998.1 protein_id gnl|my_center|LOCUS_30110 71821 72747 gene locus_tag LOCUS_30120 71821 72747 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975615.1 protein_id gnl|my_center|LOCUS_30120 74081 72933 gene locus_tag LOCUS_30130 74081 72933 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223213.1 protein_id gnl|my_center|LOCUS_30130 75100 74228 gene locus_tag LOCUS_30140 75100 74228 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_30140 76072 75155 gene locus_tag LOCUS_30150 76072 75155 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229588.1 protein_id gnl|my_center|LOCUS_30150 80176 76145 gene locus_tag LOCUS_30160 gene hrpA 80176 76145 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_30160 80253 81065 gene locus_tag LOCUS_30170 80253 81065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 82052 81096 gene locus_tag LOCUS_30180 82052 81096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 82225 83196 gene locus_tag LOCUS_30190 82225 83196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 84186 83239 gene locus_tag LOCUS_30200 84186 83239 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029931.1 protein_id gnl|my_center|LOCUS_30200 85254 84340 gene locus_tag LOCUS_30210 85254 84340 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224311.1 protein_id gnl|my_center|LOCUS_30210 85544 86524 gene locus_tag LOCUS_30220 85544 86524 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224886.1 protein_id gnl|my_center|LOCUS_30220 86640 87767 gene locus_tag LOCUS_30230 86640 87767 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975538.1 protein_id gnl|my_center|LOCUS_30230 87764 88399 gene locus_tag LOCUS_30240 87764 88399 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975539.1 protein_id gnl|my_center|LOCUS_30240 88630 88830 gene locus_tag LOCUS_30250 88630 88830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 88916 89980 gene locus_tag LOCUS_30260 88916 89980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 93189 90361 gene locus_tag LOCUS_30270 93189 90361 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_30270 93983 93381 gene locus_tag LOCUS_30280 93983 93381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 94421 95422 gene locus_tag LOCUS_30290 94421 95422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 95891 95448 gene locus_tag LOCUS_30300 95891 95448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 96124 97047 gene locus_tag LOCUS_30310 96124 97047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 99256 97142 gene locus_tag LOCUS_30320 99256 97142 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030465.1 protein_id gnl|my_center|LOCUS_30320 100870 99374 gene locus_tag LOCUS_30330 gene hflX 100870 99374 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 protein_id gnl|my_center|LOCUS_30330 101761 100994 gene locus_tag LOCUS_30340 101761 100994 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895059.1 protein_id gnl|my_center|LOCUS_30340 102738 101860 gene locus_tag LOCUS_30350 102738 101860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 103652 102759 gene locus_tag LOCUS_30360 gene dapF 103652 102759 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224258.1 protein_id gnl|my_center|LOCUS_30360 104598 103657 gene locus_tag LOCUS_30370 gene miaA 104598 103657 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_30370 104714 104968 gene locus_tag LOCUS_30380 104714 104968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 105534 105001 gene locus_tag LOCUS_30390 105534 105001 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062850.1 protein_id gnl|my_center|LOCUS_30390 107204 105684 gene locus_tag LOCUS_30400 gene miaB 107204 105684 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_30400 107273 108202 gene locus_tag LOCUS_30410 107273 108202 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 protein_id gnl|my_center|LOCUS_30410 108361 109140 gene locus_tag LOCUS_30420 108361 109140 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143316.1 protein_id gnl|my_center|LOCUS_30420 110656 109157 gene locus_tag LOCUS_30430 gene rny 110656 109157 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_30430 112516 111716 gene locus_tag LOCUS_30440 112516 111716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 113745 112699 gene locus_tag LOCUS_30450 gene recA 113745 112699 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224217.1 protein_id gnl|my_center|LOCUS_30450 115347 114019 gene locus_tag LOCUS_30460 115347 114019 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731245.1 protein_id gnl|my_center|LOCUS_30460 115528 116997 gene locus_tag LOCUS_30470 115528 116997 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893849.1 protein_id gnl|my_center|LOCUS_30470 118377 117046 gene locus_tag LOCUS_30480 gene iolF 118377 117046 CDS product myo-inositol transporter IolF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244597.1 protein_id gnl|my_center|LOCUS_30480 118704 118510 gene locus_tag LOCUS_30490 118704 118510 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973258.1 protein_id gnl|my_center|LOCUS_30490 118771 119376 gene locus_tag LOCUS_30500 118771 119376 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888435.1 protein_id gnl|my_center|LOCUS_30500 119418 124310 gene locus_tag LOCUS_30510 119418 124310 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109508967.1 protein_id gnl|my_center|LOCUS_30510 124473 126257 gene locus_tag LOCUS_30520 124473 126257 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 protein_id gnl|my_center|LOCUS_30520 126733 126236 gene locus_tag LOCUS_30530 126733 126236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 126795 127958 gene locus_tag LOCUS_30540 126795 127958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 128270 127977 gene locus_tag LOCUS_30550 128270 127977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 129474 128311 gene locus_tag LOCUS_30560 129474 128311 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467826.1 protein_id gnl|my_center|LOCUS_30560 129592 130032 gene locus_tag LOCUS_30570 129592 130032 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978301.1 protein_id gnl|my_center|LOCUS_30570 130699 130202 gene locus_tag LOCUS_30580 130699 130202 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030436.1 protein_id gnl|my_center|LOCUS_30580 131291 130692 gene locus_tag LOCUS_30590 gene pgsA 131291 130692 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093751.1 protein_id gnl|my_center|LOCUS_30590 132769 131288 gene locus_tag LOCUS_30600 gene rimO 132769 131288 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973272.1 protein_id gnl|my_center|LOCUS_30600 135547 133121 gene locus_tag LOCUS_30610 135547 133121 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929902.1 protein_id gnl|my_center|LOCUS_30610 136939 135929 gene locus_tag LOCUS_30620 136939 135929 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_30620 137082 137318 gene locus_tag LOCUS_30630 137082 137318 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091994.1 protein_id gnl|my_center|LOCUS_30630 138463 137573 gene locus_tag LOCUS_30640 138463 137573 CDS product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777001.1 protein_id gnl|my_center|LOCUS_30640 139631 138480 gene locus_tag LOCUS_30650 139631 138480 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_30650 139767 140921 gene locus_tag LOCUS_30660 139767 140921 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015376.1 protein_id gnl|my_center|LOCUS_30660 141947 140946 gene locus_tag LOCUS_30670 141947 140946 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223627.1 protein_id gnl|my_center|LOCUS_30670 142759 141944 gene locus_tag LOCUS_30680 142759 141944 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228699.1 protein_id gnl|my_center|LOCUS_30680 142865 143788 gene locus_tag LOCUS_30690 142865 143788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 144627 143881 gene locus_tag LOCUS_30700 144627 143881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30700 145528 144920 gene locus_tag LOCUS_30710 gene leuD 145528 144920 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893754.1 protein_id gnl|my_center|LOCUS_30710 147014 145581 gene locus_tag LOCUS_30720 gene leuC 147014 145581 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973442.1 protein_id gnl|my_center|LOCUS_30720 147231 147953 gene locus_tag LOCUS_30730 gene ndgR 147231 147953 CDS product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_30730 148050 148775 gene locus_tag LOCUS_30740 148050 148775 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223733.1 protein_id gnl|my_center|LOCUS_30740 148940 149764 gene locus_tag LOCUS_30750 148940 149764 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028618.1 protein_id gnl|my_center|LOCUS_30750 149881 150537 gene locus_tag LOCUS_30760 149881 150537 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031472.1 protein_id gnl|my_center|LOCUS_30760 150545 150871 gene locus_tag LOCUS_30770 150545 150871 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225806.1 protein_id gnl|my_center|LOCUS_30770 150884 151888 gene locus_tag LOCUS_30780 150884 151888 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223734.1 protein_id gnl|my_center|LOCUS_30780 152290 151898 gene locus_tag LOCUS_30790 152290 151898 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228473.1 protein_id gnl|my_center|LOCUS_30790 152393 152638 gene locus_tag LOCUS_30800 152393 152638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 152635 152937 gene locus_tag LOCUS_30810 gene mazF3 152635 152937 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405820.1 protein_id gnl|my_center|LOCUS_30810 153070 152996 gene locus_tag LOCUS_t00360 153070 152996 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 153240 153168 gene locus_tag LOCUS_t00370 153240 153168 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 154365 153283 gene locus_tag LOCUS_30820 154365 153283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 155923 154379 gene locus_tag LOCUS_30830 gene gltX 155923 154379 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775887.1 protein_id gnl|my_center|LOCUS_30830 156043 156516 gene locus_tag LOCUS_30840 156043 156516 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109032714.1 protein_id gnl|my_center|LOCUS_30840 157324 156524 gene locus_tag LOCUS_30850 157324 156524 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223594.1 protein_id gnl|my_center|LOCUS_30850 157365 158660 gene locus_tag LOCUS_30860 157365 158660 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776139.1 protein_id gnl|my_center|LOCUS_30860 158713 159186 gene locus_tag LOCUS_30870 158713 159186 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893728.1 protein_id gnl|my_center|LOCUS_30870 159273 160181 gene locus_tag LOCUS_30880 159273 160181 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230390.1 protein_id gnl|my_center|LOCUS_30880 160960 160253 gene locus_tag LOCUS_30890 160960 160253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 161059 161709 gene locus_tag LOCUS_30900 161059 161709 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404111.1 protein_id gnl|my_center|LOCUS_30900 163338 161719 gene locus_tag LOCUS_30910 gene cimA 163338 161719 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_30910 163857 163543 gene locus_tag LOCUS_30920 163857 163543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 163895 164599 gene locus_tag LOCUS_30930 163895 164599 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223792.1 protein_id gnl|my_center|LOCUS_30930 165694 164609 gene locus_tag LOCUS_30940 165694 164609 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036086.1 protein_id gnl|my_center|LOCUS_30940 165790 166878 gene locus_tag LOCUS_30950 165790 166878 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030290.1 protein_id gnl|my_center|LOCUS_30950 167109 166948 gene locus_tag LOCUS_30960 167109 166948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 167265 167828 gene locus_tag LOCUS_30970 167265 167828 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974472.1 protein_id gnl|my_center|LOCUS_30970 167935 168432 gene locus_tag LOCUS_30980 167935 168432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 169544 168513 gene locus_tag LOCUS_30990 gene ilvC 169544 168513 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775904.1 protein_id gnl|my_center|LOCUS_30990 170231 169674 gene locus_tag LOCUS_31000 gene ilvN 170231 169674 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_31000 172042 170228 gene locus_tag LOCUS_31010 172042 170228 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284399.1 protein_id gnl|my_center|LOCUS_31010 172585 172418 gene locus_tag LOCUS_31020 172585 172418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 172901 172764 gene locus_tag LOCUS_31030 172901 172764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 175832 173049 gene locus_tag LOCUS_31040 gene aceE 175832 173049 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804451.1 protein_id gnl|my_center|LOCUS_31040 177451 175880 gene locus_tag LOCUS_31050 177451 175880 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804452.1 protein_id gnl|my_center|LOCUS_31050 178514 177561 gene locus_tag LOCUS_31060 gene pucL 178514 177561 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804453.1 protein_id gnl|my_center|LOCUS_31060 178933 178598 gene locus_tag LOCUS_31070 gene uraH 178933 178598 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804454.1 protein_id gnl|my_center|LOCUS_31070 179487 178930 gene locus_tag LOCUS_31080 gene uraD 179487 178930 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804455.1 protein_id gnl|my_center|LOCUS_31080 179612 180382 gene locus_tag LOCUS_31090 179612 180382 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228695.1 protein_id gnl|my_center|LOCUS_31090 181331 180345 gene locus_tag LOCUS_31100 181331 180345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 182304 181396 gene locus_tag LOCUS_31110 182304 181396 CDS product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969931.1 protein_id gnl|my_center|LOCUS_31110 183683 182301 gene locus_tag LOCUS_31120 183683 182301 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_31120 185292 183694 gene locus_tag LOCUS_31130 gene aceB 185292 183694 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804448.1 protein_id gnl|my_center|LOCUS_31130 186837 185380 gene locus_tag LOCUS_31140 186837 185380 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804449.1 protein_id gnl|my_center|LOCUS_31140 187313 186903 gene locus_tag LOCUS_31150 187313 186903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 188523 187366 gene locus_tag LOCUS_31160 188523 187366 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728292.1 protein_id gnl|my_center|LOCUS_31160 189545 188583 gene locus_tag LOCUS_31170 189545 188583 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_31170 190402 189611 gene locus_tag LOCUS_31180 190402 189611 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027565.1 protein_id gnl|my_center|LOCUS_31180 191261 190464 gene locus_tag LOCUS_31190 191261 190464 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_31190 191467 193587 gene locus_tag LOCUS_31200 gene glgX 191467 193587 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486968.1 protein_id gnl|my_center|LOCUS_31200 194308 193613 gene locus_tag LOCUS_31210 194308 193613 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728707.1 protein_id gnl|my_center|LOCUS_31210 196986 194392 gene locus_tag LOCUS_31220 196986 194392 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486976.1 protein_id gnl|my_center|LOCUS_31220 197335 197138 gene locus_tag LOCUS_31230 197335 197138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 197346 199526 gene locus_tag LOCUS_31240 197346 199526 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031595.1 protein_id gnl|my_center|LOCUS_31240 199523 201022 gene locus_tag LOCUS_31250 199523 201022 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973557.1 protein_id gnl|my_center|LOCUS_31250 201022 203226 gene locus_tag LOCUS_31260 gene glgB 201022 203226 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_31260 203223 204032 gene locus_tag LOCUS_31270 203223 204032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 205285 204458 gene locus_tag LOCUS_31280 205285 204458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 205371 206138 gene locus_tag LOCUS_31290 205371 206138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 207245 206190 gene locus_tag LOCUS_31300 207245 206190 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973580.1 protein_id gnl|my_center|LOCUS_31300 207130 208875 gene locus_tag LOCUS_31310 gene pgm 207130 208875 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728182.1 protein_id gnl|my_center|LOCUS_31310 209080 210285 gene locus_tag LOCUS_31320 209080 210285 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265565.1 protein_id gnl|my_center|LOCUS_31320 210311 210586 gene locus_tag LOCUS_31330 210311 210586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 210667 211038 gene locus_tag LOCUS_31340 210667 211038 CDS product DUF3349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077192.1 protein_id gnl|my_center|LOCUS_31340 211038 211328 gene locus_tag LOCUS_31350 211038 211328 CDS product DUF3349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094656.