>Feature sequence01 <1 1148 gene locus_tag LOCUS_00010 <1 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222688.1:GMC family oxidoreductase 1486 3093 gene locus_tag LOCUS_00020 gene guaA 1486 3093 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222695.1 protein_id gnl|my_center|LOCUS_00020 3555 3121 gene locus_tag LOCUS_00030 3555 3121 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401406.1 protein_id gnl|my_center|LOCUS_00030 3845 3552 gene locus_tag LOCUS_00040 3845 3552 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403834.1 protein_id gnl|my_center|LOCUS_00040 4012 4275 gene locus_tag LOCUS_00050 4012 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4263 4664 gene locus_tag LOCUS_00060 4263 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4903 4691 gene locus_tag LOCUS_00070 4903 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6047 4896 gene locus_tag LOCUS_00080 6047 4896 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222697.1 protein_id gnl|my_center|LOCUS_00080 6402 7586 gene locus_tag LOCUS_00090 6402 7586 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222700.1 protein_id gnl|my_center|LOCUS_00090 7613 8293 gene locus_tag LOCUS_00100 7613 8293 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222701.1 protein_id gnl|my_center|LOCUS_00100 9736 8801 gene locus_tag LOCUS_00110 9736 8801 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222702.1 protein_id gnl|my_center|LOCUS_00110 9867 10796 gene locus_tag LOCUS_00120 9867 10796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11090 10833 gene locus_tag LOCUS_00130 11090 10833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11150 11398 gene locus_tag LOCUS_00140 11150 11398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 11881 12105 gene locus_tag LOCUS_00150 11881 12105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 13068 12193 gene locus_tag LOCUS_00160 13068 12193 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222703.1 protein_id gnl|my_center|LOCUS_00160 13199 14134 gene locus_tag LOCUS_00170 13199 14134 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222702.1 protein_id gnl|my_center|LOCUS_00170 15322 14642 gene locus_tag LOCUS_00180 15322 14642 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222701.1 protein_id gnl|my_center|LOCUS_00180 16533 15349 gene locus_tag LOCUS_00190 16533 15349 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222700.1 protein_id gnl|my_center|LOCUS_00190 16888 18039 gene locus_tag LOCUS_00200 16888 18039 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222697.1 protein_id gnl|my_center|LOCUS_00200 18032 18244 gene locus_tag LOCUS_00210 18032 18244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 18672 18271 gene locus_tag LOCUS_00220 18672 18271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 18923 18660 gene locus_tag LOCUS_00230 18923 18660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 19090 19383 gene locus_tag LOCUS_00240 19090 19383 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403834.1 protein_id gnl|my_center|LOCUS_00240 19380 19814 gene locus_tag LOCUS_00250 19380 19814 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401406.1 protein_id gnl|my_center|LOCUS_00250 21449 19842 gene locus_tag LOCUS_00260 gene guaA 21449 19842 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222695.1 protein_id gnl|my_center|LOCUS_00260 22215 23822 gene locus_tag LOCUS_00270 gene guaA 22215 23822 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222695.1 protein_id gnl|my_center|LOCUS_00270 24284 23850 gene locus_tag LOCUS_00280 24284 23850 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401406.1 protein_id gnl|my_center|LOCUS_00280 24574 24281 gene locus_tag LOCUS_00290 24574 24281 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403834.1 protein_id gnl|my_center|LOCUS_00290 24741 25004 gene locus_tag LOCUS_00300 24741 25004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 24992 25393 gene locus_tag LOCUS_00310 24992 25393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 25632 25420 gene locus_tag LOCUS_00320 25632 25420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 26776 25625 gene locus_tag LOCUS_00330 26776 25625 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222697.1 protein_id gnl|my_center|LOCUS_00330 27131 28315 gene locus_tag LOCUS_00340 27131 28315 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222700.1 protein_id gnl|my_center|LOCUS_00340 28342 29022 gene locus_tag LOCUS_00350 28342 29022 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222701.1 protein_id gnl|my_center|LOCUS_00350 30465 29530 gene locus_tag LOCUS_00360 30465 29530 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222702.1 protein_id gnl|my_center|LOCUS_00360 30596 31471 gene locus_tag LOCUS_00370 30596 31471 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222703.1 protein_id gnl|my_center|LOCUS_00370 33145 31559 gene locus_tag LOCUS_00380 33145 31559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 34877 33321 gene locus_tag LOCUS_00390 34877 33321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 36107 35424 gene locus_tag LOCUS_00400 36107 35424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 37051 36122 gene locus_tag LOCUS_00410 37051 36122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 37305 37072 gene locus_tag LOCUS_00420 37305 37072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 37728 37423 gene locus_tag LOCUS_00430 37728 37423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 38000 38716 gene locus_tag LOCUS_00440 38000 38716 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227748.1 protein_id gnl|my_center|LOCUS_00440 39062 38730 gene locus_tag LOCUS_00450 39062 38730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 40007 39357 gene locus_tag LOCUS_00460 40007 39357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 40110 42533 gene locus_tag LOCUS_00470 gene pcrA 40110 42533 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222711.1 protein_id gnl|my_center|LOCUS_00470 43087 43314 gene locus_tag LOCUS_00480 43087 43314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 43301 44113 gene locus_tag LOCUS_00490 43301 44113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 46033 44438 gene locus_tag LOCUS_00500 46033 44438 CDS product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 protein_id gnl|my_center|LOCUS_00500 46959 46030 gene locus_tag LOCUS_00510 46959 46030 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029129.1 protein_id gnl|my_center|LOCUS_00510 47023 47529 gene locus_tag LOCUS_00520 47023 47529 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867895.1 protein_id gnl|my_center|LOCUS_00520 48429 47554 gene locus_tag LOCUS_00530 48429 47554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 49023 50777 gene locus_tag LOCUS_00540 49023 50777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222713.1 protein_id gnl|my_center|LOCUS_00540 51008 52174 gene locus_tag LOCUS_00550 gene sucC 51008 52174 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222715.1 protein_id gnl|my_center|LOCUS_00550 52178 53062 gene locus_tag LOCUS_00560 gene sucD 52178 53062 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222716.1 protein_id gnl|my_center|LOCUS_00560 53286 54101 gene locus_tag LOCUS_00570 53286 54101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 54288 56447 gene locus_tag LOCUS_00580 54288 56447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 56981 56526 gene locus_tag LOCUS_00590 56981 56526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 57852 58694 gene locus_tag LOCUS_00600 57852 58694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 60029 58749 gene locus_tag LOCUS_00610 60029 58749 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258492.1 protein_id gnl|my_center|LOCUS_00610 60031 60552 gene locus_tag LOCUS_00620 60031 60552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 63275 60597 gene locus_tag LOCUS_00630 63275 60597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 63573 64505 gene locus_tag LOCUS_00640 63573 64505 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114440.1 protein_id gnl|my_center|LOCUS_00640 64512 65363 gene locus_tag LOCUS_00650 64512 65363 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222732.1 protein_id gnl|my_center|LOCUS_00650 65435 65731 gene locus_tag LOCUS_00660 65435 65731 CDS product DUF3017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222733.1 protein_id gnl|my_center|LOCUS_00660 66028 66612 gene locus_tag LOCUS_00670 66028 66612 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227534.1 protein_id gnl|my_center|LOCUS_00670 66609 67802 gene locus_tag LOCUS_00680 66609 67802 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227533.1 protein_id gnl|my_center|LOCUS_00680 68784 67930 gene locus_tag LOCUS_00690 68784 67930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 69094 68903 gene locus_tag LOCUS_00700 69094 68903 CDS product DUF1918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285998.1 protein_id gnl|my_center|LOCUS_00700 69630 69202 gene locus_tag LOCUS_00710 69630 69202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 70565 69735 gene locus_tag LOCUS_00720 70565 69735 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977680.1 protein_id gnl|my_center|LOCUS_00720 70744 71964 gene locus_tag LOCUS_00730 70744 71964 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222746.1 protein_id gnl|my_center|LOCUS_00730 72480 72040 gene locus_tag LOCUS_00740 72480 72040 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063533.1 protein_id gnl|my_center|LOCUS_00740 72579 72652 gene locus_tag LOCUS_t00010 72579 72652 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 73403 72822 gene locus_tag LOCUS_00750 73403 72822 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027648.1 protein_id gnl|my_center|LOCUS_00750 73570 74172 gene locus_tag LOCUS_00760 73570 74172 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081641.1 protein_id gnl|my_center|LOCUS_00760 75947 74337 gene locus_tag LOCUS_00770 75947 74337 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226507.1 protein_id gnl|my_center|LOCUS_00770 76151 77149 gene locus_tag LOCUS_00780 76151 77149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 77198 77995 gene locus_tag LOCUS_00790 77198 77995 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222751.1 protein_id gnl|my_center|LOCUS_00790 78056 78364 gene locus_tag LOCUS_00800 78056 78364 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870896.1 protein_id gnl|my_center|LOCUS_00800 78522 78385 gene locus_tag LOCUS_00810 78522 78385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 79214 79978 gene locus_tag LOCUS_00820 79214 79978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 80116 80730 gene locus_tag LOCUS_00830 80116 80730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 80756 82321 gene locus_tag LOCUS_00840 80756 82321 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227261.1 protein_id gnl|my_center|LOCUS_00840 82857 82327 gene locus_tag LOCUS_00850 82857 82327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 83015 82860 gene locus_tag LOCUS_00860 83015 82860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 84666 83227 gene locus_tag LOCUS_00870 84666 83227 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027994.1 protein_id gnl|my_center|LOCUS_00870 84891 87479 gene locus_tag LOCUS_00880 84891 87479 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121009479.1 protein_id gnl|my_center|LOCUS_00880 87750 88262 gene locus_tag LOCUS_00890 87750 88262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 88357 88686 gene locus_tag LOCUS_00900 88357 88686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 88686 89924 gene locus_tag LOCUS_00910 88686 89924 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230660.1 protein_id gnl|my_center|LOCUS_00910 89965 90465 gene locus_tag LOCUS_00920 89965 90465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 90622 91140 gene locus_tag LOCUS_00930 90622 91140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224118.1 protein_id gnl|my_center|LOCUS_00930 91362 91610 gene locus_tag LOCUS_00940 91362 91610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 91685 92722 gene locus_tag LOCUS_00950 gene trpS 91685 92722 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222753.1 protein_id gnl|my_center|LOCUS_00950 92763 93806 gene locus_tag LOCUS_00960 gene yhjD 92763 93806 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222755.1 protein_id gnl|my_center|LOCUS_00960 94918 93866 gene locus_tag LOCUS_00970 94918 93866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 94986 95180 gene locus_tag LOCUS_00980 94986 95180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 96188 95397 gene locus_tag LOCUS_00990 96188 95397 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893076.1 protein_id gnl|my_center|LOCUS_00990 97978 96188 gene locus_tag LOCUS_01000 gene sdhA 97978 96188 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222763.1 protein_id gnl|my_center|LOCUS_01000 98437 98018 gene locus_tag LOCUS_01010 98437 98018 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222764.1 protein_id gnl|my_center|LOCUS_01010 98880 98446 gene locus_tag LOCUS_01020 gene sdhC 98880 98446 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222765.1 protein_id gnl|my_center|LOCUS_01020 99223 99609 gene locus_tag LOCUS_01030 99223 99609 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086839697.1 protein_id gnl|my_center|LOCUS_01030 99679 100956 gene locus_tag LOCUS_01040 99679 100956 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222773.1 protein_id gnl|my_center|LOCUS_01040 102276 101071 gene locus_tag LOCUS_01050 102276 101071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222774.1 protein_id gnl|my_center|LOCUS_01050 102582 103652 gene locus_tag LOCUS_01060 102582 103652 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222775.1 protein_id gnl|my_center|LOCUS_01060 104916 103678 gene locus_tag LOCUS_01070 104916 103678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222777.1 protein_id gnl|my_center|LOCUS_01070 105099 105680 gene locus_tag LOCUS_01080 105099 105680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 106470 105727 gene locus_tag LOCUS_01090 106470 105727 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028267.1 protein_id gnl|my_center|LOCUS_01090 107363 106467 gene locus_tag LOCUS_01100 107363 106467 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028266.1 protein_id gnl|my_center|LOCUS_01100 107683 107360 gene locus_tag LOCUS_01110 107683 107360 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223409.1 protein_id gnl|my_center|LOCUS_01110 108330 107680 gene locus_tag LOCUS_01120 108330 107680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 109296 108433 gene locus_tag LOCUS_01130 109296 108433 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222792.1 protein_id gnl|my_center|LOCUS_01130 110767 109319 gene locus_tag LOCUS_01140 110767 109319 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222793.1 protein_id gnl|my_center|LOCUS_01140 111726 110764 gene locus_tag LOCUS_01150 gene deoC 111726 110764 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222794.1 protein_id gnl|my_center|LOCUS_01150 112121 111966 gene locus_tag LOCUS_01160 112121 111966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 112353 114134 gene locus_tag LOCUS_01170 gene metG 112353 114134 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467759.1 protein_id gnl|my_center|LOCUS_01170 114414 115262 gene locus_tag LOCUS_01180 114414 115262 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229979.1 protein_id gnl|my_center|LOCUS_01180 115652 117151 gene locus_tag LOCUS_01190 115652 117151 CDS product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229978.1 protein_id gnl|my_center|LOCUS_01190 117172 118035 gene locus_tag LOCUS_01200 gene rsmA 117172 118035 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229977.1 protein_id gnl|my_center|LOCUS_01200 118457 119509 gene locus_tag LOCUS_01210 118457 119509 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229976.1 protein_id gnl|my_center|LOCUS_01210 119615 120580 gene locus_tag LOCUS_01220 119615 120580 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229975.1 protein_id gnl|my_center|LOCUS_01220 120635 122425 gene locus_tag LOCUS_01230 120635 122425 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229973.1 protein_id gnl|my_center|LOCUS_01230 122606 124279 gene locus_tag LOCUS_01240 122606 124279 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229972.1 protein_id gnl|my_center|LOCUS_01240 124805 127360 gene locus_tag LOCUS_01250 124805 127360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 127357 128466 gene locus_tag LOCUS_01260 127357 128466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 128463 129920 gene locus_tag LOCUS_01270 128463 129920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 130532 129945 gene locus_tag LOCUS_01280 gene pth 130532 129945 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_01280 131277 130642 gene locus_tag LOCUS_01290 131277 130642 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229968.1 protein_id gnl|my_center|LOCUS_01290 131574 132899 gene locus_tag LOCUS_01300 131574 132899 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327153.1 protein_id gnl|my_center|LOCUS_01300 134030 133050 gene locus_tag LOCUS_01310 134030 133050 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229964.1 protein_id gnl|my_center|LOCUS_01310 135567 134059 gene locus_tag LOCUS_01320 gene glmU 135567 134059 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467757.1 protein_id gnl|my_center|LOCUS_01320 137490 135796 gene locus_tag LOCUS_01330 137490 135796 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229962.1 protein_id gnl|my_center|LOCUS_01330 137675 137604 gene locus_tag LOCUS_t00020 137675 137604 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 138223 137996 gene locus_tag LOCUS_01340 138223 137996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 138105 139001 gene locus_tag LOCUS_01350 138105 139001 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229961.1 protein_id gnl|my_center|LOCUS_01350 139191 139793 gene locus_tag LOCUS_01360 139191 139793 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467756.1 protein_id gnl|my_center|LOCUS_01360 141006 139807 gene locus_tag LOCUS_01370 141006 139807 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227683.1 protein_id gnl|my_center|LOCUS_01370 141228 141593 gene locus_tag LOCUS_01380 141228 141593 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227684.1 protein_id gnl|my_center|LOCUS_01380 141694 142152 gene locus_tag LOCUS_01390 141694 142152 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227687.1 protein_id gnl|my_center|LOCUS_01390 142611 142237 gene locus_tag LOCUS_01400 142611 142237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01400 143163 142807 gene locus_tag LOCUS_01410 143163 142807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01410 143365 143814 gene locus_tag LOCUS_01420 143365 143814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01420 144520 143990 gene locus_tag LOCUS_01430 144520 143990 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074286.1 protein_id gnl|my_center|LOCUS_01430 145776 144610 gene locus_tag LOCUS_01440 145776 144610 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229955.1 protein_id gnl|my_center|LOCUS_01440 146031 149654 gene locus_tag LOCUS_01450 gene mfd 146031 149654 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229948.1 protein_id gnl|my_center|LOCUS_01450 150605 149721 gene locus_tag LOCUS_01460 150605 149721 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030711.1 protein_id gnl|my_center|LOCUS_01460 151045 150602 gene locus_tag LOCUS_01470 151045 150602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 151321 151058 gene locus_tag LOCUS_01480 151321 151058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 151488 152330 gene locus_tag LOCUS_01490 151488 152330 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224161.1 protein_id gnl|my_center|LOCUS_01490 152323 152508 gene locus_tag LOCUS_01500 152323 152508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 152599 153003 gene locus_tag LOCUS_01510 152599 153003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 153006 153626 gene locus_tag LOCUS_01520 153006 153626 CDS product DUF3558 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125316316.1 protein_id gnl|my_center|LOCUS_01520 153626 155074 gene locus_tag LOCUS_01530 153626 155074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 155090 155914 gene locus_tag LOCUS_01540 155090 155914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 156080 157045 gene locus_tag LOCUS_01550 156080 157045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630323.1 protein_id gnl|my_center|LOCUS_01550 157050 158063 gene locus_tag LOCUS_01560 157050 158063 CDS product MazG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229944.1 protein_id gnl|my_center|LOCUS_01560 158210 159004 gene locus_tag LOCUS_01570 158210 159004 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224356.1 protein_id gnl|my_center|LOCUS_01570 159083 159952 gene locus_tag LOCUS_01580 159083 159952 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224356.1 protein_id gnl|my_center|LOCUS_01580 160396 159998 gene locus_tag LOCUS_01590 160396 159998 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284181.1 protein_id gnl|my_center|LOCUS_01590 160662 161951 gene locus_tag LOCUS_01600 gene eno 160662 161951 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229929.1 protein_id gnl|my_center|LOCUS_01600 161952 162458 gene locus_tag LOCUS_01610 161952 162458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 162455 162934 gene locus_tag LOCUS_01620 162455 162934 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229927.1 protein_id gnl|my_center|LOCUS_01620 163137 164093 gene locus_tag LOCUS_01630 163137 164093 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229925.1 protein_id gnl|my_center|LOCUS_01630 164318 165976 gene locus_tag LOCUS_01640 164318 165976 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949626.1 protein_id gnl|my_center|LOCUS_01640 166051 166977 gene locus_tag LOCUS_01650 166051 166977 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229923.1 protein_id gnl|my_center|LOCUS_01650 166970 167935 gene locus_tag LOCUS_01660 166970 167935 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229922.1 protein_id gnl|my_center|LOCUS_01660 167952 168971 gene locus_tag LOCUS_01670 167952 168971 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229921.1 protein_id gnl|my_center|LOCUS_01670 168964 169992 gene locus_tag LOCUS_01680 168964 169992 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229920.1 protein_id gnl|my_center|LOCUS_01680 171574 170096 gene locus_tag LOCUS_01690 171574 170096 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229918.1 protein_id gnl|my_center|LOCUS_01690 171627 172403 gene locus_tag LOCUS_01700 171627 172403 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_01700 173170 172622 gene locus_tag LOCUS_01710 173170 172622 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225219.1 protein_id gnl|my_center|LOCUS_01710 173579 173280 gene locus_tag LOCUS_01720 gene mazF3 173579 173280 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405820.1 protein_id gnl|my_center|LOCUS_01720 173815 173579 gene locus_tag LOCUS_01730 173815 173579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 173950 174390 gene locus_tag LOCUS_01740 173950 174390 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222802.1 protein_id gnl|my_center|LOCUS_01740 174387 175373 gene locus_tag LOCUS_01750 174387 175373 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086853184.1 protein_id gnl|my_center|LOCUS_01750 175471 175923 gene locus_tag LOCUS_01760 175471 175923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 176234 177559 gene locus_tag LOCUS_01770 176234 177559 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229915.1 protein_id gnl|my_center|LOCUS_01770 177818 177892 gene locus_tag LOCUS_t00030 177818 177892 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 177867 178370 gene locus_tag LOCUS_01780 177867 178370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 179022 178387 gene locus_tag LOCUS_01790 179022 178387 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975219.1 protein_id gnl|my_center|LOCUS_01790 179406 180500 gene locus_tag LOCUS_01800 gene yidC 179406 180500 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112810.1 protein_id gnl|my_center|LOCUS_01800 181264 180572 gene locus_tag LOCUS_01810 181264 180572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 182706 181261 gene locus_tag LOCUS_01820 182706 181261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229845.1 protein_id gnl|my_center|LOCUS_01820 183146 183937 gene locus_tag LOCUS_01830 183146 183937 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229844.1 protein_id gnl|my_center|LOCUS_01830 185485 184265 gene locus_tag LOCUS_01840 185485 184265 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229842.1 protein_id gnl|my_center|LOCUS_01840 186524 185610 gene locus_tag LOCUS_01850 186524 185610 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066509.1 protein_id gnl|my_center|LOCUS_01850 186721 188088 gene locus_tag LOCUS_01860 186721 188088 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229841.1 protein_id gnl|my_center|LOCUS_01860 188184 189491 gene locus_tag LOCUS_01870 188184 189491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 189561 190361 gene locus_tag LOCUS_01880 189561 190361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 190424 191563 gene locus_tag LOCUS_01890 190424 191563 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229838.1 protein_id gnl|my_center|LOCUS_01890 191958 191692 gene locus_tag LOCUS_01900 191958 191692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 193370 192168 gene locus_tag LOCUS_01910 gene hppD 193370 192168 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229829.1 protein_id gnl|my_center|LOCUS_01910 193522 194013 gene locus_tag LOCUS_01920 193522 194013 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229828.1 protein_id gnl|my_center|LOCUS_01920 194611 194123 gene locus_tag LOCUS_01930 gene greA 194611 194123 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229826.1 protein_id gnl|my_center|LOCUS_01930 195230 194790 gene locus_tag LOCUS_01940 195230 194790 CDS product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059315.1 protein_id gnl|my_center|LOCUS_01940 195377 196255 gene locus_tag LOCUS_01950 gene mca 195377 196255 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_01950 196252 196680 gene locus_tag LOCUS_01960 196252 196680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 198048 196717 gene locus_tag LOCUS_01970 198048 196717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 198212 200239 gene locus_tag LOCUS_01980 198212 200239 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284173.1 protein_id gnl|my_center|LOCUS_01980 201113 200364 gene locus_tag LOCUS_01990 201113 200364 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314885.1 protein_id gnl|my_center|LOCUS_01990 201203 202006 gene locus_tag LOCUS_02000 201203 202006 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_02000 202321 202073 gene locus_tag LOCUS_02010 202321 202073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 202819 202568 gene locus_tag LOCUS_02020 202819 202568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 203087 204331 gene locus_tag LOCUS_02030 203087 204331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104479.1 protein_id gnl|my_center|LOCUS_02030 204538 205899 gene locus_tag LOCUS_02040 204538 205899 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229808.1 protein_id gnl|my_center|LOCUS_02040 206394 206780 gene locus_tag LOCUS_02050 206394 206780 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896379.1 protein_id gnl|my_center|LOCUS_02050 206990 206781 gene locus_tag LOCUS_02060 206990 206781 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224160.1 protein_id gnl|my_center|LOCUS_02060 207568 207140 gene locus_tag LOCUS_02070 207568 207140 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019670.1 protein_id gnl|my_center|LOCUS_02070 207596 208081 gene locus_tag LOCUS_02080 207596 208081 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030668.1 protein_id gnl|my_center|LOCUS_02080 208718 208071 gene locus_tag LOCUS_02090 208718 208071 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030664.1 protein_id gnl|my_center|LOCUS_02090 208988 208800 gene locus_tag LOCUS_02100 208988 208800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 208909 209238 gene locus_tag LOCUS_02110 208909 209238 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974563.1 protein_id gnl|my_center|LOCUS_02110 210743 209304 gene locus_tag LOCUS_02120 210743 209304 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229805.1 protein_id gnl|my_center|LOCUS_02120 211286 210900 gene locus_tag LOCUS_02130 211286 210900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 211994 211530 gene locus_tag LOCUS_02140 211994 211530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 213623 212007 gene locus_tag LOCUS_02150 213623 212007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 215170 213722 gene locus_tag LOCUS_02160 215170 213722 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229796.1 protein_id gnl|my_center|LOCUS_02160 216030 215239 gene locus_tag LOCUS_02170 216030 215239 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449629.1 protein_id gnl|my_center|LOCUS_02170 216291 217286 gene locus_tag LOCUS_02180 216291 217286 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284007.1 protein_id gnl|my_center|LOCUS_02180 218212 217322 gene locus_tag LOCUS_02190 218212 217322 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449629.1 protein_id gnl|my_center|LOCUS_02190 219339 218269 gene locus_tag LOCUS_02200 gene glpX 219339 218269 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742217.1 protein_id gnl|my_center|LOCUS_02200 219510 220112 gene locus_tag LOCUS_02210 219510 220112 CDS product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110031.1 protein_id gnl|my_center|LOCUS_02210 220458 220174 gene locus_tag LOCUS_02220 220458 220174 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229792.1 protein_id gnl|my_center|LOCUS_02220 220877 220455 gene locus_tag LOCUS_02230 220877 220455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 222101 220965 gene locus_tag LOCUS_02240 gene xseA 222101 220965 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229790.1 protein_id gnl|my_center|LOCUS_02240 222847 222326 gene locus_tag LOCUS_02250 222847 222326 CDS product lipid droplet-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730397.1 protein_id gnl|my_center|LOCUS_02250 222928 224019 gene locus_tag LOCUS_02260 222928 224019 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467730.1 protein_id gnl|my_center|LOCUS_02260 225017 224067 gene locus_tag LOCUS_02270 225017 224067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 225849 228428 gene locus_tag LOCUS_02280 225849 228428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 229473 228481 gene locus_tag LOCUS_02290 229473 228481 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227893.1 protein_id gnl|my_center|LOCUS_02290 229651 231069 gene locus_tag LOCUS_02300 229651 231069 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083033.1 protein_id gnl|my_center|LOCUS_02300 231156 232646 gene locus_tag LOCUS_02310 231156 232646 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776950.1 protein_id gnl|my_center|LOCUS_02310 233679 232759 gene locus_tag LOCUS_02320 233679 232759 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229786.1 protein_id gnl|my_center|LOCUS_02320 233832 235016 gene locus_tag LOCUS_02330 233832 235016 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284170.1 protein_id gnl|my_center|LOCUS_02330 235016 237970 gene locus_tag LOCUS_02340 235016 237970 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229784.1 protein_id gnl|my_center|LOCUS_02340 238046 239395 gene locus_tag LOCUS_02350 238046 239395 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 protein_id gnl|my_center|LOCUS_02350 239571 239756 gene locus_tag LOCUS_02360 239571 239756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 239841 240920 gene locus_tag LOCUS_02370 gene ychF 239841 240920 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229781.1 protein_id gnl|my_center|LOCUS_02370 241851 241390 gene locus_tag LOCUS_02380 241851 241390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02380 242436 242765 gene locus_tag LOCUS_02390 242436 242765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 243084 242827 gene locus_tag LOCUS_02400 243084 242827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 243382 243143 gene locus_tag LOCUS_02410 243382 243143 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230745.1 protein_id gnl|my_center|LOCUS_02410 244406 243519 gene locus_tag LOCUS_02420 244406 243519 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230746.1 protein_id gnl|my_center|LOCUS_02420 244483 245367 gene locus_tag LOCUS_02430 244483 245367 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467855.1 protein_id gnl|my_center|LOCUS_02430 245557 246606 gene locus_tag LOCUS_02440 245557 246606 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878186.1 protein_id gnl|my_center|LOCUS_02440 246603 248207 gene locus_tag LOCUS_02450 246603 248207 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125313541.1 protein_id gnl|my_center|LOCUS_02450 248207 249247 gene locus_tag LOCUS_02460 248207 249247 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229774.1 protein_id gnl|my_center|LOCUS_02460 249849 249301 gene locus_tag LOCUS_02470 249849 249301 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223116.1 protein_id gnl|my_center|LOCUS_02470 250826 249978 gene locus_tag LOCUS_02480 250826 249978 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229773.1 protein_id gnl|my_center|LOCUS_02480 251794 250823 gene locus_tag LOCUS_02490 251794 250823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229772.1 protein_id gnl|my_center|LOCUS_02490 252825 251791 gene locus_tag LOCUS_02500 252825 251791 CDS product sigma-E factor regulatory protein RseB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229771.1 protein_id gnl|my_center|LOCUS_02500 252939 253355 gene locus_tag LOCUS_02510 252939 253355 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229768.1 protein_id gnl|my_center|LOCUS_02510 253437 253748 gene locus_tag LOCUS_02520 253437 253748 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229766.1 protein_id gnl|my_center|LOCUS_02520 254172 256079 gene locus_tag LOCUS_02530 gene typA 254172 256079 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229765.1 protein_id gnl|my_center|LOCUS_02530 256614 256180 gene locus_tag LOCUS_02540 256614 256180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 256499 258007 gene locus_tag LOCUS_02550 256499 258007 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229764.1 protein_id gnl|my_center|LOCUS_02550 258060 258971 gene locus_tag LOCUS_02560 gene mshB 258060 258971 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229758.1 protein_id gnl|my_center|LOCUS_02560 258971 259348 gene locus_tag LOCUS_02570 258971 259348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 259345 260106 gene locus_tag LOCUS_02580 259345 260106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229756.1 protein_id gnl|my_center|LOCUS_02580 260291 260611 gene locus_tag LOCUS_02590 260291 260611 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083029.1 protein_id gnl|my_center|LOCUS_02590 260608 261738 gene locus_tag LOCUS_02600 gene dapC 260608 261738 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222936.1 protein_id gnl|my_center|LOCUS_02600 262841 261855 gene locus_tag LOCUS_02610 gene dapD 262841 261855 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222940.1 protein_id gnl|my_center|LOCUS_02610 262903 263979 gene locus_tag LOCUS_02620 gene dapE 262903 263979 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222942.1 protein_id gnl|my_center|LOCUS_02620 264945 264022 gene locus_tag LOCUS_02630 264945 264022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 265205 265984 gene locus_tag LOCUS_02640 265205 265984 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222950.1 protein_id gnl|my_center|LOCUS_02640 265966 266550 gene locus_tag LOCUS_02650 265966 266550 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730304.1 protein_id gnl|my_center|LOCUS_02650 266624 266872 gene locus_tag LOCUS_02660 266624 266872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 266869 267285 gene locus_tag LOCUS_02670 266869 267285 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967235.1 protein_id gnl|my_center|LOCUS_02670 267642 267977 gene locus_tag LOCUS_02680 267642 267977 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 protein_id gnl|my_center|LOCUS_02680 268103 268450 gene locus_tag LOCUS_02690 268103 268450 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222965.1 protein_id gnl|my_center|LOCUS_02690 269278 268490 gene locus_tag LOCUS_02700 269278 268490 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_02700 269636 269803 gene locus_tag LOCUS_02710 269636 269803 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222969.1 protein_id gnl|my_center|LOCUS_02710 269838 271406 gene locus_tag LOCUS_02720 269838 271406 CDS product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222970.1 protein_id gnl|my_center|LOCUS_02720 272602 271676 gene locus_tag LOCUS_02730 272602 271676 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222971.1 protein_id gnl|my_center|LOCUS_02730 272669 273883 gene locus_tag LOCUS_02740 272669 273883 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726670.1 protein_id gnl|my_center|LOCUS_02740 274032 275138 gene locus_tag LOCUS_02750 274032 275138 CDS product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085467.1 protein_id gnl|my_center|LOCUS_02750 275630 275235 gene locus_tag LOCUS_02760 gene tatB 275630 275235 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222978.1 protein_id gnl|my_center|LOCUS_02760 277357 275720 gene locus_tag LOCUS_02770 277357 275720 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286309.1 protein_id gnl|my_center|LOCUS_02770 278364 277588 gene locus_tag LOCUS_02780 278364 277588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222976.1 protein_id gnl|my_center|LOCUS_02780 279056 278361 gene locus_tag LOCUS_02790 gene sigE 279056 278361 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314132.1 protein_id gnl|my_center|LOCUS_02790 279264 279878 gene locus_tag LOCUS_02800 279264 279878 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222974.1 protein_id gnl|my_center|LOCUS_02800 281083 279944 gene locus_tag LOCUS_02810 281083 279944 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286318.1 protein_id gnl|my_center|LOCUS_02810 281197 281730 gene locus_tag LOCUS_02820 281197 281730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 282308 281757 gene locus_tag LOCUS_02830 282308 281757 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222980.1 protein_id gnl|my_center|LOCUS_02830 283602 282301 gene locus_tag LOCUS_02840 283602 282301 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222981.1 protein_id gnl|my_center|LOCUS_02840 283758 284714 gene locus_tag LOCUS_02850 283758 284714 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_02850 284802 288131 gene locus_tag LOCUS_02860 284802 288131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 288443 288958 gene locus_tag LOCUS_02870 288443 288958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286307.1 protein_id gnl|my_center|LOCUS_02870 289536 289036 gene locus_tag LOCUS_02880 289536 289036 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230329.1 protein_id gnl|my_center|LOCUS_02880 289691 290302 gene locus_tag LOCUS_02890 gene wrbA 289691 290302 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728300.1 protein_id gnl|my_center|LOCUS_02890 290380 291348 gene locus_tag LOCUS_02900 290380 291348 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_02900 291345 291971 gene locus_tag LOCUS_02910 291345 291971 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086030.1 protein_id gnl|my_center|LOCUS_02910 292627 302940 gene locus_tag LOCUS_02920 292627 302940 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028843.1 protein_id gnl|my_center|LOCUS_02920 302979 303191 gene locus_tag LOCUS_02930 302979 303191 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975599.1 protein_id gnl|my_center|LOCUS_02930 303194 304180 gene locus_tag LOCUS_02940 303194 304180 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467380.1 protein_id gnl|my_center|LOCUS_02940 304177 304992 gene locus_tag LOCUS_02950 304177 304992 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227726.1 protein_id gnl|my_center|LOCUS_02950 306594 305509 gene locus_tag LOCUS_02960 gene corA 306594 305509 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223003.1 protein_id gnl|my_center|LOCUS_02960 307389 307033 gene locus_tag LOCUS_02970 307389 307033 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223006.1 protein_id gnl|my_center|LOCUS_02970 307607 307768 gene locus_tag LOCUS_02980 307607 307768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 307786 308355 gene locus_tag LOCUS_02990 307786 308355 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095467.1 protein_id gnl|my_center|LOCUS_02990 308395 309306 gene locus_tag LOCUS_03000 308395 309306 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223008.1 protein_id gnl|my_center|LOCUS_03000 309732 310013 gene locus_tag LOCUS_03010 309732 310013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 311277 310069 gene locus_tag LOCUS_03020 311277 310069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187324690.1 protein_id gnl|my_center|LOCUS_03020 313041 311317 gene locus_tag LOCUS_03030 313041 311317 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223014.1 protein_id gnl|my_center|LOCUS_03030 313508 314251 gene locus_tag LOCUS_03040 313508 314251 CDS product ferritin-like fold-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223015.1 protein_id gnl|my_center|LOCUS_03040 314298 314525 gene locus_tag LOCUS_03050 314298 314525 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893314.1 protein_id gnl|my_center|LOCUS_03050 314937 314587 gene locus_tag LOCUS_03060 314937 314587 CDS product DUF4873 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223017.1 protein_id gnl|my_center|LOCUS_03060 315682 314927 gene locus_tag LOCUS_03070 315682 314927 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223018.1 protein_id gnl|my_center|LOCUS_03070 315763 316662 gene locus_tag LOCUS_03080 315763 316662 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466629.1 protein_id gnl|my_center|LOCUS_03080 316659 317567 gene locus_tag LOCUS_03090 316659 317567 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223020.1 protein_id gnl|my_center|LOCUS_03090 317632 317994 gene locus_tag LOCUS_03100 317632 317994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 320560 318098 gene locus_tag LOCUS_03110 320560 318098 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668834.1 protein_id gnl|my_center|LOCUS_03110 321250 320657 gene locus_tag LOCUS_03120 321250 320657 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027253.1 protein_id gnl|my_center|LOCUS_03120 322141 321503 gene locus_tag LOCUS_03130 322141 321503 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223021.1 protein_id gnl|my_center|LOCUS_03130 322229 323338 gene locus_tag LOCUS_03140 322229 323338 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223022.1 protein_id gnl|my_center|LOCUS_03140 323423 324415 gene locus_tag LOCUS_03150 323423 324415 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728024.1 protein_id gnl|my_center|LOCUS_03150 324671 325852 gene locus_tag LOCUS_03160 gene moeZ 324671 325852 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223024.1 protein_id gnl|my_center|LOCUS_03160 325928 326161 gene locus_tag LOCUS_03170 325928 326161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 326176 326574 gene locus_tag LOCUS_03180 326176 326574 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404903.1 protein_id gnl|my_center|LOCUS_03180 326680 327444 gene locus_tag LOCUS_03190 326680 327444 CDS product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223025.1 protein_id gnl|my_center|LOCUS_03190 327472 328299 gene locus_tag LOCUS_03200 327472 328299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 328593 328258 gene locus_tag LOCUS_03210 328593 328258 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728026.1 protein_id gnl|my_center|LOCUS_03210 329873 328827 gene locus_tag LOCUS_03220 329873 328827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 330108 333269 gene locus_tag LOCUS_03230 330108 333269 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_03230 333266 336595 gene locus_tag LOCUS_03240 333266 336595 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223039.1 protein_id gnl|my_center|LOCUS_03240 337015 336635 gene locus_tag LOCUS_03250 337015 336635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 337294 337028 gene locus_tag LOCUS_03260 337294 337028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 337453 338286 gene locus_tag LOCUS_03270 337453 338286 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749477.1 protein_id gnl|my_center|LOCUS_03270 338279 338467 gene locus_tag LOCUS_03280 338279 338467 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224160.1 protein_id gnl|my_center|LOCUS_03280 338617 339075 gene locus_tag LOCUS_03290 338617 339075 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973901.1 protein_id gnl|my_center|LOCUS_03290 339110 339733 gene locus_tag LOCUS_03300 339110 339733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 340292 339738 gene locus_tag LOCUS_03310 340292 339738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 340710 340339 gene locus_tag LOCUS_03320 340710 340339 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971791.1 protein_id gnl|my_center|LOCUS_03320 340872 342014 gene locus_tag LOCUS_03330 340872 342014 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223041.1 protein_id gnl|my_center|LOCUS_03330 342081 342506 gene locus_tag LOCUS_03340 342081 342506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223042.1 protein_id gnl|my_center|LOCUS_03340 343632 342535 gene locus_tag LOCUS_03350 343632 342535 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223052.1 protein_id gnl|my_center|LOCUS_03350 343671 343886 gene locus_tag LOCUS_03360 343671 343886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 344016 345644 gene locus_tag LOCUS_03370 344016 345644 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223053.1 protein_id gnl|my_center|LOCUS_03370 345832 346314 gene locus_tag LOCUS_03380 345832 346314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 346420 346929 gene locus_tag LOCUS_03390 346420 346929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 347154 347975 gene locus_tag LOCUS_03400 347154 347975 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223600.1 protein_id gnl|my_center|LOCUS_03400 348251 348817 gene locus_tag LOCUS_03410 348251 348817 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175285932.1 protein_id gnl|my_center|LOCUS_03410 348909 349907 gene locus_tag LOCUS_03420 348909 349907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225294.1 protein_id gnl|my_center|LOCUS_03420 349904 352129 gene locus_tag LOCUS_03430 349904 352129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 352170 353021 gene locus_tag LOCUS_03440 352170 353021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 353145 354455 gene locus_tag LOCUS_03450 353145 354455 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 protein_id gnl|my_center|LOCUS_03450 354452 355819 gene locus_tag LOCUS_03460 354452 355819 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223056.1 protein_id gnl|my_center|LOCUS_03460 355843 356742 gene locus_tag LOCUS_03470 gene nudC 355843 356742 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056376.1 protein_id gnl|my_center|LOCUS_03470 357149 356889 gene locus_tag LOCUS_03480 357149 356889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 358464 357196 gene locus_tag LOCUS_03490 358464 357196 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223916.1 protein_id gnl|my_center|LOCUS_03490 359216 358461 gene locus_tag LOCUS_03500 359216 358461 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066563356.1 protein_id gnl|my_center|LOCUS_03500 359356 361437 gene locus_tag LOCUS_03510 359356 361437 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742114.1 protein_id gnl|my_center|LOCUS_03510 361913 362275 gene locus_tag LOCUS_03520 361913 362275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 362416 363288 gene locus_tag LOCUS_03530 362416 363288 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466643.1 protein_id gnl|my_center|LOCUS_03530 364605 363292 gene locus_tag LOCUS_03540 364605 363292 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223144.1 protein_id gnl|my_center|LOCUS_03540 364874 364722 gene locus_tag LOCUS_03550 364874 364722 CDS product DUF5679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551122.1 protein_id gnl|my_center|LOCUS_03550 365206 365739 gene locus_tag LOCUS_03560 365206 365739 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223146.1 protein_id gnl|my_center|LOCUS_03560 367240 365753 gene locus_tag LOCUS_03570 367240 365753 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466645.1 protein_id gnl|my_center|LOCUS_03570 367384 368430 gene locus_tag LOCUS_03580 367384 368430 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187324693.1 protein_id gnl|my_center|LOCUS_03580 368974 368450 gene locus_tag LOCUS_03590 368974 368450 CDS product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223149.1 protein_id gnl|my_center|LOCUS_03590 369168 372128 gene locus_tag LOCUS_03600 369168 372128 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630643.1 protein_id gnl|my_center|LOCUS_03600 372251 372325 gene locus_tag LOCUS_t00040 372251 372325 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 372560 372634 gene locus_tag LOCUS_t00050 372560 372634 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 372923 372708 gene locus_tag LOCUS_03610 372923 372708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 373237 373734 gene locus_tag LOCUS_03620 373237 373734 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223153.1 protein_id gnl|my_center|LOCUS_03620 373813 374925 gene locus_tag LOCUS_03630 gene prfB 373813 374925 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141748464.1 protein_id gnl|my_center|LOCUS_03630 375204 375893 gene locus_tag LOCUS_03640 gene ftsE 375204 375893 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082104.1 protein_id gnl|my_center|LOCUS_03640 375957 376859 gene locus_tag LOCUS_03650 gene ftsX 375957 376859 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223155.1 protein_id gnl|my_center|LOCUS_03650 376870 377349 gene locus_tag LOCUS_03660 gene smpB 376870 377349 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_03660 377346 378254 gene locus_tag LOCUS_03670 377346 378254 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223157.1 protein_id gnl|my_center|LOCUS_03670 378448 378824 gene locus_tag LOCUS_tm00010 378448 378824 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 380159 379575 gene locus_tag LOCUS_03680 380159 379575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03680 380393 381559 gene locus_tag LOCUS_03690 380393 381559 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222734.1 protein_id gnl|my_center|LOCUS_03690 383163 381628 gene locus_tag LOCUS_03700 383163 381628 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510563.1 protein_id gnl|my_center|LOCUS_03700 383618 383265 gene locus_tag LOCUS_03710 383618 383265 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_03710 383720 384559 gene locus_tag LOCUS_03720 383720 384559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 384668 384865 gene locus_tag LOCUS_03730 384668 384865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 385368 384814 gene locus_tag LOCUS_03740 385368 384814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 385268 386452 gene locus_tag LOCUS_03750 385268 386452 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728183.1 protein_id gnl|my_center|LOCUS_03750 386524 386757 gene locus_tag LOCUS_03760 386524 386757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 386750 388114 gene locus_tag LOCUS_03770 386750 388114 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229915.1 protein_id gnl|my_center|LOCUS_03770 389473 388118 gene locus_tag LOCUS_03780 389473 388118 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938906.1 protein_id gnl|my_center|LOCUS_03780 389623 389695 gene locus_tag LOCUS_t00060 389623 389695 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 389902 390210 gene locus_tag LOCUS_03790 389902 390210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 390691 390347 gene locus_tag LOCUS_03800 390691 390347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 390748 391869 gene locus_tag LOCUS_03810 390748 391869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 393187 392066 gene locus_tag LOCUS_03820 393187 392066 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974677.1 protein_id gnl|my_center|LOCUS_03820 393333 393803 gene locus_tag LOCUS_03830 393333 393803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 393841 394671 gene locus_tag LOCUS_03840 393841 394671 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230082.1 protein_id gnl|my_center|LOCUS_03840 395568 394738 gene locus_tag LOCUS_03850 395568 394738 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031548.1 protein_id gnl|my_center|LOCUS_03850 396145 395648 gene locus_tag LOCUS_03860 396145 395648 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226262.1 protein_id gnl|my_center|LOCUS_03860 396066 396326 gene locus_tag LOCUS_03870 396066 396326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 396441 397097 gene locus_tag LOCUS_03880 396441 397097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 397462 398238 gene locus_tag LOCUS_03890 397462 398238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 398440 399432 gene locus_tag LOCUS_03900 398440 399432 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028064.1 protein_id gnl|my_center|LOCUS_03900 400865 399438 gene locus_tag LOCUS_03910 400865 399438 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 protein_id gnl|my_center|LOCUS_03910 402246 400993 gene locus_tag LOCUS_03920 402246 400993 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896733.1 protein_id gnl|my_center|LOCUS_03920 402579 402373 gene locus_tag LOCUS_03930 402579 402373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 402596 403189 gene locus_tag LOCUS_03940 402596 403189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 404227 403268 gene locus_tag LOCUS_03950 404227 403268 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031361.1 protein_id gnl|my_center|LOCUS_03950 404573 404989 gene locus_tag LOCUS_03960 404573 404989 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227025.1 protein_id gnl|my_center|LOCUS_03960 405113 405394 gene locus_tag LOCUS_03970 405113 405394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 405765 405454 gene locus_tag LOCUS_03980 405765 405454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 406836 405844 gene locus_tag LOCUS_03990 406836 405844 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038752.1 protein_id gnl|my_center|LOCUS_03990 407898 406873 gene locus_tag LOCUS_04000 407898 406873 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029972.1 protein_id gnl|my_center|LOCUS_04000 408319 408618 gene locus_tag LOCUS_04010 408319 408618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003054488.1 protein_id gnl|my_center|LOCUS_04010 408730 409440 gene locus_tag LOCUS_04020 408730 409440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224225.1 protein_id gnl|my_center|LOCUS_04020 409481 411379 gene locus_tag LOCUS_04030 409481 411379 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_04030 411408 412166 gene locus_tag LOCUS_04040 411408 412166 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224227.1 protein_id gnl|my_center|LOCUS_04040 412174 412386 gene locus_tag LOCUS_04050 412174 412386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 413168 412350 gene locus_tag LOCUS_04060 413168 412350 CDS product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804446.1 protein_id gnl|my_center|LOCUS_04060 414439 413546 gene locus_tag LOCUS_04070 414439 413546 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411086.1 protein_id gnl|my_center|LOCUS_04070 415153 414536 gene locus_tag LOCUS_04080 415153 414536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 415594 415388 gene locus_tag LOCUS_04090 415594 415388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 415512 417293 gene locus_tag LOCUS_04100 gene ctaD 415512 417293 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229476.1 protein_id gnl|my_center|LOCUS_04100 417465 418700 gene locus_tag LOCUS_04110 gene serB 417465 418700 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229475.1 protein_id gnl|my_center|LOCUS_04110 418761 419546 gene locus_tag LOCUS_04120 418761 419546 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229474.1 protein_id gnl|my_center|LOCUS_04120 419806 420834 gene locus_tag LOCUS_04130 419806 420834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 420924 422033 gene locus_tag LOCUS_04140 420924 422033 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978297.1 protein_id gnl|my_center|LOCUS_04140 422689 422084 gene locus_tag LOCUS_04150 422689 422084 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391434.1 protein_id gnl|my_center|LOCUS_04150 423360 422686 gene locus_tag LOCUS_04160 423360 422686 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889094.1 protein_id gnl|my_center|LOCUS_04160 424487 423357 gene locus_tag LOCUS_04170 424487 423357 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241160.1 protein_id gnl|my_center|LOCUS_04170 425884 424484 gene locus_tag LOCUS_04180 425884 424484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 426469 425888 gene locus_tag LOCUS_04190 426469 425888 CDS product BioY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391133.1 protein_id gnl|my_center|LOCUS_04190 428814 426643 gene locus_tag LOCUS_04200 428814 426643 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 protein_id gnl|my_center|LOCUS_04200 429443 428844 gene locus_tag LOCUS_04210 429443 428844 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 protein_id gnl|my_center|LOCUS_04210 430807 429503 gene locus_tag LOCUS_04220 430807 429503 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229465.1 protein_id gnl|my_center|LOCUS_04220 430881 431174 gene locus_tag LOCUS_04230 gene clpS 430881 431174 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229464.1 protein_id gnl|my_center|LOCUS_04230 431234 431734 gene locus_tag LOCUS_04240 431234 431734 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229463.1 protein_id gnl|my_center|LOCUS_04240 431725 432780 gene locus_tag LOCUS_04250 431725 432780 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406908.1 protein_id gnl|my_center|LOCUS_04250 432869 433324 gene locus_tag LOCUS_04260 432869 433324 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896304.1 protein_id gnl|my_center|LOCUS_04260 433401 433679 gene locus_tag LOCUS_04270 433401 433679 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559268.1 protein_id gnl|my_center|LOCUS_04270 433914 434864 gene locus_tag LOCUS_04280 433914 434864 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229459.1 protein_id gnl|my_center|LOCUS_04280 435786 434944 gene locus_tag LOCUS_04290 435786 434944 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028354.1 protein_id gnl|my_center|LOCUS_04290 435842 436531 gene locus_tag LOCUS_04300 435842 436531 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229455.1 protein_id gnl|my_center|LOCUS_04300 436528 437337 gene locus_tag LOCUS_04310 gene murI 436528 437337 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467674.1 protein_id gnl|my_center|LOCUS_04310 438391 439161 gene locus_tag LOCUS_04320 438391 439161 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229453.1 protein_id gnl|my_center|LOCUS_04320 439230 439649 gene locus_tag LOCUS_04330 439230 439649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 439788 440462 gene locus_tag LOCUS_04340 gene rph 439788 440462 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229452.1 protein_id gnl|my_center|LOCUS_04340 440459 441064 gene locus_tag LOCUS_04350 gene rdgB 440459 441064 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229451.1 protein_id gnl|my_center|LOCUS_04350 441256 442014 gene locus_tag LOCUS_04360 441256 442014 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222221.1 protein_id gnl|my_center|LOCUS_04360 442523 442056 gene locus_tag LOCUS_04370 gene bcp 442523 442056 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 protein_id gnl|my_center|LOCUS_04370 442724 442554 gene locus_tag LOCUS_04380 442724 442554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 442944 444674 gene locus_tag LOCUS_04390 442944 444674 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226369.1 protein_id gnl|my_center|LOCUS_04390 444747 445595 gene locus_tag LOCUS_04400 444747 445595 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_04400 445596 445844 gene locus_tag LOCUS_04410 445596 445844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 447374 445857 gene locus_tag LOCUS_04420 447374 445857 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229590.1 protein_id gnl|my_center|LOCUS_04420 447886 447371 gene locus_tag LOCUS_04430 447886 447371 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 protein_id gnl|my_center|LOCUS_04430 449679 448369 gene locus_tag LOCUS_04440 449679 448369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224630.1 protein_id gnl|my_center|LOCUS_04440 451540 449783 gene locus_tag LOCUS_04450 451540 449783 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227542.1 protein_id gnl|my_center|LOCUS_04450 452706 451564 gene locus_tag LOCUS_04460 452706 451564 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031646.1 protein_id gnl|my_center|LOCUS_04460 452746 453342 gene locus_tag LOCUS_04470 452746 453342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 454028 453567 gene locus_tag LOCUS_04480 454028 453567 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229196.1 protein_id gnl|my_center|LOCUS_04480 454778 454059 gene locus_tag LOCUS_04490 454778 454059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 455807 454785 gene locus_tag LOCUS_04500 455807 454785 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031519.1 protein_id gnl|my_center|LOCUS_04500 456602 455826 gene locus_tag LOCUS_04510 456602 455826 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851039.1 protein_id gnl|my_center|LOCUS_04510 457702 456602 gene locus_tag LOCUS_04520 457702 456602 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031517.1 protein_id gnl|my_center|LOCUS_04520 458576 458501 gene locus_tag LOCUS_t00070 458576 458501 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 458719 458940 gene locus_tag LOCUS_04530 458719 458940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 459632 458976 gene locus_tag LOCUS_04540 459632 458976 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244147.1 protein_id gnl|my_center|LOCUS_04540 459999 459679 gene locus_tag LOCUS_04550 459999 459679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 460702 460115 gene locus_tag LOCUS_04560 460702 460115 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_04560 461801 460695 gene locus_tag LOCUS_04570 461801 460695 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027597.1 protein_id gnl|my_center|LOCUS_04570 463440 461830 gene locus_tag LOCUS_04580 463440 461830 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226426.1 protein_id gnl|my_center|LOCUS_04580 464101 463526 gene locus_tag LOCUS_04590 464101 463526 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974003.1 protein_id gnl|my_center|LOCUS_04590 466489 464168 gene locus_tag LOCUS_04600 gene pucD 466489 464168 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226424.1 protein_id gnl|my_center|LOCUS_04600 467835 466486 gene locus_tag LOCUS_04610 467835 466486 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223813.1 protein_id gnl|my_center|LOCUS_04610 468350 467871 gene locus_tag LOCUS_04620 468350 467871 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226423.1 protein_id gnl|my_center|LOCUS_04620 469222 468341 gene locus_tag LOCUS_04630 469222 468341 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226422.1 protein_id gnl|my_center|LOCUS_04630 469462 471009 gene locus_tag LOCUS_04640 469462 471009 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030705.1 protein_id gnl|my_center|LOCUS_04640 471281 472528 gene locus_tag LOCUS_04650 gene odc2 471281 472528 CDS product ornithine/lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970259.1 protein_id gnl|my_center|LOCUS_04650 472609 473010 gene locus_tag LOCUS_04660 gene speD 472609 473010 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226975.1 protein_id gnl|my_center|LOCUS_04660 473047 473925 gene locus_tag LOCUS_04670 473047 473925 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226974.1 protein_id gnl|my_center|LOCUS_04670 475194 474076 gene locus_tag LOCUS_04680 475194 474076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 475327 476205 gene locus_tag LOCUS_04690 gene rbsK 475327 476205 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246357.1 protein_id gnl|my_center|LOCUS_04690 476677 476312 gene locus_tag LOCUS_04700 476677 476312 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_04700 477038 477529 gene locus_tag LOCUS_04710 477038 477529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 477958 477701 gene locus_tag LOCUS_04720 477958 477701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 478667 480196 gene locus_tag LOCUS_r00010 478667 480196 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 480500 483583 gene locus_tag LOCUS_r00020 480500 483583 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 483933 485633 gene locus_tag LOCUS_04730 gene ilvD 483933 485633 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900824.1 protein_id gnl|my_center|LOCUS_04730 486476 485721 gene locus_tag LOCUS_04740 486476 485721 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027262.1 protein_id gnl|my_center|LOCUS_04740 487087 486473 gene locus_tag LOCUS_04750 gene sigK 487087 486473 CDS product ECF RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466900.1 protein_id gnl|my_center|LOCUS_04750 488347 487091 gene locus_tag LOCUS_04760 488347 487091 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224736.1 protein_id gnl|my_center|LOCUS_04760 488862 488389 gene locus_tag LOCUS_04770 488862 488389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04770 489122 488862 gene locus_tag LOCUS_04780 489122 488862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04780 489379 489125 gene locus_tag LOCUS_04790 489379 489125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04790 489559 490032 gene locus_tag LOCUS_04800 489559 490032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 490390 490124 gene locus_tag LOCUS_04810 490390 490124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04810 491079 490387 gene locus_tag LOCUS_04820 491079 490387 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224735.1 protein_id gnl|my_center|LOCUS_04820 491674 492543 gene locus_tag LOCUS_04830 491674 492543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04830 492545 492898 gene locus_tag LOCUS_04840 492545 492898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04840 492915 493337 gene locus_tag LOCUS_04850 492915 493337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04850 493765 493418 gene locus_tag LOCUS_04860 493765 493418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 493968 493762 gene locus_tag LOCUS_04870 493968 493762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 493984 494163 gene locus_tag LOCUS_04880 493984 494163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 494746 494501 gene locus_tag LOCUS_04890 494746 494501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 494815 495027 gene locus_tag LOCUS_04900 494815 495027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 495908 495036 gene locus_tag LOCUS_04910 495908 495036 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222983.1 protein_id gnl|my_center|LOCUS_04910 496223 495996 gene locus_tag LOCUS_04920 496223 495996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 497634 496390 gene locus_tag LOCUS_04930 497634 496390 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224442.1 protein_id gnl|my_center|LOCUS_04930 498553 497774 gene locus_tag LOCUS_04940 498553 497774 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265896.1 protein_id gnl|my_center|LOCUS_04940 498792 498719 gene locus_tag LOCUS_t00080 498792 498719 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 499136 500305 gene locus_tag LOCUS_04950 499136 500305 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015151.1 protein_id gnl|my_center|LOCUS_04950 500372 500989 gene locus_tag LOCUS_04960 500372 500989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 500995 501681 gene locus_tag LOCUS_04970 500995 501681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223565.1 protein_id gnl|my_center|LOCUS_04970 501766 503940 gene locus_tag LOCUS_04980 gene ligA 501766 503940 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223566.1 protein_id gnl|my_center|LOCUS_04980 503937 504122 gene locus_tag LOCUS_04990 503937 504122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 504794 504141 gene locus_tag LOCUS_05000 504794 504141 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284416.1 protein_id gnl|my_center|LOCUS_05000 505087 505386 gene locus_tag LOCUS_05010 gene gatC 505087 505386 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_05010 505386 506924 gene locus_tag LOCUS_05020 gene gatA 505386 506924 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223570.1 protein_id gnl|my_center|LOCUS_05020 506921 507118 gene locus_tag LOCUS_05030 506921 507118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 507115 508623 gene locus_tag LOCUS_05040 gene gatB 507115 508623 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223571.1 protein_id gnl|my_center|LOCUS_05040 510040 508874 gene locus_tag LOCUS_05050 510040 508874 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223577.1 protein_id gnl|my_center|LOCUS_05050 510105 510881 gene locus_tag LOCUS_05060 510105 510881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 511447 510905 gene locus_tag LOCUS_05070 511447 510905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 511810 511556 gene locus_tag LOCUS_05080 511810 511556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 511768 513600 gene locus_tag LOCUS_05090 511768 513600 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284399.1 protein_id gnl|my_center|LOCUS_05090 513609 514115 gene locus_tag LOCUS_05100 gene ilvN 513609 514115 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_05100 514170 515165 gene locus_tag LOCUS_05110 gene ilvC 514170 515165 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223583.1 protein_id gnl|my_center|LOCUS_05110 515358 515603 gene locus_tag LOCUS_05120 515358 515603 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223584.1 protein_id gnl|my_center|LOCUS_05120 515789 517420 gene locus_tag LOCUS_05130 gene serA 515789 517420 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223590.1 protein_id gnl|my_center|LOCUS_05130 517702 517487 gene locus_tag LOCUS_05140 517702 517487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 517741 518784 gene locus_tag LOCUS_05150 517741 518784 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223592.1 protein_id gnl|my_center|LOCUS_05150 519165 520865 gene locus_tag LOCUS_05160 gene cimA 519165 520865 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223593.1 protein_id gnl|my_center|LOCUS_05160 520951 521733 gene locus_tag LOCUS_05170 520951 521733 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728307.1 protein_id gnl|my_center|LOCUS_05170 522975 521743 gene locus_tag LOCUS_05180 522975 521743 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110188.1 protein_id gnl|my_center|LOCUS_05180 523091 524590 gene locus_tag LOCUS_05190 gene gltX 523091 524590 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081448.1 protein_id gnl|my_center|LOCUS_05190 524728 525435 gene locus_tag LOCUS_05200 524728 525435 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284413.1 protein_id gnl|my_center|LOCUS_05200 525628 525699 gene locus_tag LOCUS_t00090 525628 525699 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 525733 525806 gene locus_tag LOCUS_t00100 525733 525806 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 525983 526056 gene locus_tag LOCUS_t00110 525983 526056 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 526332 526640 gene locus_tag LOCUS_05210 526332 526640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05210 527476 526775 gene locus_tag LOCUS_05220 527476 526775 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560682.1 protein_id gnl|my_center|LOCUS_05220 527583 528983 gene locus_tag LOCUS_05230 gene leuC 527583 528983 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223619.1 protein_id gnl|my_center|LOCUS_05230 529036 529638 gene locus_tag LOCUS_05240 gene leuD 529036 529638 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223620.1 protein_id gnl|my_center|LOCUS_05240 529862 530818 gene locus_tag LOCUS_05250 529862 530818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 531844 530852 gene locus_tag LOCUS_05260 531844 530852 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223623.1 protein_id gnl|my_center|LOCUS_05260 534146 531852 gene locus_tag LOCUS_05270 534146 531852 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742242.1 protein_id gnl|my_center|LOCUS_05270 534808 534143 gene locus_tag LOCUS_05280 gene cofC 534808 534143 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223625.1 protein_id gnl|my_center|LOCUS_05280 534938 535717 gene locus_tag LOCUS_05290 534938 535717 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223626.1 protein_id gnl|my_center|LOCUS_05290 535710 536729 gene locus_tag LOCUS_05300 535710 536729 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223627.1 protein_id gnl|my_center|LOCUS_05300 536742 537851 gene locus_tag LOCUS_05310 536742 537851 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029309.1 protein_id gnl|my_center|LOCUS_05310 538095 538535 gene locus_tag LOCUS_05320 538095 538535 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223628.1 protein_id gnl|my_center|LOCUS_05320 539128 538502 gene locus_tag LOCUS_05330 539128 538502 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229952.1 protein_id gnl|my_center|LOCUS_05330 539326 539958 gene locus_tag LOCUS_05340 539326 539958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 540834 540028 gene locus_tag LOCUS_05350 540834 540028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05350 541157 541354 gene locus_tag LOCUS_05360 541157 541354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 542152 541433 gene locus_tag LOCUS_05370 542152 541433 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223636.1 protein_id gnl|my_center|LOCUS_05370 542144 543547 gene locus_tag LOCUS_05380 542144 543547 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223637.1 protein_id gnl|my_center|LOCUS_05380 543583 544686 gene locus_tag LOCUS_05390 543583 544686 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223638.1 protein_id gnl|my_center|LOCUS_05390 545373 544777 gene locus_tag LOCUS_05400 545373 544777 CDS product DUF3515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742243.1 protein_id gnl|my_center|LOCUS_05400 545618 545385 gene locus_tag LOCUS_05410 545618 545385 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_05410 545713 546678 gene locus_tag LOCUS_05420 545713 546678 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223640.1 protein_id gnl|my_center|LOCUS_05420 548083 546725 gene locus_tag LOCUS_05430 gene proP 548083 546725 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028291.1 protein_id gnl|my_center|LOCUS_05430 548464 549114 gene locus_tag LOCUS_05440 548464 549114 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223644.1 protein_id gnl|my_center|LOCUS_05440 549742 549458 gene locus_tag LOCUS_05450 549742 549458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 549956 551524 gene locus_tag LOCUS_05460 549956 551524 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223646.1 protein_id gnl|my_center|LOCUS_05460 551796 554015 gene locus_tag LOCUS_05470 gene recG 551796 554015 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223647.1 protein_id gnl|my_center|LOCUS_05470 554227 557604 gene locus_tag LOCUS_05480 554227 557604 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027194.1 protein_id gnl|my_center|LOCUS_05480 558055 558522 gene locus_tag LOCUS_05490 558055 558522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 558599 559177 gene locus_tag LOCUS_05500 gene rsmD 558599 559177 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_05500 559211 559717 gene locus_tag LOCUS_05510 gene coaD 559211 559717 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223683.1 protein_id gnl|my_center|LOCUS_05510 559940 560326 gene locus_tag LOCUS_05520 559940 560326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 560520 561257 gene locus_tag LOCUS_05530 560520 561257 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223687.1 protein_id gnl|my_center|LOCUS_05530 561468 562118 gene locus_tag LOCUS_05540 561468 562118 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284376.1 protein_id gnl|my_center|LOCUS_05540 562121 562303 gene locus_tag LOCUS_05550 gene rpmF 562121 562303 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223689.1 protein_id gnl|my_center|LOCUS_05550 562318 563073 gene locus_tag LOCUS_05560 gene rnc 562318 563073 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742189.1 protein_id gnl|my_center|LOCUS_05560 563102 563974 gene locus_tag LOCUS_05570 gene mutM 563102 563974 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 protein_id gnl|my_center|LOCUS_05570 564366 565634 gene locus_tag LOCUS_05580 564366 565634 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227478.1 protein_id gnl|my_center|LOCUS_05580 565631 567706 gene locus_tag LOCUS_05590 565631 567706 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227479.1 protein_id gnl|my_center|LOCUS_05590 567818 568516 gene locus_tag LOCUS_05600 567818 568516 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 protein_id gnl|my_center|LOCUS_05600 568513 569976 gene locus_tag LOCUS_05610 gene phoR 568513 569976 CDS product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403870.1 protein_id gnl|my_center|LOCUS_05610 571960 570125 gene locus_tag LOCUS_05620 gene asnB 571960 570125 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223784.1 protein_id gnl|my_center|LOCUS_05620 572330 572476 gene locus_tag LOCUS_05630 572330 572476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 572829 572449 gene locus_tag LOCUS_05640 572829 572449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 572951 573118 gene locus_tag LOCUS_05650 572951 573118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 573115 573447 gene locus_tag LOCUS_05660 573115 573447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 574607 573738 gene locus_tag LOCUS_05670 574607 573738 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947370.1 protein_id gnl|my_center|LOCUS_05670 575546 574716 gene locus_tag LOCUS_05680 575546 574716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 575765 577159 gene locus_tag LOCUS_05690 575765 577159 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243731.1 protein_id gnl|my_center|LOCUS_05690 577156 577806 gene locus_tag LOCUS_05700 577156 577806 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230842.1 protein_id gnl|my_center|LOCUS_05700 578198 578007 gene locus_tag LOCUS_05710 578198 578007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 578178 578849 gene locus_tag LOCUS_05720 578178 578849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 578846 579130 gene locus_tag LOCUS_05730 578846 579130 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223794.1 protein_id gnl|my_center|LOCUS_05730 579237 582959 gene locus_tag LOCUS_05740 gene smc 579237 582959 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223795.1 protein_id gnl|my_center|LOCUS_05740 584607 583096 gene locus_tag LOCUS_05750 584607 583096 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223797.1 protein_id gnl|my_center|LOCUS_05750 585791 584586 gene locus_tag LOCUS_05760 585791 584586 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223798.1 protein_id gnl|my_center|LOCUS_05760 585925 587454 gene locus_tag LOCUS_05770 585925 587454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 587521 588762 gene locus_tag LOCUS_05780 587521 588762 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420258.1 protein_id gnl|my_center|LOCUS_05780 588906 590216 gene locus_tag LOCUS_05790 588906 590216 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087724.1 protein_id gnl|my_center|LOCUS_05790 590213 590551 gene locus_tag LOCUS_05800 590213 590551 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223833.1 protein_id gnl|my_center|LOCUS_05800 590971 591558 gene locus_tag LOCUS_05810 590971 591558 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030270.1 protein_id gnl|my_center|LOCUS_05810 591854 593572 gene locus_tag LOCUS_05820 591854 593572 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014161.1 protein_id gnl|my_center|LOCUS_05820 593602 595257 gene locus_tag LOCUS_05830 gene ffh 593602 595257 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223845.1 protein_id gnl|my_center|LOCUS_05830 595267 596340 gene locus_tag LOCUS_05840 595267 596340 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111684.1 protein_id gnl|my_center|LOCUS_05840 596392 597288 gene locus_tag LOCUS_05850 596392 597288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 597395 598162 gene locus_tag LOCUS_05860 597395 598162 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223848.1 protein_id gnl|my_center|LOCUS_05860 598323 598093 gene locus_tag LOCUS_05870 598323 598093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 598361 598810 gene locus_tag LOCUS_05880 gene rpsP 598361 598810 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223849.1 protein_id gnl|my_center|LOCUS_05880 598807 599046 gene locus_tag LOCUS_05890 598807 599046 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103110.1 protein_id gnl|my_center|LOCUS_05890 599055 599603 gene locus_tag LOCUS_05900 gene rimM 599055 599603 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223850.1 protein_id gnl|my_center|LOCUS_05900 599632 600396 gene locus_tag LOCUS_05910 gene trmD 599632 600396 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223852.1 protein_id gnl|my_center|LOCUS_05910 600757 601116 gene locus_tag LOCUS_05920 gene rplS 600757 601116 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223853.1 protein_id gnl|my_center|LOCUS_05920 601529 601335 gene locus_tag LOCUS_05930 601529 601335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 601434 602381 gene locus_tag LOCUS_05940 gene lepB 601434 602381 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227333.1 protein_id gnl|my_center|LOCUS_05940 602384 603139 gene locus_tag LOCUS_05950 602384 603139 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223855.1 protein_id gnl|my_center|LOCUS_05950 603173 603496 gene locus_tag LOCUS_05960 603173 603496 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_05960 603828 603577 gene locus_tag LOCUS_05970 603828 603577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 603785 604186 gene locus_tag LOCUS_05980 603785 604186 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223856.1 protein_id gnl|my_center|LOCUS_05980 604188 605705 gene locus_tag LOCUS_05990 604188 605705 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189256709.1 protein_id gnl|my_center|LOCUS_05990 605702 606856 gene locus_tag LOCUS_06000 gene dprA 605702 606856 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742183.1 protein_id gnl|my_center|LOCUS_06000 607022 607930 gene locus_tag LOCUS_06010 607022 607930 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223859.1 protein_id gnl|my_center|LOCUS_06010 607905 608876 gene locus_tag LOCUS_06020 607905 608876 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223860.1 protein_id gnl|my_center|LOCUS_06020 609473 608898 gene locus_tag LOCUS_06030 609473 608898 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223861.1 protein_id gnl|my_center|LOCUS_06030 609976 610836 gene locus_tag LOCUS_06040 gene rpsB 609976 610836 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223862.1 protein_id gnl|my_center|LOCUS_06040 610933 611748 gene locus_tag LOCUS_06050 gene tsf 610933 611748 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223863.1 protein_id gnl|my_center|LOCUS_06050 611836 612600 gene locus_tag LOCUS_06060 gene pyrH 611836 612600 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223864.1 protein_id gnl|my_center|LOCUS_06060 612701 613258 gene locus_tag LOCUS_06070 gene frr 612701 613258 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466739.1 protein_id gnl|my_center|LOCUS_06070 613301 614146 gene locus_tag LOCUS_06080 613301 614146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 614357 614806 gene locus_tag LOCUS_06090 614357 614806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 615467 614790 gene locus_tag LOCUS_06100 615467 614790 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230121.1 protein_id gnl|my_center|LOCUS_06100 616481 615609 gene locus_tag LOCUS_06110 616481 615609 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868812.1 protein_id gnl|my_center|LOCUS_06110 616663 617778 gene locus_tag LOCUS_06120 gene rlmN 616663 617778 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223876.1 protein_id gnl|my_center|LOCUS_06120 618287 617985 gene locus_tag LOCUS_06130 618287 617985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 618450 619733 gene locus_tag LOCUS_06140 gene dxr 618450 619733 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284246.1 protein_id gnl|my_center|LOCUS_06140 619730 621019 gene locus_tag LOCUS_06150 619730 621019 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030397.1 protein_id gnl|my_center|LOCUS_06150 621209 622360 gene locus_tag LOCUS_06160 gene ispG 621209 622360 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284254.1 protein_id gnl|my_center|LOCUS_06160 622500 623429 gene locus_tag LOCUS_06170 622500 623429 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466751.1 protein_id gnl|my_center|LOCUS_06170 623525 625330 gene locus_tag LOCUS_06180 623525 625330 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284244.1 protein_id gnl|my_center|LOCUS_06180 625419 625823 gene locus_tag LOCUS_06190 625419 625823 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417916.1 protein_id gnl|my_center|LOCUS_06190 625926 626783 gene locus_tag LOCUS_06200 gene map 625926 626783 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223934.1 protein_id gnl|my_center|LOCUS_06200 626840 627478 gene locus_tag LOCUS_06210 626840 627478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 628198 627512 gene locus_tag LOCUS_06220 628198 627512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 628866 628201 gene locus_tag