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31350 214667 211377 gene locus_tag LOCUS_31360 214667 211377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 216545 214797 gene locus_tag LOCUS_31370 216545 214797 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030230.1 protein_id gnl|my_center|LOCUS_31370 216725 217888 gene locus_tag LOCUS_31380 216725 217888 CDS product N-acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029924.1 protein_id gnl|my_center|LOCUS_31380 219184 217832 gene locus_tag LOCUS_31390 219184 217832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 219719 219174 gene locus_tag LOCUS_31400 219719 219174 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973586.1 protein_id gnl|my_center|LOCUS_31400 220257 219712 gene locus_tag LOCUS_31410 220257 219712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 220435 220271 gene locus_tag LOCUS_31420 220435 220271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 221456 220512 gene locus_tag LOCUS_31430 gene meaB 221456 220512 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_31430 222661 221462 gene locus_tag LOCUS_31440 222661 221462 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084654.1 protein_id gnl|my_center|LOCUS_31440 222814 224175 gene locus_tag LOCUS_31450 222814 224175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 223851 223755 gene locus_tag LOCUS_t00380 223851 223755 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 224924 224205 gene locus_tag LOCUS_31460 gene nucS 224924 224205 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730195.1 protein_id gnl|my_center|LOCUS_31460 225041 225268 gene locus_tag LOCUS_31470 225041 225268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 225325 226107 gene locus_tag LOCUS_31480 225325 226107 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_31480 226155 226391 gene locus_tag LOCUS_31490 226155 226391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 226331 226516 gene locus_tag LOCUS_31500 226331 226516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 226579 226833 gene locus_tag LOCUS_31510 226579 226833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 227486 226854 gene locus_tag LOCUS_31520 227486 226854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 227647 228330 gene locus_tag LOCUS_31530 227647 228330 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406839.1 protein_id gnl|my_center|LOCUS_31530 228327 229406 gene locus_tag LOCUS_31540 228327 229406 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972408.1 protein_id gnl|my_center|LOCUS_31540 229403 230215 gene locus_tag LOCUS_31550 229403 230215 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_31550 232432 230234 gene locus_tag LOCUS_31560 232432 230234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 233301 232429 gene locus_tag LOCUS_31570 233301 232429 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112888.1 protein_id gnl|my_center|LOCUS_31570 234248 233298 gene locus_tag LOCUS_31580 234248 233298 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803743.1 protein_id gnl|my_center|LOCUS_31580 235771 234248 gene locus_tag LOCUS_31590 235771 234248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 236974 235916 gene locus_tag LOCUS_31600 236974 235916 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742137.1 protein_id gnl|my_center|LOCUS_31600 237468 237004 gene locus_tag LOCUS_31610 237468 237004 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973622.1 protein_id gnl|my_center|LOCUS_31610 237925 237521 gene locus_tag LOCUS_31620 237925 237521 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973623.1 protein_id gnl|my_center|LOCUS_31620 239391 237928 gene locus_tag LOCUS_31630 gene atpD 239391 237928 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814333.1 protein_id gnl|my_center|LOCUS_31630 240296 239388 gene locus_tag LOCUS_31640 240296 239388 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_31640 241937 240303 gene locus_tag LOCUS_31650 gene atpA 241937 240303 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775940.1 protein_id gnl|my_center|LOCUS_31650 242850 242056 gene locus_tag LOCUS_31660 242850 242056 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_31660 243428 242847 gene locus_tag LOCUS_31670 243428 242847 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229526.1 protein_id gnl|my_center|LOCUS_31670 243678 243445 gene locus_tag LOCUS_31680 243678 243445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 244551 243754 gene locus_tag LOCUS_31690 gene atpB 244551 243754 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229528.1 protein_id gnl|my_center|LOCUS_31690 244924 244601 gene locus_tag LOCUS_31700 244924 244601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 245518 244970 gene locus_tag LOCUS_31710 245518 244970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 246807 245686 gene locus_tag LOCUS_31720 246807 245686 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030207.1 protein_id gnl|my_center|LOCUS_31720 247804 246800 gene locus_tag LOCUS_31730 247804 246800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 248690 247797 gene locus_tag LOCUS_31740 gene prmC 248690 247797 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_31740 248817 250271 gene locus_tag LOCUS_31750 248817 250271 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243731.1 protein_id gnl|my_center|LOCUS_31750 250276 251109 gene locus_tag LOCUS_31760 250276 251109 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283913.1 protein_id gnl|my_center|LOCUS_31760 252283 251210 gene locus_tag LOCUS_31770 gene prfA 252283 251210 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229537.1 protein_id gnl|my_center|LOCUS_31770 252595 252386 gene locus_tag LOCUS_31780 gene rpmE 252595 252386 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775950.1 protein_id gnl|my_center|LOCUS_31780 254849 252795 gene locus_tag LOCUS_31790 254849 252795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 256138 255227 gene locus_tag LOCUS_31800 gene thrB 256138 255227 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_31800 257234 256155 gene locus_tag LOCUS_31810 gene thrC 257234 256155 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_31810 258570 257236 gene locus_tag LOCUS_31820 258570 257236 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_31820 260093 258675 gene locus_tag LOCUS_31830 gene lysA 260093 258675 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775960.1 protein_id gnl|my_center|LOCUS_31830 260176 260248 gene locus_tag LOCUS_t00390 260176 260248 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 260350 260751 gene locus_tag LOCUS_31840 260350 260751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 260748 261092 gene locus_tag LOCUS_31850 260748 261092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 261089 262546 gene locus_tag LOCUS_31860 261089 262546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 262578 262847 gene locus_tag LOCUS_31870 262578 262847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 263369 262875 gene locus_tag LOCUS_31880 263369 262875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 263736 263380 gene locus_tag LOCUS_31890 263736 263380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 264395 263751 gene locus_tag LOCUS_31900 264395 263751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 264967 264440 gene locus_tag LOCUS_31910 264967 264440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 265473 265033 gene locus_tag LOCUS_31920 265473 265033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 265679 265470 gene locus_tag LOCUS_31930 265679 265470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 266205 265801 gene locus_tag LOCUS_31940 266205 265801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 267329 266202 gene locus_tag LOCUS_31950 267329 266202 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_31950 268465 267539 gene locus_tag LOCUS_31960 gene purU 268465 267539 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887229.1 protein_id gnl|my_center|LOCUS_31960 268547 269878 gene locus_tag LOCUS_31970 268547 269878 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326026.1 protein_id gnl|my_center|LOCUS_31970 269898 270911 gene locus_tag LOCUS_31980 269898 270911 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230309.1 protein_id gnl|my_center|LOCUS_31980 270950 274882 gene locus_tag LOCUS_31990 270950 274882 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_31990 274886 275071 gene locus_tag LOCUS_32000 274886 275071 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_32000 275977 275105 gene locus_tag LOCUS_32010 275977 275105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 276798 275974 gene locus_tag LOCUS_32020 276798 275974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 277484 276825 gene locus_tag LOCUS_32030 277484 276825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 279203 277710 gene locus_tag LOCUS_32040 gene argG 279203 277710 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226260.1 protein_id gnl|my_center|LOCUS_32040 279246 280430 gene locus_tag LOCUS_32050 gene galK 279246 280430 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_32050 280604 281506 gene locus_tag LOCUS_32060 280604 281506 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894624.1 protein_id gnl|my_center|LOCUS_32060 281503 282483 gene locus_tag LOCUS_32070 281503 282483 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053710.1 protein_id gnl|my_center|LOCUS_32070 282483 283376 gene locus_tag LOCUS_32080 282483 283376 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731387.1 protein_id gnl|my_center|LOCUS_32080 283707 283309 gene locus_tag LOCUS_32090 283707 283309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 283960 284211 gene locus_tag LOCUS_32100 283960 284211 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_32100 285876 284254 gene locus_tag LOCUS_32110 285876 284254 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_32110 285993 286343 gene locus_tag LOCUS_32120 285993 286343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 286340 287989 gene locus_tag LOCUS_32130 286340 287989 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973742.1 protein_id gnl|my_center|LOCUS_32130 288026 288169 gene locus_tag LOCUS_32140 288026 288169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 288580 288245 gene locus_tag LOCUS_32150 288580 288245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 289344 288577 gene locus_tag LOCUS_32160 gene sigR 289344 288577 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_32160 290248 289463 gene locus_tag LOCUS_32170 290248 289463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973757.1 protein_id gnl|my_center|LOCUS_32170 291032 290235 gene locus_tag LOCUS_32180 291032 290235 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_32180 291142 292077 gene locus_tag LOCUS_32190 291142 292077 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728928.1 protein_id gnl|my_center|LOCUS_32190 292154 293560 gene locus_tag LOCUS_32200 gene aroA 292154 293560 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727983.1 protein_id gnl|my_center|LOCUS_32200 293557 294690 gene locus_tag LOCUS_32210 gene rsgA 293557 294690 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775972.1 protein_id gnl|my_center|LOCUS_32210 294701 295507 gene locus_tag LOCUS_32220 gene hisN 294701 295507 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973764.1 protein_id gnl|my_center|LOCUS_32220 295550 296266 gene locus_tag LOCUS_32230 295550 296266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 297443 296238 gene locus_tag LOCUS_32240 gene serA 297443 296238 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054393.1 protein_id gnl|my_center|LOCUS_32240 298465 297488 gene locus_tag LOCUS_32250 298465 297488 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028819.1 protein_id gnl|my_center|LOCUS_32250 298588 299214 gene locus_tag LOCUS_32260 298588 299214 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730011.1 protein_id gnl|my_center|LOCUS_32260 300425 299322 gene locus_tag LOCUS_32270 300425 299322 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776452.1 protein_id gnl|my_center|LOCUS_32270 301186 300425 gene locus_tag LOCUS_32280 301186 300425 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775810.1 protein_id gnl|my_center|LOCUS_32280 301299 301373 gene locus_tag LOCUS_t00400 301299 301373 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 302236 301442 gene locus_tag LOCUS_32290 302236 301442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 303487 302408 gene locus_tag LOCUS_32300 303487 302408 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_32300 306090 303490 gene locus_tag LOCUS_32310 306090 303490 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_32310 306111 306770 gene locus_tag LOCUS_32320 306111 306770 CDS product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929986.1 protein_id gnl|my_center|LOCUS_32320 307082 307258 gene locus_tag LOCUS_32330 307082 307258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 307430 308722 gene locus_tag LOCUS_32340 307430 308722 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_32340 308719 310086 gene locus_tag LOCUS_32350 308719 310086 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030488.1 protein_id gnl|my_center|LOCUS_32350 312960 310099 gene locus_tag LOCUS_32360 312960 310099 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_32360 310226 310317 gene locus_tag LOCUS_t00410 310226 310317 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 313564 312995 gene locus_tag LOCUS_32370 313564 312995 CDS product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775978.1 protein_id gnl|my_center|LOCUS_32370 314613 313564 gene locus_tag LOCUS_32380 314613 313564 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973773.1 protein_id gnl|my_center|LOCUS_32380 315185 314610 gene locus_tag LOCUS_32390 315185 314610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 315333 317132 gene locus_tag LOCUS_32400 315333 317132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 317796 317149 gene locus_tag LOCUS_32410 317796 317149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 318428 317793 gene locus_tag LOCUS_32420 318428 317793 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867997.1 protein_id gnl|my_center|LOCUS_32420 318974 319135 gene locus_tag LOCUS_32430 318974 319135 CDS product DUF5679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551122.1 protein_id gnl|my_center|LOCUS_32430 319300 320325 gene locus_tag LOCUS_32440 319300 320325 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223145.1 protein_id gnl|my_center|LOCUS_32440 320297 321784 gene locus_tag LOCUS_32450 320297 321784 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_32450 321856 322854 gene locus_tag LOCUS_32460 321856 322854 CDS product GDP-mannose--glycolipid 4-beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037588.1 protein_id gnl|my_center|LOCUS_32460 323890 322880 gene locus_tag LOCUS_32470 323890 322880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 324283 323930 gene locus_tag LOCUS_32480 324283 323930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 324416 324868 gene locus_tag LOCUS_32490 gene hsp18 324416 324868 CDS product molecular chaperone Hsp18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908539.1 protein_id gnl|my_center|LOCUS_32490 325700 325002 gene locus_tag LOCUS_32500 325700 325002 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259190.1 protein_id gnl|my_center|LOCUS_32500 326339 325896 gene locus_tag LOCUS_32510 326339 325896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 326768 326403 gene locus_tag LOCUS_32520 326768 326403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 328957 326765 gene locus_tag LOCUS_32530 328957 326765 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_32530 329103 329366 gene locus_tag LOCUS_32540 329103 329366 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_32540 329474 333016 gene locus_tag LOCUS_32550 gene recC 329474 333016 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950425.1 protein_id gnl|my_center|LOCUS_32550 333013 336597 gene locus_tag LOCUS_32560 gene recB 333013 336597 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003905355.1 protein_id gnl|my_center|LOCUS_32560 336594 338597 gene locus_tag LOCUS_32570 gene recD 336594 338597 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900979.1 protein_id gnl|my_center|LOCUS_32570 340219 339353 gene locus_tag LOCUS_32580 gene nudC 340219 339353 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_32580 344104 340241 gene locus_tag LOCUS_32590 344104 340241 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486348.1 protein_id gnl|my_center|LOCUS_32590 347517 344101 gene locus_tag LOCUS_32600 347517 344101 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_32600 349386 347530 gene locus_tag LOCUS_32610 349386 347530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 351323 349383 gene locus_tag LOCUS_32620 351323 349383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 352428 351328 gene locus_tag LOCUS_32630 gene serB 352428 351328 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_32630 353303 352551 gene locus_tag LOCUS_32640 353303 352551 CDS product pirin-like bicupin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089568.1 protein_id gnl|my_center|LOCUS_32640 353435 353896 gene locus_tag LOCUS_32650 353435 353896 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_32650 353893 354240 gene locus_tag LOCUS_32660 353893 354240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 354494 354715 gene locus_tag LOCUS_32670 354494 354715 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551414.1 protein_id gnl|my_center|LOCUS_32670 355614 354826 gene locus_tag LOCUS_32680 355614 354826 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223733.1 protein_id gnl|my_center|LOCUS_32680 355914 357689 gene locus_tag LOCUS_32690 355914 357689 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804913.1 protein_id gnl|my_center|LOCUS_32690 357764 358654 gene locus_tag LOCUS_32700 357764 358654 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_32700 358651 359652 gene locus_tag LOCUS_32710 358651 359652 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_32710 360900 359728 gene locus_tag LOCUS_32720 gene moeZ 360900 359728 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223024.1 protein_id gnl|my_center|LOCUS_32720 361103 361714 gene locus_tag LOCUS_32730 361103 361714 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_32730 361827 363125 gene locus_tag LOCUS_32740 361827 363125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 363187 363411 gene locus_tag LOCUS_32750 363187 363411 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221492514.1 protein_id gnl|my_center|LOCUS_32750 364495 363470 gene locus_tag LOCUS_32760 364495 363470 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224942.1 protein_id gnl|my_center|LOCUS_32760 364585 365172 gene locus_tag LOCUS_32770 364585 365172 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229197.1 protein_id gnl|my_center|LOCUS_32770 365895 365200 gene locus_tag LOCUS_32780 365895 365200 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 protein_id gnl|my_center|LOCUS_32780 365988 367697 gene locus_tag LOCUS_32790 365988 367697 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804750.1 protein_id gnl|my_center|LOCUS_32790 368138 367716 gene locus_tag LOCUS_32800 368138 367716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 368116 368382 gene locus_tag LOCUS_32810 368116 368382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 369244 368423 gene locus_tag LOCUS_32820 369244 368423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 369495 370307 gene locus_tag LOCUS_32830 369495 370307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 370304 371107 gene locus_tag LOCUS_32840 370304 371107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 372722 371397 gene locus_tag LOCUS_32850 372722 371397 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_32850 373699 372782 gene locus_tag LOCUS_32860 373699 372782 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867073.1 protein_id gnl|my_center|LOCUS_32860 374464 373724 gene locus_tag LOCUS_32870 374464 373724 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893323.1 protein_id gnl|my_center|LOCUS_32870 374618 374704 gene locus_tag LOCUS_t00420 374618 374704 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 376155 374743 gene locus_tag LOCUS_32880 376155 374743 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730230.1 protein_id gnl|my_center|LOCUS_32880 376317 377339 gene locus_tag LOCUS_32890 376317 377339 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969672.1 protein_id gnl|my_center|LOCUS_32890 378592 377432 gene locus_tag LOCUS_32900 378592 377432 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226810.1 protein_id gnl|my_center|LOCUS_32900 378815 379288 gene locus_tag LOCUS_32910 378815 379288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 381464 379215 gene locus_tag LOCUS_32920 381464 379215 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226811.1 protein_id gnl|my_center|LOCUS_32920 382393 381461 gene locus_tag LOCUS_32930 382393 381461 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284614.1 protein_id gnl|my_center|LOCUS_32930 382887 384155 gene locus_tag LOCUS_32940 382887 384155 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226155.1 protein_id gnl|my_center|LOCUS_32940 384263 384976 gene locus_tag LOCUS_32950 384263 384976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 384999 385841 gene locus_tag LOCUS_32960 384999 385841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 386910 385882 gene locus_tag LOCUS_32970 gene murQ 386910 385882 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029570.1 protein_id gnl|my_center|LOCUS_32970 388100 387159 gene locus_tag LOCUS_32980 388100 387159 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 protein_id gnl|my_center|LOCUS_32980 388297 390345 gene locus_tag LOCUS_32990 388297 390345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 390350 391075 gene locus_tag LOCUS_33000 390350 391075 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_33000 391820 391095 gene locus_tag LOCUS_33010 391820 391095 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776448.1 protein_id gnl|my_center|LOCUS_33010 391907 392677 gene locus_tag LOCUS_33020 391907 392677 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775747.1 protein_id gnl|my_center|LOCUS_33020 392687 393043 gene locus_tag LOCUS_33030 392687 393043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 393075 393365 gene locus_tag LOCUS_33040 393075 393365 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008946538.1 protein_id gnl|my_center|LOCUS_33040 394687 393437 gene locus_tag LOCUS_33050 394687 393437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 395534 394758 gene locus_tag LOCUS_33060 395534 394758 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895490.1 protein_id gnl|my_center|LOCUS_33060 396184 395540 gene locus_tag LOCUS_33070 396184 395540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730838.1 protein_id gnl|my_center|LOCUS_33070 396425 398464 gene locus_tag LOCUS_33080 396425 398464 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804249.1 protein_id gnl|my_center|LOCUS_33080 399533 398877 gene locus_tag LOCUS_33090 399533 398877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 400903 399677 gene locus_tag LOCUS_33100 gene dprA 400903 399677 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487183.1 protein_id gnl|my_center|LOCUS_33100 402582 400900 gene locus_tag LOCUS_33110 402582 400900 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030329.1 protein_id gnl|my_center|LOCUS_33110 403010 402582 gene locus_tag LOCUS_33120 403010 402582 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_33120 403835 403524 gene locus_tag LOCUS_33130 403835 403524 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_33130 404535 403825 gene locus_tag LOCUS_33140 404535 403825 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087713.1 protein_id gnl|my_center|LOCUS_33140 405326 404535 gene locus_tag LOCUS_33150 405326 404535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33150 406090 405323 gene locus_tag LOCUS_33160 406090 405323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33160 406519 406124 gene locus_tag LOCUS_33170 gene rplS 406519 406124 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973398.1 protein_id gnl|my_center|LOCUS_33170 408529 406910 gene locus_tag LOCUS_33180 408529 406910 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031132.1 protein_id gnl|my_center|LOCUS_33180 409532 408783 gene locus_tag LOCUS_33190 409532 408783 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225083.1 protein_id gnl|my_center|LOCUS_33190 411877 409724 gene locus_tag LOCUS_33200 411877 409724 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977936.1 protein_id gnl|my_center|LOCUS_33200 412610 411888 gene locus_tag LOCUS_33210 412610 411888 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325539.1 protein_id gnl|my_center|LOCUS_33210 413283 412720 gene locus_tag LOCUS_33220 gene def 413283 412720 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856004.1 protein_id gnl|my_center|LOCUS_33220 415490 413280 gene locus_tag LOCUS_33230 415490 413280 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551773.1 protein_id gnl|my_center|LOCUS_33230 416459 415530 gene locus_tag LOCUS_33240 416459 415530 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972808.1 protein_id gnl|my_center|LOCUS_33240 417381 416473 gene locus_tag LOCUS_33250 417381 416473 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972807.1 protein_id gnl|my_center|LOCUS_33250 419338 417467 gene locus_tag LOCUS_33260 419338 417467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 419914 420822 gene locus_tag LOCUS_33270 419914 420822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 420952 421878 gene locus_tag LOCUS_33280 420952 421878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 422071 422787 gene locus_tag LOCUS_33290 422071 422787 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_33290 424348 422813 gene locus_tag LOCUS_33300 424348 422813 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851586.1 protein_id gnl|my_center|LOCUS_33300 425670 424495 gene locus_tag LOCUS_33310 425670 424495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 426193 425675 gene locus_tag LOCUS_33320 gene rimM 426193 425675 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973400.1 protein_id gnl|my_center|LOCUS_33320 426513 426226 gene locus_tag LOCUS_33330 426513 426226 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_33330 426947 426513 gene locus_tag LOCUS_33340 gene rpsP 426947 426513 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223849.1 protein_id gnl|my_center|LOCUS_33340 427205 427942 gene locus_tag LOCUS_33350 427205 427942 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230868.1 protein_id gnl|my_center|LOCUS_33350 429082 428186 gene locus_tag LOCUS_33360 429082 428186 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028540.1 protein_id gnl|my_center|LOCUS_33360 431961 429079 gene locus_tag LOCUS_33370 431961 429079 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227899.1 protein_id gnl|my_center|LOCUS_33370 432171 434852 gene locus_tag LOCUS_33380 432171 434852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 436190 435114 gene locus_tag LOCUS_33390 436190 435114 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976959.1 protein_id gnl|my_center|LOCUS_33390 437816 436224 gene locus_tag LOCUS_33400 gene ffh 437816 436224 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327355.1 protein_id gnl|my_center|LOCUS_33400 438012 438740 gene locus_tag LOCUS_33410 438012 438740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 438880 439581 gene locus_tag LOCUS_33420 438880 439581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 440479 439607 gene locus_tag LOCUS_33430 440479 439607 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228350.1 protein_id gnl|my_center|LOCUS_33430 440570 441976 gene locus_tag LOCUS_33440 440570 441976 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029546.1 protein_id gnl|my_center|LOCUS_33440 444837 442015 gene locus_tag LOCUS_33450 444837 442015 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223261.1 protein_id gnl|my_center|LOCUS_33450 446148 444844 gene locus_tag LOCUS_33460 446148 444844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 446710 446207 gene locus_tag LOCUS_33470 446710 446207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 447311 446730 gene locus_tag LOCUS_33480 447311 446730 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223264.1 protein_id gnl|my_center|LOCUS_33480 447635 448186 gene locus_tag LOCUS_33490 447635 448186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 451746 448462 gene locus_tag LOCUS_33500 451746 448462 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111768112.1 protein_id gnl|my_center|LOCUS_33500 451841 452362 gene locus_tag LOCUS_33510 451841 452362 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975641.1 protein_id gnl|my_center|LOCUS_33510 452433 453674 gene locus_tag LOCUS_33520 452433 453674 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162234465.1 protein_id gnl|my_center|LOCUS_33520 454904 453714 gene locus_tag LOCUS_33530 454904 453714 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929847.1 protein_id gnl|my_center|LOCUS_33530 455006 456448 gene locus_tag LOCUS_33540 455006 456448 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029647.1 protein_id gnl|my_center|LOCUS_33540 457575 456574 gene locus_tag LOCUS_33550 457575 456574 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031566.1 protein_id gnl|my_center|LOCUS_33550 457631 458128 gene locus_tag LOCUS_33560 457631 458128 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_33560 459159 458161 gene locus_tag LOCUS_33570 459159 458161 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_33570 459309 461027 gene locus_tag LOCUS_33580 459309 461027 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896053.1 protein_id gnl|my_center|LOCUS_33580 462269 461055 gene locus_tag LOCUS_33590 462269 461055 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777090.1 protein_id gnl|my_center|LOCUS_33590 463547 462363 gene locus_tag LOCUS_33600 gene ftsY 463547 462363 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_33600 463879 463616 gene locus_tag LOCUS_33610 463879 463616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 <466110 464049 gene locus_tag LOCUS_33620 <466110 464049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030315.1:chromosome segregation protein SMC >Feature sequence6 <1 597 gene locus_tag LOCUS_33630 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037897409.1:MoxR