LOCUS_06230 628866 628201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 629294 628938 gene locus_tag LOCUS_06240 629294 628938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06240 629614 629291 gene locus_tag LOCUS_06250 629614 629291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 630066 629611 gene locus_tag LOCUS_06260 630066 629611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 630249 631754 gene locus_tag LOCUS_06270 630249 631754 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093851.1 protein_id gnl|my_center|LOCUS_06270 632463 631765 gene locus_tag LOCUS_06280 632463 631765 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223939.1 protein_id gnl|my_center|LOCUS_06280 632513 633772 gene locus_tag LOCUS_06290 632513 633772 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877490.1 protein_id gnl|my_center|LOCUS_06290 635256 633916 gene locus_tag LOCUS_06300 gene gdhA 635256 633916 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941959.1 protein_id gnl|my_center|LOCUS_06300 636774 635374 gene locus_tag LOCUS_06310 636774 635374 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223941.1 protein_id gnl|my_center|LOCUS_06310 637447 636902 gene locus_tag LOCUS_06320 637447 636902 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230876.1 protein_id gnl|my_center|LOCUS_06320 637579 638205 gene locus_tag LOCUS_06330 637579 638205 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989851.1 protein_id gnl|my_center|LOCUS_06330 638383 639216 gene locus_tag LOCUS_06340 638383 639216 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223943.1 protein_id gnl|my_center|LOCUS_06340 639858 639226 gene locus_tag LOCUS_06350 639858 639226 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229512.1 protein_id gnl|my_center|LOCUS_06350 640162 640992 gene locus_tag LOCUS_06360 640162 640992 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223943.1 protein_id gnl|my_center|LOCUS_06360 641120 641491 gene locus_tag LOCUS_06370 641120 641491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 642089 642583 gene locus_tag LOCUS_06380 642089 642583 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091319925.1 protein_id gnl|my_center|LOCUS_06380 643752 642589 gene locus_tag LOCUS_06390 643752 642589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226399.1 protein_id gnl|my_center|LOCUS_06390 644280 643756 gene locus_tag LOCUS_06400 644280 643756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086849351.1 protein_id gnl|my_center|LOCUS_06400 644833 644378 gene locus_tag LOCUS_06410 644833 644378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226397.1 protein_id gnl|my_center|LOCUS_06410 646008 645013 gene locus_tag LOCUS_06420 646008 645013 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270038.1 protein_id gnl|my_center|LOCUS_06420 646576 646130 gene locus_tag LOCUS_06430 646576 646130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 651095 646581 gene locus_tag LOCUS_06440 651095 646581 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223320.1 protein_id gnl|my_center|LOCUS_06440 651409 651095 gene locus_tag LOCUS_06450 651409 651095 CDS product type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227366.1 protein_id gnl|my_center|LOCUS_06450 651976 651431 gene locus_tag LOCUS_06460 651976 651431 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227367.1 protein_id gnl|my_center|LOCUS_06460 652132 652590 gene locus_tag LOCUS_06470 652132 652590 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223944.1 protein_id gnl|my_center|LOCUS_06470 652868 654988 gene locus_tag LOCUS_06480 652868 654988 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228817.1 protein_id gnl|my_center|LOCUS_06480 655231 655968 gene locus_tag LOCUS_06490 655231 655968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 656171 656785 gene locus_tag LOCUS_06500 gene cobO 656171 656785 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228816.1 protein_id gnl|my_center|LOCUS_06500 656779 658149 gene locus_tag LOCUS_06510 656779 658149 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899509.1 protein_id gnl|my_center|LOCUS_06510 658378 659859 gene locus_tag LOCUS_06520 658378 659859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 659971 661176 gene locus_tag LOCUS_06530 659971 661176 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868658.1 protein_id gnl|my_center|LOCUS_06530 661173 661583 gene locus_tag LOCUS_06540 661173 661583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 661872 661603 gene locus_tag LOCUS_06550 661872 661603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 662024 662173 gene locus_tag LOCUS_06560 662024 662173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 662222 662734 gene locus_tag LOCUS_06570 662222 662734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06570 662871 663971 gene locus_tag LOCUS_06580 662871 663971 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225984036.1 protein_id gnl|my_center|LOCUS_06580 664375 665436 gene locus_tag LOCUS_06590 664375 665436 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414559.1 protein_id gnl|my_center|LOCUS_06590 665658 666881 gene locus_tag LOCUS_06600 gene cobA 665658 666881 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226827.1 protein_id gnl|my_center|LOCUS_06600 670548 666934 gene locus_tag LOCUS_06610 gene cobN 670548 666934 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228832.1 protein_id gnl|my_center|LOCUS_06610 670952 670545 gene locus_tag LOCUS_06620 670952 670545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 670922 672205 gene locus_tag LOCUS_06630 gene cobG 670922 672205 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729385.1 protein_id gnl|my_center|LOCUS_06630 672202 672828 gene locus_tag LOCUS_06640 672202 672828 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_06640 672825 674390 gene locus_tag LOCUS_06650 672825 674390 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228824.1 protein_id gnl|my_center|LOCUS_06650 675159 674356 gene locus_tag LOCUS_06660 675159 674356 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975552.1 protein_id gnl|my_center|LOCUS_06660 675154 676260 gene locus_tag LOCUS_06670 675154 676260 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258096.1 protein_id gnl|my_center|LOCUS_06670 676706 676314 gene locus_tag LOCUS_06680 676706 676314 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031553.1 protein_id gnl|my_center|LOCUS_06680 676928 678325 gene locus_tag LOCUS_06690 676928 678325 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230541.1 protein_id gnl|my_center|LOCUS_06690 678453 679001 gene locus_tag LOCUS_06700 678453 679001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 679074 679688 gene locus_tag LOCUS_06710 679074 679688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 679800 680018 gene locus_tag LOCUS_06720 679800 680018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 679990 680280 gene locus_tag LOCUS_06730 679990 680280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 681045 680302 gene locus_tag LOCUS_06740 gene cobM 681045 680302 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895328.1 protein_id gnl|my_center|LOCUS_06740 682268 681042 gene locus_tag LOCUS_06750 gene cbiE 682268 681042 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114023.1 protein_id gnl|my_center|LOCUS_06750 682713 682270 gene locus_tag LOCUS_06760 682713 682270 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284874.1 protein_id gnl|my_center|LOCUS_06760 684230 682710 gene locus_tag LOCUS_06770 684230 682710 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223946.1 protein_id gnl|my_center|LOCUS_06770 685320 684550 gene locus_tag LOCUS_06780 gene yaaA 685320 684550 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223956.1 protein_id gnl|my_center|LOCUS_06780 685585 687309 gene locus_tag LOCUS_06790 685585 687309 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223963.1 protein_id gnl|my_center|LOCUS_06790 687433 688107 gene locus_tag LOCUS_06800 687433 688107 CDS product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063881.1 protein_id gnl|my_center|LOCUS_06800 688083 688913 gene locus_tag LOCUS_06810 688083 688913 CDS product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528739.1 protein_id gnl|my_center|LOCUS_06810 690153 689407 gene locus_tag LOCUS_06820 690153 689407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 690739 690329 gene locus_tag LOCUS_06830 690739 690329 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_06830 690778 691809 gene locus_tag LOCUS_06840 690778 691809 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228127.1 protein_id gnl|my_center|LOCUS_06840 692399 692947 gene locus_tag LOCUS_06850 692399 692947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 693412 692963 gene locus_tag LOCUS_06860 693412 692963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 693900 693409 gene locus_tag LOCUS_06870 693900 693409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 694173 694739 gene locus_tag LOCUS_06880 gene rimP 694173 694739 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285696.1 protein_id gnl|my_center|LOCUS_06880 694736 695815 gene locus_tag LOCUS_06890 gene nusA 694736 695815 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228123.1 protein_id gnl|my_center|LOCUS_06890 696176 695832 gene locus_tag LOCUS_06900 696176 695832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 696319 699546 gene locus_tag LOCUS_06910 696319 699546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 699622 699915 gene locus_tag LOCUS_06920 699622 699915 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228120.1 protein_id gnl|my_center|LOCUS_06920 699964 700458 gene locus_tag LOCUS_06930 gene rbfA 699964 700458 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228119.1 protein_id gnl|my_center|LOCUS_06930 700515 701540 gene locus_tag LOCUS_06940 700515 701540 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228112.1 protein_id gnl|my_center|LOCUS_06940 701727 703052 gene locus_tag LOCUS_06950 701727 703052 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228111.1 protein_id gnl|my_center|LOCUS_06950 703599 703102 gene locus_tag LOCUS_06960 gene def 703599 703102 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_06960 703690 704598 gene locus_tag LOCUS_06970 gene truB 703690 704598 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091315604.1 protein_id gnl|my_center|LOCUS_06970 705016 705264 gene locus_tag LOCUS_06980 705016 705264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 705505 705930 gene locus_tag LOCUS_06990 705505 705930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 705941 706405 gene locus_tag LOCUS_07000 705941 706405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 706402 706584 gene locus_tag LOCUS_07010 706402 706584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 706943 707680 gene locus_tag LOCUS_07020 706943 707680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 707799 708728 gene locus_tag LOCUS_07030 707799 708728 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790919.1 protein_id gnl|my_center|LOCUS_07030 708836 709372 gene locus_tag LOCUS_07040 708836 709372 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228105.1 protein_id gnl|my_center|LOCUS_07040 709534 710118 gene locus_tag LOCUS_07050 709534 710118 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775746.1 protein_id gnl|my_center|LOCUS_07050 710352 710621 gene locus_tag LOCUS_07060 gene rpsO 710352 710621 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084034.1 protein_id gnl|my_center|LOCUS_07060 710902 713214 gene locus_tag LOCUS_07070 710902 713214 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228103.1 protein_id gnl|my_center|LOCUS_07070 713223 714569 gene locus_tag LOCUS_07080 713223 714569 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228102.1 protein_id gnl|my_center|LOCUS_07080 714585 715343 gene locus_tag LOCUS_07090 gene dapB 714585 715343 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804662.1 protein_id gnl|my_center|LOCUS_07090 715343 715825 gene locus_tag LOCUS_07100 715343 715825 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285688.1 protein_id gnl|my_center|LOCUS_07100 715924 718992 gene locus_tag LOCUS_07110 715924 718992 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950658.1 protein_id gnl|my_center|LOCUS_07110 718997 719281 gene locus_tag LOCUS_07120 718997 719281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 719776 719288 gene locus_tag LOCUS_07130 719776 719288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 720421 719855 gene locus_tag LOCUS_07140 720421 719855 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228094.1 protein_id gnl|my_center|LOCUS_07140 720504 721736 gene locus_tag LOCUS_07150 720504 721736 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228093.1 protein_id gnl|my_center|LOCUS_07150 722643 721720 gene locus_tag LOCUS_07160 722643 721720 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228092.1 protein_id gnl|my_center|LOCUS_07160 723207 722662 gene locus_tag LOCUS_07170 723207 722662 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228091.1 protein_id gnl|my_center|LOCUS_07170 723380 724132 gene locus_tag LOCUS_07180 gene thyX 723380 724132 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228090.1 protein_id gnl|my_center|LOCUS_07180 724255 724881 gene locus_tag LOCUS_07190 724255 724881 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230583.1 protein_id gnl|my_center|LOCUS_07190 725063 726007 gene locus_tag LOCUS_07200 gene dapA 725063 726007 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878175.1 protein_id gnl|my_center|LOCUS_07200 726097 727728 gene locus_tag LOCUS_07210 726097 727728 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454980.1 protein_id gnl|my_center|LOCUS_07210 727968 728261 gene locus_tag LOCUS_07220 727968 728261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 728555 728947 gene locus_tag LOCUS_07230 728555 728947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 729240 729082 gene locus_tag LOCUS_07240 729240 729082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 729669 730019 gene locus_tag LOCUS_07250 729669 730019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 730962 730114 gene locus_tag LOCUS_07260 730962 730114 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081655759.1 protein_id gnl|my_center|LOCUS_07260 731303 731103 gene locus_tag LOCUS_07270 731303 731103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 731461 733722 gene locus_tag LOCUS_07280 731461 733722 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228076.1 protein_id gnl|my_center|LOCUS_07280 735056 733842 gene locus_tag LOCUS_07290 735056 733842 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223998.1 protein_id gnl|my_center|LOCUS_07290 735726 735154 gene locus_tag LOCUS_07300 735726 735154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 736388 735855 gene locus_tag LOCUS_07310 736388 735855 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894076.1 protein_id gnl|my_center|LOCUS_07310 737433 737520 gene locus_tag LOCUS_t00120 737433 737520 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 737498 737986 gene locus_tag LOCUS_07320 737498 737986 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228067.1 protein_id gnl|my_center|LOCUS_07320 738287 738793 gene locus_tag LOCUS_07330 738287 738793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 738907 739812 gene locus_tag LOCUS_07340 738907 739812 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228065.1 protein_id gnl|my_center|LOCUS_07340 739816 740703 gene locus_tag LOCUS_07350 739816 740703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 740817 742106 gene locus_tag LOCUS_07360 740817 742106 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014768.1 protein_id gnl|my_center|LOCUS_07360 743053 742202 gene locus_tag LOCUS_07370 743053 742202 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 protein_id gnl|my_center|LOCUS_07370 743174 743890 gene locus_tag LOCUS_07380 743174 743890 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228057.1 protein_id gnl|my_center|LOCUS_07380 744082 744486 gene locus_tag LOCUS_07390 744082 744486 CDS product DUF3040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110487.1 protein_id gnl|my_center|LOCUS_07390 746795 744588 gene locus_tag LOCUS_07400 746795 744588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 748036 746792 gene locus_tag LOCUS_07410 748036 746792 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228053.1 protein_id gnl|my_center|LOCUS_07410 749070 748039 gene locus_tag LOCUS_07420 749070 748039 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742066.1 protein_id gnl|my_center|LOCUS_07420 749461 749892 gene locus_tag LOCUS_07430 gene mraZ 749461 749892 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467434.1 protein_id gnl|my_center|LOCUS_07430 750089 751090 gene locus_tag LOCUS_07440 gene rsmH 750089 751090 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228045.1 protein_id gnl|my_center|LOCUS_07440 751087 752064 gene locus_tag LOCUS_07450 751087 752064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 752064 753956 gene locus_tag LOCUS_07460 752064 753956 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467433.1 protein_id gnl|my_center|LOCUS_07460 754109 754540 gene locus_tag LOCUS_07470 754109 754540 CDS product OsmC family peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224811.1 protein_id gnl|my_center|LOCUS_07470 755037 756674 gene locus_tag LOCUS_07480 755037 756674 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228042.1 protein_id gnl|my_center|LOCUS_07480 756671 758155 gene locus_tag LOCUS_07490 756671 758155 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228041.1 protein_id gnl|my_center|LOCUS_07490 758152 759228 gene locus_tag LOCUS_07500 gene mraY 758152 759228 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228040.1 protein_id gnl|my_center|LOCUS_07500 759275 760666 gene locus_tag LOCUS_07510 gene murD 759275 760666 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228039.1 protein_id gnl|my_center|LOCUS_07510 760672 762090 gene locus_tag LOCUS_07520 gene ftsW 760672 762090 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228038.1 protein_id gnl|my_center|LOCUS_07520 762087 763256 gene locus_tag LOCUS_07530 gene murG 762087 763256 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228037.1 protein_id gnl|my_center|LOCUS_07530 763253 764731 gene locus_tag LOCUS_07540 gene murC 763253 764731 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_07540 764842 765483 gene locus_tag LOCUS_07550 764842 765483 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228035.1 protein_id gnl|my_center|LOCUS_07550 766313 767734 gene locus_tag LOCUS_07560 gene ftsZ 766313 767734 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224820.1 protein_id gnl|my_center|LOCUS_07560 767864 768583 gene locus_tag LOCUS_07570 gene pgeF 767864 768583 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224821.1 protein_id gnl|my_center|LOCUS_07570 768580 769326 gene locus_tag LOCUS_07580 768580 769326 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224822.1 protein_id gnl|my_center|LOCUS_07580 769396 770013 gene locus_tag LOCUS_07590 gene sepF 769396 770013 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224823.1 protein_id gnl|my_center|LOCUS_07590 770033 770317 gene locus_tag LOCUS_07600 770033 770317 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224824.1 protein_id gnl|my_center|LOCUS_07600 770364 771242 gene locus_tag LOCUS_07610 770364 771242 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224825.1 protein_id gnl|my_center|LOCUS_07610 771319 771822 gene locus_tag LOCUS_07620 771319 771822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 772154 775336 gene locus_tag LOCUS_07630 gene ileS 772154 775336 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224829.1 protein_id gnl|my_center|LOCUS_07630 775947 775531 gene locus_tag LOCUS_07640 775947 775531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 777667 776186 gene locus_tag LOCUS_07650 gene gndA 777667 776186 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222331.1 protein_id gnl|my_center|LOCUS_07650 777778 778026 gene locus_tag LOCUS_07660 777778 778026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 778050 778721 gene locus_tag LOCUS_07670 gene lspA 778050 778721 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947675.1 protein_id gnl|my_center|LOCUS_07670 778718 779653 gene locus_tag LOCUS_07680 778718 779653 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224836.1 protein_id gnl|my_center|LOCUS_07680 779753 780154 gene locus_tag LOCUS_07690 779753 780154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 780224 781336 gene locus_tag LOCUS_07700 780224 781336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07700 781249 781818 gene locus_tag LOCUS_07710 781249 781818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07710 781829 782500 gene locus_tag LOCUS_07720 781829 782500 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223180.1 protein_id gnl|my_center|LOCUS_07720 782592 783665 gene locus_tag LOCUS_07730 782592 783665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 783717 786644 gene locus_tag LOCUS_07740 783717 786644 CDS product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480405.1 protein_id gnl|my_center|LOCUS_07740 787479 786652 gene locus_tag LOCUS_07750 787479 786652 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124123.1 protein_id gnl|my_center|LOCUS_07750 787539 788123 gene locus_tag LOCUS_07760 787539 788123 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226000.1 protein_id gnl|my_center|LOCUS_07760 788120 788722 gene locus_tag LOCUS_07770 788120 788722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 788857 790329 gene locus_tag LOCUS_07780 788857 790329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 791336 790446 gene locus_tag LOCUS_07790 791336 790446 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530870.1 protein_id gnl|my_center|LOCUS_07790 792321 791350 gene locus_tag LOCUS_07800 792321 791350 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_07800 793190 792318 gene locus_tag LOCUS_07810 793190 792318 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_07810 794329 793355 gene locus_tag LOCUS_07820 794329 793355 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003952307.1 protein_id gnl|my_center|LOCUS_07820 794408 794740 gene locus_tag LOCUS_07830 794408 794740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 795495 794674 gene locus_tag LOCUS_07840 795495 794674 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226473.1 protein_id gnl|my_center|LOCUS_07840 796124 795492 gene locus_tag LOCUS_07850 796124 795492 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222383.1 protein_id gnl|my_center|LOCUS_07850 796916 796251 gene locus_tag LOCUS_07860 796916 796251 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222383.1 protein_id gnl|my_center|LOCUS_07860 797972 797025 gene locus_tag LOCUS_07870 797972 797025 CDS product AsnC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224837.1 protein_id gnl|my_center|LOCUS_07870 798229 801828 gene locus_tag LOCUS_07880 gene dnaE 798229 801828 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224037.1 protein_id gnl|my_center|LOCUS_07880 801891 803126 gene locus_tag LOCUS_07890 801891 803126 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_07890 803342 804121 gene locus_tag LOCUS_07900 803342 804121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 806134 804140 gene locus_tag LOCUS_07910 806134 804140 CDS product galactan 5-O-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084053.1 protein_id gnl|my_center|LOCUS_07910 806334 806945 gene locus_tag LOCUS_07920 806334 806945 CDS product DUF2567 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224098.1 protein_id gnl|my_center|LOCUS_07920 807203 806985 gene locus_tag LOCUS_07930 807203 806985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 807348 808196 gene locus_tag LOCUS_07940 807348 808196 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_07940 808217 808441 gene locus_tag LOCUS_07950 808217 808441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 810503 808548 gene locus_tag LOCUS_07960 810503 808548 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028738.1 protein_id gnl|my_center|LOCUS_07960 810976 810533 gene locus_tag LOCUS_07970 810976 810533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972728.1 protein_id gnl|my_center|LOCUS_07970 811468 814494 gene locus_tag LOCUS_07980 811468 814494 CDS product ALF repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030734.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07980 815228 815722 gene locus_tag LOCUS_07990 815228 815722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 815744 816049 gene locus_tag LOCUS_08000 815744 816049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 816191 816409 gene locus_tag LOCUS_08010 816191 816409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 818678 817719 gene locus_tag LOCUS_08020 818678 817719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 819393 818734 gene locus_tag LOCUS_08030 819393 818734 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466787.1 protein_id gnl|my_center|LOCUS_08030 820152 819508 gene locus_tag LOCUS_08040 820152 819508 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224101.1 protein_id gnl|my_center|LOCUS_08040 820084 820254 gene locus_tag LOCUS_08050 820084 820254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 820291 821301 gene locus_tag LOCUS_08060 gene nadA 820291 821301 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224102.1 protein_id gnl|my_center|LOCUS_08060 821298 822890 gene locus_tag LOCUS_08070 821298 822890 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831489.1 protein_id gnl|my_center|LOCUS_08070 822887 823780 gene locus_tag LOCUS_08080 gene nadC 822887 823780 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224104.1 protein_id gnl|my_center|LOCUS_08080 824280 823981 gene locus_tag LOCUS_08090 824280 823981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 824510 824277 gene locus_tag LOCUS_08100 824510 824277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 826664 824553 gene locus_tag LOCUS_08110 826664 824553 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227139.1 protein_id gnl|my_center|LOCUS_08110 826890 827798 gene locus_tag LOCUS_08120 gene pdxS 826890 827798 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_08120 828408 827848 gene locus_tag LOCUS_08130 828408 827848 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284483.1 protein_id gnl|my_center|LOCUS_08130 828554 829174 gene locus_tag LOCUS_08140 828554 829174 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284464.1 protein_id gnl|my_center|LOCUS_08140 829171 829479 gene locus_tag LOCUS_08150 829171 829479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 829632 831059 gene locus_tag LOCUS_08160 829632 831059 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226438.1 protein_id gnl|my_center|LOCUS_08160 831138 831752 gene locus_tag LOCUS_08170 gene pdxT 831138 831752 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_08170 831805 832557 gene locus_tag LOCUS_08180 831805 832557 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227126.1 protein_id gnl|my_center|LOCUS_08180 832868 832590 gene locus_tag LOCUS_08190 832868 832590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 832762 833184 gene locus_tag LOCUS_08200 832762 833184 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977952.1 protein_id gnl|my_center|LOCUS_08200 833197 834219 gene locus_tag LOCUS_08210 833197 834219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 834267 834773 gene locus_tag LOCUS_08220 834267 834773 CDS product DUF4262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878153.1 protein_id gnl|my_center|LOCUS_08220 834865 835452 gene locus_tag LOCUS_08230 gene ruvC 834865 835452 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284467.1 protein_id gnl|my_center|LOCUS_08230 835449 836030 gene locus_tag LOCUS_08240 gene ruvA 835449 836030 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227122.1 protein_id gnl|my_center|LOCUS_08240 836056 837150 gene locus_tag LOCUS_08250 gene ruvB 836056 837150 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467235.1 protein_id gnl|my_center|LOCUS_08250 837259 837642 gene locus_tag LOCUS_08260 837259 837642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 837824 839449 gene locus_tag LOCUS_08270 837824 839449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 839453 840694 gene locus_tag LOCUS_08280 gene secF 839453 840694 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227118.1 protein_id gnl|my_center|LOCUS_08280 840698 841243 gene locus_tag LOCUS_08290 840698 841243 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227117.1 protein_id gnl|my_center|LOCUS_08290 841550 843778 gene locus_tag LOCUS_08300 841550 843778 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227116.1 protein_id gnl|my_center|LOCUS_08300 844935 844069 gene locus_tag LOCUS_08310 844935 844069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 845245 845847 gene locus_tag LOCUS_08320 845245 845847 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_08320 845869 847137 gene locus_tag LOCUS_08330 gene hisS 845869 847137 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082383.1 protein_id gnl|my_center|LOCUS_08330 847137 847772 gene locus_tag LOCUS_08340 847137 847772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227104.1 protein_id gnl|my_center|LOCUS_08340 849162 847819 gene locus_tag LOCUS_08350 849162 847819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08350 850188 849172 gene locus_tag LOCUS_08360 850188 849172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228743.1 protein_id gnl|my_center|LOCUS_08360 850752 852566 gene locus_tag LOCUS_08370 gene aspS 850752 852566 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224570.1 protein_id gnl|my_center|LOCUS_08370 852810 854015 gene locus_tag LOCUS_08380 852810 854015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224572.1 protein_id gnl|my_center|LOCUS_08380 854950 856470 gene locus_tag LOCUS_08390 854950 856470 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036716.1 protein_id gnl|my_center|LOCUS_08390 856648 857982 gene locus_tag LOCUS_08400 856648 857982 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224577.1 protein_id gnl|my_center|LOCUS_08400 858009 858974 gene locus_tag LOCUS_08410 858009 858974 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223743.1 protein_id gnl|my_center|LOCUS_08410 860200 859166 gene locus_tag LOCUS_08420 860200 859166 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230685.1 protein_id gnl|my_center|LOCUS_08420 860259 860498 gene locus_tag LOCUS_08430 860259 860498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 860495 860899 gene locus_tag LOCUS_08440 860495 860899 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224580.1 protein_id gnl|my_center|LOCUS_08440 860896 861228 gene locus_tag LOCUS_08450 860896 861228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224581.1 protein_id gnl|my_center|LOCUS_08450 861301 863985 gene locus_tag LOCUS_08460 gene alaS 861301 863985 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224582.1 protein_id gnl|my_center|LOCUS_08460 863982 864452 gene locus_tag LOCUS_08470 gene ruvX 863982 864452 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051736371.1 protein_id gnl|my_center|LOCUS_08470 864463 865680 gene locus_tag LOCUS_08480 864463 865680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 865670 866551 gene locus_tag LOCUS_08490 865670 866551 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852947.1 protein_id gnl|my_center|LOCUS_08490 866950 866681 gene locus_tag LOCUS_08500 866950 866681 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224593.1 protein_id gnl|my_center|LOCUS_08500 868271 866979 gene locus_tag LOCUS_08510 868271 866979 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224594.1 protein_id gnl|my_center|LOCUS_08510 869081 868275 gene locus_tag LOCUS_08520 869081 868275 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224595.1 protein_id gnl|my_center|LOCUS_08520 869314 869550 gene locus_tag LOCUS_08530 869314 869550 CDS product glucose PTS transporter subunit EIIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284356.1 protein_id gnl|my_center|LOCUS_08530 869547 870002 gene locus_tag LOCUS_08540 869547 870002 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224597.1 protein_id gnl|my_center|LOCUS_08540 870095 870757 gene locus_tag LOCUS_08550 870095 870757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 870858 872000 gene locus_tag LOCUS_08560 gene aroC 870858 872000 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224602.1 protein_id gnl|my_center|LOCUS_08560 872000 872524 gene locus_tag LOCUS_08570 872000 872524 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742170.1 protein_id gnl|my_center|LOCUS_08570 872553 873668 gene locus_tag LOCUS_08580 gene aroB 872553 873668 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224604.1 protein_id gnl|my_center|LOCUS_08580 873665 874093 gene locus_tag LOCUS_08590 gene aroQ 873665 874093 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224605.1 protein_id gnl|my_center|LOCUS_08590 874141 875394 gene locus_tag LOCUS_08600 874141 875394 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224609.1 protein_id gnl|my_center|LOCUS_08600 875569 876129 gene locus_tag LOCUS_08610 gene efp 875569 876129 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_08610 876178 876618 gene locus_tag LOCUS_08620 gene nusB 876178 876618 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224611.1 protein_id gnl|my_center|LOCUS_08620 877330 876842 gene locus_tag LOCUS_08630 877330 876842 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096372.1 protein_id gnl|my_center|LOCUS_08630 877590 878183 gene locus_tag LOCUS_08640 gene pyrR 877590 878183 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224613.1 protein_id gnl|my_center|LOCUS_08640 878183 879115 gene locus_tag LOCUS_08650 878183 879115 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224614.1 protein_id gnl|my_center|LOCUS_08650 879112 880449 gene locus_tag LOCUS_08660 879112 880449 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224615.1 protein_id gnl|my_center|LOCUS_08660 880467 881000 gene locus_tag LOCUS_08670 880467 881000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082346.1 protein_id gnl|my_center|LOCUS_08670 880997 882118 gene locus_tag LOCUS_08680 gene carA 880997 882118 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224617.1 protein_id gnl|my_center|LOCUS_08680 882118 885447 gene locus_tag LOCUS_08690 gene carB 882118 885447 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224620.1 protein_id gnl|my_center|LOCUS_08690 885444 886289 gene locus_tag LOCUS_08700 gene pyrF 885444 886289 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224621.1 protein_id gnl|my_center|LOCUS_08700 886413 887660 gene locus_tag LOCUS_08710 886413 887660 CDS product alpha-(1-2)-phosphatidylinositol mannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411339.1 protein_id gnl|my_center|LOCUS_08710 888342 888659 gene locus_tag LOCUS_08720 gene mihF 888342 888659 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224622.1 protein_id gnl|my_center|LOCUS_08720 888656 889261 gene locus_tag LOCUS_08730 gene gmk 888656 889261 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466863.1 protein_id gnl|my_center|LOCUS_08730 889425 889730 gene locus_tag LOCUS_08740 gene rpoZ 889425 889730 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224624.1 protein_id gnl|my_center|LOCUS_08740 889727 890992 gene locus_tag LOCUS_08750 gene coaBC 889727 890992 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831608.1 protein_id gnl|my_center|LOCUS_08750 891112 892275 gene locus_tag LOCUS_08760 gene metK 891112 892275 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284357.1 protein_id gnl|my_center|LOCUS_08760 893600 892389 gene locus_tag LOCUS_08770 893600 892389 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270408.1 protein_id gnl|my_center|LOCUS_08770 894211 893729 gene locus_tag LOCUS_08780 894211 893729 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226777.1 protein_id gnl|my_center|LOCUS_08780 894369 896351 gene locus_tag LOCUS_08790 894369 896351 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224627.1 protein_id gnl|my_center|LOCUS_08790 896473 897243 gene locus_tag LOCUS_08800 896473 897243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142339.1 protein_id gnl|my_center|LOCUS_08800 897320 899140 gene locus_tag LOCUS_08810 gene ggt 897320 899140 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030896.1 protein_id gnl|my_center|LOCUS_08810 899325 900251 gene locus_tag LOCUS_08820 gene fmt 899325 900251 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224632.1 protein_id gnl|my_center|LOCUS_08820 900248 901669 gene locus_tag LOCUS_08830 900248 901669 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224633.1 protein_id gnl|my_center|LOCUS_08830 901705 902121 gene locus_tag LOCUS_08840 901705 902121 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229473.1 protein_id gnl|my_center|LOCUS_08840 902162 902581 gene locus_tag LOCUS_08850 902162 902581 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224765.1 protein_id gnl|my_center|LOCUS_08850 902749 904131 gene locus_tag LOCUS_08860 902749 904131 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537978.1 protein_id gnl|my_center|LOCUS_08860 904128 905009 gene locus_tag LOCUS_08870 904128 905009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 905198 906049 gene locus_tag LOCUS_08880 gene ribD 905198 906049 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082329.1 protein_id gnl|my_center|LOCUS_08880 906060 906719 gene locus_tag LOCUS_08890 906060 906719 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224640.1 protein_id gnl|my_center|LOCUS_08890 906757 908025 gene locus_tag LOCUS_08900 906757 908025 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 protein_id gnl|my_center|LOCUS_08900 908022 908519 gene locus_tag LOCUS_08910 gene ribH 908022 908519 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224642.1 protein_id gnl|my_center|LOCUS_08910 908611 909069 gene locus_tag LOCUS_08920 908611 909069 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224643.1 protein_id gnl|my_center|LOCUS_08920 910515 909322 gene locus_tag LOCUS_08930 910515 909322 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227636.1 protein_id gnl|my_center|LOCUS_08930 911278 910508 gene locus_tag LOCUS_08940 911278 910508 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286332.1 protein_id gnl|my_center|LOCUS_08940 911447 912469 gene locus_tag LOCUS_08950 911447 912469 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475575.1 protein_id gnl|my_center|LOCUS_08950 912778 914814 gene locus_tag LOCUS_08960 gene uvrC 912778 914814 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831611.1 protein_id gnl|my_center|LOCUS_08960 914811 915689 gene locus_tag LOCUS_08970 gene rapZ 914811 915689 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466867.1 protein_id gnl|my_center|LOCUS_08970 915686 916660 gene locus_tag LOCUS_08980 gene yvcK 915686 916660 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224648.1 protein_id gnl|my_center|LOCUS_08980 916660 917646 gene locus_tag LOCUS_08990 gene whiA 916660 917646 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224649.1 protein_id gnl|my_center|LOCUS_08990 918541 917852 gene locus_tag LOCUS_09000 918541 917852 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977695.1 protein_id gnl|my_center|LOCUS_09000 920256 918538 gene locus_tag LOCUS_09010 920256 918538 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027601.1 protein_id gnl|my_center|LOCUS_09010 920441 921427 gene locus_tag LOCUS_09020 920441 921427 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258645.1 protein_id gnl|my_center|LOCUS_09020 921424 921957 gene locus_tag LOCUS_09030 921424 921957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 921958 923457 gene locus_tag LOCUS_09040 921958 923457 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043618478.1 protein_id gnl|my_center|LOCUS_09040 923653 924663 gene locus_tag LOCUS_09050 gene gap 923653 924663 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_09050 924689 925891 gene locus_tag LOCUS_09060 924689 925891 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224667.1 protein_id gnl|my_center|LOCUS_09060 925897 926685 gene locus_tag LOCUS_09070 gene tpiA 925897 926685 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224668.1 protein_id gnl|my_center|LOCUS_09070 926759 926995 gene locus_tag LOCUS_09080 gene secG 926759 926995 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076011.1 protein_id gnl|my_center|LOCUS_09080 927055 927396 gene locus_tag LOCUS_09090 927055 927396 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284344.1 protein_id gnl|my_center|LOCUS_09090 927551 927919 gene locus_tag LOCUS_09100 927551 927919 CDS product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891587.1 protein_id gnl|my_center|LOCUS_09100 928138 928371 gene locus_tag LOCUS_09110 928138 928371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 928368 928532 gene locus_tag LOCUS_09120 928368 928532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 928529 929119 gene locus_tag LOCUS_09130 928529 929119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 929280 929468 gene locus_tag LOCUS_09140 929280 929468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 929610 929849 gene locus_tag LOCUS_09150 929610 929849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09150 929978 930706 gene locus_tag LOCUS_09160 gene hypB 929978 930706 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728544.1 protein_id gnl|my_center|LOCUS_09160 930922 931941 gene locus_tag LOCUS_09170 930922 931941 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527716.1 protein_id gnl|my_center|LOCUS_09170 932299 932009 gene locus_tag LOCUS_09180 932299 932009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 932445 933302 gene locus_tag LOCUS_09190 932445 933302 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031781.1 protein_id gnl|my_center|LOCUS_09190 933302 933472 gene locus_tag LOCUS_09200 933302 933472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 933600 934019 gene locus_tag LOCUS_09210 933600 934019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 934016 934561 gene locus_tag LOCUS_09220 934016 934561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 934571 936082 gene locus_tag LOCUS_09230 934571 936082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 936141 936962 gene locus_tag LOCUS_09240 936141 936962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 937561 937007 gene locus_tag LOCUS_09250 gene hxlB 937561 937007 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963719.1 protein_id gnl|my_center|LOCUS_09250 938193 937558 gene locus_tag LOCUS_09260 938193 937558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 939166 938171 gene locus_tag LOCUS_09270 939166 938171 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550371.1 protein_id gnl|my_center|LOCUS_09270 939941 939159 gene locus_tag LOCUS_09280 939941 939159 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056890.1 protein_id gnl|my_center|LOCUS_09280 941257 939938 gene locus_tag LOCUS_09290 941257 939938 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521381.1 protein_id gnl|my_center|LOCUS_09290 941420 942208 gene locus_tag LOCUS_09300 941420 942208 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227853.1 protein_id gnl|my_center|LOCUS_09300 942359 943417 gene locus_tag LOCUS_09310 942359 943417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 943565 944161 gene locus_tag LOCUS_09320 943565 944161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 944168 946360 gene locus_tag LOCUS_09330 944168 946360 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224133.1 protein_id gnl|my_center|LOCUS_09330 946869 946516 gene locus_tag LOCUS_09340 946869 946516 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729125.1 protein_id gnl|my_center|LOCUS_09340 947034 947903 gene locus_tag LOCUS_09350 947034 947903 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_09350 947900 948547 gene locus_tag LOCUS_09360 947900 948547 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728500.1 protein_id gnl|my_center|LOCUS_09360 948574 949044 gene locus_tag LOCUS_09370 gene rraA 948574 949044 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399786.1 protein_id gnl|my_center|LOCUS_09370 949943 949140 gene locus_tag LOCUS_09380 949943 949140 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204082927.1 protein_id gnl|my_center|LOCUS_09380 950010 950450 gene locus_tag LOCUS_09390 950010 950450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 950615 951448 gene locus_tag LOCUS_09400 950615 951448 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230164.1 protein_id gnl|my_center|LOCUS_09400 951520 952338 gene locus_tag LOCUS_09410 951520 952338 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223656.1 protein_id gnl|my_center|LOCUS_09410 953436 952942 gene locus_tag LOCUS_09420 953436 952942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 953578 954510 gene locus_tag LOCUS_09430 953578 954510 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033982.1 protein_id gnl|my_center|LOCUS_09430 955324 954569 gene locus_tag LOCUS_09440 gene pgl 955324 954569 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224672.1 protein_id gnl|my_center|LOCUS_09440 956310 955321 gene locus_tag LOCUS_09450 gene opcA 956310 955321 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224673.1 protein_id gnl|my_center|LOCUS_09450 957836 956307 gene locus_tag LOCUS_09460 gene zwf 957836 956307 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224674.1 protein_id gnl|my_center|LOCUS_09460 959476 957833 gene locus_tag LOCUS_09470 959476 957833 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224675.1 protein_id gnl|my_center|LOCUS_09470 960673 959564 gene locus_tag LOCUS_09480 gene tal 960673 959564 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728814.1 protein_id gnl|my_center|LOCUS_09480 962787 960688 gene locus_tag LOCUS_09490 gene tkt 962787 960688 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224677.1 protein_id gnl|my_center|LOCUS_09490 963055 963987 gene locus_tag LOCUS_09500 963055 963987 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224678.1 protein_id gnl|my_center|LOCUS_09500 965028 964033 gene locus_tag LOCUS_09510 965028 964033 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037354.1 protein_id gnl|my_center|LOCUS_09510 965300 966820 gene locus_tag LOCUS_09520 965300 966820 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028557.1 protein_id gnl|my_center|LOCUS_09520 966813 968795 gene locus_tag LOCUS_09530 966813 968795 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976053.1 protein_id gnl|my_center|LOCUS_09530 969892 968924 gene locus_tag LOCUS_09540 969892 968924 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224686.1 protein_id gnl|my_center|LOCUS_09540 970033 970350 gene locus_tag LOCUS_09550 970033 970350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224687.1 protein_id gnl|my_center|LOCUS_09550 970347 971219 gene locus_tag LOCUS_09560 970347 971219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_09560 971315 971833 gene locus_tag LOCUS_09570 gene mmpR5 971315 971833 CDS product siderophore transport transcriptional regulator MmpR5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403442.1 protein_id gnl|my_center|LOCUS_09570 972055 973032 gene locus_tag LOCUS_09580 972055 973032 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029184.1 protein_id gnl|my_center|LOCUS_09580 974042 973077 gene locus_tag LOCUS_09590 974042 973077 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224691.1 protein_id gnl|my_center|LOCUS_09590 975139 974267 gene locus_tag LOCUS_09600 975139 974267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223088.1 protein_id gnl|my_center|LOCUS_09600 975992 975180 gene locus_tag LOCUS_09610 975992 975180 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224693.1 protein_id gnl|my_center|LOCUS_09610 976930 975989 gene locus_tag LOCUS_09620 976930 975989 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224694.1 protein_id gnl|my_center|LOCUS_09620 979420 977756 gene locus_tag LOCUS_09630 gene mptB 979420 977756 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224695.1 protein_id gnl|my_center|LOCUS_09630 979466 980278 gene locus_tag LOCUS_09640 979466 980278 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742174.1 protein_id gnl|my_center|LOCUS_09640 980275 981738 gene locus_tag LOCUS_09650 gene sufB 980275 981738 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224697.1 protein_id gnl|my_center|LOCUS_09650 981738 982928 gene locus_tag LOCUS_09660 gene sufD 981738 982928 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224698.1 protein_id gnl|my_center|LOCUS_09660 983031 983804 gene locus_tag LOCUS_09670 gene sufC 983031 983804 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224699.1 protein_id gnl|my_center|LOCUS_09670 983801 985123 gene locus_tag LOCUS_09680 983801 985123 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224700.1 protein_id gnl|my_center|LOCUS_09680 985134 985595 gene locus_tag LOCUS_09690 985134 985595 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_09690 985592 986032 gene locus_tag LOCUS_09700 985592 986032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 988307 986130 gene locus_tag LOCUS_09710 988307 986130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 990296 988545 gene locus_tag LOCUS_09720 990296 988545 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224721.1 protein_id gnl|my_center|LOCUS_09720 991650 990535 gene locus_tag LOCUS_09730 991650 990535 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887447.1 protein_id gnl|my_center|LOCUS_09730 991777 993351 gene locus_tag LOCUS_09740 gene dgt 991777 993351 CDS product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224725.1 protein_id gnl|my_center|LOCUS_09740 993389 994066 gene locus_tag LOCUS_09750 993389 994066 CDS product acVLRF1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224727.1 protein_id gnl|my_center|LOCUS_09750 994283 995911 gene locus_tag LOCUS_09760 994283 995911 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224728.1 protein_id gnl|my_center|LOCUS_09760 996027 996320 gene locus_tag LOCUS_09770 996027 996320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 996492 997295 gene locus_tag LOCUS_09780 996492 997295 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 protein_id gnl|my_center|LOCUS_09780 998046 997306 gene locus_tag LOCUS_09790 998046 997306 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466882.1 protein_id gnl|my_center|LOCUS_09790 998291 999001 gene locus_tag LOCUS_09800 998291 999001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 999961 999158 gene locus_tag LOCUS_09810 999961 999158 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285030.1 protein_id gnl|my_center|LOCUS_09810 1000143 1001957 gene locus_tag LOCUS_09820 1000143 1001957 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226492.1 protein_id gnl|my_center|LOCUS_09820 1001962 1002999 gene locus_tag LOCUS_09830 1001962 1002999 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226493.1 protein_id gnl|my_center|LOCUS_09830 1002996 1003901 gene locus_tag LOCUS_09840 1002996 1003901 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226494.1 protein_id gnl|my_center|LOCUS_09840 1003898 1005526 gene locus_tag LOCUS_09850 1003898 1005526 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226495.1 protein_id gnl|my_center|LOCUS_09850 1006012 1006515 gene locus_tag LOCUS_09860 1006012 1006515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1007475 1006852 gene locus_tag LOCUS_09870 1007475 1006852 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224090.1 protein_id gnl|my_center|LOCUS_09870 1008425 1007478 gene locus_tag LOCUS_09880 1008425 1007478 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863161.1 protein_id gnl|my_center|LOCUS_09880 1008638 1009204 gene locus_tag LOCUS_09890 1008638 1009204 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226500.1 protein_id gnl|my_center|LOCUS_09890 1009211 1010002 gene locus_tag LOCUS_09900 1009211 1010002 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226501.1 protein_id gnl|my_center|LOCUS_09900 1010069 1011004 gene locus_tag LOCUS_09910 1010069 1011004 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030985.1 protein_id gnl|my_center|LOCUS_09910 1011041 1012048 gene locus_tag LOCUS_09920 1011041 1012048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1012234 1013895 gene locus_tag LOCUS_09930 1012234 1013895 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727978.1 protein_id gnl|my_center|LOCUS_09930 1013956 1015191 gene locus_tag LOCUS_09940 gene mshC 1013956 1015191 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226760.1 protein_id gnl|my_center|LOCUS_09940 1015645 1016898 gene locus_tag LOCUS_09950 1015645 1016898 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227093.1 protein_id gnl|my_center|LOCUS_09950 1016895 1017338 gene locus_tag LOCUS_09960 1016895 1017338 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227092.1 protein_id gnl|my_center|LOCUS_09960 1017292 1017747 gene locus_tag LOCUS_09970 1017292 1017747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1017722 1018309 gene locus_tag LOCUS_09980 1017722 1018309 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227090.1 protein_id gnl|my_center|LOCUS_09980 1018373 1019614 gene locus_tag LOCUS_09990 1018373 1019614 CDS product alanine-phosphoribitol ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227089.1 protein_id gnl|my_center|LOCUS_09990 1020690 1019779 gene locus_tag LOCUS_10000 1020690 1019779 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226750.1 protein_id gnl|my_center|LOCUS_10000 1020875 1021594 gene locus_tag LOCUS_10010 1020875 1021594 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467175.1 protein_id gnl|my_center|LOCUS_10010 1021594 1021914 gene locus_tag LOCUS_10020 1021594 1021914 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226745.1 protein_id gnl|my_center|LOCUS_10020 1021932 1022777 gene locus_tag LOCUS_10030 gene hisG 1021932 1022777 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226744.1 protein_id gnl|my_center|LOCUS_10030 1022948 1023742 gene locus_tag LOCUS_10040 1022948 1023742 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223867.1 protein_id gnl|my_center|LOCUS_10040 1025344 1024550 gene locus_tag LOCUS_10050 1025344 1024550 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226742.1 protein_id gnl|my_center|LOCUS_10050 1026236 1025382 gene locus_tag LOCUS_10060 1026236 1025382 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226741.1 protein_id gnl|my_center|LOCUS_10060 1026306 1027457 gene locus_tag LOCUS_10070 1026306 1027457 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226740.1 protein_id gnl|my_center|LOCUS_10070 1027539 1028369 gene locus_tag LOCUS_10080 1027539 1028369 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226739.1 protein_id gnl|my_center|LOCUS_10080 1029342 1028503 gene locus_tag LOCUS_10090 1029342 1028503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1030048 1029389 gene locus_tag LOCUS_10100 1030048 1029389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1030623 1032416 gene locus_tag LOCUS_10110 gene arc 1030623 1032416 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284603.1 protein_id gnl|my_center|LOCUS_10110 1032518 1033471 gene locus_tag LOCUS_10120 1032518 1033471 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226729.1 protein_id gnl|my_center|LOCUS_10120 1034007 1033495 gene locus_tag LOCUS_10130 1034007 1033495 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226727.1 protein_id gnl|my_center|LOCUS_10130 1035178 1034153 gene locus_tag LOCUS_10140 1035178 1034153 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_10140 1035352 1036848 gene locus_tag LOCUS_10150 gene dop 1035352 1036848 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226726.1 protein_id gnl|my_center|LOCUS_10150 1037031 1037228 gene locus_tag LOCUS_10160 1037031 1037228 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226725.1 protein_id gnl|my_center|LOCUS_10160 1037317 1038171 gene locus_tag LOCUS_10170 gene prcB 1037317 1038171 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226724.1 protein_id gnl|my_center|LOCUS_10170 1038234 1038968 gene locus_tag LOCUS_10180 gene prcA 1038234 1038968 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226723.1 protein_id gnl|my_center|LOCUS_10180 1039060 1040418 gene locus_tag LOCUS_10190 gene pafA 1039060 1040418 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226720.1 protein_id gnl|my_center|LOCUS_10190 1041912 1040440 gene locus_tag LOCUS_10200 1041912 1040440 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072278426.1 protein_id gnl|my_center|LOCUS_10200 1042643 1041951 gene locus_tag LOCUS_10210 1042643 1041951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1043533 1042640 gene locus_tag LOCUS_10220 1043533 1042640 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804332.1 protein_id gnl|my_center|LOCUS_10220 1043892 1043530 gene locus_tag LOCUS_10230 1043892 1043530 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804331.1 protein_id gnl|my_center|LOCUS_10230 1044073 1044636 gene locus_tag LOCUS_10240 1044073 1044636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1044794 1046263 gene locus_tag LOCUS_10250 1044794 1046263 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017586463.1 protein_id gnl|my_center|LOCUS_10250 1045409 1045498 gene locus_tag LOCUS_t00130 1045409 1045498 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1046559 1047542 gene locus_tag LOCUS_10260 1046559 1047542 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226715.1 protein_id gnl|my_center|LOCUS_10260 1047539 1048507 gene locus_tag LOCUS_10270 1047539 1048507 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_10270 1048526 1048735 gene locus_tag LOCUS_10280 1048526 1048735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1048791 1049060 gene locus_tag LOCUS_10290 gene tatA 1048791 1049060 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908276.1 protein_id gnl|my_center|LOCUS_10290 1049157 1050026 gene locus_tag LOCUS_10300 gene tatC 1049157 1050026 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226711.1 protein_id gnl|my_center|LOCUS_10300 1050083 1050994 gene locus_tag LOCUS_10310 1050083 1050994 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226710.1 protein_id gnl|my_center|LOCUS_10310 1051085 1053832 gene locus_tag LOCUS_10320 1051085 1053832 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226708.1 protein_id gnl|my_center|LOCUS_10320 1053870 1054337 gene locus_tag LOCUS_10330 1053870 1054337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1054381 1055604 gene locus_tag LOCUS_10340 1054381 1055604 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878254.1 protein_id gnl|my_center|LOCUS_10340 1056609 1055662 gene locus_tag LOCUS_10350 1056609 1055662 CDS product 5'-3' exonuclease H3TH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226704.1 protein_id gnl|my_center|LOCUS_10350 1056956 1056663 gene locus_tag LOCUS_10360 1056956 1056663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1057070 1057831 gene locus_tag LOCUS_10370 1057070 1057831 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226344.1 protein_id gnl|my_center|LOCUS_10370 1057828 1058769 gene locus_tag LOCUS_10380 gene pfkB 1057828 1058769 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226343.1 protein_id gnl|my_center|LOCUS_10380 1058766 1059218 gene locus_tag LOCUS_10390 1058766 1059218 CDS product fructose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226342.1 protein_id gnl|my_center|LOCUS_10390 1059215 1060681 gene locus_tag LOCUS_10400 1059215 1060681 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226341.1 protein_id gnl|my_center|LOCUS_10400 1060755 1060994 gene locus_tag LOCUS_10410 1060755 1060994 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804336.1 protein_id gnl|my_center|LOCUS_10410 1061015 1062565 gene locus_tag LOCUS_10420 1061015 1062565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1062735 1063514 gene locus_tag LOCUS_10430 1062735 1063514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1063573 1064724 gene locus_tag LOCUS_10440 1063573 1064724 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_10440 1064721 1065188 gene locus_tag LOCUS_10450 1064721 1065188 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092399.1 protein_id gnl|my_center|LOCUS_10450 1066518 1065574 gene locus_tag LOCUS_10460 1066518 1065574 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742147.1 protein_id gnl|my_center|LOCUS_10460 1066852 1067430 gene locus_tag LOCUS_10470 1066852 1067430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1067631 1069256 gene locus_tag LOCUS_10480 1067631 1069256 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226567.1 protein_id gnl|my_center|LOCUS_10480 1069290 1069895 gene locus_tag LOCUS_10490 1069290 1069895 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028650.1 protein_id gnl|my_center|LOCUS_10490 1070037 1071629 gene locus_tag LOCUS_10500 gene lnt 1070037 1071629 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226566.1 protein_id gnl|my_center|LOCUS_10500 1071704 1072474 gene locus_tag LOCUS_10510 1071704 1072474 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 protein_id gnl|my_center|LOCUS_10510 1072976 1072632 gene locus_tag LOCUS_10520 1072976 1072632 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081521.1 protein_id gnl|my_center|LOCUS_10520 1074819 1073416 gene locus_tag LOCUS_10530 1074819 1073416 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226560.1 protein_id gnl|my_center|LOCUS_10530 1075696 1074902 gene locus_tag LOCUS_10540 1075696 1074902 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226558.1 protein_id gnl|my_center|LOCUS_10540 1075688 1076134 gene locus_tag LOCUS_10550 1075688 1076134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1076271 1076933 gene locus_tag LOCUS_10560 1076271 1076933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1077097 1077681 gene locus_tag LOCUS_10570 1077097 1077681 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230926.1 protein_id gnl|my_center|LOCUS_10570 1077726 1078667 gene locus_tag LOCUS_10580 1077726 1078667 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229376.1 protein_id gnl|my_center|LOCUS_10580 1078685 1079527 gene locus_tag LOCUS_10590 1078685 1079527 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229377.1 protein_id gnl|my_center|LOCUS_10590 1082287 1079576 gene locus_tag LOCUS_10600 1082287 1079576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 1083739 1082333 gene locus_tag LOCUS_10610 1083739 1082333 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243731.1 protein_id gnl|my_center|LOCUS_10610 1085412 1083898 gene locus_tag LOCUS_10620 1085412 1083898 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227769.1 protein_id gnl|my_center|LOCUS_10620 1087039 1085489 gene locus_tag LOCUS_10630 gene uxaC 1087039 1085489 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777068.1 protein_id gnl|my_center|LOCUS_10630 1087637 1087233 gene locus_tag LOCUS_10640 1087637 1087233 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_10640 1088808 1087693 gene locus_tag LOCUS_10650 gene arsB 1088808 1087693 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727470.1 protein_id gnl|my_center|LOCUS_10650 1089173 1088805 gene locus_tag LOCUS_10660 1089173 1088805 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 protein_id gnl|my_center|LOCUS_10660 1089258 1089698 gene locus_tag LOCUS_10670 1089258 1089698 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222676.1 protein_id gnl|my_center|LOCUS_10670 1089957 1090955 gene locus_tag LOCUS_10680 1089957 1090955 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014237.1 protein_id gnl|my_center|LOCUS_10680 1091127 1091333 gene locus_tag LOCUS_10690 1091127 1091333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1092329 1091343 gene locus_tag LOCUS_10700 1092329 1091343 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168512796.1 protein_id gnl|my_center|LOCUS_10700 1093814 1092402 gene locus_tag LOCUS_10710 gene xylB 1093814 1092402 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222654.1 protein_id gnl|my_center|LOCUS_10710 1095128 1093887 gene locus_tag LOCUS_10720 gene xylA 1095128 1093887 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_10720 1096396 1095125 gene locus_tag LOCUS_10730 1096396 1095125 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027551.1 protein_id gnl|my_center|LOCUS_10730 1096692 1099826 gene locus_tag LOCUS_10740 1096692 1099826 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 protein_id gnl|my_center|LOCUS_10740 1099919 1100965 gene locus_tag LOCUS_10750 1099919 1100965 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729197.1 protein_id gnl|my_center|LOCUS_10750 1101569 1101096 gene locus_tag LOCUS_10760 1101569 1101096 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005123490.1 protein_id gnl|my_center|LOCUS_10760 1102375 1101500 gene locus_tag LOCUS_10770 1102375 1101500 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112619.1 protein_id gnl|my_center|LOCUS_10770 1103972 1102458 gene locus_tag LOCUS_10780 1103972 1102458 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227763.1 protein_id gnl|my_center|LOCUS_10780 1104118 1104759 gene locus_tag LOCUS_10790 1104118 1104759 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140806.1 protein_id gnl|my_center|LOCUS_10790 1104756 1105547 gene locus_tag LOCUS_10800 1104756 1105547 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876252.1 protein_id gnl|my_center|LOCUS_10800 1106687 1105566 gene locus_tag LOCUS_10810 1106687 1105566 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191120.1 protein_id gnl|my_center|LOCUS_10810 1108383 1106911 gene locus_tag LOCUS_10820 1108383 1106911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1109423 1108434 gene locus_tag LOCUS_10830 1109423 1108434 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976379.1 protein_id gnl|my_center|LOCUS_10830 1112128 1109552 gene locus_tag LOCUS_10840 1112128 1109552 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027862.1 protein_id gnl|my_center|LOCUS_10840 1112844 1112467 gene locus_tag LOCUS_10850 1112844 1112467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1113185 1113352 gene locus_tag LOCUS_10860 1113185 1113352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1114710 1113502 gene locus_tag LOCUS_10870 1114710 1113502 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223424.1 protein_id gnl|my_center|LOCUS_10870 1116329 1114710 gene locus_tag LOCUS_10880 1116329 1114710 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731564.1 protein_id gnl|my_center|LOCUS_10880 1116474 1117295 gene locus_tag LOCUS_10890 gene kduI 1116474 1117295 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383270.1 protein_id gnl|my_center|LOCUS_10890 1117324 1118082 gene locus_tag LOCUS_10900 gene kduD 1117324 1118082 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230720.1 protein_id gnl|my_center|LOCUS_10900 1118079 1118840 gene locus_tag LOCUS_10910 1118079 1118840 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_10910 1118921 1119163 gene locus_tag LOCUS_10920 1118921 1119163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1119702 1119118 gene locus_tag LOCUS_10930 1119702 1119118 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228457.1 protein_id gnl|my_center|LOCUS_10930 1120124 1119900 gene locus_tag LOCUS_10940 1120124 1119900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1121194 1120193 gene locus_tag LOCUS_10950 1121194 1120193 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226556.1 protein_id gnl|my_center|LOCUS_10950 1122603 1121251 gene locus_tag LOCUS_10960 1122603 1121251 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226464.1 protein_id gnl|my_center|LOCUS_10960 1122724 1122807 gene locus_tag LOCUS_t00140 1122724 1122807 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1122995 1123411 gene locus_tag LOCUS_10970 1122995 1123411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1123408 1124442 gene locus_tag LOCUS_10980 1123408 1124442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1125057 1124635 gene locus_tag LOCUS_10990 1125057 1124635 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118992.1 protein_id gnl|my_center|LOCUS_10990 1125187 1125963 gene locus_tag LOCUS_11000 1125187 1125963 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485043.1 protein_id gnl|my_center|LOCUS_11000 1126193 1127626 gene locus_tag LOCUS_11010 1126193 1127626 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729117.1 protein_id gnl|my_center|LOCUS_11010 1129725 1127731 gene locus_tag LOCUS_11020 1129725 1127731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1130870 1129722 gene locus_tag LOCUS_11030 1130870 1129722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1131595 1130867 gene locus_tag LOCUS_11040 1131595 1130867 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742194.1 protein_id gnl|my_center|LOCUS_11040 1132383 1133807 gene locus_tag LOCUS_11050 1132383 1133807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1134532 1134182 gene locus_tag LOCUS_11060 1134532 1134182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1135453 1135673 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcccctacgagggatcgcaac 1135908 1136243 gene locus_tag LOCUS_11070 1135908 1136243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1136248 1137492 gene locus_tag LOCUS_11080 1136248 1137492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1137500 1138279 gene locus_tag LOCUS_11090 1137500 1138279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1138276 1138905 gene locus_tag LOCUS_11100 1138276 1138905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1139016 1139381 gene locus_tag LOCUS_11110 1139016 1139381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1139461 1139772 gene locus_tag LOCUS_11120 1139461 1139772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1140332 1139901 gene locus_tag LOCUS_11130 1140332 1139901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1140531 1140313 gene locus_tag LOCUS_11140 1140531 1140313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1140875 1140531 gene locus_tag LOCUS_11150 1140875 1140531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1141362 1142255 gene locus_tag LOCUS_11160 1141362 1142255 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222333.1 protein_id gnl|my_center|LOCUS_11160 1142261 1142482 gene locus_tag LOCUS_11170 1142261 1142482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1143485 1142535 gene locus_tag LOCUS_11180 1143485 1142535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1144174 1143482 gene locus_tag LOCUS_11190 gene tmk 1144174 1143482 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880600.1 protein_id gnl|my_center|LOCUS_11190 1144189 1144614 gene locus_tag LOCUS_11200 1144189 1144614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1145168 1144713 gene locus_tag LOCUS_11210 1145168 1144713 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566035.1 protein_id gnl|my_center|LOCUS_11210 1145876 1145184 gene locus_tag LOCUS_11220 1145876 1145184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1146610 1145873 gene locus_tag LOCUS_11230 gene tmk 1146610 1145873 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903416.1 protein_id gnl|my_center|LOCUS_11230 1147313 1146600 gene locus_tag LOCUS_11240 1147313 1146600 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904152.1 protein_id gnl|my_center|LOCUS_11240 1147771 1147313 gene locus_tag LOCUS_11250 gene queD 1147771 1147313 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090505.1 protein_id gnl|my_center|LOCUS_11250 1148015 1147764 gene locus_tag LOCUS_11260 1148015 1147764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1148265 1149419 gene locus_tag LOCUS_11270 1148265 1149419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1149431 1150153 gene locus_tag LOCUS_11280 1149431 1150153 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903333.1 protein_id gnl|my_center|LOCUS_11280 1151180 1150611 gene locus_tag LOCUS_11290 1151180 1150611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1151467 1152066 gene locus_tag LOCUS_11300 1151467 1152066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1152438 1153106 gene locus_tag LOCUS_11310 1152438 1153106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1153343 1153912 gene locus_tag LOCUS_11320 1153343 1153912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1153912 1154712 gene locus_tag LOCUS_11330 1153912 1154712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1154733 1156070 gene locus_tag LOCUS_11340 1154733 1156070 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029708.1 protein_id gnl|my_center|LOCUS_11340 1156067 1156948 gene locus_tag LOCUS_11350 1156067 1156948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1156945 1157844 gene locus_tag LOCUS_11360 1156945 1157844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1157860 1158051 gene locus_tag LOCUS_11370 1157860 1158051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1158058 1158480 gene locus_tag LOCUS_11380 1158058 1158480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1158495 1158920 gene locus_tag LOCUS_11390 1158495 1158920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1158917 1159348 gene locus_tag LOCUS_11400 1158917 1159348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228853.1 protein_id gnl|my_center|LOCUS_11400 1159348 1161876 gene locus_tag LOCUS_11410 1159348 1161876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1161934 1162104 gene locus_tag LOCUS_11420 1161934 1162104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1162813 1163412 gene locus_tag LOCUS_11430 1162813 1163412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1163490 1163966 gene locus_tag LOCUS_11440 1163490 1163966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1164328 1165062 gene locus_tag LOCUS_11450 1164328 1165062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1165059 1165514 gene locus_tag LOCUS_11460 1165059 1165514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1165613 1166593 gene locus_tag LOCUS_11470 1165613 1166593 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224286.1 protein_id gnl|my_center|LOCUS_11470 1166597 1167475 gene locus_tag LOCUS_11480 1166597 1167475 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208608472.1 protein_id gnl|my_center|LOCUS_11480 1167666 1168343 gene locus_tag LOCUS_11490 1167666 1168343 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222750.1 protein_id gnl|my_center|LOCUS_11490 1169952 1169047 gene locus_tag LOCUS_11500 1169952 1169047 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728967.1 protein_id gnl|my_center|LOCUS_11500 1170437 1170234 gene locus_tag LOCUS_11510 1170437 1170234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1170405 1171229 gene locus_tag LOCUS_11520 1170405 1171229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1171411 1172136 gene locus_tag LOCUS_11530 1171411 1172136 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897093.1 protein_id gnl|my_center|LOCUS_11530 1172450 1173052 gene locus_tag LOCUS_11540 1172450 1173052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1173848 1173558 gene locus_tag LOCUS_11550 1173848 1173558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1174032 1174319 gene locus_tag LOCUS_11560 1174032 1174319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1174324 1174550 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcgatccctcgtaggggcgatgaggac 1174932 1175411 gene locus_tag LOCUS_11570 1174932 1175411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1175408 1176436 gene locus_tag LOCUS_11580 1175408 1176436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1178272 1176644 gene locus_tag LOCUS_11590 1178272 1176644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1178658 1178269 gene locus_tag LOCUS_11600 1178658 1178269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1178633 1178956 gene locus_tag LOCUS_11610 1178633 1178956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1179099 1179731 gene locus_tag LOCUS_11620 1179099 1179731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1179734 1180513 gene locus_tag LOCUS_11630 1179734 1180513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1180953 1181156 gene locus_tag LOCUS_11640 1180953 1181156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11640 1181418 1181705 gene locus_tag LOCUS_11650 1181418 1181705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1181877 1182080 gene locus_tag LOCUS_11660 1181877 1182080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1182442 1182047 gene locus_tag LOCUS_11670 1182442 1182047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1183023 1182583 gene locus_tag LOCUS_11680 1183023 1182583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1183535 1184479 gene locus_tag LOCUS_11690 1183535 1184479 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085410.1 protein_id gnl|my_center|LOCUS_11690 1184476 1187040 gene locus_tag LOCUS_11700 1184476 1187040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1187059 1188000 gene locus_tag LOCUS_11710 1187059 1188000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1188230 1187949 gene locus_tag LOCUS_11720 1188230 1187949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11720 1188681 1188166 gene locus_tag LOCUS_11730 1188681 1188166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11730 1190347 1188794 gene locus_tag LOCUS_11740 gene phoD 1190347 1188794 CDS product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 protein_id gnl|my_center|LOCUS_11740 1190488 1190721 gene locus_tag LOCUS_11750 1190488 1190721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1190791 1191027 gene locus_tag LOCUS_11760 1190791 1191027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1191754 1191158 gene locus_tag LOCUS_11770 1191754 1191158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1192209 1192448 gene locus_tag LOCUS_11780 1192209 1192448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1193479 1193123 gene locus_tag LOCUS_11790 1193479 1193123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1193375 1194076 gene locus_tag LOCUS_11800 1193375 1194076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1194209 1194565 gene locus_tag LOCUS_11810 1194209 1194565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1195004 1195471 gene locus_tag LOCUS_11820 1195004 1195471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1195468 1196109 gene locus_tag LOCUS_11830 1195468 1196109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1196131 1196658 gene locus_tag LOCUS_11840 1196131 1196658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1196996 1196703 gene locus_tag LOCUS_11850 1196996 1196703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11850 1197879 1197340 gene locus_tag LOCUS_11860 1197879 1197340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11860 1199770 1198358 gene locus_tag LOCUS_11870 1199770 1198358 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229437.1 protein_id gnl|my_center|LOCUS_11870 1201234 1200185 gene locus_tag LOCUS_11880 1201234 1200185 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777114.1 protein_id gnl|my_center|LOCUS_11880 1202574 1201231 gene locus_tag LOCUS_11890 1202574 1201231 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777115.1 protein_id gnl|my_center|LOCUS_11890 1203000 1203182 gene locus_tag LOCUS_11900 1203000 1203182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1203758 1204009 gene locus_tag LOCUS_11910 1203758 1204009 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119905.1 protein_id gnl|my_center|LOCUS_11910 1204072 1204755 gene locus_tag LOCUS_11920 1204072 1204755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 1205246 1205593 gene locus_tag LOCUS_11930 1205246 1205593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1206773 1206372 gene locus_tag LOCUS_11940 1206773 1206372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1207729 1207220 gene locus_tag LOCUS_11950 1207729 1207220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1208369 1208121 gene locus_tag LOCUS_11960 1208369 1208121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1208626 1208366 gene locus_tag LOCUS_11970 1208626 1208366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1208988 1208662 gene locus_tag LOCUS_11980 1208988 1208662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1209202 1209050 gene locus_tag LOCUS_11990 1209202 1209050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1209657 1209409 gene locus_tag LOCUS_12000 1209657 1209409 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221457660.1 protein_id gnl|my_center|LOCUS_12000 1209571 1209876 gene locus_tag LOCUS_12010 1209571 1209876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1210094 1209882 gene locus_tag LOCUS_12020 1210094 1209882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1210641 1210832 gene locus_tag LOCUS_12030 1210641 1210832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1211761 1210865 gene locus_tag LOCUS_12040 1211761 1210865 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223269.1 protein_id gnl|my_center|LOCUS_12040 1211825 1211977 gene locus_tag LOCUS_12050 1211825 1211977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1212226 1212558 gene locus_tag LOCUS_12060 1212226 1212558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1213044 1212616 gene locus_tag LOCUS_12070 1213044 1212616 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114401.1 protein_id gnl|my_center|LOCUS_12070 1213239 1213706 gene locus_tag LOCUS_12080 1213239 1213706 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674531.1 protein_id gnl|my_center|LOCUS_12080 1214664 1213738 gene locus_tag LOCUS_12090 1214664 1213738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1215301 1214807 gene locus_tag LOCUS_12100 1215301 1214807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 1215625 1215392 gene locus_tag LOCUS_12110 1215625 1215392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1215778 1216008 gene locus_tag LOCUS_12120 1215778 1216008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1215956 1216186 gene locus_tag LOCUS_12130 1215956 1216186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1216138 1216308 gene locus_tag LOCUS_12140 1216138 1216308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1217695 1216418 gene locus_tag LOCUS_12150 gene thrS 1217695 1216418 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485230.1 protein_id gnl|my_center|LOCUS_12150 1218169 1217912 gene locus_tag LOCUS_12160 1218169 1217912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1219532 1218201 gene locus_tag LOCUS_12170 1219532 1218201 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188081.1 protein_id gnl|my_center|LOCUS_12170 1219768 1219532 gene locus_tag LOCUS_12180 1219768 1219532 CDS product acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533152.1 protein_id gnl|my_center|LOCUS_12180 1220764 1219784 gene locus_tag LOCUS_12190 1220764 1219784 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541610.1 protein_id gnl|my_center|LOCUS_12190 1221660 1220761 gene locus_tag LOCUS_12200 1221660 1220761 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113253.1 protein_id gnl|my_center|LOCUS_12200 1221890 1221660 gene locus_tag LOCUS_12210 1221890 1221660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1221781 1223166 gene locus_tag LOCUS_12220 1221781 1223166 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223101.1 protein_id gnl|my_center|LOCUS_12220 1223360 1224133 gene locus_tag LOCUS_12230 1223360 1224133 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249291.1 protein_id gnl|my_center|LOCUS_12230 1224269 1224646 gene locus_tag LOCUS_12240 1224269 1224646 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896379.1 protein_id gnl|my_center|LOCUS_12240 1225284 1224739 gene locus_tag LOCUS_12250 1225284 1224739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12250 1225647 1225324 gene locus_tag LOCUS_12260 1225647 1225324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12260 1226962 1225994 gene locus_tag LOCUS_12270 1226962 1225994 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224286.1 protein_id gnl|my_center|LOCUS_12270 1228130 1227747 gene locus_tag LOCUS_12280 1228130 1227747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1228263 1228439 gene locus_tag LOCUS_12290 1228263 1228439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1228709 1229059 gene locus_tag LOCUS_12300 1228709 1229059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1229090 1229461 gene locus_tag LOCUS_12310 1229090 1229461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1230863 1229871 gene locus_tag LOCUS_12320 1230863 1229871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1232120 1231875 gene locus_tag LOCUS_12330 1232120 1231875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1232241 1232831 gene locus_tag LOCUS_12340 1232241 1232831 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230285.1 protein_id gnl|my_center|LOCUS_12340 1232828 1234150 gene locus_tag LOCUS_12350 1232828 1234150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1234522 1234866 gene locus_tag LOCUS_12360 1234522 1234866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1235160 1235381 gene locus_tag LOCUS_12370 1235160 1235381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1235889 1235671 gene locus_tag LOCUS_12380 1235889 1235671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1236299 1237006 gene locus_tag LOCUS_12390 1236299 1237006 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393101.1 protein_id gnl|my_center|LOCUS_12390 1237003 1237875 gene locus_tag LOCUS_12400 1237003 1237875 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406412.1 protein_id gnl|my_center|LOCUS_12400 1237872 1239008 gene locus_tag LOCUS_12410 1237872 1239008 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089089.1 protein_id gnl|my_center|LOCUS_12410 1239005 1240420 gene locus_tag LOCUS_12420 1239005 1240420 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892003.1 protein_id gnl|my_center|LOCUS_12420 1240449 1241861 gene locus_tag LOCUS_12430 1240449 1241861 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002489776.1 protein_id gnl|my_center|LOCUS_12430 1243234 1242371 gene locus_tag LOCUS_12440 1243234 1242371 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729056.1 protein_id gnl|my_center|LOCUS_12440 1243408 1244364 gene locus_tag LOCUS_12450 1243408 1244364 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003952307.1 protein_id gnl|my_center|LOCUS_12450 1244914 1245195 gene locus_tag LOCUS_12460 1244914 1245195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 1245202 1245474 gene locus_tag LOCUS_12470 1245202 1245474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1245553 1246002 gene locus_tag LOCUS_12480 1245553 1246002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1246027 1246443 gene locus_tag LOCUS_12490 1246027 1246443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1246725 1247027 gene locus_tag LOCUS_12500 1246725 1247027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1247053 1248336 gene locus_tag LOCUS_12510 1247053 1248336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1248573 1248794 gene locus_tag LOCUS_12520 1248573 1248794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1248867 1249169 gene locus_tag LOCUS_12530 1248867 1249169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1249243 