family ATPase 602 1909 gene locus_tag LOCUS_33640 602 1909 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223048.1 protein_id gnl|my_center|LOCUS_33640 2539 1988 gene locus_tag LOCUS_33650 2539 1988 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_33650 3000 2548 gene locus_tag LOCUS_33660 3000 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 4448 3006 gene locus_tag LOCUS_33670 4448 3006 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975860.1 protein_id gnl|my_center|LOCUS_33670 4929 4588 gene locus_tag LOCUS_33680 4929 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 5732 4926 gene locus_tag LOCUS_33690 5732 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 5889 7211 gene locus_tag LOCUS_33700 5889 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 7252 8532 gene locus_tag LOCUS_33710 7252 8532 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389746.1 protein_id gnl|my_center|LOCUS_33710 8581 9264 gene locus_tag LOCUS_33720 8581 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 9712 9346 gene locus_tag LOCUS_tm00010 9712 9346 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 10475 9804 gene locus_tag LOCUS_33730 10475 9804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 10444 10938 gene locus_tag LOCUS_33740 10444 10938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 12873 10954 gene locus_tag LOCUS_33750 12873 10954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 13493 12954 gene locus_tag LOCUS_33760 gene smpB 13493 12954 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_33760 14837 13551 gene locus_tag LOCUS_33770 14837 13551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 15949 15041 gene locus_tag LOCUS_33780 gene ftsX 15949 15041 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_33780 16654 15965 gene locus_tag LOCUS_33790 gene ftsE 16654 15965 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_33790 17896 16781 gene locus_tag LOCUS_33800 gene prfB 17896 16781 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141748464.1 protein_id gnl|my_center|LOCUS_33800 17992 18942 gene locus_tag LOCUS_33810 17992 18942 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027561.1 protein_id gnl|my_center|LOCUS_33810 19246 18956 gene locus_tag LOCUS_33820 19246 18956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 19629 19327 gene locus_tag LOCUS_33830 19629 19327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 20249 19707 gene locus_tag LOCUS_33840 20249 19707 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224939.1 protein_id gnl|my_center|LOCUS_33840 20323 21375 gene locus_tag LOCUS_33850 20323 21375 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223769.1 protein_id gnl|my_center|LOCUS_33850 21482 21407 gene locus_tag LOCUS_t00430 21482 21407 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 21737 21498 gene locus_tag LOCUS_33860 21737 21498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 22204 21734 gene locus_tag LOCUS_33870 22204 21734 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 protein_id gnl|my_center|LOCUS_33870 22636 22208 gene locus_tag LOCUS_33880 22636 22208 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224000.1 protein_id gnl|my_center|LOCUS_33880 24072 22810 gene locus_tag LOCUS_33890 24072 22810 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259394.1 protein_id gnl|my_center|LOCUS_33890 23231 23129 gene locus_tag LOCUS_t00440 23231 23129 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25176 24133 gene locus_tag LOCUS_33900 25176 24133 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399801.1 protein_id gnl|my_center|LOCUS_33900 25231 26451 gene locus_tag LOCUS_33910 gene fasR 25231 26451 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_33910 26493 26990 gene locus_tag LOCUS_33920 26493 26990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 27121 28140 gene locus_tag LOCUS_33930 27121 28140 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775707.1 protein_id gnl|my_center|LOCUS_33930 28303 28548 gene locus_tag LOCUS_33940 28303 28548 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976417.1 protein_id gnl|my_center|LOCUS_33940 28622 29881 gene locus_tag LOCUS_33950 28622 29881 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_33950 29929 30132 gene locus_tag LOCUS_33960 29929 30132 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339146.1 protein_id gnl|my_center|LOCUS_33960 31165 30215 gene locus_tag LOCUS_33970 31165 30215 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877923.1 protein_id gnl|my_center|LOCUS_33970 33067 31229 gene locus_tag LOCUS_33980 33067 31229 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327729.1 protein_id gnl|my_center|LOCUS_33980 33825 33328 gene locus_tag LOCUS_33990 33825 33328 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_33990 34060 33902 gene locus_tag LOCUS_34000 34060 33902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 34029 35999 gene locus_tag LOCUS_34010 34029 35999 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_34010 36718 35996 gene locus_tag LOCUS_34020 36718 35996 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811326.1 protein_id gnl|my_center|LOCUS_34020 38366 36753 gene locus_tag LOCUS_34030 38366 36753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 39460 38486 gene locus_tag LOCUS_34040 39460 38486 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 protein_id gnl|my_center|LOCUS_34040 40466 39489 gene locus_tag LOCUS_34050 40466 39489 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_34050 41677 40484 gene locus_tag LOCUS_34060 41677 40484 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728848.1 protein_id gnl|my_center|LOCUS_34060 42749 41688 gene locus_tag LOCUS_34070 42749 41688 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_34070 43021 43998 gene locus_tag LOCUS_34080 43021 43998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 44107 45006 gene locus_tag LOCUS_34090 44107 45006 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897816.1 protein_id gnl|my_center|LOCUS_34090 45003 46304 gene locus_tag LOCUS_34100 45003 46304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 46350 47357 gene locus_tag LOCUS_34110 46350 47357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 47319 47393 gene locus_tag LOCUS_t00450 47319 47393 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 47466 48881 gene locus_tag LOCUS_34120 47466 48881 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459733.1 protein_id gnl|my_center|LOCUS_34120 48878 49807 gene locus_tag LOCUS_34130 48878 49807 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 protein_id gnl|my_center|LOCUS_34130 49877 50929 gene locus_tag LOCUS_34140 49877 50929 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532261.1 protein_id gnl|my_center|LOCUS_34140 51738 50905 gene locus_tag LOCUS_34150 51738 50905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 52304 51735 gene locus_tag LOCUS_34160 52304 51735 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225943.1 protein_id gnl|my_center|LOCUS_34160 53444 52626 gene locus_tag LOCUS_34170 gene otsB 53444 52626 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029558.1 protein_id gnl|my_center|LOCUS_34170 53537 55003 gene locus_tag LOCUS_34180 53537 55003 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062235.1 protein_id gnl|my_center|LOCUS_34180 55144 55217 gene locus_tag LOCUS_t00460 55144 55217 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 55271 55951 gene locus_tag LOCUS_34190 55271 55951 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013562.1 protein_id gnl|my_center|LOCUS_34190 56320 55958 gene locus_tag LOCUS_34200 56320 55958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 56940 56593 gene locus_tag LOCUS_34210 56940 56593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 57473 56943 gene locus_tag LOCUS_34220 57473 56943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 58566 57700 gene locus_tag LOCUS_34230 gene rpoD 58566 57700 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141334.1 protein_id gnl|my_center|LOCUS_34230 60553 58655 gene locus_tag LOCUS_34240 gene dnaG 60553 58655 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228362.1 protein_id gnl|my_center|LOCUS_34240 60685 62934 gene locus_tag LOCUS_34250 60685 62934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 63044 63697 gene locus_tag LOCUS_34260 63044 63697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 63738 64154 gene locus_tag LOCUS_34270 63738 64154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 64199 64957 gene locus_tag LOCUS_34280 64199 64957 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227890.1 protein_id gnl|my_center|LOCUS_34280 65023 66489 gene locus_tag LOCUS_34290 65023 66489 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230704.1 protein_id gnl|my_center|LOCUS_34290 66486 67034 gene locus_tag LOCUS_34300 66486 67034 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230705.1 protein_id gnl|my_center|LOCUS_34300 68427 67117 gene locus_tag LOCUS_34310 68427 67117 CDS product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097444.1 protein_id gnl|my_center|LOCUS_34310 68530 69681 gene locus_tag LOCUS_34320 68530 69681 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225745.1 protein_id gnl|my_center|LOCUS_34320 71916 69709 gene locus_tag LOCUS_34330 71916 69709 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804378.1 protein_id gnl|my_center|LOCUS_34330 73639 72020 gene locus_tag LOCUS_34340 73639 72020 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224032.1 protein_id gnl|my_center|LOCUS_34340 74955 73768 gene locus_tag LOCUS_34350 74955 73768 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_34350 75050 75601 gene locus_tag LOCUS_34360 75050 75601 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296608.1 protein_id gnl|my_center|LOCUS_34360 76702 75623 gene locus_tag LOCUS_34370 gene dusB 76702 75623 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230697.1 protein_id gnl|my_center|LOCUS_34370 77083 76766 gene locus_tag LOCUS_34380 77083 76766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 77372 77632 gene locus_tag LOCUS_34390 77372 77632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 78500 77655 gene locus_tag LOCUS_34400 78500 77655 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230418.1 protein_id gnl|my_center|LOCUS_34400 79415 78540 gene locus_tag LOCUS_34410 79415 78540 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230419.1 protein_id gnl|my_center|LOCUS_34410 80406 79477 gene locus_tag LOCUS_34420 80406 79477 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230420.1 protein_id gnl|my_center|LOCUS_34420 80494 80943 gene locus_tag LOCUS_34430 80494 80943 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895858.1 protein_id gnl|my_center|LOCUS_34430 81758 80940 gene locus_tag LOCUS_34440 81758 80940 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976293.1 protein_id gnl|my_center|LOCUS_34440 81808 82548 gene locus_tag LOCUS_34450 gene recO 81808 82548 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228390.1 protein_id gnl|my_center|LOCUS_34450 82535 84055 gene locus_tag LOCUS_34460 82535 84055 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854953.1 protein_id gnl|my_center|LOCUS_34460 85861 84077 gene locus_tag LOCUS_34470 gene leuA 85861 84077 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976275.1 protein_id gnl|my_center|LOCUS_34470 85982 86992 gene locus_tag LOCUS_34480 85982 86992 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776972.1 protein_id gnl|my_center|LOCUS_34480 87038 87682 gene locus_tag LOCUS_34490 87038 87682 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776971.1 protein_id gnl|my_center|LOCUS_34490 87679 88524 gene locus_tag LOCUS_34500 87679 88524 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776970.1 protein_id gnl|my_center|LOCUS_34500 88549 88929 gene locus_tag LOCUS_34510 88549 88929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 89010 89813 gene locus_tag LOCUS_34520 89010 89813 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223253.1 protein_id gnl|my_center|LOCUS_34520 90974 90015 gene locus_tag LOCUS_34530 gene era 90974 90015 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 protein_id gnl|my_center|LOCUS_34530 91347 90967 gene locus_tag LOCUS_34540 91347 90967 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456125.1 protein_id gnl|my_center|LOCUS_34540 92679 91351 gene locus_tag LOCUS_34550 92679 91351 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_34550 93164 92676 gene locus_tag LOCUS_34560 gene ybeY 93164 92676 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976270.1 protein_id gnl|my_center|LOCUS_34560 94264 93161 gene locus_tag LOCUS_34570 94264 93161 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_34570 95180 94320 gene locus_tag LOCUS_34580 95180 94320 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531059.1 protein_id gnl|my_center|LOCUS_34580 95260 95775 gene locus_tag LOCUS_34590 95260 95775 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191904.1 protein_id gnl|my_center|LOCUS_34590 96689 95715 gene locus_tag LOCUS_34600 gene pip 96689 95715 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204007.1 protein_id gnl|my_center|LOCUS_34600 97168 96707 gene locus_tag LOCUS_34610 97168 96707 CDS product DUF5709 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027611.1 protein_id gnl|my_center|LOCUS_34610 97226 97957 gene locus_tag LOCUS_34620 97226 97957 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070188143.1 protein_id gnl|my_center|LOCUS_34620 97932 98738 gene locus_tag LOCUS_34630 97932 98738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 98735 99469 gene locus_tag LOCUS_34640 98735 99469 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_34640 100673 99432 gene locus_tag LOCUS_34650 gene tgt 100673 99432 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112950.1 protein_id gnl|my_center|LOCUS_34650 101404 100670 gene locus_tag LOCUS_34660 101404 100670 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 protein_id gnl|my_center|LOCUS_34660 102605 101418 gene locus_tag LOCUS_34670 gene dnaJ 102605 101418 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_34670 103751 102693 gene locus_tag LOCUS_34680 gene hrcA 103751 102693 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123574708.1 protein_id gnl|my_center|LOCUS_34680 103827 104732 gene locus_tag LOCUS_34690 103827 104732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 104842 105273 gene locus_tag LOCUS_34700 104842 105273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 105321 106220 gene locus_tag LOCUS_34710 105321 106220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 106384 107436 gene locus_tag LOCUS_34720 106384 107436 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284156.1 protein_id gnl|my_center|LOCUS_34720 108096 107461 gene locus_tag LOCUS_34730 108096 107461 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078016.1 protein_id gnl|my_center|LOCUS_34730 108209 109105 gene locus_tag LOCUS_34740 108209 109105 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728763.1 protein_id gnl|my_center|LOCUS_34740 110333 109116 gene locus_tag LOCUS_34750 gene hemW 110333 109116 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_34750 111238 110333 gene locus_tag LOCUS_34760 111238 110333 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898125.1 protein_id gnl|my_center|LOCUS_34760 111305 112597 gene locus_tag LOCUS_34770 111305 112597 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230134.1 protein_id gnl|my_center|LOCUS_34770 112597 113556 gene locus_tag LOCUS_34780 112597 113556 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230135.1 protein_id gnl|my_center|LOCUS_34780 113570 114397 gene locus_tag LOCUS_34790 113570 114397 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230136.1 protein_id gnl|my_center|LOCUS_34790 114472 115701 gene locus_tag LOCUS_34800 114472 115701 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043778558.1 protein_id gnl|my_center|LOCUS_34800 116390 115713 gene locus_tag LOCUS_34810 116390 115713 CDS product heme peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728839.1 protein_id gnl|my_center|LOCUS_34810 118549 116435 gene locus_tag LOCUS_34820 118549 116435 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971555.1 protein_id gnl|my_center|LOCUS_34820 119863 118709 gene locus_tag LOCUS_34830 119863 118709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 121843 119981 gene locus_tag LOCUS_34840 gene lepA 121843 119981 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976242.1 protein_id gnl|my_center|LOCUS_34840 123489 121897 gene locus_tag LOCUS_34850 123489 121897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 123617 123880 gene locus_tag LOCUS_34860 gene rpsT 123617 123880 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_34860 124993 124013 gene locus_tag LOCUS_34870 gene holA 124993 124013 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485035.1 protein_id gnl|my_center|LOCUS_34870 127461 125107 gene locus_tag LOCUS_34880 127461 125107 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028431.1 protein_id gnl|my_center|LOCUS_34880 129049 127754 gene locus_tag LOCUS_34890 129049 127754 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529753.1 protein_id gnl|my_center|LOCUS_34890 129024 129209 gene locus_tag LOCUS_34900 129024 129209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 130319 129270 gene locus_tag LOCUS_34910 130319 129270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 130602 131645 gene locus_tag LOCUS_34920 130602 131645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 131713 132780 gene locus_tag LOCUS_34930 131713 132780 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085283.1 protein_id gnl|my_center|LOCUS_34930 132777 133808 gene locus_tag LOCUS_34940 132777 133808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 136435 133916 gene locus_tag LOCUS_34950 gene leuS 136435 133916 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_34950 137209 136586 gene locus_tag LOCUS_34960 137209 136586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 138211 137219 gene locus_tag LOCUS_34970 138211 137219 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_34970 138272 139306 gene locus_tag LOCUS_34980 138272 139306 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257892.1 protein_id gnl|my_center|LOCUS_34980 139303 140202 gene locus_tag LOCUS_34990 139303 140202 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114860.1 protein_id gnl|my_center|LOCUS_34990 140199 141410 gene locus_tag LOCUS_35000 140199 141410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 141421 142434 gene locus_tag LOCUS_35010 gene galE 141421 142434 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_35010 142501 142788 gene locus_tag LOCUS_35020 142501 142788 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229766.1 protein_id gnl|my_center|LOCUS_35020 143013 144413 gene locus_tag LOCUS_35030 143013 144413 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087724.1 protein_id gnl|my_center|LOCUS_35030 144410 144748 gene locus_tag LOCUS_35040 144410 144748 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051565.1 protein_id gnl|my_center|LOCUS_35040 144841 147147 gene locus_tag LOCUS_35050 144841 147147 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487177.1 protein_id gnl|my_center|LOCUS_35050 148318 147782 gene locus_tag LOCUS_35060 148318 147782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 149657 148710 gene locus_tag LOCUS_35070 149657 148710 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028065.1 protein_id gnl|my_center|LOCUS_35070 150764 149667 gene locus_tag LOCUS_35080 150764 149667 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179809238.1 protein_id gnl|my_center|LOCUS_35080 150911 151612 gene locus_tag LOCUS_35090 150911 151612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 151648 152694 gene locus_tag LOCUS_35100 151648 152694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 153095 152718 gene locus_tag LOCUS_35110 153095 152718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 153496 153107 gene locus_tag LOCUS_35120 153496 153107 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296550.1 protein_id gnl|my_center|LOCUS_35120 154592 153582 gene locus_tag LOCUS_35130 154592 153582 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_35130 155683 154592 gene locus_tag LOCUS_35140 155683 154592 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_35140 155866 156798 gene locus_tag LOCUS_35150 gene folP 155866 156798 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327205.1 protein_id gnl|my_center|LOCUS_35150 156795 157454 gene locus_tag LOCUS_35160 156795 157454 CDS product class III extradiol dioxygenase subunit B-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030454.1 protein_id gnl|my_center|LOCUS_35160 158669 157455 gene locus_tag LOCUS_35170 158669 157455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 159766 158666 gene locus_tag LOCUS_35180 159766 158666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 160158 160727 gene locus_tag LOCUS_35190 160158 160727 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084689.1 protein_id gnl|my_center|LOCUS_35190 161127 160738 gene locus_tag LOCUS_35200 161127 160738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 161912 161175 gene locus_tag LOCUS_35210 161912 161175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 161988 162536 gene locus_tag LOCUS_35220 161988 162536 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730372.1 protein_id gnl|my_center|LOCUS_35220 163227 162556 gene locus_tag LOCUS_35230 163227 162556 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230842.1 protein_id gnl|my_center|LOCUS_35230 163214 164581 gene locus_tag LOCUS_35240 163214 164581 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977776.1 protein_id gnl|my_center|LOCUS_35240 165658 164747 gene locus_tag LOCUS_35250 165658 164747 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222971.1 protein_id gnl|my_center|LOCUS_35250 165828 167000 gene locus_tag LOCUS_35260 165828 167000 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087812.1 protein_id gnl|my_center|LOCUS_35260 167024 167284 gene locus_tag LOCUS_35270 167024 167284 CDS product DUF2630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224533.1 protein_id gnl|my_center|LOCUS_35270 167305 168990 gene locus_tag LOCUS_35280 167305 168990 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104297.1 protein_id gnl|my_center|LOCUS_35280 169023 169601 gene locus_tag LOCUS_35290 169023 169601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 170339 169611 gene locus_tag LOCUS_35300 170339 169611 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224232.1 protein_id gnl|my_center|LOCUS_35300 170383 171381 gene locus_tag LOCUS_35310 170383 171381 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475972.1 protein_id gnl|my_center|LOCUS_35310 172491 171403 gene locus_tag LOCUS_35320 172491 171403 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973464.1 protein_id gnl|my_center|LOCUS_35320 172645 173898 gene locus_tag LOCUS_35330 172645 173898 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971515.1 protein_id gnl|my_center|LOCUS_35330 173981 174775 gene locus_tag LOCUS_35340 173981 174775 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804035.1 protein_id gnl|my_center|LOCUS_35340 174772 175596 gene locus_tag LOCUS_35350 174772 175596 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227771.1 protein_id gnl|my_center|LOCUS_35350 176845 175571 gene locus_tag LOCUS_35360 gene tetA(P) 176845 175571 CDS product tetracycline efflux MFS transporter TetA(P) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964756.1 protein_id gnl|my_center|LOCUS_35360 177010 177516 gene locus_tag LOCUS_35370 177010 177516 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029611.1 protein_id gnl|my_center|LOCUS_35370 179406 177592 gene locus_tag LOCUS_35380 179406 177592 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227358.1 protein_id gnl|my_center|LOCUS_35380 181262 179403 gene locus_tag LOCUS_35390 181262 179403 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227357.1 protein_id gnl|my_center|LOCUS_35390 181433 181969 gene locus_tag LOCUS_35400 181433 181969 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228370.1 protein_id gnl|my_center|LOCUS_35400 183646 182099 gene locus_tag LOCUS_35410 183646 182099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 184552 183758 gene locus_tag LOCUS_35420 184552 183758 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223631.1 protein_id gnl|my_center|LOCUS_35420 185046 184549 gene locus_tag LOCUS_35430 185046 184549 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225543.1 protein_id gnl|my_center|LOCUS_35430 186505 185120 gene locus_tag LOCUS_35440 186505 185120 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225544.1 protein_id gnl|my_center|LOCUS_35440 186447 186638 gene locus_tag LOCUS_35450 186447 186638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 186728 187579 gene locus_tag LOCUS_35460 186728 187579 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777099.1 protein_id gnl|my_center|LOCUS_35460 188034 187714 gene locus_tag LOCUS_35470 188034 187714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 188872 188207 gene locus_tag LOCUS_35480 188872 188207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230855.1 protein_id gnl|my_center|LOCUS_35480 189510 188863 gene locus_tag LOCUS_35490 189510 188863 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230856.1 protein_id gnl|my_center|LOCUS_35490 190027 189581 gene locus_tag LOCUS_35500 190027 189581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 190981 190043 gene locus_tag LOCUS_35510 190981 190043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 191696 191085 gene locus_tag LOCUS_35520 191696 191085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 192271 191696 gene locus_tag LOCUS_35530 192271 191696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 192705 192268 gene locus_tag LOCUS_35540 192705 192268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 192884 192702 gene locus_tag LOCUS_35550 192884 192702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 193643 193125 gene locus_tag LOCUS_35560 193643 193125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 194557 193772 gene locus_tag LOCUS_35570 gene aqpZ 194557 193772 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102790.1 protein_id gnl|my_center|LOCUS_35570 195140 194721 gene locus_tag LOCUS_35580 195140 194721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 195638 195408 gene locus_tag LOCUS_35590 195638 195408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 197021 195714 gene locus_tag LOCUS_35600 197021 195714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 197692 197018 gene locus_tag LOCUS_35610 197692 197018 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222808.1 protein_id gnl|my_center|LOCUS_35610 198196 197729 gene locus_tag LOCUS_35620 198196 197729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 198908 198390 gene locus_tag LOCUS_35630 198908 198390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 199843 198956 gene locus_tag LOCUS_35640 199843 198956 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887314.1 protein_id gnl|my_center|LOCUS_35640 201687 199897 gene locus_tag LOCUS_35650 201687 199897 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227541.1 protein_id gnl|my_center|LOCUS_35650 201810 202271 gene locus_tag LOCUS_35660 201810 202271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 203216 202284 gene locus_tag LOCUS_35670 203216 202284 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727027.1 protein_id gnl|my_center|LOCUS_35670 203310 204494 gene locus_tag LOCUS_35680 203310 204494 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728588.1 protein_id gnl|my_center|LOCUS_35680 205267 204542 gene locus_tag LOCUS_35690 205267 204542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 205956 205297 gene locus_tag LOCUS_35700 205956 205297 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090769.1 protein_id gnl|my_center|LOCUS_35700 208209 206035 gene locus_tag LOCUS_35710 208209 206035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 208883 208254 gene locus_tag LOCUS_35720 208883 208254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 209440 208880 gene locus_tag LOCUS_35730 209440 208880 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870827.1 protein_id gnl|my_center|LOCUS_35730 209505 210491 gene locus_tag LOCUS_35740 209505 210491 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903868.1 protein_id gnl|my_center|LOCUS_35740 210648 211409 gene locus_tag LOCUS_35750 210648 211409 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971646.1 protein_id gnl|my_center|LOCUS_35750 212352 211420 gene locus_tag LOCUS_35760 212352 211420 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_35760 212789 212349 gene locus_tag LOCUS_35770 212789 212349 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224170.1 protein_id gnl|my_center|LOCUS_35770 213573 213923 gene locus_tag LOCUS_35780 213573 213923 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974904.1 protein_id gnl|my_center|LOCUS_35780 213998 214552 gene locus_tag LOCUS_35790 213998 214552 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023518.1 protein_id gnl|my_center|LOCUS_35790 215338 215682 gene locus_tag LOCUS_35800 215338 215682 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804905.1 protein_id gnl|my_center|LOCUS_35800 216398 217957 gene locus_tag LOCUS_35810 216398 217957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227708.1 protein_id gnl|my_center|LOCUS_35810 218158 218355 gene locus_tag LOCUS_35820 218158 218355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 218352 219506 gene locus_tag LOCUS_35830 218352 219506 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230505.1 protein_id gnl|my_center|LOCUS_35830 219648 219571 gene locus_tag LOCUS_t00470 219648 219571 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 220362 219721 gene locus_tag LOCUS_35840 220362 219721 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976227.1 protein_id gnl|my_center|LOCUS_35840 220640 220359 gene locus_tag LOCUS_35850 220640 220359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 221491 220763 gene locus_tag LOCUS_35860 gene nadD 221491 220763 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_35860 221657 221511 gene locus_tag LOCUS_35870 221657 221511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 222941 221682 gene locus_tag LOCUS_35880 222941 221682 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_35880 223211 224113 gene locus_tag LOCUS_35890 223211 224113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 224110 224643 gene locus_tag LOCUS_35900 224110 224643 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889092.1 protein_id gnl|my_center|LOCUS_35900 225544 224741 gene locus_tag LOCUS_35910 225544 224741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 225565 226347 gene locus_tag LOCUS_35920 225565 226347 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222271.1 protein_id gnl|my_center|LOCUS_35920 226971 226405 gene locus_tag LOCUS_35930 226971 226405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 227456 226968 gene locus_tag LOCUS_35940 227456 226968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 229263 227503 gene locus_tag LOCUS_35950 229263 227503 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052568.1 protein_id gnl|my_center|LOCUS_35950 230258 229260 gene locus_tag LOCUS_35960 230258 229260 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363253.1 protein_id gnl|my_center|LOCUS_35960 231343 230258 gene locus_tag LOCUS_35970 231343 230258 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775832.1 protein_id gnl|my_center|LOCUS_35970 233245 231392 gene locus_tag LOCUS_35980 233245 231392 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115413031.1 protein_id gnl|my_center|LOCUS_35980 233358 234896 gene locus_tag LOCUS_35990 233358 234896 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730628.1 protein_id gnl|my_center|LOCUS_35990 234998 236080 gene locus_tag LOCUS_36000 234998 236080 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028408.1 protein_id gnl|my_center|LOCUS_36000 236077 236733 gene locus_tag LOCUS_36010 236077 236733 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410207.1 protein_id gnl|my_center|LOCUS_36010 237100 236714 gene locus_tag LOCUS_36020 237100 236714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080796943.1 protein_id gnl|my_center|LOCUS_36020 237075 237308 gene locus_tag LOCUS_36030 237075 237308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 237520 238392 gene locus_tag LOCUS_36040 237520 238392 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172953.1 protein_id gnl|my_center|LOCUS_36040 241322 238488 gene locus_tag LOCUS_36050 241322 238488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 242541 241438 gene locus_tag LOCUS_36060 gene proB 242541 241438 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_36060 244033 242561 gene locus_tag LOCUS_36070 gene obgE 244033 242561 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 protein_id gnl|my_center|LOCUS_36070 244420 244142 gene locus_tag LOCUS_36080 gene rpmA 244420 244142 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_36080 244741 244433 gene locus_tag LOCUS_36090 gene rplU 244741 244433 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896002.1 protein_id gnl|my_center|LOCUS_36090 244948 245718 gene locus_tag LOCUS_36100 244948 245718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256421.1 protein_id gnl|my_center|LOCUS_36100 245715 246110 gene locus_tag LOCUS_36110 245715 246110 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 protein_id gnl|my_center|LOCUS_36110 247428 246154 gene locus_tag LOCUS_36120 247428 246154 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082601.1 protein_id gnl|my_center|LOCUS_36120 247532 247873 gene locus_tag LOCUS_36130 247532 247873 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804405.1 protein_id gnl|my_center|LOCUS_36130 248061 248666 gene locus_tag LOCUS_36140 248061 248666 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226757.1 protein_id gnl|my_center|LOCUS_36140 248659 249900 gene locus_tag LOCUS_36150 248659 249900 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028035.1 protein_id gnl|my_center|LOCUS_36150 249897 251108 gene locus_tag LOCUS_36160 249897 251108 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757481.1 protein_id gnl|my_center|LOCUS_36160 251260 251844 gene locus_tag LOCUS_36170 251260 251844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 251934 252605 gene locus_tag LOCUS_36180 251934 252605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 254104 252629 gene locus_tag LOCUS_36190 254104 252629 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479549.1 protein_id gnl|my_center|LOCUS_36190 257580 254170 gene locus_tag LOCUS_36200 257580 254170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36200 258626 257874 gene locus_tag LOCUS_36210 258626 257874 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_36210 259301 258633 gene locus_tag LOCUS_36220 259301 258633 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727382.1 protein_id gnl|my_center|LOCUS_36220 259478 261070 gene locus_tag LOCUS_36230 259478 261070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 261221 262081 gene locus_tag LOCUS_36240 261221 262081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 264121 262157 gene locus_tag LOCUS_36250 264121 262157 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_36250 264565 264134 gene locus_tag LOCUS_36260 264565 264134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 264948 264562 gene locus_tag LOCUS_36270 264948 264562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 265532 264945 gene locus_tag LOCUS_36280 265532 264945 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972189.1 protein_id gnl|my_center|LOCUS_36280 267196 265574 gene locus_tag LOCUS_36290 267196 265574 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892272.1 protein_id gnl|my_center|LOCUS_36290 267813 267193 gene locus_tag LOCUS_36300 267813 267193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 270821 267810 gene locus_tag LOCUS_36310 270821 267810 CDS product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727236.1 protein_id gnl|my_center|LOCUS_36310 272370 271081 gene locus_tag LOCUS_36320 272370 271081 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742232.1 protein_id gnl|my_center|LOCUS_36320 273364 272648 gene locus_tag LOCUS_36330 273364 272648 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975444.1 protein_id gnl|my_center|LOCUS_36330 274695 273364 gene locus_tag LOCUS_36340 274695 273364 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_36340 275195 274758 gene locus_tag LOCUS_36350 gene ndk 275195 274758 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729972.1 protein_id gnl|my_center|LOCUS_36350 275354 276154 gene locus_tag LOCUS_36360 275354 276154 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973364.1 protein_id gnl|my_center|LOCUS_36360 276151 276978 gene locus_tag LOCUS_36370 276151 276978 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222446.1 protein_id gnl|my_center|LOCUS_36370 277060 278394 gene locus_tag LOCUS_36380 gene eis2 277060 278394 CDS product amikacin resistance N-acetyltransferase Eis2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079811.1 protein_id gnl|my_center|LOCUS_36380 278514 279311 gene locus_tag LOCUS_36390 278514 279311 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776722.1 protein_id gnl|my_center|LOCUS_36390 280423 279446 gene locus_tag LOCUS_36400 280423 279446 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902161.1 protein_id gnl|my_center|LOCUS_36400 281463 280474 gene locus_tag LOCUS_36410 281463 280474 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027417.1 protein_id gnl|my_center|LOCUS_36410 281630 282994 gene locus_tag LOCUS_36420 281630 282994 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229016.1 protein_id gnl|my_center|LOCUS_36420 282997 285462 gene locus_tag LOCUS_36430 282997 285462 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156722191.1 protein_id gnl|my_center|LOCUS_36430 285648 286862 gene locus_tag LOCUS_36440 285648 286862 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729341.1 protein_id gnl|my_center|LOCUS_36440 286989 287579 gene locus_tag LOCUS_36450 286989 287579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 287982 287620 gene locus_tag LOCUS_36460 287982 287620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 289787 287979 gene locus_tag LOCUS_36470 289787 287979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 289887 290540 gene locus_tag LOCUS_36480 289887 290540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 290589 291809 gene locus_tag LOCUS_36490 290589 291809 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228905.1 protein_id gnl|my_center|LOCUS_36490 291814 293001 gene locus_tag LOCUS_36500 291814 293001 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027238.1 protein_id gnl|my_center|LOCUS_36500 293277 294032 gene locus_tag LOCUS_36510 293277 294032 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_36510 294154 294029 gene locus_tag LOCUS_36520 294154 294029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 295230 294154 gene locus_tag LOCUS_36530 295230 294154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 295309 297933 gene locus_tag LOCUS_36540 gene valS 295309 297933 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224259.1 protein_id gnl|my_center|LOCUS_36540 298573 298118 gene locus_tag LOCUS_36550 298573 298118 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974764.1 protein_id gnl|my_center|LOCUS_36550 298622 299449 gene locus_tag LOCUS_36560 298622 299449 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222740.1 protein_id gnl|my_center|LOCUS_36560 299712 301025 gene locus_tag LOCUS_36570 299712 301025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 301022 302047 gene locus_tag LOCUS_36580 301022 302047 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225105.1 protein_id gnl|my_center|LOCUS_36580 302044 302925 gene locus_tag LOCUS_36590 302044 302925 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410221.1 protein_id gnl|my_center|LOCUS_36590 303025 303825 gene locus_tag LOCUS_36600 303025 303825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 305271 303832 gene locus_tag LOCUS_36610 305271 303832 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061268956.1 protein_id gnl|my_center|LOCUS_36610 305533 307635 gene locus_tag LOCUS_36620 gene glgX 305533 307635 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 protein_id gnl|my_center|LOCUS_36620 307790 309301 gene locus_tag LOCUS_36630 307790 309301 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972907.1 protein_id gnl|my_center|LOCUS_36630 309304 309870 gene locus_tag LOCUS_36640 309304 309870 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939756.1 protein_id gnl|my_center|LOCUS_36640 311033 309915 gene locus_tag LOCUS_36650 311033 309915 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227995.1 protein_id gnl|my_center|LOCUS_36650 312085 311030 gene locus_tag LOCUS_36660 312085 311030 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898171.1 protein_id gnl|my_center|LOCUS_36660 313047 312082 gene locus_tag LOCUS_36670 313047 312082 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976259.1 protein_id gnl|my_center|LOCUS_36670 314693 313404 gene locus_tag LOCUS_36680 gene clpX 314693 313404 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896045.1 protein_id gnl|my_center|LOCUS_36680 315482 314823 gene locus_tag LOCUS_36690 315482 314823 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930165.1 protein_id gnl|my_center|LOCUS_36690 316144 315494 gene locus_tag LOCUS_36700 316144 315494 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115412275.1 protein_id gnl|my_center|LOCUS_36700 316276 316767 gene locus_tag LOCUS_36710 316276 316767 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036604.1 protein_id gnl|my_center|LOCUS_36710 317798 316851 gene locus_tag LOCUS_36720 317798 316851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 319433 317928 gene locus_tag LOCUS_36730 gene tig 319433 317928 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_36730 319749 319823 gene locus_tag LOCUS_t00480 319749 319823 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 319853 319926 gene locus_tag LOCUS_t00490 319853 319926 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 320876 319947 gene locus_tag LOCUS_36740 320876 319947 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226614.1 protein_id gnl|my_center|LOCUS_36740 321072 320929 gene locus_tag LOCUS_36750 321072 320929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 322255 321170 gene locus_tag LOCUS_36760 322255 321170 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804775.1 protein_id gnl|my_center|LOCUS_36760 323023 322454 gene locus_tag LOCUS_36770 323023 322454 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228802.1 protein_id gnl|my_center|LOCUS_36770 323148 324038 gene locus_tag LOCUS_36780 323148 324038 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228801.1 protein_id gnl|my_center|LOCUS_36780 325002 324055 gene locus_tag LOCUS_36790 gene sigJ 325002 324055 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030761.1 protein_id gnl|my_center|LOCUS_36790 326399 324999 gene locus_tag LOCUS_36800 326399 324999 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031431.1 protein_id gnl|my_center|LOCUS_36800 327282 326491 gene locus_tag LOCUS_36810 327282 326491 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222374.1 protein_id gnl|my_center|LOCUS_36810 327437 328945 gene locus_tag LOCUS_36820 327437 328945 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804819.1 protein_id gnl|my_center|LOCUS_36820 328945 329907 gene locus_tag LOCUS_36830 gene prpB 328945 329907 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731425.1 protein_id gnl|my_center|LOCUS_36830 329904 331034 gene locus_tag LOCUS_36840 329904 331034 CDS product bifunctional 2-methylcitrate synthase/citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079735.1 protein_id gnl|my_center|LOCUS_36840 332036 331062 gene locus_tag LOCUS_36850 332036 331062 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 protein_id gnl|my_center|LOCUS_36850 332353 332033 gene locus_tag LOCUS_36860 332353 332033 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897009.1 protein_id gnl|my_center|LOCUS_36860 333986 332649 gene locus_tag LOCUS_36870 333986 332649 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029671.1 protein_id gnl|my_center|LOCUS_36870 334008 334283 gene locus_tag LOCUS_36880 334008 334283 CDS product Rho termination factor N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_36880 335285 334302 gene locus_tag LOCUS_36890 335285 334302 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030497.1 protein_id gnl|my_center|LOCUS_36890 336526 335327 gene locus_tag LOCUS_36900 336526 335327 CDS product AgaS family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030496.1 protein_id gnl|my_center|LOCUS_36900 337896 336523 gene locus_tag LOCUS_36910 337896 336523 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225764.1 protein_id gnl|my_center|LOCUS_36910 338792 337944 gene locus_tag LOCUS_36920 338792 337944 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459730.1 protein_id gnl|my_center|LOCUS_36920 339751 338789 gene locus_tag LOCUS_36930 339751 338789 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_36930 341088 339748 gene locus_tag LOCUS_36940 341088 339748 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213190.1 protein_id gnl|my_center|LOCUS_36940 341264 342058 gene locus_tag LOCUS_36950 341264 342058 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225769.1 protein_id gnl|my_center|LOCUS_36950 343858 342338 gene locus_tag LOCUS_36960 343858 342338 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029898.1 protein_id gnl|my_center|LOCUS_36960 343779 344393 gene locus_tag LOCUS_36970 343779 344393 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029897.1 protein_id gnl|my_center|LOCUS_36970 344422 344778 gene locus_tag LOCUS_36980 344422 344778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 344891 345118 gene locus_tag LOCUS_36990 344891 345118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 345476 346093 gene locus_tag LOCUS_37000 345476 346093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 346272 346595 gene locus_tag LOCUS_37010 346272 346595 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089378.1 protein_id gnl|my_center|LOCUS_37010 347932 347012 gene locus_tag LOCUS_37020 gene ppk2 347932 347012 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062218.1 protein_id gnl|my_center|LOCUS_37020 348070 349122 gene locus_tag LOCUS_37030 348070 349122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 349297 350640 gene locus_tag LOCUS_37040 349297 350640 CDS product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887964.1 protein_id gnl|my_center|LOCUS_37040 350843 350577 gene locus_tag LOCUS_37050 350843 350577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 351981 350845 gene locus_tag LOCUS_37060 351981 350845 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227734.1 protein_id gnl|my_center|LOCUS_37060 352592 351978 gene locus_tag LOCUS_37070 352592 351978 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227735.1 protein_id gnl|my_center|LOCUS_37070 353692 352589 gene locus_tag LOCUS_37080 353692 352589 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227736.1 protein_id gnl|my_center|LOCUS_37080 354075 353689 gene locus_tag LOCUS_37090 354075 353689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 354302 355924 gene locus_tag LOCUS_37100 354302 355924 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730746.1 protein_id gnl|my_center|LOCUS_37100 355990 356949 gene locus_tag LOCUS_37110 355990 356949 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223829.1 protein_id gnl|my_center|LOCUS_37110 357030 358409 gene