1249518 gene locus_tag LOCUS_12540 1249243 1249518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1249697 1250116 gene locus_tag LOCUS_12550 1249697 1250116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12550 1250292 1250573 gene locus_tag LOCUS_12560 1250292 1250573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1251459 1250617 gene locus_tag LOCUS_12570 1251459 1250617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1251698 1251462 gene locus_tag LOCUS_12580 1251698 1251462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1252902 1252534 gene locus_tag LOCUS_12590 1252902 1252534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1253872 1253090 gene locus_tag LOCUS_12600 1253872 1253090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1254020 1257100 gene locus_tag LOCUS_12610 1254020 1257100 CDS product Tn3-like element Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143760.1 protein_id gnl|my_center|LOCUS_12610 1258663 1257119 gene locus_tag LOCUS_12620 1258663 1257119 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466576.1 protein_id gnl|my_center|LOCUS_12620 1258768 1259481 gene locus_tag LOCUS_12630 1258768 1259481 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968585.1 protein_id gnl|my_center|LOCUS_12630 1259923 1260195 gene locus_tag LOCUS_12640 1259923 1260195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12640 1261501 1260398 gene locus_tag LOCUS_12650 1261501 1260398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1261827 1262027 gene locus_tag LOCUS_12660 1261827 1262027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1263076 1262042 gene locus_tag LOCUS_12670 1263076 1262042 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226521.1 protein_id gnl|my_center|LOCUS_12670 1263839 1263468 gene locus_tag LOCUS_12680 1263839 1263468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1264055 1265020 gene locus_tag LOCUS_12690 gene pip 1264055 1265020 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087175.1 protein_id gnl|my_center|LOCUS_12690 1265402 1265043 gene locus_tag LOCUS_12700 1265402 1265043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1265684 1265427 gene locus_tag LOCUS_12710 1265684 1265427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1267024 1266176 gene locus_tag LOCUS_12720 1267024 1266176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1268044 1267163 gene locus_tag LOCUS_12730 1268044 1267163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 1268833 1268441 gene locus_tag LOCUS_12740 1268833 1268441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1269628 1269452 gene locus_tag LOCUS_12750 1269628 1269452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1270119 1269661 gene locus_tag LOCUS_12760 1270119 1269661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1271056 1270820 gene locus_tag LOCUS_12770 1271056 1270820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1271657 1272034 gene locus_tag LOCUS_12780 1271657 1272034 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225939.1 protein_id gnl|my_center|LOCUS_12780 1273170 1272457 gene locus_tag LOCUS_12790 1273170 1272457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12790 1274484 1273279 gene locus_tag LOCUS_12800 1274484 1273279 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_12800 1276208 1274532 gene locus_tag LOCUS_12810 1276208 1274532 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193195.1 protein_id gnl|my_center|LOCUS_12810 1277573 1276221 gene locus_tag LOCUS_12820 1277573 1276221 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113881.1 protein_id gnl|my_center|LOCUS_12820 1278608 1277715 gene locus_tag LOCUS_12830 1278608 1277715 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_12830 1279144 1279452 gene locus_tag LOCUS_12840 1279144 1279452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1279665 1280939 gene locus_tag LOCUS_12850 1279665 1280939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1282514 1280901 gene locus_tag LOCUS_12860 1282514 1280901 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456532.1 protein_id gnl|my_center|LOCUS_12860 1282692 1283834 gene locus_tag LOCUS_12870 1282692 1283834 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838427.1 protein_id gnl|my_center|LOCUS_12870 1283884 1285542 gene locus_tag LOCUS_12880 1283884 1285542 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_12880 1286226 1285552 gene locus_tag LOCUS_12890 1286226 1285552 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878611.1 protein_id gnl|my_center|LOCUS_12890 1287046 1286288 gene locus_tag LOCUS_12900 1287046 1286288 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230307.1 protein_id gnl|my_center|LOCUS_12900 1288286 1287120 gene locus_tag LOCUS_12910 1288286 1287120 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728068.1 protein_id gnl|my_center|LOCUS_12910 1288789 1288304 gene locus_tag LOCUS_12920 1288789 1288304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1289997 1288786 gene locus_tag LOCUS_12930 1289997 1288786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1290259 1291113 gene locus_tag LOCUS_12940 1290259 1291113 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877268.1 protein_id gnl|my_center|LOCUS_12940 1291110 1291925 gene locus_tag LOCUS_12950 1291110 1291925 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073859065.1 protein_id gnl|my_center|LOCUS_12950 1292101 1292325 gene locus_tag LOCUS_12960 1292101 1292325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12960 1292715 1292248 gene locus_tag LOCUS_12970 1292715 1292248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1293180 1294049 gene locus_tag LOCUS_12980 1293180 1294049 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893773.1 protein_id gnl|my_center|LOCUS_12980 1294212 1294982 gene locus_tag LOCUS_12990 1294212 1294982 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174552531.1 protein_id gnl|my_center|LOCUS_12990 1295083 1295217 gene locus_tag LOCUS_13000 1295083 1295217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1296117 1295734 gene locus_tag LOCUS_13010 1296117 1295734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13010 1297765 1296839 gene locus_tag LOCUS_13020 1297765 1296839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1297925 1298176 gene locus_tag LOCUS_13030 1297925 1298176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1298596 1298366 gene locus_tag LOCUS_13040 1298596 1298366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1298549 1298695 gene locus_tag LOCUS_13050 1298549 1298695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1299823 1298759 gene locus_tag LOCUS_13060 1299823 1298759 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257709.1 protein_id gnl|my_center|LOCUS_13060 1300659 1299820 gene locus_tag LOCUS_13070 1300659 1299820 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224923.1 protein_id gnl|my_center|LOCUS_13070 1301187 1301495 gene locus_tag LOCUS_13080 1301187 1301495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1302398 1301382 gene locus_tag LOCUS_13090 1302398 1301382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13090 1303021 1302875 gene locus_tag LOCUS_13100 1303021 1302875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1303307 1303711 gene locus_tag LOCUS_13110 1303307 1303711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13110 1304446 1303814 gene locus_tag LOCUS_13120 1304446 1303814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1305744 1304497 gene locus_tag LOCUS_13130 gene ectB 1305744 1304497 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230319.1 protein_id gnl|my_center|LOCUS_13130 1306234 1305833 gene locus_tag LOCUS_13140 1306234 1305833 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976954.1 protein_id gnl|my_center|LOCUS_13140 1306552 1306283 gene locus_tag LOCUS_13150 1306552 1306283 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225483.1 protein_id gnl|my_center|LOCUS_13150 1308084 1306552 gene locus_tag LOCUS_13160 1308084 1306552 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525355.1 protein_id gnl|my_center|LOCUS_13160 1308947 1308084 gene locus_tag LOCUS_13170 1308947 1308084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1310221 1308944 gene locus_tag LOCUS_13180 1310221 1308944 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225872.1 protein_id gnl|my_center|LOCUS_13180 1310796 1310290 gene locus_tag LOCUS_13190 gene ectA 1310796 1310290 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449632.1 protein_id gnl|my_center|LOCUS_13190 1311401 1312357 gene locus_tag LOCUS_13200 1311401 1312357 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222870.1 protein_id gnl|my_center|LOCUS_13200 1313770 1312493 gene locus_tag LOCUS_13210 1313770 1312493 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029637.1 protein_id gnl|my_center|LOCUS_13210 1314622 1314374 gene locus_tag LOCUS_13220 1314622 1314374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1315018 1314662 gene locus_tag LOCUS_13230 1315018 1314662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13230 1316212 1315658 gene locus_tag LOCUS_13240 gene bioQ 1316212 1315658 CDS product TetR family transcriptional regulator BioQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728885.1 protein_id gnl|my_center|LOCUS_13240 1316316 1317389 gene locus_tag LOCUS_13250 gene bioB 1316316 1317389 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027664.1 protein_id gnl|my_center|LOCUS_13250 1317389 1318651 gene locus_tag LOCUS_13260 1317389 1318651 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027665.1 protein_id gnl|my_center|LOCUS_13260 1318648 1319787 gene locus_tag LOCUS_13270 1318648 1319787 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977587.1 protein_id gnl|my_center|LOCUS_13270 1319784 1320458 gene locus_tag LOCUS_13280 gene bioD 1319784 1320458 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027666.1 protein_id gnl|my_center|LOCUS_13280 1320798 1321649 gene locus_tag LOCUS_13290 1320798 1321649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1323001 1321787 gene locus_tag LOCUS_13300 1323001 1321787 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 protein_id gnl|my_center|LOCUS_13300 1323408 1324709 gene locus_tag LOCUS_13310 1323408 1324709 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111195.1 protein_id gnl|my_center|LOCUS_13310 1324752 1325255 gene locus_tag LOCUS_13320 1324752 1325255 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039528.1 protein_id gnl|my_center|LOCUS_13320 1325297 1326826 gene locus_tag LOCUS_13330 1325297 1326826 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227765.1 protein_id gnl|my_center|LOCUS_13330 1327124 1328512 gene locus_tag LOCUS_13340 1327124 1328512 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268048.1 protein_id gnl|my_center|LOCUS_13340 1328546 1329334 gene locus_tag LOCUS_13350 1328546 1329334 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230346.1 protein_id gnl|my_center|LOCUS_13350 1330097 1329804 gene locus_tag LOCUS_13360 1330097 1329804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13360 1331643 1330300 gene locus_tag LOCUS_13370 1331643 1330300 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211863.1 protein_id gnl|my_center|LOCUS_13370 1332254 1333048 gene locus_tag LOCUS_13380 1332254 1333048 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385779.1 protein_id gnl|my_center|LOCUS_13380 1333512 1333006 gene locus_tag LOCUS_13390 1333512 1333006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1334062 1334199 gene locus_tag LOCUS_13400 1334062 1334199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1334789 1336264 gene locus_tag LOCUS_13410 1334789 1336264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1336676 1337110 gene locus_tag LOCUS_13420 1336676 1337110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1337607 1337185 gene locus_tag LOCUS_13430 1337607 1337185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1340022 1337689 gene locus_tag LOCUS_13440 1340022 1337689 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228501.1 protein_id gnl|my_center|LOCUS_13440 1341371 1340223 gene locus_tag LOCUS_13450 1341371 1340223 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229312.1 protein_id gnl|my_center|LOCUS_13450 1341575 1341381 gene locus_tag LOCUS_13460 1341575 1341381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1344085 1341632 gene locus_tag LOCUS_13470 1344085 1341632 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229304.1 protein_id gnl|my_center|LOCUS_13470 1345002 1344373 gene locus_tag LOCUS_13480 1345002 1344373 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978121.1 protein_id gnl|my_center|LOCUS_13480 1346087 1344999 gene locus_tag LOCUS_13490 1346087 1344999 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_13490 1346419 1346769 gene locus_tag LOCUS_13500 1346419 1346769 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229318.1 protein_id gnl|my_center|LOCUS_13500 1346766 1347947 gene locus_tag LOCUS_13510 1346766 1347947 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229319.1 protein_id gnl|my_center|LOCUS_13510 1348121 1349401 gene locus_tag LOCUS_13520 1348121 1349401 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973528.1 protein_id gnl|my_center|LOCUS_13520 1349458 1350690 gene locus_tag LOCUS_13530 1349458 1350690 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229309.1 protein_id gnl|my_center|LOCUS_13530 1350745 1351023 gene locus_tag LOCUS_13540 1350745 1351023 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229308.1 protein_id gnl|my_center|LOCUS_13540 1351020 1353863 gene locus_tag LOCUS_13550 1351020 1353863 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142077.1 protein_id gnl|my_center|LOCUS_13550 1353856 1354458 gene locus_tag LOCUS_13560 1353856 1354458 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205601.1 protein_id gnl|my_center|LOCUS_13560 1354455 1355816 gene locus_tag LOCUS_13570 1354455 1355816 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 protein_id gnl|my_center|LOCUS_13570 1355957 1356577 gene locus_tag LOCUS_13580 1355957 1356577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1356574 1357554 gene locus_tag LOCUS_13590 gene folD 1356574 1357554 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_13590 1357620 1358465 gene locus_tag LOCUS_13600 gene purU 1357620 1358465 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229305.1 protein_id gnl|my_center|LOCUS_13600 1359217 1360875 gene locus_tag LOCUS_13610 1359217 1360875 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972257.1 protein_id gnl|my_center|LOCUS_13610 1361555 1361415 gene locus_tag LOCUS_13620 1361555 1361415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13620 1361806 1361594 gene locus_tag LOCUS_13630 1361806 1361594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13630 1362761 1363096 gene locus_tag LOCUS_13640 1362761 1363096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1365109 1363178 gene locus_tag LOCUS_13650 1365109 1363178 CDS product sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226206.1 protein_id gnl|my_center|LOCUS_13650 1366007 1365096 gene locus_tag LOCUS_13660 1366007 1365096 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226205.1 protein_id gnl|my_center|LOCUS_13660 1366329 1367003 gene locus_tag LOCUS_13670 1366329 1367003 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226204.1 protein_id gnl|my_center|LOCUS_13670 1367281 1368651 gene locus_tag LOCUS_13680 1367281 1368651 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226203.1 protein_id gnl|my_center|LOCUS_13680 1370180 1369809 gene locus_tag LOCUS_13690 gene glbN 1370180 1369809 CDS product group 1 truncated hemoglobin GlbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407730.1 protein_id gnl|my_center|LOCUS_13690 1371481 1371032 gene locus_tag LOCUS_13700 1371481 1371032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1372635 1372135 gene locus_tag LOCUS_13710 1372635 1372135 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972077.1 protein_id gnl|my_center|LOCUS_13710 1372784 1374364 gene locus_tag LOCUS_13720 1372784 1374364 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965939.1 protein_id gnl|my_center|LOCUS_13720 1374370 1376835 gene locus_tag LOCUS_13730 1374370 1376835 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921440.1 protein_id gnl|my_center|LOCUS_13730 1376838 1377617 gene locus_tag LOCUS_13740 1376838 1377617 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086319.1 protein_id gnl|my_center|LOCUS_13740 1377624 1378532 gene locus_tag LOCUS_13750 1377624 1378532 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730865.1 protein_id gnl|my_center|LOCUS_13750 1378529 1379848 gene locus_tag LOCUS_13760 1378529 1379848 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086136.1 protein_id gnl|my_center|LOCUS_13760 1379919 1381196 gene locus_tag LOCUS_13770 1379919 1381196 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393273.1 protein_id gnl|my_center|LOCUS_13770 1381245 1381502 gene locus_tag LOCUS_13780 1381245 1381502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13780 1381512 1381703 gene locus_tag LOCUS_13790 1381512 1381703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13790 1382606 1382259 gene locus_tag LOCUS_13800 1382606 1382259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13800 1383584 1384570 gene locus_tag LOCUS_13810 1383584 1384570 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853829.1 protein_id gnl|my_center|LOCUS_13810 1384624 1385262 gene locus_tag LOCUS_13820 1384624 1385262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1385342 1386916 gene locus_tag LOCUS_13830 1385342 1386916 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257231.1 protein_id gnl|my_center|LOCUS_13830 1387160 1388014 gene locus_tag LOCUS_13840 gene catA 1387160 1388014 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728003.1 protein_id gnl|my_center|LOCUS_13840 1388145 1389266 gene locus_tag LOCUS_13850 1388145 1389266 CDS product muconate/chloromuconate family cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015092.1 protein_id gnl|my_center|LOCUS_13850 1389294 1389776 gene locus_tag LOCUS_13860 1389294 1389776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1389981 1390742 gene locus_tag LOCUS_13870 1389981 1390742 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084317.1 protein_id gnl|my_center|LOCUS_13870 1391678 1391403 gene locus_tag LOCUS_13880 1391678 1391403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1392360 1392127 gene locus_tag LOCUS_13890 1392360 1392127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1393932 1392742 gene locus_tag LOCUS_13900 1393932 1392742 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977616.1 protein_id gnl|my_center|LOCUS_13900 1394262 1394005 gene locus_tag LOCUS_13910 1394262 1394005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1395323 1394355 gene locus_tag LOCUS_13920 1395323 1394355 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084065.1 protein_id gnl|my_center|LOCUS_13920 1395468 1395848 gene locus_tag LOCUS_13930 gene blaI 1395468 1395848 CDS product transcriptional repressor BlaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409301.1 protein_id gnl|my_center|LOCUS_13930 1395848 1396786 gene locus_tag LOCUS_13940 1395848 1396786 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908696.1 protein_id gnl|my_center|LOCUS_13940 1397002 1397883 gene locus_tag LOCUS_13950 1397002 1397883 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222712.1 protein_id gnl|my_center|LOCUS_13950 1398499 1397858 gene locus_tag LOCUS_13960 1398499 1397858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1398999 1398502 gene locus_tag LOCUS_13970 1398999 1398502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1398929 1399156 gene locus_tag LOCUS_13980 1398929 1399156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1399574 1399807 gene locus_tag LOCUS_13990 1399574 1399807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1399985 1400800 gene locus_tag LOCUS_14000 1399985 1400800 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226304.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14000 1401916 1400807 gene locus_tag LOCUS_14010 1401916 1400807 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206889.1 protein_id gnl|my_center|LOCUS_14010 1403452 1402004 gene locus_tag LOCUS_14020 1403452 1402004 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030921.1 protein_id gnl|my_center|LOCUS_14020 1403934 1405085 gene locus_tag LOCUS_14030 1403934 1405085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1405927 1405112 gene locus_tag LOCUS_14040 1405927 1405112 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_14040 1407328 1406369 gene locus_tag LOCUS_14050 1407328 1406369 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223551.1 protein_id gnl|my_center|LOCUS_14050 1408148 1407366 gene locus_tag LOCUS_14060 1408148 1407366 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_14060 1408714 1408190 gene locus_tag LOCUS_14070 1408714 1408190 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_14070 1409284 1409375 gene locus_tag LOCUS_t00150 1409284 1409375 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1410657 1409461 gene locus_tag LOCUS_14080 1410657 1409461 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838427.1 protein_id gnl|my_center|LOCUS_14080 1411832 1410654 gene locus_tag LOCUS_14090 1411832 1410654 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728221.1 protein_id gnl|my_center|LOCUS_14090 1411922 1412821 gene locus_tag LOCUS_14100 1411922 1412821 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897067.1 protein_id gnl|my_center|LOCUS_14100 1414544 1412832 gene locus_tag LOCUS_14110 gene mimR 1414544 1412832 CDS product transcriptional regulator MimR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728053.1 protein_id gnl|my_center|LOCUS_14110 1414789 1416420 gene locus_tag LOCUS_14120 1414789 1416420 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728663.1 protein_id gnl|my_center|LOCUS_14120 1416503 1417873 gene locus_tag LOCUS_14130 1416503 1417873 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889602.1 protein_id gnl|my_center|LOCUS_14130 1417906 1418955 gene locus_tag LOCUS_14140 1417906 1418955 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896426.1 protein_id gnl|my_center|LOCUS_14140 1419073 1419846 gene locus_tag LOCUS_14150 1419073 1419846 CDS product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026965.1 protein_id gnl|my_center|LOCUS_14150 1420733 1421230 gene locus_tag LOCUS_14160 1420733 1421230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1422196 1421153 gene locus_tag LOCUS_14170 gene tdh 1422196 1421153 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249867.1 protein_id gnl|my_center|LOCUS_14170 1422915 1422229 gene locus_tag LOCUS_14180 1422915 1422229 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807684.1 protein_id gnl|my_center|LOCUS_14180 1424005 1422941 gene locus_tag LOCUS_14190 1424005 1422941 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853200.1 protein_id gnl|my_center|LOCUS_14190 1424580 1424131 gene locus_tag LOCUS_14200 1424580 1424131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1424854 1425774 gene locus_tag LOCUS_14210 1424854 1425774 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810407.1 protein_id gnl|my_center|LOCUS_14210 1425867 1427300 gene locus_tag LOCUS_14220 1425867 1427300 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385749.1 protein_id gnl|my_center|LOCUS_14220 1427297 1428172 gene locus_tag LOCUS_14230 1427297 1428172 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967128.1 protein_id gnl|my_center|LOCUS_14230 1428263 1429366 gene locus_tag LOCUS_14240 1428263 1429366 CDS product muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728002.1 protein_id gnl|my_center|LOCUS_14240 1429943 1430311 gene locus_tag LOCUS_14250 1429943 1430311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1430302 1431645 gene locus_tag LOCUS_14260 1430302 1431645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1431638 1432567 gene locus_tag LOCUS_14270 1431638 1432567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1432581 1433144 gene locus_tag LOCUS_14280 1432581 1433144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1433141 1433446 gene locus_tag LOCUS_14290 gene nuoK 1433141 1433446 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392499.1 protein_id gnl|my_center|LOCUS_14290 1433452 1435323 gene locus_tag LOCUS_14300 gene nuoL 1433452 1435323 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 protein_id gnl|my_center|LOCUS_14300 1435327 1436826 gene locus_tag LOCUS_14310 1435327 1436826 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257847.1 protein_id gnl|my_center|LOCUS_14310 1436823 1438244 gene locus_tag LOCUS_14320 1436823 1438244 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_14320 1438416 1439042 gene locus_tag LOCUS_14330 1438416 1439042 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225120.1 protein_id gnl|my_center|LOCUS_14330 1440588 1439215 gene locus_tag LOCUS_14340 gene sbnD 1440588 1439215 CDS product staphyloferrin B export MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610051.1 protein_id gnl|my_center|LOCUS_14340 1441565 1440585 gene locus_tag LOCUS_14350 gene sbnA 1441565 1440585 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570807.1 protein_id gnl|my_center|LOCUS_14350 1442891 1443301 gene locus_tag LOCUS_14360 1442891 1443301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1443478 1443942 gene locus_tag LOCUS_14370 1443478 1443942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14370 1444131 1445633 gene locus_tag LOCUS_14380 1444131 1445633 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113065.1 protein_id gnl|my_center|LOCUS_14380 1446064 1446270 gene locus_tag LOCUS_14390 1446064 1446270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 1446869 1446636 gene locus_tag LOCUS_14400 1446869 1446636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14400 1447125 1447478 gene locus_tag LOCUS_14410 1447125 1447478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1448649 1447648 gene locus_tag LOCUS_14420 1448649 1447648 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409298.1 protein_id gnl|my_center|LOCUS_14420 1449017 1448646 gene locus_tag LOCUS_14430 1449017 1448646 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112732.1 protein_id gnl|my_center|LOCUS_14430 1450564 1449587 gene locus_tag LOCUS_14440 1450564 1449587 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084065.1 protein_id gnl|my_center|LOCUS_14440 1450686 1451066 gene locus_tag LOCUS_14450 1450686 1451066 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889330.1 protein_id gnl|my_center|LOCUS_14450 1453507 1451645 gene locus_tag LOCUS_14460 1453507 1451645 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484240.1 protein_id gnl|my_center|LOCUS_14460 1455101 1454196 gene locus_tag LOCUS_14470 1455101 1454196 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064264.1 protein_id gnl|my_center|LOCUS_14470 1455800 1455330 gene locus_tag LOCUS_14480 1455800 1455330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14480 1458008 1456626 gene locus_tag LOCUS_14490 1458008 1456626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 1458615 1458818 gene locus_tag LOCUS_14500 1458615 1458818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1458851 1459294 gene locus_tag LOCUS_14510 1458851 1459294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1459441 1460496 gene locus_tag LOCUS_14520 1459441 1460496 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209895261.1 protein_id gnl|my_center|LOCUS_14520 1460841 1461074 gene locus_tag LOCUS_14530 1460841 1461074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877644.1 protein_id gnl|my_center|LOCUS_14530 1461767 1461252 gene locus_tag LOCUS_14540 1461767 1461252 CDS product DUF1360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226138.1 protein_id gnl|my_center|LOCUS_14540 1461839 1462045 gene locus_tag LOCUS_14550 1461839 1462045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1463564 1462206 gene locus_tag LOCUS_14560 gene proP 1463564 1462206 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831685.1 protein_id gnl|my_center|LOCUS_14560 1463836 1464144 gene locus_tag LOCUS_14570 1463836 1464144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1464350 1464793 gene locus_tag LOCUS_14580 1464350 1464793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1465355 1466647 gene locus_tag LOCUS_14590 1465355 1466647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1467107 1467568 gene locus_tag LOCUS_14600 1467107 1467568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 1468591 1468746 gene locus_tag LOCUS_14610 1468591 1468746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1469294 1469031 gene locus_tag LOCUS_14620 1469294 1469031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1469425 1469988 gene locus_tag LOCUS_14630 1469425 1469988 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728973.1 protein_id gnl|my_center|LOCUS_14630 1470776 1470477 gene locus_tag LOCUS_14640 1470776 1470477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1471039 1470755 gene locus_tag LOCUS_14650 1471039 1470755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1472312 1472067 gene locus_tag LOCUS_14660 1472312 1472067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1473396 1472749 gene locus_tag LOCUS_14670 1473396 1472749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1474769 1473408 gene locus_tag LOCUS_14680 1474769 1473408 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525150.1 protein_id gnl|my_center|LOCUS_14680 1476058 1474772 gene locus_tag LOCUS_14690 1476058 1474772 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245531.1 protein_id gnl|my_center|LOCUS_14690 1477643 1476225 gene locus_tag LOCUS_14700 1477643 1476225 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_14700 1479346 1477640 gene locus_tag LOCUS_14710 1479346 1477640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1480539 1479343 gene locus_tag LOCUS_14720 1480539 1479343 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041861981.1 protein_id gnl|my_center|LOCUS_14720 1481339 1480536 gene locus_tag LOCUS_14730 1481339 1480536 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460928.1 protein_id gnl|my_center|LOCUS_14730 1481534 1482928 gene locus_tag LOCUS_14740 1481534 1482928 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927872.1 protein_id gnl|my_center|LOCUS_14740 1482925 1484391 gene locus_tag LOCUS_14750 1482925 1484391 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040326.1 protein_id gnl|my_center|LOCUS_14750 1484631 1484464 gene locus_tag LOCUS_14760 1484631 1484464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 1485023 1484805 gene locus_tag LOCUS_14770 1485023 1484805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 1485408 1485160 gene locus_tag LOCUS_14780 1485408 1485160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1486965 1485640 gene locus_tag LOCUS_14790 1486965 1485640 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226953.1 protein_id gnl|my_center|LOCUS_14790 1488380 1486962 gene locus_tag LOCUS_14800 1488380 1486962 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064065404.1 protein_id gnl|my_center|LOCUS_14800 1490239 1488392 gene locus_tag LOCUS_14810 1490239 1488392 CDS product DUF3556 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407380.1 protein_id gnl|my_center|LOCUS_14810 1491793 1490318 gene locus_tag LOCUS_14820 gene lcfB 1491793 1490318 CDS product long-chain-fatty-acid--CoA ligase LcfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244686.1 protein_id gnl|my_center|LOCUS_14820 1492311 1493150 gene locus_tag LOCUS_14830 1492311 1493150 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730322.1 protein_id gnl|my_center|LOCUS_14830 1493153 1493368 gene locus_tag LOCUS_14840 1493153 1493368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14840 1493346 1493777 gene locus_tag LOCUS_14850 1493346 1493777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14850 1494323 1496407 gene locus_tag LOCUS_14860 1494323 1496407 CDS product transferrin receptor-like dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928760.1 protein_id gnl|my_center|LOCUS_14860 1496475 1496786 gene locus_tag LOCUS_14870 1496475 1496786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1496806 1497222 gene locus_tag LOCUS_14880 1496806 1497222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 1497320 1497511 gene locus_tag LOCUS_14890 1497320 1497511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1499290 1498487 gene locus_tag LOCUS_14900 1499290 1498487 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222334.1 protein_id gnl|my_center|LOCUS_14900 1500528 1500070 gene locus_tag LOCUS_14910 1500528 1500070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1500800 1501411 gene locus_tag LOCUS_14920 1500800 1501411 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532489.1 protein_id gnl|my_center|LOCUS_14920 1501697 1501371 gene locus_tag LOCUS_14930 1501697 1501371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1502063 1502257 gene locus_tag LOCUS_14940 1502063 1502257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1502708 1504120 gene locus_tag LOCUS_14950 1502708 1504120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1505257 1505649 gene locus_tag LOCUS_14960 1505257 1505649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1506364 1505678 gene locus_tag LOCUS_14970 1506364 1505678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1506538 1506404 gene locus_tag LOCUS_14980 1506538 1506404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1506892 1507155 gene locus_tag LOCUS_14990 1506892 1507155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1507267 1507458 gene locus_tag LOCUS_15000 1507267 1507458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1507475 1508146 gene locus_tag LOCUS_15010 1507475 1508146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1508524 1508156 gene locus_tag LOCUS_15020 1508524 1508156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 1510515 1509148 gene locus_tag LOCUS_15030 1510515 1509148 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091313186.1 protein_id gnl|my_center|LOCUS_15030 1510630 1511187 gene locus_tag LOCUS_15040 1510630 1511187 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226000.1 protein_id gnl|my_center|LOCUS_15040 1511489 1512046 gene locus_tag LOCUS_15050 1511489 1512046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1513690 1512197 gene locus_tag LOCUS_15060 1513690 1512197 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082592.1 protein_id gnl|my_center|LOCUS_15060 1513947 1514390 gene locus_tag LOCUS_15070 1513947 1514390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1514603 1514391 gene locus_tag LOCUS_15080 1514603 1514391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1514660 1514893 gene locus_tag LOCUS_15090 1514660 1514893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 1514931 1515401 gene locus_tag LOCUS_15100 1514931 1515401 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467392.1 protein_id gnl|my_center|LOCUS_15100 1515533 1516738 gene locus_tag LOCUS_15110 1515533 1516738 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227797.1 protein_id gnl|my_center|LOCUS_15110 1518445 1517408 gene locus_tag LOCUS_15120 1518445 1517408 CDS product Vms1/Ankzf1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776244.1 protein_id gnl|my_center|LOCUS_15120 1518735 1519130 gene locus_tag LOCUS_15130 1518735 1519130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1519163 1519621 gene locus_tag LOCUS_15140 1519163 1519621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1519775 1520605 gene locus_tag LOCUS_15150 1519775 1520605 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729731.1 protein_id gnl|my_center|LOCUS_15150 1521190 1521603 gene locus_tag LOCUS_15160 1521190 1521603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1521655 1521918 gene locus_tag LOCUS_15170 1521655 1521918 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511323.1 protein_id gnl|my_center|LOCUS_15170 1522230 1522715 gene locus_tag LOCUS_15180 1522230 1522715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1523756 1524802 gene locus_tag LOCUS_15190 1523756 1524802 CDS product 2-keto-3-deoxygluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040097.1 protein_id gnl|my_center|LOCUS_15190 1524799 1526043 gene locus_tag LOCUS_15200 1524799 1526043 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063966.1 protein_id gnl|my_center|LOCUS_15200 1526069 1527124 gene locus_tag LOCUS_15210 gene pdxA 1526069 1527124 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063965.1 protein_id gnl|my_center|LOCUS_15210 1527127 1528002 gene locus_tag LOCUS_15220 1527127 1528002 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818670.1 protein_id gnl|my_center|LOCUS_15220 1527995 1528279 gene locus_tag LOCUS_15230 1527995 1528279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1528553 1529347 gene locus_tag LOCUS_15240 1528553 1529347 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198408425.1 protein_id gnl|my_center|LOCUS_15240 1529334 1530563 gene locus_tag LOCUS_15250 1529334 1530563 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_15250 1530591 1531250 gene locus_tag LOCUS_15260 1530591 1531250 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869088.1 protein_id gnl|my_center|LOCUS_15260 1534222 1531295 gene locus_tag LOCUS_15270 1534222 1531295 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_15270 1535385 1534219 gene locus_tag LOCUS_15280 1535385 1534219 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815469.1 protein_id gnl|my_center|LOCUS_15280 1535642 1537036 gene locus_tag LOCUS_15290 1535642 1537036 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028355.1 protein_id gnl|my_center|LOCUS_15290 1537747 1537487 gene locus_tag LOCUS_15300 1537747 1537487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1540110 1538977 gene locus_tag LOCUS_15310 1540110 1538977 CDS product glutathione-independent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104138.1 protein_id gnl|my_center|LOCUS_15310 1541918 1540791 gene locus_tag LOCUS_15320 1541918 1540791 CDS product NAD-dependent formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809490.1 protein_id gnl|my_center|LOCUS_15320 1542883 1543182 gene locus_tag LOCUS_15330 1542883 1543182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1543319 1544326 gene locus_tag LOCUS_15340 1543319 1544326 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421550.1 protein_id gnl|my_center|LOCUS_15340 1544394 1545227 gene locus_tag LOCUS_15350 1544394 1545227 CDS product bromoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074324.1 protein_id gnl|my_center|LOCUS_15350 1545245 1545568 gene locus_tag LOCUS_15360 1545245 1545568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1546035 1546289 gene locus_tag LOCUS_15370 1546035 1546289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 1546302 1547642 gene locus_tag LOCUS_15380 1546302 1547642 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227047.1 protein_id gnl|my_center|LOCUS_15380 1547684 1548739 gene locus_tag LOCUS_15390 1547684 1548739 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047756.1 protein_id gnl|my_center|LOCUS_15390 1550474 1548876 gene locus_tag LOCUS_15400 1550474 1548876 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104297.1 protein_id gnl|my_center|LOCUS_15400 1551466 1551245 gene locus_tag LOCUS_15410 1551466 1551245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1552504 1551731 gene locus_tag LOCUS_15420 1552504 1551731 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729052.1 protein_id gnl|my_center|LOCUS_15420 1553902 1552517 gene locus_tag LOCUS_15430 1553902 1552517 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015481.1 protein_id gnl|my_center|LOCUS_15430 1554462 1553938 gene locus_tag LOCUS_15440 1554462 1553938 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082774477.1 protein_id gnl|my_center|LOCUS_15440 1554625 1555422 gene locus_tag LOCUS_15450 1554625 1555422 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891775.1 protein_id gnl|my_center|LOCUS_15450 1557016 1555895 gene locus_tag LOCUS_15460 1557016 1555895 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093786317.1 protein_id gnl|my_center|LOCUS_15460 1558545 1557016 gene locus_tag LOCUS_15470 1558545 1557016 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456532.1 protein_id gnl|my_center|LOCUS_15470 1558739 1559623 gene locus_tag LOCUS_15480 1558739 1559623 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977934.1 protein_id gnl|my_center|LOCUS_15480 1559741 1560826 gene locus_tag LOCUS_15490 1559741 1560826 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089310.1 protein_id gnl|my_center|LOCUS_15490 1561997 1563046 gene locus_tag LOCUS_15500 1561997 1563046 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027946.1 protein_id gnl|my_center|LOCUS_15500 1564065 1563172 gene locus_tag LOCUS_15510 1564065 1563172 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_15510 1565072 1564062 gene locus_tag LOCUS_15520 1565072 1564062 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729074.1 protein_id gnl|my_center|LOCUS_15520 1565461 1565141 gene locus_tag LOCUS_15530 1565461 1565141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1565570 1565977 gene locus_tag LOCUS_15540 1565570 1565977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1566114 1566317 gene locus_tag LOCUS_15550 1566114 1566317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1566648 1567802 gene locus_tag LOCUS_15560 1566648 1567802 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404360.1 protein_id gnl|my_center|LOCUS_15560 1568660 1569448 gene locus_tag LOCUS_15570 1568660 1569448 CDS product OBAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698597.1 protein_id gnl|my_center|LOCUS_15570 1570454 1569804 gene locus_tag LOCUS_15580 1570454 1569804 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878301.1 protein_id gnl|my_center|LOCUS_15580 1570580 1571506 gene locus_tag LOCUS_15590 1570580 1571506 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086737.1 protein_id gnl|my_center|LOCUS_15590 1571503 1572705 gene locus_tag LOCUS_15600 1571503 1572705 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480052.1 protein_id gnl|my_center|LOCUS_15600 1572702 1573484 gene locus_tag LOCUS_15610 1572702 1573484 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225418.1 protein_id gnl|my_center|LOCUS_15610 1573624 1575108 gene locus_tag LOCUS_15620 1573624 1575108 CDS product proline permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877529.1 protein_id gnl|my_center|LOCUS_15620 1575156 1575563 gene locus_tag LOCUS_15630 1575156 1575563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1575541 1577145 gene locus_tag LOCUS_15640 1575541 1577145 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082963.1 protein_id gnl|my_center|LOCUS_15640 1577817 1577380 gene locus_tag LOCUS_15650 1577817 1577380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1579012 1578218 gene locus_tag LOCUS_15660 1579012 1578218 CDS product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026965.1 protein_id gnl|my_center|LOCUS_15660 1579377 1579045 gene locus_tag LOCUS_15670 1579377 1579045 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978605.1 protein_id gnl|my_center|LOCUS_15670 1580449 1579424 gene locus_tag LOCUS_15680 1580449 1579424 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728056.1 protein_id gnl|my_center|LOCUS_15680 1581153 1580446 gene locus_tag LOCUS_15690 1581153 1580446 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026967.1 protein_id gnl|my_center|LOCUS_15690 1582160 1581153 gene locus_tag LOCUS_15700 1582160 1581153 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026966.1 protein_id gnl|my_center|LOCUS_15700 1583842 1582400 gene locus_tag LOCUS_15710 1583842 1582400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1584922 1585299 gene locus_tag LOCUS_15720 1584922 1585299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1585369 1585908 gene locus_tag LOCUS_15730 1585369 1585908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228866.1 protein_id gnl|my_center|LOCUS_15730 1585905 1587080 gene locus_tag LOCUS_15740 1585905 1587080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228865.1 protein_id gnl|my_center|LOCUS_15740 1587093 1588298 gene locus_tag LOCUS_15750 1587093 1588298 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222813.1 protein_id gnl|my_center|LOCUS_15750 1588875 1589141 gene locus_tag LOCUS_15760 1588875 1589141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 1589268 1589669 gene locus_tag LOCUS_15770 1589268 1589669 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487415.1 protein_id gnl|my_center|LOCUS_15770 1591243 1589753 gene locus_tag LOCUS_15780 1591243 1589753 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727675.1 protein_id gnl|my_center|LOCUS_15780 1592462 1591506 gene locus_tag LOCUS_15790 1592462 1591506 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_15790 1594703 1592793 gene locus_tag LOCUS_15800 gene htpG 1594703 1592793 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467081.1 protein_id gnl|my_center|LOCUS_15800 1596506 1595361 gene locus_tag LOCUS_15810 1596506 1595361 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029664.1 protein_id gnl|my_center|LOCUS_15810 1596910 1596503 gene locus_tag LOCUS_15820 1596910 1596503 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974528.1 protein_id gnl|my_center|LOCUS_15820 1597644 1597198 gene locus_tag LOCUS_15830 1597644 1597198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1597883 1598515 gene locus_tag LOCUS_15840 1597883 1598515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1600459 1598654 gene locus_tag LOCUS_15850 1600459 1598654 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896427.1 protein_id gnl|my_center|LOCUS_15850 1601949 1600657 gene locus_tag LOCUS_15860 1601949 1600657 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222293.1 protein_id gnl|my_center|LOCUS_15860 1602151 1602360 gene locus_tag LOCUS_15870 1602151 1602360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 1602410 1603741 gene locus_tag LOCUS_15880 gene mgtE 1602410 1603741 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803803.1 protein_id gnl|my_center|LOCUS_15880 1603927 1604706 gene locus_tag LOCUS_15890 1603927 1604706 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975613.1 protein_id gnl|my_center|LOCUS_15890 1604843 1605688 gene locus_tag LOCUS_15900 gene catA 1604843 1605688 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728003.1 protein_id gnl|my_center|LOCUS_15900 1606048 1606683 gene locus_tag LOCUS_15910 1606048 1606683 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225120.1 protein_id gnl|my_center|LOCUS_15910 1606968 1608605 gene locus_tag LOCUS_15920 1606968 1608605 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104497.1 protein_id gnl|my_center|LOCUS_15920 1610249 1608816 gene locus_tag LOCUS_15930 1610249 1608816 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222691.1 protein_id gnl|my_center|LOCUS_15930 1611803 1610379 gene locus_tag LOCUS_15940 1611803 1610379 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_15940 1612747 1611803 gene locus_tag LOCUS_15950 gene speB 1612747 1611803 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 protein_id gnl|my_center|LOCUS_15950 1614051 1612744 gene locus_tag LOCUS_15960 1614051 1612744 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899946.1 protein_id gnl|my_center|LOCUS_15960 1615550 1614087 gene locus_tag LOCUS_15970 1615550 1614087 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030292.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence02 554 1060 gene locus_tag LOCUS_15980 554 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1057 1842 gene locus_tag LOCUS_15990 1057 1842 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495647.1 protein_id gnl|my_center|LOCUS_15990 1839 2879 gene locus_tag LOCUS_16000 1839 2879 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729306.1 protein_id gnl|my_center|LOCUS_16000 2963 3208 gene locus_tag LOCUS_16010 2963 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 3213 4097 gene locus_tag LOCUS_16020 3213 4097 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227822.1 protein_id gnl|my_center|LOCUS_16020 4094 4984 gene locus_tag LOCUS_16030 4094 4984 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227821.1 protein_id gnl|my_center|LOCUS_16030 5100 6836 gene locus_tag LOCUS_16040 gene recN 5100 6836 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467394.1 protein_id gnl|my_center|LOCUS_16040 6991 8187 gene locus_tag LOCUS_16050 gene steA 6991 8187 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286379.1 protein_id gnl|my_center|LOCUS_16050 8184 9116 gene locus_tag LOCUS_16060 8184 9116 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227815.1 protein_id gnl|my_center|LOCUS_16060 9070 9258 gene locus_tag LOCUS_16070 9070 9258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 9346 11058 gene locus_tag LOCUS_16080 9346 11058 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063606961.1 protein_id gnl|my_center|LOCUS_16080 11122 11754 gene locus_tag LOCUS_16090 11122 11754 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227807.1 protein_id gnl|my_center|LOCUS_16090 12306 11767 gene locus_tag LOCUS_16100 12306 11767 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227806.1 protein_id gnl|my_center|LOCUS_16100 12464 13366 gene locus_tag LOCUS_16110 gene xerD 12464 13366 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286377.1 protein_id gnl|my_center|LOCUS_16110 13554 14501 gene locus_tag LOCUS_16120 13554 14501 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_16120 14586 15449 gene locus_tag LOCUS_16130 14586 15449 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227802.1 protein_id gnl|my_center|LOCUS_16130 15446 16102 gene locus_tag LOCUS_16140 gene scpB 15446 16102 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227801.1 protein_id gnl|my_center|LOCUS_16140 16095 16877 gene locus_tag LOCUS_16150 16095 16877 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227800.1 protein_id gnl|my_center|LOCUS_16150 17374 16919 gene locus_tag LOCUS_16160 17374 16919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16160 17613 17314 gene locus_tag LOCUS_16170 17613 17314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16170 18306 17824 gene locus_tag LOCUS_16180 18306 17824 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467392.1 protein_id gnl|my_center|LOCUS_16180 18468 19193 gene locus_tag LOCUS_16190 gene cmk 18468 19193 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227793.1 protein_id gnl|my_center|LOCUS_16190 19190 19918 gene locus_tag LOCUS_16200 19190 19918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 19915 21369 gene locus_tag LOCUS_16210 gene der 19915 21369 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467391.1 protein_id gnl|my_center|LOCUS_16210 21458 22291 gene locus_tag LOCUS_16220 21458 22291 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136617434.1 protein_id gnl|my_center|LOCUS_16220 24431 22338 gene locus_tag LOCUS_16230 24431 22338 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 protein_id gnl|my_center|LOCUS_16230 24611 26824 gene locus_tag LOCUS_16240 24611 26824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 26903 27574 gene locus_tag LOCUS_16250 26903 27574 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028005.1 protein_id gnl|my_center|LOCUS_16250 27618 27962 gene locus_tag LOCUS_16260 27618 27962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 29305 27971 gene locus_tag LOCUS_16270 29305 27971 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051831.1 protein_id gnl|my_center|LOCUS_16270 29826 29506 gene locus_tag LOCUS_16280 29826 29506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 30355 29870 gene locus_tag LOCUS_16290 30355 29870 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224543.1 protein_id gnl|my_center|LOCUS_16290 30919 33273 gene locus_tag LOCUS_16300 gene atsD 30919 33273 CDS product arylsulfatase AtsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403397.1 protein_id gnl|my_center|LOCUS_16300 33368 34201 gene locus_tag LOCUS_16310 33368 34201 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804229.1 protein_id gnl|my_center|LOCUS_16310 34218 35126 gene locus_tag LOCUS_16320 34218 35126 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729360.1 protein_id gnl|my_center|LOCUS_16320 36015 37598 gene locus_tag LOCUS_16330 36015 37598 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399701.1 protein_id gnl|my_center|LOCUS_16330 38049 37810 gene locus_tag LOCUS_16340 38049 37810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 38103 38597 gene locus_tag LOCUS_16350 38103 38597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 38772 39458 gene locus_tag LOCUS_16360 38772 39458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 40024 39518 gene locus_tag LOCUS_16370 40024 39518 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229486.1 protein_id gnl|my_center|LOCUS_16370 40112 40774 gene locus_tag LOCUS_16380 40112 40774 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230026.1 protein_id gnl|my_center|LOCUS_16380 41121 40786 gene locus_tag LOCUS_16390 41121 40786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 42004 41162 gene locus_tag LOCUS_16400 42004 41162 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972431.1 protein_id gnl|my_center|LOCUS_16400 42738 42115 gene locus_tag LOCUS_16410 42738 42115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 43235 42963 gene locus_tag LOCUS_16420 43235 42963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16420 45106 43766 gene locus_tag LOCUS_16430 45106 43766 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083711.1 protein_id gnl|my_center|LOCUS_16430 46467 45148 gene locus_tag LOCUS_16440 gene hisD 46467 45148 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728086.1 protein_id gnl|my_center|LOCUS_16440 46575 47594 gene locus_tag LOCUS_16450 46575 47594 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728085.1 protein_id gnl|my_center|LOCUS_16450 47934 48266 gene locus_tag LOCUS_16460 47934 48266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 48551 49435 gene locus_tag LOCUS_16470 gene purU 48551 49435 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893574.1 protein_id gnl|my_center|LOCUS_16470 49984 49595 gene locus_tag LOCUS_16480 49984 49595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 51666 50266 gene locus_tag LOCUS_16490 51666 50266 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728675.1 protein_id gnl|my_center|LOCUS_16490 53008 51800 gene locus_tag LOCUS_16500 53008 51800 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920653.1 protein_id gnl|my_center|LOCUS_16500 54088 53063 gene locus_tag LOCUS_16510 54088 53063 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776787.1 protein_id gnl|my_center|LOCUS_16510 55488 54088 gene locus_tag LOCUS_16520 55488 54088 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142192546.1 protein_id gnl|my_center|LOCUS_16520 55558 56286 gene locus_tag LOCUS_16530 55558 56286 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728678.1 protein_id gnl|my_center|LOCUS_16530 57073 56840 gene locus_tag LOCUS_16540 57073 56840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 57333 58514 gene locus_tag LOCUS_16550 57333 58514 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013443.1 protein_id gnl|my_center|LOCUS_16550 58549 59547 gene locus_tag LOCUS_16560 58549 59547 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013444.1 protein_id gnl|my_center|LOCUS_16560 59623 60480 gene locus_tag LOCUS_16570 59623 60480 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399734.1 protein_id gnl|my_center|LOCUS_16570 60572 61963 gene locus_tag LOCUS_16580 60572 61963 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013450.1 protein_id gnl|my_center|LOCUS_16580 61994 62992 gene locus_tag LOCUS_16590 61994 62992 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742135.1 protein_id gnl|my_center|LOCUS_16590 64786 63557 gene locus_tag LOCUS_16600 64786 63557 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977776.1 protein_id gnl|my_center|LOCUS_16600 66287 64860 gene locus_tag LOCUS_16610 gene mmsA 66287 64860 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 protein_id gnl|my_center|LOCUS_16610 68276 66414 gene locus_tag LOCUS_16620 gene iolD 68276 66414 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_16620 69169 68273 gene locus_tag LOCUS_16630 gene iolB 69169 68273 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031348.1 protein_id gnl|my_center|LOCUS_16630 70091 69210 gene locus_tag LOCUS_16640 70091 69210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031349.1 protein_id gnl|my_center|LOCUS_16640 71083 70121 gene locus_tag LOCUS_16650 gene iolC 71083 70121 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972167.1 protein_id gnl|my_center|LOCUS_16650 71389 72072 gene locus_tag LOCUS_16660 71389 72072 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224911.1 protein_id gnl|my_center|LOCUS_16660 72409 73332 gene locus_tag LOCUS_16670 72409 73332 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031353.1 protein_id gnl|my_center|LOCUS_16670 73381 74403 gene locus_tag LOCUS_16680 73381 74403 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031545.1 protein_id gnl|my_center|LOCUS_16680 75211 75531 gene locus_tag LOCUS_16690 75211 75531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 77475 76198 gene locus_tag LOCUS_16700 77475 76198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 79259 78447 gene locus_tag LOCUS_16710 79259 78447 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222335.1 protein_id gnl|my_center|LOCUS_16710 80313 80981 gene locus_tag LOCUS_16720 80313 80981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 80975 81406 gene locus_tag LOCUS_16730 80975 81406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 81410 81802 gene locus_tag LOCUS_16740 81410 81802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 81918 82226 gene locus_tag LOCUS_16750 81918 82226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 82338 82742 gene locus_tag LOCUS_16760 82338 82742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 82879 83079 gene locus_tag LOCUS_16770 82879 83079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 83401 83709 gene locus_tag LOCUS_16780 83401 83709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 84558 85136 gene locus_tag LOCUS_16790 84558 85136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 85133 85996 gene locus_tag LOCUS_16800 85133 85996 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228190.1 protein_id gnl|my_center|LOCUS_16800 86078 87349 gene locus_tag LOCUS_16810 86078 87349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 89488 88166 gene locus_tag LOCUS_16820 89488 88166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 91599 89512 gene locus_tag LOCUS_16830 91599 89512 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225322.1 protein_id gnl|my_center|LOCUS_16830 92629 91613 gene locus_tag LOCUS_16840 92629 91613 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080232.1 protein_id gnl|my_center|LOCUS_16840 94307 92730 gene locus_tag LOCUS_16850 94307 92730 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080231.1 protein_id gnl|my_center|LOCUS_16850 94774 94989 gene locus_tag LOCUS_16860 94774 94989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 95169 95095 gene locus_tag LOCUS_t00160 95169 95095 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 95892 95263 gene locus_tag LOCUS_16870 95892 95263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 96011 96394 gene locus_tag LOCUS_16880 96011 96394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 97769 96396 gene locus_tag LOCUS_16890 97769 96396 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728155.1 protein_id gnl|my_center|LOCUS_16890 97908 98750 gene locus_tag LOCUS_16900 97908 98750 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972568.1 protein_id gnl|my_center|LOCUS_16900 98780 100111 gene locus_tag LOCUS_16910 98780 100111 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_16910 100108 101514 gene locus_tag LOCUS_16920 gene hydA 100108 101514 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_16920 101531 102529 gene locus_tag LOCUS_16930 101531 102529 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030901.1 protein_id gnl|my_center|LOCUS_16930 102805 102981 gene locus_tag LOCUS_16940 102805 102981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 103433 104119 gene locus_tag LOCUS_16950 103433 104119 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921582.1 protein_id gnl|my_center|LOCUS_16950 104168 104803 gene locus_tag LOCUS_16960 104168 104803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16960 104719 104940 gene locus_tag LOCUS_16970 104719 104940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16970 104947 105462 gene locus_tag LOCUS_16980 104947 105462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16980 105557 106480 gene locus_tag LOCUS_16990 105557 106480 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046421936.1 protein_id gnl|my_center|LOCUS_16990 106820 106410 gene locus_tag LOCUS_17000 106820 106410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 107139 108104 gene locus_tag LOCUS_17010 107139 108104 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230270.1 protein_id gnl|my_center|LOCUS_17010 108101 108913 gene locus_tag LOCUS_17020 108101 108913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 109820 111649 gene locus_tag LOCUS_17030 109820 111649 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222472.1 protein_id gnl|my_center|LOCUS_17030 111646 112707 gene locus_tag LOCUS_17040 111646 112707 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222471.1 protein_id gnl|my_center|LOCUS_17040 112874 113629 gene locus_tag LOCUS_17050 112874 113629 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976090.1 protein_id gnl|my_center|LOCUS_17050 113720 115081 gene locus_tag LOCUS_17060 113720 115081 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973927.1 protein_id gnl|my_center|LOCUS_17060 115095 116432 gene locus_tag LOCUS_17070 115095 116432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028535.1 protein_id gnl|my_center|LOCUS_17070 116429 117661 gene locus_tag LOCUS_17080 116429 117661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 117658 119079 gene locus_tag LOCUS_17090 117658 119079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 119076 120230 gene locus_tag LOCUS_17100 119076 120230 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028531.1 protein_id gnl|my_center|LOCUS_17100 120227 121216 gene locus_tag LOCUS_17110 120227 121216 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_17110 121223 122368 gene locus_tag LOCUS_17120 121223 122368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 122402 123742 gene locus_tag LOCUS_17130 122402 123742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 123785 124504 gene locus_tag LOCUS_17140 123785 124504 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326434.1 protein_id gnl|my_center|LOCUS_17140 124501 125658 gene locus_tag LOCUS_17150 124501 125658 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_17150 125835 126494 gene locus_tag LOCUS_17160 125835 126494 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231017.1 protein_id gnl|my_center|LOCUS_17160 128181 126634 gene locus_tag LOCUS_17170 128181 126634 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_17170 129102 128266 gene locus_tag LOCUS_17180 129102 128266 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230706.1 protein_id gnl|my_center|LOCUS_17180 130152 129142 gene locus_tag LOCUS_17190 130152 129142 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804906.1 protein_id gnl|my_center|LOCUS_17190 130127 130306 gene locus_tag LOCUS_17200 130127 130306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 132199 130343 gene locus_tag LOCUS_17210 132199 130343 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223544.1 protein_id gnl|my_center|LOCUS_17210 133632 135341 gene locus_tag LOCUS_17220 133632 135341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 135407 136609 gene locus_tag LOCUS_17230 gene metK 135407 136609 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284357.1 protein_id gnl|my_center|LOCUS_17230 136757 137731 gene locus_tag LOCUS_17240 136757 137731 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_17240 137753 141355 gene locus_tag LOCUS_17250 gene metH 137753 141355 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226749.1 protein_id gnl|my_center|LOCUS_17250 141417 142877 gene locus_tag LOCUS_17260 gene ahcY 141417 142877 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227086.1 protein_id gnl|my_center|LOCUS_17260 143157 144059 gene locus_tag LOCUS_17270 143157 144059 CDS product mycobacterial-type methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411241.1 protein_id gnl|my_center|LOCUS_17270 144297 145700 gene locus_tag LOCUS_17280 144297 145700 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467865.1 protein_id gnl|my_center|LOCUS_17280 147890 145719 gene locus_tag LOCUS_17290 147890 145719 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728359.1 protein_id gnl|my_center|LOCUS_17290 148828 147887 gene locus_tag LOCUS_17300 148828 147887 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027744.1 protein_id gnl|my_center|LOCUS_17300 150430 148874 gene locus_tag LOCUS_17310 150430 148874 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384516.1 protein_id gnl|my_center|LOCUS_17310 150662 151474 gene locus_tag LOCUS_17320 150662 151474 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015684.1 protein_id gnl|my_center|LOCUS_17320 152565 151540 gene locus_tag LOCUS_17330 152565 151540 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787047.1 protein_id gnl|my_center|LOCUS_17330 153490 152633 gene locus_tag LOCUS_17340 153490 152633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229834.1 protein_id gnl|my_center|LOCUS_17340 154000 155193 gene locus_tag LOCUS_17350 154000 155193 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226796.1 protein_id gnl|my_center|LOCUS_17350 155427 155630 gene locus_tag LOCUS_17360 155427 155630 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_17360 155796 156737 gene locus_tag LOCUS_17370 155796 156737 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689435.1 protein_id gnl|my_center|LOCUS_17370 156952 156776 gene locus_tag LOCUS_17380 156952 156776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 157828 157031 gene locus_tag LOCUS_17390 157828 157031 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225677.1 protein_id gnl|my_center|LOCUS_17390 158369 157929 gene locus_tag LOCUS_17400 158369 157929 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030803.1 protein_id gnl|my_center|LOCUS_17400 159328 158366 gene locus_tag LOCUS_17410 159328 158366 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030804.1 protein_id gnl|my_center|LOCUS_17410 160217 159330 gene locus_tag LOCUS_17420 160217 159330 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030805.1 protein_id gnl|my_center|LOCUS_17420 161174 160302 gene locus_tag LOCUS_17430 161174 160302 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030806.1 protein_id gnl|my_center|LOCUS_17430 161588 163144 gene locus_tag LOCUS_17440 161588 163144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 163223 164644 gene locus_tag LOCUS_17450 163223 164644 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224038.1 protein_id gnl|my_center|LOCUS_17450 166259 164799 gene locus_tag LOCUS_17460 166259 164799 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742166.1 protein_id gnl|my_center|LOCUS_17460 168459 166342 gene locus_tag LOCUS_17470 168459 166342 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111053.1 protein_id gnl|my_center|LOCUS_17470 169036 168548 gene locus_tag LOCUS_17480 169036 168548 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228095.1 protein_id gnl|my_center|LOCUS_17480 169241 170686 gene locus_tag LOCUS_17490 169241 170686 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222661.1 protein_id gnl|my_center|LOCUS_17490 170937 171680 gene locus_tag LOCUS_17500 170937 171680 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244476.1 protein_id gnl|my_center|LOCUS_17500 171753 172994 gene locus_tag LOCUS_17510 gene dhbC 171753 172994 CDS product isochorismate synthase DhbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243699.1 protein_id gnl|my_center|LOCUS_17510 173072 174715 gene locus_tag LOCUS_17520 173072 174715 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243083.1 protein_id gnl|my_center|LOCUS_17520 174743 175399 gene locus_tag LOCUS_17530 174743 175399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17530 175429 175665 gene locus_tag LOCUS_17540 175429 175665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17540 177343 175760 gene locus_tag LOCUS_17550 177343 175760 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028586.1 protein_id gnl|my_center|LOCUS_17550 177300 177623 gene locus_tag LOCUS_17560 177300 177623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 177786 177998 gene locus_tag LOCUS_17570 177786 177998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 178142 178816 gene locus_tag LOCUS_17580 178142 178816 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226820.1 protein_id gnl|my_center|LOCUS_17580 178918 179301 gene locus_tag LOCUS_17590 gene gcvH 178918 179301 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_17590 179420 179884 gene locus_tag LOCUS_17600 179420 179884 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559567.1 protein_id gnl|my_center|LOCUS_17600 180206 180682 gene locus_tag LOCUS_17610 180206 180682 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_17610 180914 181468 gene locus_tag LOCUS_17620 180914 181468 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226814.1 protein_id gnl|my_center|LOCUS_17620 181784 184690 gene locus_tag LOCUS_17630 gene gcvP 181784 184690 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226813.1 protein_id gnl|my_center|LOCUS_17630 184765 185043 gene locus_tag LOCUS_17640 184765 185043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 185919 185092 gene locus_tag LOCUS_17650 185919 185092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_17650 186410 186030 gene locus_tag LOCUS_17660 186410 186030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 186624 186430 gene locus_tag LOCUS_17670 186624 186430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 188187 187147 gene locus_tag LOCUS_17680 188187 187147 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226804.1 protein_id gnl|my_center|LOCUS_17680 189548 188184 gene locus_tag LOCUS_17690 189548 188184 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226803.1 protein_id gnl|my_center|LOCUS_17690 190322 189759 gene locus_tag LOCUS_17700 190322 189759 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831756.1 protein_id gnl|my_center|LOCUS_17700 190555 192036 gene locus_tag LOCUS_17710 190555 192036 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246610.1 protein_id gnl|my_center|LOCUS_17710 194895 192784 gene locus_tag LOCUS_17720 194895 192784 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031870.1 protein_id gnl|my_center|LOCUS_17720 195639 195052 gene locus_tag LOCUS_17730 195639 195052 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226802.1 protein_id gnl|my_center|LOCUS_17730 195763 197049 gene locus_tag LOCUS_17740 gene egtA 195763 197049 CDS product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226794.1 protein_id gnl|my_center|LOCUS_17740 197062 198426 gene locus_tag LOCUS_17750 gene egtB 197062 198426 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226793.1 protein_id gnl|my_center|LOCUS_17750 198438 199196 gene locus_tag LOCUS_17760 gene egtC 198438 199196 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226792.1 protein_id gnl|my_center|LOCUS_17760 199193 200161 gene locus_tag LOCUS_17770 gene egtD 199193 200161 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226791.1 protein_id gnl|my_center|LOCUS_17770 200243 200698 gene locus_tag LOCUS_17780 200243 200698 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467644.1 protein_id gnl|my_center|LOCUS_17780 201589 200768 gene locus_tag LOCUS_17790 201589 200768 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061558.1 protein_id gnl|my_center|LOCUS_17790 201797 202537 gene locus_tag LOCUS_17800 201797 202537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 202675 203436 gene locus_tag LOCUS_17810 202675 203436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 204621 203437 gene locus_tag LOCUS_17820 204621 203437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 204696 204908 gene locus_tag LOCUS_17830 204696 204908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 204936 205616 gene locus_tag LOCUS_17840 204936 205616 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227425.1 protein_id gnl|my_center|LOCUS_17840 205853 205611 gene locus_tag LOCUS_17850 205853 205611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 206071 205850 gene locus_tag LOCUS_17860 206071 205850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 209087 206271 gene locus_tag LOCUS_17870 209087 206271 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226785.1 protein_id gnl|my_center|LOCUS_17870 210161 209355 gene locus_tag LOCUS_17880 210161 209355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 210638 211504 gene locus_tag LOCUS_17890 210638 211504 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_17890 211501 211716 gene locus_tag LOCUS_17900 211501 211716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 211809 212729 gene locus_tag LOCUS_17910 211809 212729 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030936.1 protein_id gnl|my_center|LOCUS_17910 213915 212779 gene locus_tag LOCUS_17920 213915 212779 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975127.1 protein_id gnl|my_center|LOCUS_17920 214586 214044 gene locus_tag LOCUS_17930 214586 214044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 216475 214592 gene locus_tag LOCUS_17940 216475 214592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 217249 216950 gene locus_tag LOCUS_17950 217249 216950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17950 217563 217246 gene locus_tag LOCUS_17960 217563 217246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17960 217538 217960 gene locus_tag LOCUS_17970 217538 217960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 218664 217975 gene locus_tag LOCUS_17980 218664 217975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17980 220349 218772 gene locus_tag LOCUS_17990 gene tet(35) 220349 218772 CDS product tetracycline efflux Na+/H+ antiporter family transporter Tet(35) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480402.1 protein_id gnl|my_center|LOCUS_17990 221519 220566 gene locus_tag LOCUS_18000 221519 220566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 221671 224856 gene locus_tag LOCUS_18010 gene cypB 221671 224856 CDS product bifunctional cytochrome P450/NADPH--P450 reductase CypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246174.1 protein_id gnl|my_center|LOCUS_18010 224996 226942 gene locus_tag LOCUS_18020 224996 226942 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030396.1 protein_id gnl|my_center|LOCUS_18020 228569 226989 gene locus_tag LOCUS_18030 228569 226989 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026894.1 protein_id gnl|my_center|LOCUS_18030 228749 229747 gene locus_tag LOCUS_18040 228749 229747 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_18040 230221 229775 gene locus_tag LOCUS_18050 230221 229775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 230551 231201 gene locus_tag LOCUS_18060 230551 231201 CDS product UdgX family uracil-DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974454.1 protein_id gnl|my_center|LOCUS_18060 231346 231209 gene locus_tag LOCUS_18070 231346 231209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 231529 232467 gene locus_tag LOCUS_18080 231529 232467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022977.1 protein_id gnl|my_center|LOCUS_18080 234071 232533 gene locus_tag LOCUS_18090 234071 232533 CDS product selenium-binding protein SBP56-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728146.1 protein_id gnl|my_center|LOCUS_18090 234043 234585 gene locus_tag LOCUS_18100 234043 234585 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777029.1 protein_id gnl|my_center|LOCUS_18100 234639 235835 gene locus_tag LOCUS_18110 gene lhgO 234639 235835 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198032110.1 protein_id gnl|my_center|LOCUS_18110 235926 236210 gene locus_tag LOCUS_18120 235926 236210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 237146 236235 gene locus_tag LOCUS_18130 gene ligD 237146 236235 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863172.1 protein_id gnl|my_center|LOCUS_18130 238144 237143 gene locus_tag LOCUS_18140 gene ligD 238144 237143 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227028.1 protein_id gnl|my_center|LOCUS_18140 238731 238141 gene locus_tag LOCUS_18150 238731 238141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 239846 238818 gene locus_tag LOCUS_18160 239846 238818 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227670.1 protein_id gnl|my_center|LOCUS_18160 240508 240077 gene locus_tag LOCUS_18170 240508 240077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 240717 241469 gene locus_tag LOCUS_18180 240717 241469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 241602 243398 gene locus_tag LOCUS_18190 241602 243398 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225166.1 protein_id gnl|my_center|LOCUS_18190 243491 246406 gene locus_tag LOCUS_18200 243491 246406 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228347.1 protein_id gnl|my_center|LOCUS_18200 246481 246936 gene locus_tag LOCUS_18210 246481 246936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 246921 247154 gene locus_tag LOCUS_18220 246921 247154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 247472 247179 gene locus_tag LOCUS_18230 247472 247179 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974205.1 protein_id gnl|my_center|LOCUS_18230 248771 247836 gene locus_tag LOCUS_18240 248771 247836 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729296.1 protein_id gnl|my_center|LOCUS_18240 249362 248904 gene locus_tag LOCUS_18250 249362 248904 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406624.1 protein_id gnl|my_center|LOCUS_18250 251555 249471 gene locus_tag LOCUS_18260 251555 249471 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727118.1 protein_id gnl|my_center|LOCUS_18260 252544 251552 gene locus_tag LOCUS_18270 252544 251552 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727119.1 protein_id gnl|my_center|LOCUS_18270 253044 252541 gene locus_tag LOCUS_18280 253044 252541 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727120.1 protein_id gnl|my_center|LOCUS_18280 253233 253673 gene locus_tag LOCUS_18290 253233 253673 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079498.1 protein_id gnl|my_center|LOCUS_18290 254561 253866 gene locus_tag LOCUS_18300 254561 253866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18300 255113 254706 gene locus_tag LOCUS_18310 255113 254706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18310 255383 256204 gene locus_tag LOCUS_18320 255383 256204 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223750.1 protein_id gnl|my_center|LOCUS_18320 256201 257007 gene locus_tag LOCUS_18330 256201 257007 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_18330 257004 258185 gene locus_tag LOCUS_18340 257004 258185 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223752.1 protein_id gnl|my_center|LOCUS_18340 258208 258954 gene locus_tag LOCUS_18350 gene pcaH 258208 258954 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223753.1 protein_id gnl|my_center|LOCUS_18350 259044 259520 gene locus_tag LOCUS_18360 gene pcaG 259044 259520 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223754.1 protein_id gnl|my_center|LOCUS_18360 259552 260874 gene locus_tag LOCUS_18370 259552 260874 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088413.1 protein_id gnl|my_center|LOCUS_18370 260871 261635 gene locus_tag LOCUS_18380 gene pcaD 260871 261635 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223755.1 protein_id gnl|my_center|LOCUS_18380 261635 262036 gene locus_tag LOCUS_18390 261635 262036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18390 262054 262875 gene locus_tag LOCUS_18400 262054 262875 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_18400 263302 263730 gene locus_tag LOCUS_18410 263302 263730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18410 264445 264783 gene locus_tag LOCUS_18420 264445 264783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 264856 265134 gene locus_tag LOCUS_18430 264856 265134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 265592 265122 gene locus_tag LOCUS_18440 265592 265122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 265870 265592 gene locus_tag LOCUS_18450 265870 265592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 266941 266048 gene locus_tag LOCUS_18460 266941 266048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 267798 266962 gene locus_tag LOCUS_18470 267798 266962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 268772 267909 gene locus_tag LOCUS_18480 268772 267909 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530264.1 protein_id gnl|my_center|LOCUS_18480 268929 269312 gene locus_tag LOCUS_18490 268929 269312 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529398.1 protein_id gnl|my_center|LOCUS_18490 270480 269356 gene locus_tag LOCUS_18500 270480 269356 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535007.1 protein_id gnl|my_center|LOCUS_18500 271283 270498 gene locus_tag LOCUS_18510 271283 270498 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_18510 271546 271340 gene locus_tag LOCUS_18520 271546 271340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 272503 272033 gene locus_tag LOCUS_18530 272503 272033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 273195 272722 gene locus_tag LOCUS_18540 273195 272722 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023518.1 protein_id gnl|my_center|LOCUS_18540 273535 273188 gene locus_tag LOCUS_18550 273535 273188 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969808.1 protein_id gnl|my_center|LOCUS_18550 273664 274659 gene locus_tag LOCUS_18560 273664 274659 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878179.1 protein_id gnl|my_center|LOCUS_18560 274656 275396 gene locus_tag LOCUS_18570 274656 275396 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228377.1 protein_id gnl|my_center|LOCUS_18570 275419 276627 gene locus_tag LOCUS_18580 275419 276627 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228376.1 protein_id gnl|my_center|LOCUS_18580 276624 277229 gene locus_tag LOCUS_18590 276624 277229 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228375.1 protein_id gnl|my_center|LOCUS_18590 277876 277274 gene locus_tag LOCUS_18600 277876 277274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 278607 277903 gene locus_tag LOCUS_18610 278607 277903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886572.1 protein_id gnl|my_center|LOCUS_18610 278766 279377 gene locus_tag LOCUS_18620 278766 279377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 281435 279498 gene locus_tag LOCUS_18630 281435 279498 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_18630 281952 281503 gene locus_tag LOCUS_18640 281952 281503 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423338.1 protein_id gnl|my_center|LOCUS_18640 282144 282779 gene locus_tag LOCUS_18650 282144 282779 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967676.1 protein_id gnl|my_center|LOCUS_18650 282915 283499 gene locus_tag LOCUS_18660 282915 283499 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237176.1 protein_id gnl|my_center|LOCUS_18660 283496 284950 gene locus_tag LOCUS_18670 283496 284950 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098487.1 protein_id gnl|my_center|LOCUS_18670 284978 285205 gene locus_tag LOCUS_18680 284978 285205 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098486.1 protein_id gnl|my_center|LOCUS_18680 285238 285519 gene locus_tag LOCUS_18690 285238 285519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 288182 285801 gene locus_tag LOCUS_18700 288182 285801 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223450.1 protein_id gnl|my_center|LOCUS_18700 288283 288681 gene locus_tag LOCUS_18710 288283 288681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18710 288694 289326 gene locus_tag LOCUS_18720 288694 289326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18720 291061 289319 gene locus_tag LOCUS_18730 291061 289319 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030966.1 protein_id gnl|my_center|LOCUS_18730 291333 293114 gene locus_tag LOCUS_18740 291333 293114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 293063 294484 gene locus_tag LOCUS_18750 gene hpnE 293063 294484 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_18750 294481 295491 gene locus_tag LOCUS_18760 294481 295491 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223417.1 protein_id gnl|my_center|LOCUS_18760 295488 297440 gene locus_tag LOCUS_18770 gene shc 295488 297440 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_18770 297447 298070 gene locus_tag LOCUS_18780 297447 298070 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972232.1 protein_id gnl|my_center|LOCUS_18780 298070 299071 gene locus_tag LOCUS_18790 gene hpnH 298070 299071 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972231.1 protein_id gnl|my_center|LOCUS_18790 299416 299688 gene locus_tag LOCUS_18800 299416 299688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 299695 299973 gene locus_tag LOCUS_18810 299695 299973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 300632 299958 gene locus_tag LOCUS_18820 300632 299958 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888709.1 protein_id gnl|my_center|LOCUS_18820 300868 303558 gene locus_tag LOCUS_18830 300868 303558 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977982.1 protein_id gnl|my_center|LOCUS_18830 304293 303559 gene locus_tag LOCUS_18840 304293 303559 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 protein_id gnl|my_center|LOCUS_18840 305210 304284 gene locus_tag LOCUS_18850 305210 304284 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731346.1 protein_id gnl|my_center|LOCUS_18850 307648 305207 gene locus_tag LOCUS_18860 307648 305207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 308166 307750 gene locus_tag LOCUS_18870 308166 307750 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896518.1 protein_id gnl|my_center|LOCUS_18870 308286 309068 gene locus_tag LOCUS_18880 308286 309068 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969785.1 protein_id gnl|my_center|LOCUS_18880 309517 309119 gene locus_tag LOCUS_18890 309517 309119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 310258 309599 gene locus_tag LOCUS_18900 310258 309599 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_18900 310437 312104 gene locus_tag LOCUS_18910 310437 312104 CDS product ubiquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184859936.1 protein_id gnl|my_center|LOCUS_18910 312304 312732 gene locus_tag LOCUS_18920 312304 312732 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401141.1 