locus_tag LOCUS_37120 357030 358409 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027755.1 protein_id gnl|my_center|LOCUS_37120 358429 358731 gene locus_tag LOCUS_37130 358429 358731 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411038.1 protein_id gnl|my_center|LOCUS_37130 359646 358744 gene locus_tag LOCUS_37140 359646 358744 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078880017.1 protein_id gnl|my_center|LOCUS_37140 363166 359693 gene locus_tag LOCUS_37150 gene lysX 363166 359693 CDS product bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877820.1 protein_id gnl|my_center|LOCUS_37150 364917 363274 gene locus_tag LOCUS_37160 364917 363274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 365702 364890 gene locus_tag LOCUS_37170 365702 364890 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_37170 365747 365935 gene locus_tag LOCUS_37180 365747 365935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 366584 366135 gene locus_tag LOCUS_37190 366584 366135 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804783.1 protein_id gnl|my_center|LOCUS_37190 366874 368892 gene locus_tag LOCUS_37200 366874 368892 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528006.1 protein_id gnl|my_center|LOCUS_37200 368903 371326 gene locus_tag LOCUS_37210 368903 371326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37210 372609 371230 gene locus_tag LOCUS_37220 372609 371230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 373413 372646 gene locus_tag LOCUS_37230 373413 372646 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228584.1 protein_id gnl|my_center|LOCUS_37230 373325 373513 gene locus_tag LOCUS_37240 373325 373513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 373706 376348 gene locus_tag LOCUS_37250 gene pepN 373706 376348 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028475.1 protein_id gnl|my_center|LOCUS_37250 377116 376694 gene locus_tag LOCUS_37260 377116 376694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 377462 377097 gene locus_tag LOCUS_37270 377462 377097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 377539 378156 gene locus_tag LOCUS_37280 gene pyrR 377539 378156 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805074.1 protein_id gnl|my_center|LOCUS_37280 378156 379127 gene locus_tag LOCUS_37290 378156 379127 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_37290 379127 380431 gene locus_tag LOCUS_37300 379127 380431 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_37300 380544 382316 gene locus_tag LOCUS_37310 380544 382316 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226836.1 protein_id gnl|my_center|LOCUS_37310 382338 383006 gene locus_tag LOCUS_37320 382338 383006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 383936 383073 gene locus_tag LOCUS_37330 383936 383073 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730839.1 protein_id gnl|my_center|LOCUS_37330 384098 384523 gene locus_tag LOCUS_37340 384098 384523 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_37340 385393 384533 gene locus_tag LOCUS_37350 385393 384533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 385456 386220 gene locus_tag LOCUS_37360 gene fabG 385456 386220 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225006.1 protein_id gnl|my_center|LOCUS_37360 388065 386236 gene locus_tag LOCUS_37370 388065 386236 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156206934.1 protein_id gnl|my_center|LOCUS_37370 389360 388134 gene locus_tag LOCUS_37380 389360 388134 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730434.1 protein_id gnl|my_center|LOCUS_37380 389543 390343 gene locus_tag LOCUS_37390 389543 390343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804403.1 protein_id gnl|my_center|LOCUS_37390 390981 390403 gene locus_tag LOCUS_37400 390981 390403 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896521.1 protein_id gnl|my_center|LOCUS_37400 391089 391550 gene locus_tag LOCUS_37410 391089 391550 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227147.1 protein_id gnl|my_center|LOCUS_37410 391651 394497 gene locus_tag LOCUS_37420 391651 394497 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138169592.1 protein_id gnl|my_center|LOCUS_37420 395356 394484 gene locus_tag LOCUS_37430 395356 394484 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891968.1 protein_id gnl|my_center|LOCUS_37430 395891 395436 gene locus_tag LOCUS_37440 395891 395436 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030668.1 protein_id gnl|my_center|LOCUS_37440 397029 396346 gene locus_tag LOCUS_37450 397029 396346 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030664.1 protein_id gnl|my_center|LOCUS_37450 399165 397483 gene locus_tag LOCUS_37460 gene ettA 399165 397483 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412708.1 protein_id gnl|my_center|LOCUS_37460 399870 399355 gene locus_tag LOCUS_37470 399870 399355 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179444103.1 protein_id gnl|my_center|LOCUS_37470 401551 400007 gene locus_tag LOCUS_37480 401551 400007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 401637 401711 gene locus_tag LOCUS_t00500 401637 401711 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 401739 402416 gene locus_tag LOCUS_37490 gene orn 401739 402416 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_37490 402505 402580 gene locus_tag LOCUS_t00510 402505 402580 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 402712 403185 gene locus_tag LOCUS_37500 402712 403185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 403243 404553 gene locus_tag LOCUS_37510 403243 404553 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977619.1 protein_id gnl|my_center|LOCUS_37510 404553 405296 gene locus_tag LOCUS_37520 404553 405296 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230360.1 protein_id gnl|my_center|LOCUS_37520 405374 406249 gene locus_tag LOCUS_37530 405374 406249 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804236.1 protein_id gnl|my_center|LOCUS_37530 406266 407825 gene locus_tag LOCUS_37540 406266 407825 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483874.1 protein_id gnl|my_center|LOCUS_37540 407894 407969 gene locus_tag LOCUS_t00520 407894 407969 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 408825 408121 gene locus_tag LOCUS_37550 408825 408121 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029057.1 protein_id gnl|my_center|LOCUS_37550 409160 408825 gene locus_tag LOCUS_37560 409160 408825 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029058.1 protein_id gnl|my_center|LOCUS_37560 409200 409631 gene locus_tag LOCUS_37570 409200 409631 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173849887.1 protein_id gnl|my_center|LOCUS_37570 409628 410722 gene locus_tag LOCUS_37580 409628 410722 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410146.1 protein_id gnl|my_center|LOCUS_37580 410829 411239 gene locus_tag LOCUS_37590 410829 411239 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026896.1 protein_id gnl|my_center|LOCUS_37590 411239 411502 gene locus_tag LOCUS_37600 411239 411502 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978241.1 protein_id gnl|my_center|LOCUS_37600 411571 412011 gene locus_tag LOCUS_37610 411571 412011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 412116 412772 gene locus_tag LOCUS_37620 412116 412772 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730262.1 protein_id gnl|my_center|LOCUS_37620 413576 412971 gene locus_tag LOCUS_37630 413576 412971 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899142.1 protein_id gnl|my_center|LOCUS_37630 413876 414268 gene locus_tag LOCUS_37640 413876 414268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 414475 414399 gene locus_tag LOCUS_t00530 414475 414399 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 414911 415396 gene locus_tag LOCUS_37650 414911 415396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 415535 415975 gene locus_tag LOCUS_37660 415535 415975 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892834.1 protein_id gnl|my_center|LOCUS_37660 416113 417039 gene locus_tag LOCUS_37670 416113 417039 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257977.1 protein_id gnl|my_center|LOCUS_37670 417480 417094 gene locus_tag LOCUS_37680 417480 417094 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728710.1 protein_id gnl|my_center|LOCUS_37680 417606 417953 gene locus_tag LOCUS_37690 417606 417953 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224553.1 protein_id gnl|my_center|LOCUS_37690 417950 418474 gene locus_tag LOCUS_37700 417950 418474 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525198.1 protein_id gnl|my_center|LOCUS_37700 418566 419252 gene locus_tag LOCUS_37710 418566 419252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 420247 419327 gene locus_tag LOCUS_37720 420247 419327 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013847.1 protein_id gnl|my_center|LOCUS_37720 421320 420247 gene locus_tag LOCUS_37730 421320 420247 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013848.1 protein_id gnl|my_center|LOCUS_37730 422746 421418 gene locus_tag LOCUS_37740 422746 421418 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013850.1 protein_id gnl|my_center|LOCUS_37740 423243 422929 gene locus_tag LOCUS_37750 423243 422929 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 protein_id gnl|my_center|LOCUS_37750 423598 423245 gene locus_tag LOCUS_37760 423598 423245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 423740 424222 gene locus_tag LOCUS_37770 gene bcp 423740 424222 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 protein_id gnl|my_center|LOCUS_37770 424309 424227 gene locus_tag LOCUS_t00540 424309 424227 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 425143 424322 gene locus_tag LOCUS_37780 425143 424322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 426003 425140 gene locus_tag LOCUS_37790 426003 425140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 426655 426104 gene locus_tag LOCUS_37800 426655 426104 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008593045.1 protein_id gnl|my_center|LOCUS_37800 427457 426645 gene locus_tag LOCUS_37810 427457 426645 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969714.1 protein_id gnl|my_center|LOCUS_37810 428141 427539 gene locus_tag LOCUS_37820 gene rdgB 428141 427539 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229451.1 protein_id gnl|my_center|LOCUS_37820 428896 428174 gene locus_tag LOCUS_37830 gene rph 428896 428174 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_37830 429733 428942 gene locus_tag LOCUS_37840 429733 428942 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_37840 430686 429883 gene locus_tag LOCUS_37850 gene murI 430686 429883 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567685.1 protein_id gnl|my_center|LOCUS_37850 431677 430727 gene locus_tag LOCUS_37860 431677 430727 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975900.1 protein_id gnl|my_center|LOCUS_37860 431957 431685 gene locus_tag LOCUS_37870 431957 431685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 432458 432042 gene locus_tag LOCUS_37880 432458 432042 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084685.1 protein_id gnl|my_center|LOCUS_37880 433128 432523 gene locus_tag LOCUS_37890 433128 432523 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 protein_id gnl|my_center|LOCUS_37890 433497 433174 gene locus_tag LOCUS_37900 gene clpS 433497 433174 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180153.1 protein_id gnl|my_center|LOCUS_37900 433545 434954 gene locus_tag LOCUS_37910 433545 434954 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_37910 434957 435535 gene locus_tag LOCUS_37920 434957 435535 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 protein_id gnl|my_center|LOCUS_37920 <436334 435561 gene locus_tag LOCUS_37930 <436334 435561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803873.1:alpha/beta hydrolase family protein >Feature sequence7 1755 961 gene locus_tag LOCUS_37940 1755 961 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451301.1 protein_id gnl|my_center|LOCUS_37940 2265 1765 gene locus_tag LOCUS_37950 2265 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 2825 2511 gene locus_tag LOCUS_37960 2825 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 3840 4315 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atcaacggtgtgaaggcgatcaacgg 5448 4450 gene locus_tag LOCUS_37970 5448 4450 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030691.1 protein_id gnl|my_center|LOCUS_37970 5625 7127 gene locus_tag LOCUS_37980 gene gndA 5625 7127 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804424.1 protein_id gnl|my_center|LOCUS_37980 7138 7659 gene locus_tag LOCUS_37990 7138 7659 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977146.1 protein_id gnl|my_center|LOCUS_37990 8275 7664 gene locus_tag LOCUS_38000 8275 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38000 8560 8303 gene locus_tag LOCUS_38010 8560 8303 CDS product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776417.1 protein_id gnl|my_center|LOCUS_38010 8702 9571 gene locus_tag LOCUS_38020 8702 9571 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270333.1 protein_id gnl|my_center|LOCUS_38020 10427 9591 gene locus_tag LOCUS_38030 10427 9591 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_38030 10506 11588 gene locus_tag LOCUS_38040 10506 11588 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222439.1 protein_id gnl|my_center|LOCUS_38040 12194 11673 gene locus_tag LOCUS_38050 12194 11673 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027861.1 protein_id gnl|my_center|LOCUS_38050 12311 13063 gene locus_tag LOCUS_38060 12311 13063 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_38060 13060 14343 gene locus_tag LOCUS_38070 13060 14343 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222415.1 protein_id gnl|my_center|LOCUS_38070 14340 15437 gene locus_tag LOCUS_38080 gene hemC 14340 15437 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975518.1 protein_id gnl|my_center|LOCUS_38080 15553 17223 gene locus_tag LOCUS_38090 15553 17223 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975519.1 protein_id gnl|my_center|LOCUS_38090 17347 18366 gene locus_tag LOCUS_38100 gene hemB 17347 18366 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727312.1 protein_id gnl|my_center|LOCUS_38100 18424 19791 gene locus_tag LOCUS_38110 gene hemL 18424 19791 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029675.1 protein_id gnl|my_center|LOCUS_38110 19938 20594 gene locus_tag LOCUS_38120 19938 20594 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214057055.1 protein_id gnl|my_center|LOCUS_38120 20594 21211 gene locus_tag LOCUS_38130 20594 21211 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029677.1 protein_id gnl|my_center|LOCUS_38130 21208 21981 gene locus_tag LOCUS_38140 21208 21981 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974477.1 protein_id gnl|my_center|LOCUS_38140 21992 23761 gene locus_tag LOCUS_38150 21992 23761 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029679.1 protein_id gnl|my_center|LOCUS_38150 23758 24804 gene locus_tag LOCUS_38160 gene ccsB 23758 24804 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029680.1 protein_id gnl|my_center|LOCUS_38160 25819 24872 gene locus_tag LOCUS_38170 25819 24872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 27356 25929 gene locus_tag LOCUS_38180 27356 25929 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228500.1 protein_id gnl|my_center|LOCUS_38180 27793 27353 gene locus_tag LOCUS_38190 27793 27353 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027124.1 protein_id gnl|my_center|LOCUS_38190 28375 27950 gene locus_tag LOCUS_38200 28375 27950 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059289.1 protein_id gnl|my_center|LOCUS_38200 28932 28372 gene locus_tag LOCUS_38210 28932 28372 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028726.1 protein_id gnl|my_center|LOCUS_38210 30279 29398 gene locus_tag LOCUS_38220 30279 29398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 30410 