protein_id gnl|my_center|LOCUS_18920 313248 312805 gene locus_tag LOCUS_18930 313248 312805 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026899.1 protein_id gnl|my_center|LOCUS_18930 313686 314264 gene locus_tag LOCUS_18940 313686 314264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18940 315223 314387 gene locus_tag LOCUS_18950 315223 314387 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530904.1 protein_id gnl|my_center|LOCUS_18950 315458 315769 gene locus_tag LOCUS_18960 315458 315769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 315866 316891 gene locus_tag LOCUS_18970 315866 316891 CDS product DUF5914 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026912.1 protein_id gnl|my_center|LOCUS_18970 318514 316958 gene locus_tag LOCUS_18980 318514 316958 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877361.1 protein_id gnl|my_center|LOCUS_18980 319263 318511 gene locus_tag LOCUS_18990 319263 318511 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225920.1 protein_id gnl|my_center|LOCUS_18990 319793 319275 gene locus_tag LOCUS_19000 gene idi 319793 319275 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804097.1 protein_id gnl|my_center|LOCUS_19000 320806 319817 gene locus_tag LOCUS_19010 320806 319817 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225923.1 protein_id gnl|my_center|LOCUS_19010 322335 320803 gene locus_tag LOCUS_19020 gene crtI 322335 320803 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026910.1 protein_id gnl|my_center|LOCUS_19020 322727 323389 gene locus_tag LOCUS_19030 322727 323389 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230052.1 protein_id gnl|my_center|LOCUS_19030 323386 324066 gene locus_tag LOCUS_19040 323386 324066 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230053.1 protein_id gnl|my_center|LOCUS_19040 324063 324719 gene locus_tag LOCUS_19050 324063 324719 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230054.1 protein_id gnl|my_center|LOCUS_19050 325791 324748 gene locus_tag LOCUS_19060 325791 324748 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029199.1 protein_id gnl|my_center|LOCUS_19060 327237 325843 gene locus_tag LOCUS_19070 327237 325843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 327839 327234 gene locus_tag LOCUS_19080 327839 327234 CDS product IS607 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146551.1 protein_id gnl|my_center|LOCUS_19080 329620 328067 gene locus_tag LOCUS_19090 329620 328067 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742208.1 protein_id gnl|my_center|LOCUS_19090 329900 329703 gene locus_tag LOCUS_19100 329900 329703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 330019 330264 gene locus_tag LOCUS_19110 330019 330264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 331518 330508 gene locus_tag LOCUS_19120 331518 330508 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222870.1 protein_id gnl|my_center|LOCUS_19120 331620 331820 gene locus_tag LOCUS_19130 331620 331820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 334482 331969 gene locus_tag LOCUS_19140 334482 331969 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030897.1 protein_id gnl|my_center|LOCUS_19140 335561 334602 gene locus_tag LOCUS_19150 335561 334602 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027236.1 protein_id gnl|my_center|LOCUS_19150 337414 335651 gene locus_tag LOCUS_19160 gene selB 337414 335651 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226942.1 protein_id gnl|my_center|LOCUS_19160 338715 337414 gene locus_tag LOCUS_19170 gene selA 338715 337414 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727953.1 protein_id gnl|my_center|LOCUS_19170 339704 338727 gene locus_tag LOCUS_19180 339704 338727 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668747.1 protein_id gnl|my_center|LOCUS_19180 341286 339856 gene locus_tag LOCUS_19190 341286 339856 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_19190 343011 341401 gene locus_tag LOCUS_19200 343011 341401 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726949.1 protein_id gnl|my_center|LOCUS_19200 344717 342999 gene locus_tag LOCUS_19210 344717 342999 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090028.1 protein_id gnl|my_center|LOCUS_19210 345370 344714 gene locus_tag LOCUS_19220 345370 344714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 345428 348697 gene locus_tag LOCUS_19230 345428 348697 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112417.1 protein_id gnl|my_center|LOCUS_19230 349045 348743 gene locus_tag LOCUS_19240 349045 348743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 349502 349407 gene locus_tag LOCUS_t00170 349502 349407 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 349557 350564 gene locus_tag LOCUS_19250 gene selD 349557 350564 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727954.1 protein_id gnl|my_center|LOCUS_19250 351186 350551 gene locus_tag LOCUS_19260 351186 350551 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028311.1 protein_id gnl|my_center|LOCUS_19260 351393 352979 gene locus_tag LOCUS_19270 351393 352979 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031209.1 protein_id gnl|my_center|LOCUS_19270 353091 353357 gene locus_tag LOCUS_19280 353091 353357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 354094 353522 gene locus_tag LOCUS_19290 354094 353522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19290 354744 354286 gene locus_tag LOCUS_19300 354744 354286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19300 354933 354751 gene locus_tag LOCUS_19310 354933 354751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 355730 354945 gene locus_tag LOCUS_19320 355730 354945 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284974.1 protein_id gnl|my_center|LOCUS_19320 355968 359315 gene locus_tag LOCUS_19330 gene fdh 355968 359315 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227547.1 transl_except (pos:356523..356525,aa:Sec) note codon on position 186 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_19330 359305 360237 gene locus_tag LOCUS_19340 359305 360237 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727951.1 protein_id gnl|my_center|LOCUS_19340 360234 361172 gene locus_tag LOCUS_19350 gene nrfD 360234 361172 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227549.1 protein_id gnl|my_center|LOCUS_19350 361725 361186 gene locus_tag LOCUS_19360 361725 361186 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 protein_id gnl|my_center|LOCUS_19360 362204 362866 gene locus_tag LOCUS_19370 362204 362866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19370 364161 362962 gene locus_tag LOCUS_19380 364161 362962 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_19380 364304 364834 gene locus_tag LOCUS_19390 364304 364834 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_19390 364831 365538 gene locus_tag LOCUS_19400 364831 365538 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973942.1 protein_id gnl|my_center|LOCUS_19400 365535 367970 gene locus_tag LOCUS_19410 365535 367970 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327169.1 protein_id gnl|my_center|LOCUS_19410 368333 369193 gene locus_tag LOCUS_19420 368333 369193 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028582.1 protein_id gnl|my_center|LOCUS_19420 369566 370216 gene locus_tag LOCUS_19430 369566 370216 CDS product transglycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230245.1 protein_id gnl|my_center|LOCUS_19430 370988 371245 gene locus_tag LOCUS_19440 370988 371245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 371242 372570 gene locus_tag LOCUS_19450 371242 372570 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742179.1 protein_id gnl|my_center|LOCUS_19450 372567 373316 gene locus_tag LOCUS_19460 372567 373316 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230360.1 protein_id gnl|my_center|LOCUS_19460 374878 373310 gene locus_tag LOCUS_19470 gene murJ 374878 373310 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224759.1 protein_id gnl|my_center|LOCUS_19470 375076 375507 gene locus_tag LOCUS_19480 375076 375507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 376233 375559 gene locus_tag LOCUS_19490 376233 375559 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_19490 377560 376226 gene locus_tag LOCUS_19500 377560 376226 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_19500 379185 378031 gene locus_tag LOCUS_19510 379185 378031 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132624759.1 protein_id gnl|my_center|LOCUS_19510 379283 380023 gene locus_tag LOCUS_19520 379283 380023 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972504.1 protein_id gnl|my_center|LOCUS_19520 380838 380230 gene locus_tag LOCUS_19530 380838 380230 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109619.1 protein_id gnl|my_center|LOCUS_19530 381035 381556 gene locus_tag LOCUS_19540 381035 381556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 381643 381831 gene locus_tag LOCUS_19550 381643 381831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 382602 382417 gene locus_tag LOCUS_19560 382602 382417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 383007 382870 gene locus_tag LOCUS_19570 383007 382870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 384762 383185 gene locus_tag LOCUS_19580 384762 383185 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_19580 384929 385978 gene locus_tag LOCUS_19590 384929 385978 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327718.1 protein_id gnl|my_center|LOCUS_19590 386234 386010 gene locus_tag LOCUS_19600 386234 386010 CDS product DUF5703 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561940.1 protein_id gnl|my_center|LOCUS_19600 387226 386231 gene locus_tag LOCUS_19610 387226 386231 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226470.1 protein_id gnl|my_center|LOCUS_19610 388280 387375 gene locus_tag LOCUS_19620 388280 387375 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285031.1 protein_id gnl|my_center|LOCUS_19620 388728 388423 gene locus_tag LOCUS_19630 388728 388423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 388642 389481 gene locus_tag LOCUS_19640 388642 389481 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729632.1 protein_id gnl|my_center|LOCUS_19640 389504 390253 gene locus_tag LOCUS_19650 389504 390253 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226474.1 protein_id gnl|my_center|LOCUS_19650 390250 390699 gene locus_tag LOCUS_19660 390250 390699 CDS product DUF6314 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224870.1 protein_id gnl|my_center|LOCUS_19660 392050 391433 gene locus_tag LOCUS_19670 392050 391433 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062703.1 protein_id gnl|my_center|LOCUS_19670 392217 393494 gene locus_tag LOCUS_19680 392217 393494 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228110.1 protein_id gnl|my_center|LOCUS_19680 393549 394985 gene locus_tag LOCUS_19690 393549 394985 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223105.1 protein_id gnl|my_center|LOCUS_19690 395066 396118 gene locus_tag LOCUS_19700 395066 396118 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776787.1 protein_id gnl|my_center|LOCUS_19700 397156 396119 gene locus_tag LOCUS_19710 397156 396119 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226008.1 protein_id gnl|my_center|LOCUS_19710 397146 397778 gene locus_tag LOCUS_19720 397146 397778 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728128.1 protein_id gnl|my_center|LOCUS_19720 397873 398877 gene locus_tag LOCUS_19730 397873 398877 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226007.1 protein_id gnl|my_center|LOCUS_19730 399970 399119 gene locus_tag LOCUS_19740 399970 399119 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222514.1 protein_id gnl|my_center|LOCUS_19740 400736 400131 gene locus_tag LOCUS_19750 400736 400131 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171812.1 protein_id gnl|my_center|LOCUS_19750 400698 401405 gene locus_tag LOCUS_19760 400698 401405 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043786700.1 protein_id gnl|my_center|LOCUS_19760 401402 402463 gene locus_tag LOCUS_19770 401402 402463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532164.1 protein_id gnl|my_center|LOCUS_19770 403503 402712 gene locus_tag LOCUS_19780 403503 402712 CDS product aminoglycoside adenylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029599.1 protein_id gnl|my_center|LOCUS_19780 403610 403945 gene locus_tag LOCUS_19790 403610 403945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 404536 404192 gene locus_tag LOCUS_19800 404536 404192 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063604.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19800 405293 404736 gene locus_tag LOCUS_19810 405293 404736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 405988 405296 gene locus_tag LOCUS_19820 405988 405296 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 protein_id gnl|my_center|LOCUS_19820 407347 406136 gene locus_tag LOCUS_19830 407347 406136 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027238.1 protein_id gnl|my_center|LOCUS_19830 407795 407532 gene locus_tag LOCUS_19840 407795 407532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 408509 408174 gene locus_tag LOCUS_19850 408509 408174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 409254 409523 gene locus_tag LOCUS_19860 409254 409523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 410262 409639 gene locus_tag LOCUS_19870 410262 409639 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_19870 410844 410344 gene locus_tag LOCUS_19880 410844 410344 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057935.1 protein_id gnl|my_center|LOCUS_19880 411002 411940 gene locus_tag LOCUS_19890 411002 411940 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226059.1 protein_id gnl|my_center|LOCUS_19890 413408 411966 gene locus_tag LOCUS_19900 413408 411966 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 protein_id gnl|my_center|LOCUS_19900 414388 413408 gene locus_tag LOCUS_19910 414388 413408 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229613.1 protein_id gnl|my_center|LOCUS_19910 414563 415057 gene locus_tag LOCUS_19920 414563 415057 CDS product DUF3830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229621.1 protein_id gnl|my_center|LOCUS_19920 415073 415831 gene locus_tag LOCUS_19930 415073 415831 CDS product arylmalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229614.1 protein_id gnl|my_center|LOCUS_19930 415966 416742 gene locus_tag LOCUS_19940 415966 416742 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877404.1 protein_id gnl|my_center|LOCUS_19940 416746 417435 gene locus_tag LOCUS_19950 416746 417435 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229616.1 protein_id gnl|my_center|LOCUS_19950 417670 418026 gene locus_tag LOCUS_19960 417670 418026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 419697 418219 gene locus_tag LOCUS_19970 419697 418219 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229619.1 protein_id gnl|my_center|LOCUS_19970 419828 421078 gene locus_tag LOCUS_19980 419828 421078 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229620.1 protein_id gnl|my_center|LOCUS_19980 421146 422405 gene locus_tag LOCUS_19990 421146 422405 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227558.1 protein_id gnl|my_center|LOCUS_19990 422673 423713 gene locus_tag LOCUS_20000 422673 423713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20000 423797 425530 gene locus_tag LOCUS_20010 423797 425530 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804193.1 protein_id gnl|my_center|LOCUS_20010 425613 426278 gene locus_tag LOCUS_20020 425613 426278 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226101.1 protein_id gnl|my_center|LOCUS_20020 426427 427416 gene locus_tag LOCUS_20030 426427 427416 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_20030 427468 428400 gene locus_tag LOCUS_20040 427468 428400 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 protein_id gnl|my_center|LOCUS_20040 428491 429933 gene locus_tag LOCUS_20050 gene proS 428491 429933 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908400.1 protein_id gnl|my_center|LOCUS_20050 430099 430500 gene locus_tag LOCUS_20060 430099 430500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 430856 433243 gene locus_tag LOCUS_20070 430856 433243 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_20070 433333 434166 gene locus_tag LOCUS_20080 433333 434166 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_20080 434168 434356 gene locus_tag LOCUS_20090 434168 434356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 434442 436403 gene locus_tag LOCUS_20100 434442 436403 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727420.1 protein_id gnl|my_center|LOCUS_20100 436597 437106 gene locus_tag LOCUS_20110 436597 437106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 437209 438216 gene locus_tag LOCUS_20120 437209 438216 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899778.1 protein_id gnl|my_center|LOCUS_20120 439078 438818 gene locus_tag LOCUS_20130 439078 438818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877189.1 protein_id gnl|my_center|LOCUS_20130 439232 440557 gene locus_tag LOCUS_20140 439232 440557 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228110.1 protein_id gnl|my_center|LOCUS_20140 440580 441410 gene locus_tag LOCUS_20150 440580 441410 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530304.1 protein_id gnl|my_center|LOCUS_20150 442497 442745 gene locus_tag LOCUS_20160 442497 442745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 443456 442800 gene locus_tag LOCUS_20170 443456 442800 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091790.1 protein_id gnl|my_center|LOCUS_20170 443821 443453 gene locus_tag LOCUS_20180 443821 443453 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079340.1 protein_id gnl|my_center|LOCUS_20180 444354 444614 gene locus_tag LOCUS_20190 444354 444614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20190 445069 444653 gene locus_tag LOCUS_20200 445069 444653 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230138.1 protein_id gnl|my_center|LOCUS_20200 445746 445066 gene locus_tag LOCUS_20210 445746 445066 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535056.1 protein_id gnl|my_center|LOCUS_20210 445675 445881 gene locus_tag LOCUS_20220 445675 445881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 445994 446863 gene locus_tag LOCUS_20230 445994 446863 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231049.1 protein_id gnl|my_center|LOCUS_20230 446930 447379 gene locus_tag LOCUS_20240 446930 447379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 447562 449196 gene locus_tag LOCUS_20250 447562 449196 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226759.1 protein_id gnl|my_center|LOCUS_20250 449208 450182 gene locus_tag LOCUS_20260 449208 450182 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027411.1 protein_id gnl|my_center|LOCUS_20260 450291 451277 gene locus_tag LOCUS_20270 450291 451277 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226477.1 protein_id gnl|my_center|LOCUS_20270 452149 451364 gene locus_tag LOCUS_20280 gene map 452149 451364 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730281.1 protein_id gnl|my_center|LOCUS_20280 453152 453796 gene locus_tag LOCUS_20290 453152 453796 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031152.1 protein_id gnl|my_center|LOCUS_20290 453821 454369 gene locus_tag LOCUS_20300 453821 454369 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918753.1 protein_id gnl|my_center|LOCUS_20300 454661 454353 gene locus_tag LOCUS_20310 454661 454353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 454797 455102 gene locus_tag LOCUS_20320 454797 455102 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730282.1 protein_id gnl|my_center|LOCUS_20320 455488 455141 gene locus_tag LOCUS_20330 455488 455141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 456609 455995 gene locus_tag LOCUS_20340 gene satP 456609 455995 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528527.1 protein_id gnl|my_center|LOCUS_20340 458019 457012 gene locus_tag LOCUS_20350 gene xerC 458019 457012 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_20350 458150 459277 gene locus_tag LOCUS_20360 458150 459277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 459445 460290 gene locus_tag LOCUS_20370 459445 460290 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027243.1 protein_id gnl|my_center|LOCUS_20370 460947 460405 gene locus_tag LOCUS_20380 460947 460405 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976326.1 protein_id gnl|my_center|LOCUS_20380 461380 461802 gene locus_tag LOCUS_20390 461380 461802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 463042 461858 gene locus_tag LOCUS_20400 463042 461858 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232783.1 protein_id gnl|my_center|LOCUS_20400 463917 463150 gene locus_tag LOCUS_20410 gene map 463917 463150 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972570.1 protein_id gnl|my_center|LOCUS_20410 464302 464955 gene locus_tag LOCUS_20420 464302 464955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 464955 467054 gene locus_tag LOCUS_20430 464955 467054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 467254 468027 gene locus_tag LOCUS_20440 467254 468027 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729479.1 protein_id gnl|my_center|LOCUS_20440 468290 469963 gene locus_tag LOCUS_20450 468290 469963 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256570.1 protein_id gnl|my_center|LOCUS_20450 469963 471318 gene locus_tag LOCUS_20460 469963 471318 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256571.1 protein_id gnl|my_center|LOCUS_20460 472592 471315 gene locus_tag LOCUS_20470 472592 471315 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232783.1 protein_id gnl|my_center|LOCUS_20470 473891 472689 gene locus_tag LOCUS_20480 473891 472689 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086841829.1 protein_id gnl|my_center|LOCUS_20480 474333 473905 gene locus_tag LOCUS_20490 474333 473905 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226504.1 protein_id gnl|my_center|LOCUS_20490 475269 474421 gene locus_tag LOCUS_20500 475269 474421 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226503.1 protein_id gnl|my_center|LOCUS_20500 475681 476028 gene locus_tag LOCUS_20510 475681 476028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 476229 476062 gene locus_tag LOCUS_20520 476229 476062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 476737 482184 gene locus_tag LOCUS_20530 476737 482184 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226015.1 protein_id gnl|my_center|LOCUS_20530 482407 483180 gene locus_tag LOCUS_20540 482407 483180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226765.1 protein_id gnl|my_center|LOCUS_20540 484252 484410 gene locus_tag LOCUS_20550 484252 484410 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084988.1 protein_id gnl|my_center|LOCUS_20550 485156 484485 gene locus_tag LOCUS_20560 485156 484485 CDS product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084718.1 protein_id gnl|my_center|LOCUS_20560 486216 485194 gene locus_tag LOCUS_20570 486216 485194 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226767.1 protein_id gnl|my_center|LOCUS_20570 487057 486290 gene locus_tag LOCUS_20580 gene fabI 487057 486290 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_20580 487843 487139 gene locus_tag LOCUS_20590 487843 487139 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226771.1 protein_id gnl|my_center|LOCUS_20590 488047 490929 gene locus_tag LOCUS_20600 488047 490929 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228786.1 protein_id gnl|my_center|LOCUS_20600 491353 490937 gene locus_tag LOCUS_20610 491353 490937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 491301 491465 gene locus_tag LOCUS_20620 491301 491465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 491716 492543 gene locus_tag LOCUS_20630 491716 492543 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223902.1 protein_id gnl|my_center|LOCUS_20630 493178 492651 gene locus_tag LOCUS_20640 493178 492651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 493540 493175 gene locus_tag LOCUS_20650 493540 493175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 494400 493645 gene locus_tag LOCUS_20660 494400 493645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 494855 494397 gene locus_tag LOCUS_20670 494855 494397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 494968 495393 gene locus_tag LOCUS_20680 494968 495393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 495698 495898 gene locus_tag LOCUS_20690 495698 495898 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_20690 497550 496312 gene locus_tag LOCUS_20700 497550 496312 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029659.1 protein_id gnl|my_center|LOCUS_20700 498056 498580 gene locus_tag LOCUS_20710 498056 498580 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223356.1 protein_id gnl|my_center|LOCUS_20710 498580 499584 gene locus_tag LOCUS_20720 498580 499584 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027413.1 protein_id gnl|my_center|LOCUS_20720 499693 500787 gene locus_tag LOCUS_20730 499693 500787 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975538.1 protein_id gnl|my_center|LOCUS_20730 500784 501383 gene locus_tag LOCUS_20740 500784 501383 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223203.1 protein_id gnl|my_center|LOCUS_20740 501393 501731 gene locus_tag LOCUS_20750 501393 501731 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094643.1 protein_id gnl|my_center|LOCUS_20750 502211 501759 gene locus_tag LOCUS_20760 502211 501759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 502894 502598 gene locus_tag LOCUS_20770 502894 502598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 502790 503026 gene locus_tag LOCUS_20780 502790 503026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 505489 503099 gene locus_tag LOCUS_20790 505489 503099 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224401.1 protein_id gnl|my_center|LOCUS_20790 506279 505617 gene locus_tag LOCUS_20800 506279 505617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 507198 506323 gene locus_tag LOCUS_20810 507198 506323 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079005.1 protein_id gnl|my_center|LOCUS_20810 508527 507202 gene locus_tag LOCUS_20820 508527 507202 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967206.1 protein_id gnl|my_center|LOCUS_20820 509279 508524 gene locus_tag LOCUS_20830 509279 508524 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729739.1 protein_id gnl|my_center|LOCUS_20830 510830 509574 gene locus_tag LOCUS_20840 510830 509574 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_20840 511810 511070 gene locus_tag LOCUS_20850 511810 511070 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224207.1 protein_id gnl|my_center|LOCUS_20850 513110 512313 gene locus_tag LOCUS_20860 513110 512313 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015201.1 protein_id gnl|my_center|LOCUS_20860 513979 513107 gene locus_tag LOCUS_20870 513979 513107 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230113.1 protein_id gnl|my_center|LOCUS_20870 514590 513976 gene locus_tag LOCUS_20880 514590 513976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20880 515357 514593 gene locus_tag LOCUS_20890 515357 514593 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105454.1 protein_id gnl|my_center|LOCUS_20890 516608 515391 gene locus_tag LOCUS_20900 516608 515391 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014042.1 protein_id gnl|my_center|LOCUS_20900 516769 517467 gene locus_tag LOCUS_20910 516769 517467 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230108.1 protein_id gnl|my_center|LOCUS_20910 517595 517945 gene locus_tag LOCUS_20920 517595 517945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 518965 517988 gene locus_tag LOCUS_20930 518965 517988 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485415.1 protein_id gnl|my_center|LOCUS_20930 519052 519912 gene locus_tag LOCUS_20940 519052 519912 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226532.1 protein_id gnl|my_center|LOCUS_20940 521221 520322 gene locus_tag LOCUS_20950 521221 520322 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877762.1 protein_id gnl|my_center|LOCUS_20950 522268 521285 gene locus_tag LOCUS_20960 522268 521285 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 protein_id gnl|my_center|LOCUS_20960 523209 522268 gene locus_tag LOCUS_20970 523209 522268 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226780.1 protein_id gnl|my_center|LOCUS_20970 524336 523224 gene locus_tag LOCUS_20980 524336 523224 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_20980 525906 524944 gene locus_tag LOCUS_20990 525906 524944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 526053 526313 gene locus_tag LOCUS_21000 526053 526313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 527493 526393 gene locus_tag LOCUS_21010 527493 526393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 529331 527673 gene locus_tag LOCUS_21020 529331 527673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 530586 529294 gene locus_tag LOCUS_21030 530586 529294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21030 531171 530806 gene locus_tag LOCUS_21040 531171 530806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 532063 531191 gene locus_tag LOCUS_21050 532063 531191 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928730.1 protein_id gnl|my_center|LOCUS_21050 532145 532708 gene locus_tag LOCUS_21060 532145 532708 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079687.1 protein_id gnl|my_center|LOCUS_21060 534157 533240 gene locus_tag LOCUS_21070 534157 533240 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972862.1 protein_id gnl|my_center|LOCUS_21070 535089 534343 gene locus_tag LOCUS_21080 535089 534343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21080 536091 535753 gene locus_tag LOCUS_21090 536091 535753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 536838 536317 gene locus_tag LOCUS_21100 536838 536317 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226782.1 protein_id gnl|my_center|LOCUS_21100 538308 536953 gene locus_tag LOCUS_21110 538308 536953 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226784.1 protein_id gnl|my_center|LOCUS_21110 539547 538717 gene locus_tag LOCUS_21120 539547 538717 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030941.1 protein_id gnl|my_center|LOCUS_21120 539756 541840 gene locus_tag LOCUS_21130 539756 541840 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 protein_id gnl|my_center|LOCUS_21130 541837 543231 gene locus_tag LOCUS_21140 541837 543231 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223027.1 protein_id gnl|my_center|LOCUS_21140 543228 545750 gene locus_tag LOCUS_21150 gene nirB 543228 545750 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223029.1 protein_id gnl|my_center|LOCUS_21150 545747 546070 gene locus_tag LOCUS_21160 gene nirD 545747 546070 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005100148.1 protein_id gnl|my_center|LOCUS_21160 546191 546691 gene locus_tag LOCUS_21170 546191 546691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 546766 548397 gene locus_tag LOCUS_21180 546766 548397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 548496 548633 gene locus_tag LOCUS_21190 548496 548633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 548765 548998 gene locus_tag LOCUS_21200 548765 548998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 549345 549007 gene locus_tag LOCUS_21210 549345 549007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 550243 549440 gene locus_tag LOCUS_21220 550243 549440 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124525.1 protein_id gnl|my_center|LOCUS_21220 551230 550253 gene locus_tag LOCUS_21230 551230 550253 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030964.1 protein_id gnl|my_center|LOCUS_21230 553078 551282 gene locus_tag LOCUS_21240 553078 551282 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533218.1 protein_id gnl|my_center|LOCUS_21240 553586 555991 gene locus_tag LOCUS_21250 553586 555991 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269956.1 protein_id gnl|my_center|LOCUS_21250 555988 557085 gene locus_tag LOCUS_21260 555988 557085 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228351.1 protein_id gnl|my_center|LOCUS_21260 557210 559291 gene locus_tag LOCUS_21270 557210 559291 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727118.1 protein_id gnl|my_center|LOCUS_21270 559291 559785 gene locus_tag LOCUS_21280 559291 559785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 560196 559939 gene locus_tag LOCUS_21290 560196 559939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 561055 560471 gene locus_tag LOCUS_21300 561055 560471 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706362.1 protein_id gnl|my_center|LOCUS_21300 561172 562008 gene locus_tag LOCUS_21310 561172 562008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 562047 562694 gene locus_tag LOCUS_21320 562047 562694 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223072.1 protein_id gnl|my_center|LOCUS_21320 562723 563073 gene locus_tag LOCUS_21330 562723 563073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 565021 563294 gene locus_tag LOCUS_21340 565021 563294 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_21340 565752 565177 gene locus_tag LOCUS_21350 565752 565177 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466933.1 protein_id gnl|my_center|LOCUS_21350 565882 567015 gene locus_tag LOCUS_21360 565882 567015 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039217.1 protein_id gnl|my_center|LOCUS_21360 567571 567074 gene locus_tag LOCUS_21370 567571 567074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21370 567980 568438 gene locus_tag LOCUS_21380 567980 568438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 569185 568460 gene locus_tag LOCUS_21390 569185 568460 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224986.1 protein_id gnl|my_center|LOCUS_21390 569782 569324 gene locus_tag LOCUS_21400 569782 569324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21400 572277 569908 gene locus_tag LOCUS_21410 572277 569908 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030101.1 protein_id gnl|my_center|LOCUS_21410 573115 572447 gene locus_tag LOCUS_21420 573115 572447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 573405 573605 gene locus_tag LOCUS_21430 573405 573605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 573737 574009 gene locus_tag LOCUS_21440 573737 574009 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228157.1 protein_id gnl|my_center|LOCUS_21440 574951 574454 gene locus_tag LOCUS_21450 574951 574454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21450 575813 575133 gene locus_tag LOCUS_21460 575813 575133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 575999 576514 gene locus_tag LOCUS_21470 575999 576514 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776788.1 protein_id gnl|my_center|LOCUS_21470 576597 577112 gene locus_tag LOCUS_21480 576597 577112 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030929.1 protein_id gnl|my_center|LOCUS_21480 577322 578584 gene locus_tag LOCUS_21490 577322 578584 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031716.1 protein_id gnl|my_center|LOCUS_21490 580030 578639 gene locus_tag LOCUS_21500 580030 578639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 580767 580027 gene locus_tag LOCUS_21510 580767 580027 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257620.1 protein_id gnl|my_center|LOCUS_21510 580916 581116 gene locus_tag LOCUS_21520 580916 581116 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226108.1 protein_id gnl|my_center|LOCUS_21520 581148 581357 gene locus_tag LOCUS_21530 581148 581357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 581729 581385 gene locus_tag LOCUS_21540 581729 581385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227035.1 protein_id gnl|my_center|LOCUS_21540 582302 581808 gene locus_tag LOCUS_21550 582302 581808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 583396 582311 gene locus_tag LOCUS_21560 583396 582311 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891590.1 protein_id gnl|my_center|LOCUS_21560 583596 583757 gene locus_tag LOCUS_21570 583596 583757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 583851 584828 gene locus_tag LOCUS_21580 583851 584828 CDS product TIGR03557 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227034.1 protein_id gnl|my_center|LOCUS_21580 585122 584841 gene locus_tag LOCUS_21590 585122 584841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228327.1 protein_id gnl|my_center|LOCUS_21590 585100 585297 gene locus_tag LOCUS_21600 585100 585297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 585366 585803 gene locus_tag LOCUS_21610 585366 585803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 585800 586207 gene locus_tag LOCUS_21620 585800 586207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 586699 586448 gene locus_tag LOCUS_21630 586699 586448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 586812 587678 gene locus_tag LOCUS_21640 586812 587678 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222148.1 protein_id gnl|my_center|LOCUS_21640 587666 587860 gene locus_tag LOCUS_21650 587666 587860 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224345.1 protein_id gnl|my_center|LOCUS_21650 588119 589087 gene locus_tag LOCUS_21660 588119 589087 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086857074.1 protein_id gnl|my_center|LOCUS_21660 590178 589315 gene locus_tag LOCUS_21670 590178 589315 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727900.1 protein_id gnl|my_center|LOCUS_21670 590522 592012 gene locus_tag LOCUS_21680 590522 592012 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031615.1 protein_id gnl|my_center|LOCUS_21680 592901 592020 gene locus_tag LOCUS_21690 592901 592020 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226124.1 protein_id gnl|my_center|LOCUS_21690 593062 594078 gene locus_tag LOCUS_21700 593062 594078 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742236.1 protein_id gnl|my_center|LOCUS_21700 595476 594622 gene locus_tag LOCUS_21710 595476 594622 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226123.1 protein_id gnl|my_center|LOCUS_21710 596438 595518 gene locus_tag LOCUS_21720 596438 595518 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030727.1 protein_id gnl|my_center|LOCUS_21720 596655 596900 gene locus_tag LOCUS_21730 596655 596900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 597869 597021 gene locus_tag LOCUS_21740 597869 597021 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028071.1 protein_id gnl|my_center|LOCUS_21740 598831 598346 gene locus_tag LOCUS_21750 598831 598346 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083407.1 protein_id gnl|my_center|LOCUS_21750 599115 599372 gene locus_tag LOCUS_21760 599115 599372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 599598 599957 gene locus_tag LOCUS_21770 599598 599957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 599957 600151 gene locus_tag LOCUS_21780 599957 600151 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093358.1 protein_id gnl|my_center|LOCUS_21780 600470 600174 gene locus_tag LOCUS_21790 600470 600174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 600758 601081 gene locus_tag LOCUS_21800 600758 601081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 601234 602307 gene locus_tag LOCUS_21810 601234 602307 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027358.1 protein_id gnl|my_center|LOCUS_21810 603660 602347 gene locus_tag LOCUS_21820 603660 602347 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831529.1 protein_id gnl|my_center|LOCUS_21820 604504 603707 gene locus_tag LOCUS_21830 604504 603707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 605478 604501 gene locus_tag LOCUS_21840 605478 604501 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226116.1 protein_id gnl|my_center|LOCUS_21840 606158 605469 gene locus_tag LOCUS_21850 606158 605469 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226117.1 protein_id gnl|my_center|LOCUS_21850 607608 606229 gene locus_tag LOCUS_21860 607608 606229 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226118.1 protein_id gnl|my_center|LOCUS_21860 608201 607605 gene locus_tag LOCUS_21870 608201 607605 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226119.1 protein_id gnl|my_center|LOCUS_21870 609421 608198 gene locus_tag LOCUS_21880 609421 608198 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 protein_id gnl|my_center|LOCUS_21880 610383 609418 gene locus_tag LOCUS_21890 610383 609418 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030720.1 protein_id gnl|my_center|LOCUS_21890 611396 610380 gene locus_tag LOCUS_21900 611396 610380 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226109.1 protein_id gnl|my_center|LOCUS_21900 612463 611393 gene locus_tag LOCUS_21910 612463 611393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 614094 612460 gene locus_tag LOCUS_21920 614094 612460 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226120.1 protein_id gnl|my_center|LOCUS_21920 614584 614405 gene locus_tag LOCUS_21930 614584 614405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 615912 614668 gene locus_tag LOCUS_21940 615912 614668 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015099.1 protein_id gnl|my_center|LOCUS_21940 616250 615954 gene locus_tag LOCUS_21950 gene catC 616250 615954 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728004.1 protein_id gnl|my_center|LOCUS_21950 617106 616363 gene locus_tag LOCUS_21960 gene catA 617106 616363 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728003.1 protein_id gnl|my_center|LOCUS_21960 618398 617295 gene locus_tag LOCUS_21970 618398 617295 CDS product muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728002.1 protein_id gnl|my_center|LOCUS_21970 619306 618395 gene locus_tag LOCUS_21980 619306 618395 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728001.1 protein_id gnl|my_center|LOCUS_21980 619652 621022 gene locus_tag LOCUS_21990 gene benA 619652 621022 CDS product benzoate 1,2-dioxygenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728000.1 protein_id gnl|my_center|LOCUS_21990 621037 621549 gene locus_tag LOCUS_22000 gene benB 621037 621549 CDS product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015095.1 protein_id gnl|my_center|LOCUS_22000 621602 622609 gene locus_tag LOCUS_22010 621602 622609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22010 622614 623408 gene locus_tag LOCUS_22020 622614 623408 CDS product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113313.1 protein_id gnl|my_center|LOCUS_22020 623569 626304 gene locus_tag LOCUS_22030 623569 626304 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727994.1 protein_id gnl|my_center|LOCUS_22030 626734 626312 gene locus_tag LOCUS_22040 626734 626312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101257084.1 protein_id gnl|my_center|LOCUS_22040 626802 627569 gene locus_tag LOCUS_22050 626802 627569 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226540.1 protein_id gnl|my_center|LOCUS_22050 627669 628169 gene locus_tag LOCUS_22060 627669 628169 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030939.1 protein_id gnl|my_center|LOCUS_22060 628219 628704 gene locus_tag LOCUS_22070 628219 628704 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226079.1 protein_id gnl|my_center|LOCUS_22070 628701 629318 gene locus_tag LOCUS_22080 628701 629318 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226078.1 protein_id gnl|my_center|LOCUS_22080 629335 629964 gene locus_tag LOCUS_22090 629335 629964 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015424.1 