31783 gene locus_tag LOCUS_38230 30410 31783 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223941.1 protein_id gnl|my_center|LOCUS_38230 32222 31851 gene locus_tag LOCUS_38240 32222 31851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 32221 33198 gene locus_tag LOCUS_38250 32221 33198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38250 34404 33388 gene locus_tag LOCUS_38260 34404 33388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 35276 34497 gene locus_tag LOCUS_38270 gene pstB 35276 34497 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230712.1 protein_id gnl|my_center|LOCUS_38270 35626 36738 gene locus_tag LOCUS_38280 gene pstS 35626 36738 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776547.1 protein_id gnl|my_center|LOCUS_38280 36893 37834 gene locus_tag LOCUS_38290 gene pstC 36893 37834 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776546.1 protein_id gnl|my_center|LOCUS_38290 37864 38916 gene locus_tag LOCUS_38300 gene pstA 37864 38916 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 protein_id gnl|my_center|LOCUS_38300 40705 38951 gene locus_tag LOCUS_38310 40705 38951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 41859 40975 gene locus_tag LOCUS_38320 41859 40975 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776549.1 protein_id gnl|my_center|LOCUS_38320 44086 41900 gene locus_tag LOCUS_38330 44086 41900 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_38330 45352 44228 gene locus_tag LOCUS_38340 gene mshD 45352 44228 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_38340 45455 45940 gene locus_tag LOCUS_38350 45455 45940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 46043 47005 gene locus_tag LOCUS_38360 46043 47005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 47002 48339 gene locus_tag LOCUS_38370 47002 48339 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029419.1 protein_id gnl|my_center|LOCUS_38370 48336 48941 gene locus_tag LOCUS_38380 48336 48941 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326755.1 protein_id gnl|my_center|LOCUS_38380 49646 48960 gene locus_tag LOCUS_38390 49646 48960 CDS product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726991.1 protein_id gnl|my_center|LOCUS_38390 49856 50830 gene locus_tag LOCUS_38400 49856 50830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 51424 50894 gene locus_tag LOCUS_38410 51424 50894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229320.1 protein_id gnl|my_center|LOCUS_38410 51969 51421 gene locus_tag LOCUS_38420 51969 51421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 52751 52050 gene locus_tag LOCUS_38430 gene glnR 52751 52050 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_38430 52926 53195 gene locus_tag LOCUS_38440 52926 53195 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974810.1 protein_id gnl|my_center|LOCUS_38440 53584 54432 gene locus_tag LOCUS_38450 53584 54432 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730790.1 protein_id gnl|my_center|LOCUS_38450 54455 54763 gene locus_tag LOCUS_38460 54455 54763 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974805.1 protein_id gnl|my_center|LOCUS_38460 54881 57718 gene locus_tag LOCUS_38470 54881 57718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 58099 57659 gene locus_tag LOCUS_38480 gene dtd 58099 57659 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729707.1 protein_id gnl|my_center|LOCUS_38480 58464 58111 gene locus_tag LOCUS_38490 58464 58111 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729159.1 protein_id gnl|my_center|LOCUS_38490 58564 59946 gene locus_tag LOCUS_38500 58564 59946 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228765.1 protein_id gnl|my_center|LOCUS_38500 61518 60760 gene locus_tag LOCUS_38510 61518 60760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 61634 62485 gene locus_tag LOCUS_38520 61634 62485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 63524 62490 gene locus_tag LOCUS_38530 63524 62490 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728687.1 protein_id gnl|my_center|LOCUS_38530 63571 64047 gene locus_tag LOCUS_38540 63571 64047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 64282 64776 gene locus_tag LOCUS_38550 64282 64776 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974791.1 protein_id gnl|my_center|LOCUS_38550 64899 65867 gene locus_tag LOCUS_38560 64899 65867 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 protein_id gnl|my_center|LOCUS_38560 65975 66553 gene locus_tag LOCUS_38570 65975 66553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 66628 67077 gene locus_tag LOCUS_38580 66628 67077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 67178 68158 gene locus_tag LOCUS_38590 67178 68158 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_38590 68227 68946 gene locus_tag LOCUS_38600 68227 68946 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804566.1 protein_id gnl|my_center|LOCUS_38600 68943 71543 gene locus_tag LOCUS_38610 68943 71543 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804565.1 protein_id gnl|my_center|LOCUS_38610 71654 72181 gene locus_tag LOCUS_38620 71654 72181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 72366 72548 gene locus_tag LOCUS_38630 72366 72548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 72545 72940 gene locus_tag LOCUS_38640 72545 72940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 72937 73509 gene locus_tag LOCUS_38650 72937 73509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 73509 74126 gene locus_tag LOCUS_38660 73509 74126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 74150 74761 gene locus_tag LOCUS_38670 74150 74761 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230856.1 protein_id gnl|my_center|LOCUS_38670 74752 75402 gene locus_tag LOCUS_38680 74752 75402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 75395 75766 gene locus_tag LOCUS_38690 75395 75766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 77342 75897 gene locus_tag LOCUS_38700 77342 75897 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897250.1 protein_id gnl|my_center|LOCUS_38700 77493 78215 gene locus_tag LOCUS_38710 77493 78215 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383089.1 protein_id gnl|my_center|LOCUS_38710 79835 78225 gene locus_tag LOCUS_38720 79835 78225 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227212.1 protein_id gnl|my_center|LOCUS_38720 80820 79888 gene locus_tag LOCUS_38730 80820 79888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 80949 81545 gene locus_tag LOCUS_38740 80949 81545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 81629 82183 gene locus_tag LOCUS_38750 81629 82183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 82186 82875 gene locus_tag LOCUS_38760 82186 82875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 83571 82984 gene locus_tag LOCUS_38770 83571 82984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 85628 83769 gene locus_tag LOCUS_38780 gene typA 85628 83769 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_38780 86767 85754 gene locus_tag LOCUS_38790 86767 85754 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226137.1 protein_id gnl|my_center|LOCUS_38790 86904 88040 gene locus_tag LOCUS_38800 86904 88040 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837503.1 protein_id gnl|my_center|LOCUS_38800 88073 88543 gene locus_tag LOCUS_38810 88073 88543 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974766.1 protein_id gnl|my_center|LOCUS_38810 89042 88554 gene locus_tag LOCUS_38820 89042 88554 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 protein_id gnl|my_center|LOCUS_38820 89100 89849 gene locus_tag LOCUS_38830 89100 89849 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974762.1 protein_id gnl|my_center|LOCUS_38830 90402 89881 gene locus_tag LOCUS_38840 90402 89881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 91105 90440 gene locus_tag LOCUS_38850 gene phoU 91105 90440 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_38850 91286 92677 gene locus_tag LOCUS_38860 91286 92677 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_38860 92674 93351 gene locus_tag LOCUS_38870 92674 93351 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_38870 94226 93414 gene locus_tag LOCUS_38880 94226 93414 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531321.1 protein_id gnl|my_center|LOCUS_38880 >Feature sequence8 180 1439 gene locus_tag LOCUS_38890 gene dxr 180 1439 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284246.1 protein_id gnl|my_center|LOCUS_38890 1536 2852 gene locus_tag LOCUS_38900 1536 2852 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030397.1 protein_id gnl|my_center|LOCUS_38900 2913 4454 gene locus_tag LOCUS_38910 2913 4454 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929823.1 protein_id gnl|my_center|LOCUS_38910 4467 5648 gene locus_tag LOCUS_38920 gene ispG 4467 5648 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284254.1 protein_id gnl|my_center|LOCUS_38920 5674 6528 gene locus_tag LOCUS_38930 5674 6528 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_38930 6608 6763 gene locus_tag LOCUS_38940 6608 6763 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086052.1 protein_id gnl|my_center|LOCUS_38940 6760 7578 gene locus_tag LOCUS_38950 6760 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 7614 9380 gene locus_tag LOCUS_38960 7614 9380 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804649.1 protein_id gnl|my_center|LOCUS_38960 10472 9387 gene locus_tag LOCUS_38970 10472 9387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 10646 11122 gene locus_tag LOCUS_38980 gene rimP 10646 11122 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285696.1 protein_id gnl|my_center|LOCUS_38980 11135 12106 gene locus_tag LOCUS_38990 gene nusA 11135 12106 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_38990 13144 12131 gene locus_tag LOCUS_39000 13144 12131 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054086.1 protein_id gnl|my_center|LOCUS_39000 13381 15084 gene locus_tag LOCUS_39010 13381 15084 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975161.1 protein_id gnl|my_center|LOCUS_39010 15144 15473 gene locus_tag LOCUS_39020 15144 15473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 15695 18754 gene locus_tag LOCUS_39030 15695 18754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 18854 19348 gene locus_tag LOCUS_39040 gene rbfA 18854 19348 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804655.1 protein_id gnl|my_center|LOCUS_39040 19428 20261 gene locus_tag LOCUS_39050 gene truB 19428 20261 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030403.1 protein_id gnl|my_center|LOCUS_39050 20278 21189 gene locus_tag LOCUS_39060 20278 21189 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_39060 22513 21569 gene locus_tag LOCUS_39070 22513 21569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 23987 22599 gene locus_tag LOCUS_39080 23987 22599 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730326.1 protein_id gnl|my_center|LOCUS_39080 24237 24506 gene locus_tag LOCUS_39090 gene rpsO 24237 24506 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973291.1 protein_id gnl|my_center|LOCUS_39090 25016 27217 gene locus_tag LOCUS_39100 25016 27217 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_39100 27286 28533 gene locus_tag LOCUS_39110 27286 28533 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_39110 29335 28640 gene locus_tag LOCUS_39120 29335 28640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 29372 30124 gene locus_tag LOCUS_39130 gene dapB 29372 30124 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228101.1 protein_id gnl|my_center|LOCUS_39130 30153 31061 gene locus_tag LOCUS_39140 30153 31061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 31653 31102 gene locus_tag LOCUS_39150 31653 31102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 31860 33545 gene locus_tag LOCUS_39160 31860 33545 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804669.1 protein_id gnl|my_center|LOCUS_39160 33910 33605 gene locus_tag LOCUS_39170 33910 33605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 33930 34637 gene locus_tag LOCUS_39180 33930 34637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 34850 34665 gene locus_tag LOCUS_39190 gene rpmB 34850 34665 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_39190 35070 37376 gene locus_tag LOCUS_39200 gene recG 35070 37376 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223647.1 protein_id gnl|my_center|LOCUS_39200 37450 38028 gene locus_tag LOCUS_39210 gene rsmD 37450 38028 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_39210 38313 38822 gene locus_tag LOCUS_39220 gene coaD 38313 38822 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_39220 38960 39466 gene locus_tag LOCUS_39230 38960 39466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 39622 40146 gene locus_tag LOCUS_39240 39622 40146 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_39240 40197 40388 gene locus_tag LOCUS_39250 gene rpmF 40197 40388 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006139588.1 protein_id gnl|my_center|LOCUS_39250 40403 41482 gene locus_tag LOCUS_39260 40403 41482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 41505 42365 gene locus_tag LOCUS_39270 gene mutM 41505 42365 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973422.1 protein_id gnl|my_center|LOCUS_39270 42471 43097 gene locus_tag LOCUS_39280 42471 43097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 43197 46775 gene locus_tag LOCUS_39290 gene smc 43197 46775 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_39290 47079 46873 gene locus_tag LOCUS_39300 47079 46873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 46963 47208 gene locus_tag LOCUS_39310 46963 47208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 >Feature sequence9 1177 1839 gene locus_tag LOCUS_39320 1177 1839 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_39320 1868 2569 gene locus_tag LOCUS_39330 1868 2569 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_39330 3025 2579 gene locus_tag LOCUS_39340 3025 2579 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327459.1 protein_id gnl|my_center|LOCUS_39340 3936 3028 gene locus_tag LOCUS_39350 3936 3028 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973152.1 protein_id gnl|my_center|LOCUS_39350 4490 3933 gene locus_tag LOCUS_39360 gene dut 4490 3933 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_39360 4990 4502 gene locus_tag LOCUS_39370 4990 4502 CDS product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908084.1 protein_id gnl|my_center|LOCUS_39370 5510 5211 gene locus_tag LOCUS_39380 5510 5211 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728564.1 protein_id gnl|my_center|LOCUS_39380 7907 5706 gene locus_tag LOCUS_39390 7907 5706 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729974.1 protein_id gnl|my_center|LOCUS_39390 9594 7993 gene locus_tag LOCUS_39400 9594 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 10922 9696 gene locus_tag LOCUS_39410 10922 9696 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973161.1 protein_id gnl|my_center|LOCUS_39410 11102 14227 gene locus_tag LOCUS_39420 11102 14227 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027462.1 protein_id gnl|my_center|LOCUS_39420 15409 14312 gene locus_tag LOCUS_39430 15409 14312 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015587.1 protein_id gnl|my_center|LOCUS_39430 15686 16927 gene locus_tag LOCUS_39440 15686 16927 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975631.1 protein_id gnl|my_center|LOCUS_39440 17072 18964 gene locus_tag LOCUS_39450 17072 18964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223760.1 protein_id gnl|my_center|LOCUS_39450 21002 18993 gene locus_tag LOCUS_39460 21002 18993 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730584.1 protein_id gnl|my_center|LOCUS_39460 22422 21013 gene locus_tag LOCUS_39470 22422 21013 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226764.1 protein_id gnl|my_center|LOCUS_39470 22667 24223 gene locus_tag LOCUS_39480 22667 24223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480