protein_id gnl|my_center|LOCUS_22090 630372 629998 gene locus_tag LOCUS_22100 630372 629998 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977520.1 protein_id gnl|my_center|LOCUS_22100 630439 631470 gene locus_tag LOCUS_22110 630439 631470 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227634.1 protein_id gnl|my_center|LOCUS_22110 631544 631876 gene locus_tag LOCUS_22120 631544 631876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 632349 631930 gene locus_tag LOCUS_22130 632349 631930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 632469 634157 gene locus_tag LOCUS_22140 632469 634157 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_22140 636707 634191 gene locus_tag LOCUS_22150 636707 634191 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229028.1 protein_id gnl|my_center|LOCUS_22150 638251 636824 gene locus_tag LOCUS_22160 638251 636824 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243731.1 protein_id gnl|my_center|LOCUS_22160 638510 639694 gene locus_tag LOCUS_22170 638510 639694 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226129.1 protein_id gnl|my_center|LOCUS_22170 640346 639708 gene locus_tag LOCUS_22180 640346 639708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 640664 640350 gene locus_tag LOCUS_22190 640664 640350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 640888 640616 gene locus_tag LOCUS_22200 640888 640616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 641515 641862 gene locus_tag LOCUS_22210 641515 641862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 642182 641892 gene locus_tag LOCUS_22220 642182 641892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 643698 642682 gene locus_tag LOCUS_22230 643698 642682 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038292.1 protein_id gnl|my_center|LOCUS_22230 645070 643847 gene locus_tag LOCUS_22240 645070 643847 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868921.1 protein_id gnl|my_center|LOCUS_22240 645224 646795 gene locus_tag LOCUS_22250 645224 646795 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225825.1 protein_id gnl|my_center|LOCUS_22250 646795 647862 gene locus_tag LOCUS_22260 646795 647862 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225826.1 protein_id gnl|my_center|LOCUS_22260 647918 648973 gene locus_tag LOCUS_22270 647918 648973 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225827.1 protein_id gnl|my_center|LOCUS_22270 649095 652388 gene locus_tag LOCUS_22280 649095 652388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 652479 653321 gene locus_tag LOCUS_22290 652479 653321 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_22290 653365 654552 gene locus_tag LOCUS_22300 653365 654552 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_22300 654549 655538 gene locus_tag LOCUS_22310 654549 655538 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972284.1 protein_id gnl|my_center|LOCUS_22310 655594 659181 gene locus_tag LOCUS_22320 655594 659181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 659260 661971 gene locus_tag LOCUS_22330 659260 661971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 662105 663286 gene locus_tag LOCUS_22340 662105 663286 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028853.1 protein_id gnl|my_center|LOCUS_22340 663286 664146 gene locus_tag LOCUS_22350 663286 664146 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028852.1 protein_id gnl|my_center|LOCUS_22350 664143 665003 gene locus_tag LOCUS_22360 664143 665003 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028851.1 protein_id gnl|my_center|LOCUS_22360 665000 665668 gene locus_tag LOCUS_22370 665000 665668 CDS product EboA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028850.1 protein_id gnl|my_center|LOCUS_22370 665668 666534 gene locus_tag LOCUS_22380 665668 666534 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028849.1 protein_id gnl|my_center|LOCUS_22380 666539 667708 gene locus_tag LOCUS_22390 gene eboE 666539 667708 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028848.1 protein_id gnl|my_center|LOCUS_22390 667705 669117 gene locus_tag LOCUS_22400 667705 669117 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_22400 669152 670159 gene locus_tag LOCUS_22410 669152 670159 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972408.1 protein_id gnl|my_center|LOCUS_22410 670956 670231 gene locus_tag LOCUS_22420 670956 670231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 672199 671219 gene locus_tag LOCUS_22430 672199 671219 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110075.1 protein_id gnl|my_center|LOCUS_22430 672313 673110 gene locus_tag LOCUS_22440 672313 673110 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969730.1 protein_id gnl|my_center|LOCUS_22440 673204 674271 gene locus_tag LOCUS_22450 673204 674271 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230588.1 protein_id gnl|my_center|LOCUS_22450 674065 673982 gene locus_tag LOCUS_t00180 674065 673982 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 674332 675060 gene locus_tag LOCUS_22460 674332 675060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 675475 675702 gene locus_tag LOCUS_22470 675475 675702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 676302 675745 gene locus_tag LOCUS_22480 676302 675745 CDS product DUF1360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226138.1 protein_id gnl|my_center|LOCUS_22480 676482 677048 gene locus_tag LOCUS_22490 676482 677048 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728973.1 protein_id gnl|my_center|LOCUS_22490 677211 677630 gene locus_tag LOCUS_22500 677211 677630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 677627 677968 gene locus_tag LOCUS_22510 677627 677968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 678054 679094 gene locus_tag LOCUS_22520 678054 679094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 679138 679548 gene locus_tag LOCUS_22530 679138 679548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 679664 679876 gene locus_tag LOCUS_22540 679664 679876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 679901 680095 gene locus_tag LOCUS_22550 679901 680095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 680655 680206 gene locus_tag LOCUS_22560 680655 680206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 681542 680820 gene locus_tag LOCUS_22570 681542 680820 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079514.1 protein_id gnl|my_center|LOCUS_22570 681819 682040 gene locus_tag LOCUS_22580 681819 682040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 682488 682030 gene locus_tag LOCUS_22590 682488 682030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 684515 683331 gene locus_tag LOCUS_22600 684515 683331 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869305.1 protein_id gnl|my_center|LOCUS_22600 684903 684598 gene locus_tag LOCUS_22610 684903 684598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 685676 686185 gene locus_tag LOCUS_22620 685676 686185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 686508 686684 gene locus_tag LOCUS_22630 686508 686684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 686879 687544 gene locus_tag LOCUS_22640 686879 687544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 687663 688157 gene locus_tag LOCUS_22650 687663 688157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 688452 688183 gene locus_tag LOCUS_22660 688452 688183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 689939 688452 gene locus_tag LOCUS_22670 689939 688452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 690442 689966 gene locus_tag LOCUS_22680 690442 689966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 692193 690709 gene locus_tag LOCUS_22690 692193 690709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 693286 692375 gene locus_tag LOCUS_22700 693286 692375 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 protein_id gnl|my_center|LOCUS_22700 694460 693279 gene locus_tag LOCUS_22710 694460 693279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 694656 694441 gene locus_tag LOCUS_22720 694656 694441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 694879 696237 gene locus_tag LOCUS_22730 694879 696237 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730651.1 protein_id gnl|my_center|LOCUS_22730 696234 697253 gene locus_tag LOCUS_22740 696234 697253 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_22740 697322 698344 gene locus_tag LOCUS_22750 697322 698344 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275382.1 protein_id gnl|my_center|LOCUS_22750 698341 699078 gene locus_tag LOCUS_22760 698341 699078 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275383.1 protein_id gnl|my_center|LOCUS_22760 699075 699650 gene locus_tag LOCUS_22770 699075 699650 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889390.1 protein_id gnl|my_center|LOCUS_22770 699677 700423 gene locus_tag LOCUS_22780 699677 700423 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275384.1 protein_id gnl|my_center|LOCUS_22780 700434 701333 gene locus_tag LOCUS_22790 700434 701333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 701418 702812 gene locus_tag LOCUS_22800 701418 702812 CDS product NADP-dependent succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081095.1 protein_id gnl|my_center|LOCUS_22800 703133 703513 gene locus_tag LOCUS_22810 703133 703513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 704651 703557 gene locus_tag LOCUS_22820 704651 703557 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950414.1 protein_id gnl|my_center|LOCUS_22820 705643 704741 gene locus_tag LOCUS_22830 705643 704741 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_22830 706239 705676 gene locus_tag LOCUS_22840 706239 705676 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971771.1 protein_id gnl|my_center|LOCUS_22840 706519 707481 gene locus_tag LOCUS_22850 706519 707481 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977963.1 protein_id gnl|my_center|LOCUS_22850 707628 708374 gene locus_tag LOCUS_22860 707628 708374 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060771.1 protein_id gnl|my_center|LOCUS_22860 708996 709256 gene locus_tag LOCUS_22870 708996 709256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 709340 709756 gene locus_tag LOCUS_22880 709340 709756 CDS product DUF2267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929007.1 protein_id gnl|my_center|LOCUS_22880 709809 709988 gene locus_tag LOCUS_22890 709809 709988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 710036 710254 gene locus_tag LOCUS_22900 710036 710254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 710700 710329 gene locus_tag LOCUS_22910 710700 710329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 711357 710848 gene locus_tag LOCUS_22920 711357 710848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485905.1 protein_id gnl|my_center|LOCUS_22920 711762 712790 gene locus_tag LOCUS_22930 711762 712790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 712790 713920 gene locus_tag LOCUS_22940 712790 713920 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990082.1 protein_id gnl|my_center|LOCUS_22940 714157 715551 gene locus_tag LOCUS_22950 714157 715551 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027469.1 protein_id gnl|my_center|LOCUS_22950 716733 715573 gene locus_tag LOCUS_22960 716733 715573 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030513.1 protein_id gnl|my_center|LOCUS_22960 717018 719858 gene locus_tag LOCUS_22970 717018 719858 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222319.1 protein_id gnl|my_center|LOCUS_22970 720146 719889 gene locus_tag LOCUS_22980 720146 719889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22980 720511 720143 gene locus_tag LOCUS_22990 720511 720143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22990 721400 720429 gene locus_tag LOCUS_23000 721400 720429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23000 721593 723182 gene locus_tag LOCUS_23010 gene fadD5 721593 723182 CDS product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726688.1 protein_id gnl|my_center|LOCUS_23010 723533 724834 gene locus_tag LOCUS_23020 723533 724834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 724831 725250 gene locus_tag LOCUS_23030 724831 725250 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971678.1 protein_id gnl|my_center|LOCUS_23030 725247 725603 gene locus_tag LOCUS_23040 725247 725603 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971677.1 protein_id gnl|my_center|LOCUS_23040 725584 725739 gene locus_tag LOCUS_23050 725584 725739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 725762 727015 gene locus_tag LOCUS_23060 725762 727015 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972616.1 protein_id gnl|my_center|LOCUS_23060 726985 728199 gene locus_tag LOCUS_23070 726985 728199 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975925.1 protein_id gnl|my_center|LOCUS_23070 729861 728251 gene locus_tag LOCUS_23080 729861 728251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 730041 731264 gene locus_tag LOCUS_23090 730041 731264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225442.1 protein_id gnl|my_center|LOCUS_23090 732489 731335 gene locus_tag LOCUS_23100 732489 731335 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228154.1 protein_id gnl|my_center|LOCUS_23100 732624 732779 gene locus_tag LOCUS_23110 732624 732779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 732783 734009 gene locus_tag LOCUS_23120 732783 734009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 734759 734079 gene locus_tag LOCUS_23130 734759 734079 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228642.1 protein_id gnl|my_center|LOCUS_23130 736244 734790 gene locus_tag LOCUS_23140 736244 734790 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190096.1 protein_id gnl|my_center|LOCUS_23140 736681 736241 gene locus_tag LOCUS_23150 736681 736241 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228629.1 protein_id gnl|my_center|LOCUS_23150 742290 736681 gene locus_tag LOCUS_23160 742290 736681 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831510.1 protein_id gnl|my_center|LOCUS_23160 743264 742287 gene locus_tag LOCUS_23170 743264 742287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228636.1 protein_id gnl|my_center|LOCUS_23170 745183 743261 gene locus_tag LOCUS_23180 745183 743261 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228637.1 protein_id gnl|my_center|LOCUS_23180 746184 745180 gene locus_tag LOCUS_23190 746184 745180 CDS product DUF1702 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086861803.1 protein_id gnl|my_center|LOCUS_23190 747510 746263 gene locus_tag LOCUS_23200 747510 746263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 749710 748091 gene locus_tag LOCUS_23210 749710 748091 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727596.1 protein_id gnl|my_center|LOCUS_23210 751674 749950 gene locus_tag LOCUS_23220 751674 749950 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727978.1 protein_id gnl|my_center|LOCUS_23220 752240 751680 gene locus_tag LOCUS_23230 752240 751680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 753120 752743 gene locus_tag LOCUS_23240 753120 752743 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487415.1 protein_id gnl|my_center|LOCUS_23240 753749 753558 gene locus_tag LOCUS_23250 753749 753558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 753908 756439 gene locus_tag LOCUS_23260 gene hrpB 753908 756439 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223186.1 protein_id gnl|my_center|LOCUS_23260 757179 756334 gene locus_tag LOCUS_23270 757179 756334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 757258 757470 gene locus_tag LOCUS_23280 757258 757470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 757467 758213 gene locus_tag LOCUS_23290 757467 758213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 758514 759548 gene locus_tag LOCUS_23300 758514 759548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 760644 759523 gene locus_tag LOCUS_23310 760644 759523 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270078.1 protein_id gnl|my_center|LOCUS_23310 760816 761382 gene locus_tag LOCUS_23320 760816 761382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 761603 761424 gene locus_tag LOCUS_23330 761603 761424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 761828 762421 gene locus_tag LOCUS_23340 761828 762421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 762553 762846 gene locus_tag LOCUS_23350 762553 762846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 763458 763048 gene locus_tag LOCUS_23360 763458 763048 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063011.1 protein_id gnl|my_center|LOCUS_23360 764047 763652 gene locus_tag LOCUS_23370 764047 763652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 768441 764098 gene locus_tag LOCUS_23380 768441 764098 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909023.1 protein_id gnl|my_center|LOCUS_23380 768757 769275 gene locus_tag LOCUS_23390 768757 769275 CDS product DUF664 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224874.1 protein_id gnl|my_center|LOCUS_23390 769936 769298 gene locus_tag LOCUS_23400 769936 769298 CDS product NUDIX hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726735.1 protein_id gnl|my_center|LOCUS_23400 771355 770051 gene locus_tag LOCUS_23410 771355 770051 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528603.1 protein_id gnl|my_center|LOCUS_23410 771467 772447 gene locus_tag LOCUS_23420 771467 772447 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467673.1 protein_id gnl|my_center|LOCUS_23420 773052 772522 gene locus_tag LOCUS_23430 773052 772522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 773768 773298 gene locus_tag LOCUS_23440 773768 773298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 773834 774511 gene locus_tag LOCUS_23450 773834 774511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 774828 774508 gene locus_tag LOCUS_23460 774828 774508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 776777 774825 gene locus_tag LOCUS_23470 776777 774825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 777442 776774 gene locus_tag LOCUS_23480 777442 776774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 779068 778583 gene locus_tag LOCUS_23490 gene bfr 779068 778583 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895015.1 protein_id gnl|my_center|LOCUS_23490 779403 779191 gene locus_tag LOCUS_23500 779403 779191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 780218 779583 gene locus_tag LOCUS_23510 780218 779583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23510 781372 780140 gene locus_tag LOCUS_23520 781372 780140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23520 781806 781309 gene locus_tag LOCUS_23530 781806 781309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23530 782029 782994 gene locus_tag LOCUS_23540 782029 782994 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860401.1 protein_id gnl|my_center|LOCUS_23540 783020 783898 gene locus_tag LOCUS_23550 783020 783898 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554892.1 protein_id gnl|my_center|LOCUS_23550 784410 783928 gene locus_tag LOCUS_23560 784410 783928 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863309.1 protein_id gnl|my_center|LOCUS_23560 785344 784454 gene locus_tag LOCUS_23570 gene couO 785344 784454 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225127.1 protein_id gnl|my_center|LOCUS_23570 786252 785341 gene locus_tag LOCUS_23580 786252 785341 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013534.1 protein_id gnl|my_center|LOCUS_23580 786365 786835 gene locus_tag LOCUS_23590 786365 786835 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855798.1 protein_id gnl|my_center|LOCUS_23590 788410 786887 gene locus_tag LOCUS_23600 788410 786887 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225131.1 protein_id gnl|my_center|LOCUS_23600 790958 790161 gene locus_tag LOCUS_23610 790958 790161 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567940.1 protein_id gnl|my_center|LOCUS_23610 791618 791070 gene locus_tag LOCUS_23620 791618 791070 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027573.1 protein_id gnl|my_center|LOCUS_23620 >Feature sequence03 526 894 gene locus_tag LOCUS_23630 526 894 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086677666.1 protein_id gnl|my_center|LOCUS_23630 997 2346 gene locus_tag LOCUS_23640 997 2346 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229751.1 protein_id gnl|my_center|LOCUS_23640 2387 2626 gene locus_tag LOCUS_23650 2387 2626 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229750.1 protein_id gnl|my_center|LOCUS_23650 2632 3702 gene locus_tag LOCUS_23660 2632 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283989.1 protein_id gnl|my_center|LOCUS_23660 3841 5115 gene locus_tag LOCUS_23670 gene manA 3841 5115 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229748.1 protein_id gnl|my_center|LOCUS_23670 5323 6849 gene locus_tag LOCUS_23680 5323 6849 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229745.1 protein_id gnl|my_center|LOCUS_23680 7514 6897 gene locus_tag LOCUS_23690 7514 6897 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027253.1 protein_id gnl|my_center|LOCUS_23690 7701 9095 gene locus_tag LOCUS_23700 7701 9095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 11743 9137 gene locus_tag LOCUS_23710 11743 9137 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229743.1 protein_id gnl|my_center|LOCUS_23710 11947 12648 gene locus_tag LOCUS_23720 11947 12648 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229736.1 protein_id gnl|my_center|LOCUS_23720 12762 13427 gene locus_tag LOCUS_23730 gene mtrA 12762 13427 CDS product MtrAB system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005150760.1 protein_id gnl|my_center|LOCUS_23730 13933 15198 gene locus_tag LOCUS_23740 13933 15198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23740 15201 16952 gene locus_tag LOCUS_23750 15201 16952 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229728.1 protein_id gnl|my_center|LOCUS_23750 17165 17737 gene locus_tag LOCUS_23760 17165 17737 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054881065.1 protein_id gnl|my_center|LOCUS_23760 18250 18978 gene locus_tag LOCUS_23770 gene raiA 18250 18978 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229726.1 protein_id gnl|my_center|LOCUS_23770 19264 22137 gene locus_tag LOCUS_23780 gene secA 19264 22137 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229725.1 protein_id gnl|my_center|LOCUS_23780 22622 22236 gene locus_tag LOCUS_23790 22622 22236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 22749 23153 gene locus_tag LOCUS_23800 22749 23153 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229722.1 protein_id gnl|my_center|LOCUS_23800 23853 25382 gene locus_tag LOCUS_r00030 23853 25382 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 25686 28769 gene locus_tag LOCUS_r00040 25686 28769 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 29933 29085 gene locus_tag LOCUS_23810 29933 29085 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229721.1 protein_id gnl|my_center|LOCUS_23810 29932 31365 gene locus_tag LOCUS_23820 29932 31365 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_23820 31377 31868 gene locus_tag LOCUS_23830 31377 31868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229719.1 protein_id gnl|my_center|LOCUS_23830 32202 31915 gene locus_tag LOCUS_23840 32202 31915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 32277 32612 gene locus_tag LOCUS_23850 32277 32612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 33842 32829 gene locus_tag LOCUS_23860 gene rsgA 33842 32829 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229716.1 protein_id gnl|my_center|LOCUS_23860 35110 33842 gene locus_tag LOCUS_23870 gene aroA 35110 33842 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727983.1 protein_id gnl|my_center|LOCUS_23870 35232 35960 gene locus_tag LOCUS_23880 35232 35960 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229715.1 protein_id gnl|my_center|LOCUS_23880 35957 36568 gene locus_tag LOCUS_23890 35957 36568 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229714.1 protein_id gnl|my_center|LOCUS_23890 37062 36577 gene locus_tag LOCUS_23900 gene ybaK 37062 36577 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229713.1 protein_id gnl|my_center|LOCUS_23900 37560 37318 gene locus_tag LOCUS_23910 37560 37318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 37538 37882 gene locus_tag LOCUS_23920 37538 37882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 38077 38760 gene locus_tag LOCUS_23930 38077 38760 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_23930 38757 39089 gene locus_tag LOCUS_23940 38757 39089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 39450 39229 gene locus_tag LOCUS_23950 39450 39229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 39453 39668 gene locus_tag LOCUS_23960 39453 39668 CDS product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416887.1 protein_id gnl|my_center|LOCUS_23960 39707 41197 gene locus_tag LOCUS_23970 39707 41197 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229710.1 protein_id gnl|my_center|LOCUS_23970 41700 41446 gene locus_tag LOCUS_23980 gene whiB1 41700 41446 CDS product transcriptional regulator WhiB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893300.1 protein_id gnl|my_center|LOCUS_23980 42850 41945 gene locus_tag LOCUS_23990 42850 41945 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229709.1 protein_id gnl|my_center|LOCUS_23990 43092 43532 gene locus_tag LOCUS_24000 43092 43532 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229708.1 protein_id gnl|my_center|LOCUS_24000 43886 43551 gene locus_tag LOCUS_24010 43886 43551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 44425 43943 gene locus_tag LOCUS_24020 44425 43943 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229707.1 protein_id gnl|my_center|LOCUS_24020 46070 44451 gene locus_tag LOCUS_24030 46070 44451 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727668.1 protein_id gnl|my_center|LOCUS_24030 46775 46602 gene locus_tag LOCUS_24040 46775 46602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 46737 47126 gene locus_tag LOCUS_24050 46737 47126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 47977 47570 gene locus_tag LOCUS_24060 gene sodN 47977 47570 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_24060 48058 48372 gene locus_tag LOCUS_24070 48058 48372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 49088 48480 gene locus_tag LOCUS_24080 49088 48480 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229701.1 protein_id gnl|my_center|LOCUS_24080 49416 50636 gene locus_tag LOCUS_24090 49416 50636 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229700.1 protein_id gnl|my_center|LOCUS_24090 50884 53340 gene locus_tag LOCUS_24100 50884 53340 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084250.1 protein_id gnl|my_center|LOCUS_24100 54264 53371 gene locus_tag LOCUS_24110 54264 53371 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027366.1 protein_id gnl|my_center|LOCUS_24110 56010 54451 gene locus_tag LOCUS_24120 56010 54451 CDS product bis-aminopropyl spermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229699.1 protein_id gnl|my_center|LOCUS_24120 56242 57384 gene locus_tag LOCUS_24130 56242 57384 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229698.1 protein_id gnl|my_center|LOCUS_24130 57381 58055 gene locus_tag LOCUS_24140 57381 58055 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229697.1 protein_id gnl|my_center|LOCUS_24140 58019 58735 gene locus_tag LOCUS_24150 58019 58735 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229696.1 protein_id gnl|my_center|LOCUS_24150 58738 59622 gene locus_tag LOCUS_24160 58738 59622 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229695.1 protein_id gnl|my_center|LOCUS_24160 60580 59771 gene locus_tag LOCUS_24170 60580 59771 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223166.1 protein_id gnl|my_center|LOCUS_24170 60664 62214 gene locus_tag LOCUS_24180 gene hutH 60664 62214 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223167.1 protein_id gnl|my_center|LOCUS_24180 62237 63871 gene locus_tag LOCUS_24190 gene hutU 62237 63871 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223168.1 protein_id gnl|my_center|LOCUS_24190 63913 65127 gene locus_tag LOCUS_24200 63913 65127 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223169.1 protein_id gnl|my_center|LOCUS_24200 65124 66440 gene locus_tag LOCUS_24210 65124 66440 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 protein_id gnl|my_center|LOCUS_24210 66527 67687 gene locus_tag LOCUS_24220 gene hutI 66527 67687 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223171.1 protein_id gnl|my_center|LOCUS_24220 68592 67693 gene locus_tag LOCUS_24230 68592 67693 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972197.1 protein_id gnl|my_center|LOCUS_24230 69844 68663 gene locus_tag LOCUS_24240 69844 68663 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_24240 70875 69844 gene locus_tag LOCUS_24250 gene tdh 70875 69844 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031190.1 protein_id gnl|my_center|LOCUS_24250 71329 71003 gene locus_tag LOCUS_24260 71329 71003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 75298 71624 gene locus_tag LOCUS_24270 75298 71624 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467712.1 protein_id gnl|my_center|LOCUS_24270 79399 75659 gene locus_tag LOCUS_24280 79399 75659 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229685.1 protein_id gnl|my_center|LOCUS_24280 80452 79604 gene locus_tag LOCUS_24290 80452 79604 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229684.1 protein_id gnl|my_center|LOCUS_24290 81544 80453 gene locus_tag LOCUS_24300 81544 80453 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229683.1 protein_id gnl|my_center|LOCUS_24300 83038 81863 gene locus_tag LOCUS_24310 gene ald 83038 81863 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229678.1 protein_id gnl|my_center|LOCUS_24310 84636 83104 gene locus_tag LOCUS_24320 84636 83104 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229675.1 protein_id gnl|my_center|LOCUS_24320 85041 85415 gene locus_tag LOCUS_24330 gene gcvH 85041 85415 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_24330 85450 86811 gene locus_tag LOCUS_24340 85450 86811 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 protein_id gnl|my_center|LOCUS_24340 86984 87382 gene locus_tag LOCUS_24350 86984 87382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 87419 87658 gene locus_tag LOCUS_24360 87419 87658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 88119 87787 gene locus_tag LOCUS_24370 88119 87787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 88523 88122 gene locus_tag LOCUS_24380 88523 88122 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891506.1 protein_id gnl|my_center|LOCUS_24380 89027 88584 gene locus_tag LOCUS_24390 89027 88584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 89941 89213 gene locus_tag LOCUS_24400 89941 89213 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031142.1 protein_id gnl|my_center|LOCUS_24400 90109 91218 gene locus_tag LOCUS_24410 90109 91218 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031180.1 protein_id gnl|my_center|LOCUS_24410 91222 92364 gene locus_tag LOCUS_24420 91222 92364 CDS product long-chain specific acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031182.1 protein_id gnl|my_center|LOCUS_24420 92451 93620 gene locus_tag LOCUS_24430 92451 93620 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_24430 93650 94525 gene locus_tag LOCUS_24440 93650 94525 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 protein_id gnl|my_center|LOCUS_24440 94889 94536 gene locus_tag LOCUS_24450 94889 94536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 95357 95025 gene locus_tag LOCUS_24460 95357 95025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 96097 95354 gene locus_tag LOCUS_24470 96097 95354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 96901 96119 gene locus_tag LOCUS_24480 96901 96119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 98607 96916 gene locus_tag LOCUS_24490 98607 96916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 99115 98612 gene locus_tag LOCUS_24500 99115 98612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 99384 100889 gene locus_tag LOCUS_24510 99384 100889 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057464.1 protein_id gnl|my_center|LOCUS_24510 100889 102172 gene locus_tag LOCUS_24520 100889 102172 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_24520 102169 103497 gene locus_tag LOCUS_24530 102169 103497 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_24530 103580 105217 gene locus_tag LOCUS_24540 103580 105217 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731564.1 protein_id gnl|my_center|LOCUS_24540 105969 105271 gene locus_tag LOCUS_24550 105969 105271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 106363 107475 gene locus_tag LOCUS_24560 106363 107475 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528974.1 protein_id gnl|my_center|LOCUS_24560 107915 107535 gene locus_tag LOCUS_24570 107915 107535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 108291 109217 gene locus_tag LOCUS_24580 108291 109217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 109337 110548 gene locus_tag LOCUS_24590 109337 110548 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031183.1 protein_id gnl|my_center|LOCUS_24590 110799 113021 gene locus_tag LOCUS_24600 110799 113021 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031141.1 protein_id gnl|my_center|LOCUS_24600 113735 113118 gene locus_tag LOCUS_24610 113735 113118 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229440.1 protein_id gnl|my_center|LOCUS_24610 113842 115326 gene locus_tag LOCUS_24620 113842 115326 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230822.1 protein_id gnl|my_center|LOCUS_24620 115475 116242 gene locus_tag LOCUS_24630 115475 116242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 116381 117535 gene locus_tag LOCUS_24640 116381 117535 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228776.1 protein_id gnl|my_center|LOCUS_24640 117669 117863 gene locus_tag LOCUS_24650 117669 117863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 118137 119252 gene locus_tag LOCUS_24660 118137 119252 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767320.1 protein_id gnl|my_center|LOCUS_24660 119276 119680 gene locus_tag LOCUS_24670 119276 119680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742169.1 protein_id gnl|my_center|LOCUS_24670 120151 119771 gene locus_tag LOCUS_24680 120151 119771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 120449 122539 gene locus_tag LOCUS_24690 120449 122539 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091319019.1 protein_id gnl|my_center|LOCUS_24690 122894 122604 gene locus_tag LOCUS_24700 122894 122604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 123167 123889 gene locus_tag LOCUS_24710 123167 123889 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_24710 123944 124081 gene locus_tag LOCUS_24720 123944 124081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 125107 124220 gene locus_tag LOCUS_24730 125107 124220 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259109.1 protein_id gnl|my_center|LOCUS_24730 127451 125169 gene locus_tag LOCUS_24740 gene metE 127451 125169 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405914.1 protein_id gnl|my_center|LOCUS_24740 128014 129363 gene locus_tag LOCUS_24750 128014 129363 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230185.1 protein_id gnl|my_center|LOCUS_24750 129471 129905 gene locus_tag LOCUS_24760 gene arfB 129471 129905 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230741.1 protein_id gnl|my_center|LOCUS_24760 130064 130366 gene locus_tag LOCUS_24770 130064 130366 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230177.1 protein_id gnl|my_center|LOCUS_24770 130376 130741 gene locus_tag LOCUS_24780 130376 130741 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230176.1 protein_id gnl|my_center|LOCUS_24780 130738 132477 gene locus_tag LOCUS_24790 130738 132477 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230175.1 protein_id gnl|my_center|LOCUS_24790 132518 133219 gene locus_tag LOCUS_24800 132518 133219 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230174.1 protein_id gnl|my_center|LOCUS_24800 133209 133916 gene locus_tag LOCUS_24810 gene ureG 133209 133916 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230173.1 protein_id gnl|my_center|LOCUS_24810 133913 134677 gene locus_tag LOCUS_24820 133913 134677 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230172.1 protein_id gnl|my_center|LOCUS_24820 134674 135549 gene locus_tag LOCUS_24830 134674 135549 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794809.1 protein_id gnl|my_center|LOCUS_24830 136317 136084 gene locus_tag LOCUS_24840 136317 136084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 137024 136362 gene locus_tag LOCUS_24850 137024 136362 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224281.1 protein_id gnl|my_center|LOCUS_24850 137715 137059 gene locus_tag LOCUS_24860 137715 137059 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_24860 138143 138538 gene locus_tag LOCUS_24870 138143 138538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 138907 139599 gene locus_tag LOCUS_24880 138907 139599 CDS product glycoside hydrolase family 11 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978772.1 protein_id gnl|my_center|LOCUS_24880 139822 140505 gene locus_tag LOCUS_24890 139822 140505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 141079 141468 gene locus_tag LOCUS_24900 141079 141468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 142040 141810 gene locus_tag LOCUS_24910 142040 141810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 142668 143204 gene locus_tag LOCUS_24920 142668 143204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 143696 143848 gene locus_tag LOCUS_24930 143696 143848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 143864 144088 gene locus_tag LOCUS_24940 143864 144088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 144980 145648 gene locus_tag LOCUS_24950 144980 145648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 145754 145680 gene locus_tag LOCUS_t00190 145754 145680 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 145859 146728 gene locus_tag LOCUS_24960 145859 146728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 146819 147745 gene locus_tag LOCUS_24970 146819 147745 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229548.1 protein_id gnl|my_center|LOCUS_24970 147771 149504 gene locus_tag LOCUS_24980 gene argS 147771 149504 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229544.1 protein_id gnl|my_center|LOCUS_24980 149517 150935 gene locus_tag LOCUS_24990 gene lysA 149517 150935 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229543.1 protein_id gnl|my_center|LOCUS_24990 150936 152240 gene locus_tag LOCUS_25000 150936 152240 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229542.1 protein_id gnl|my_center|LOCUS_25000 152237 153328 gene locus_tag LOCUS_25010 gene thrC 152237 153328 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229541.1 protein_id gnl|my_center|LOCUS_25010 153325 154239 gene locus_tag LOCUS_25020 gene thrB 153325 154239 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229540.1 protein_id gnl|my_center|LOCUS_25020 154716 154910 gene locus_tag LOCUS_25030 154716 154910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 155095 157104 gene locus_tag LOCUS_25040 gene rho 155095 157104 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229539.1 protein_id gnl|my_center|LOCUS_25040 157369 157599 gene locus_tag LOCUS_25050 gene rpmE 157369 157599 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229538.1 protein_id gnl|my_center|LOCUS_25050 157693 158766 gene locus_tag LOCUS_25060 gene prfA 157693 158766 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229537.1 protein_id gnl|my_center|LOCUS_25060 158895 159764 gene locus_tag LOCUS_25070 gene prmC 158895 159764 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229533.1 protein_id gnl|my_center|LOCUS_25070 160634 159765 gene locus_tag LOCUS_25080 160634 159765 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812528.1 protein_id gnl|my_center|LOCUS_25080 160828 161472 gene locus_tag LOCUS_25090 160828 161472 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229531.1 protein_id gnl|my_center|LOCUS_25090 161863 163011 gene locus_tag LOCUS_25100 161863 163011 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229530.1 protein_id gnl|my_center|LOCUS_25100 163008 163463 gene locus_tag LOCUS_25110 163008 163463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 163510 163737 gene locus_tag LOCUS_25120 163510 163737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 163843 164625 gene locus_tag LOCUS_25130 gene atpB 163843 164625 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229528.1 protein_id gnl|my_center|LOCUS_25130 164672 164881 gene locus_tag LOCUS_25140 164672 164881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 164911 165474 gene locus_tag LOCUS_25150 164911 165474 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229526.1 protein_id gnl|my_center|LOCUS_25150 165528 166358 gene locus_tag LOCUS_25160 165528 166358 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229525.1 protein_id gnl|my_center|LOCUS_25160 166434 168086 gene locus_tag LOCUS_25170 gene atpA 166434 168086 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229524.1 protein_id gnl|my_center|LOCUS_25170 168097 169023 gene locus_tag LOCUS_25180 168097 169023 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229523.1 protein_id gnl|my_center|LOCUS_25180 169091 170458 gene locus_tag LOCUS_25190 gene atpD 169091 170458 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229522.1 protein_id gnl|my_center|LOCUS_25190 170611 170976 gene locus_tag LOCUS_25200 170611 170976 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229521.1 protein_id gnl|my_center|LOCUS_25200 170993 171436 gene locus_tag LOCUS_25210 170993 171436 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229520.1 protein_id gnl|my_center|LOCUS_25210 172074 171490 gene locus_tag LOCUS_25220 172074 171490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25220 172039 172293 gene locus_tag LOCUS_25230 172039 172293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 172468 172959 gene locus_tag LOCUS_25240 172468 172959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 173036 173506 gene locus_tag LOCUS_25250 173036 173506 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223641.1 protein_id gnl|my_center|LOCUS_25250 173623 175776 gene locus_tag LOCUS_25260 173623 175776 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404979.1 protein_id gnl|my_center|LOCUS_25260 176417 175845 gene locus_tag LOCUS_25270 176417 175845 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406839.1 protein_id gnl|my_center|LOCUS_25270 176633 177814 gene locus_tag LOCUS_25280 gene murA 176633 177814 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229517.1 protein_id gnl|my_center|LOCUS_25280 178273 177824 gene locus_tag LOCUS_25290 178273 177824 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224598.1 protein_id gnl|my_center|LOCUS_25290 178377 178787 gene locus_tag LOCUS_25300 178377 178787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224599.1 protein_id gnl|my_center|LOCUS_25300 179429 178788 gene locus_tag LOCUS_25310 179429 178788 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256576.1 protein_id gnl|my_center|LOCUS_25310 180001 179456 gene locus_tag LOCUS_25320 180001 179456 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229502.1 protein_id gnl|my_center|LOCUS_25320 181428 180010 gene locus_tag LOCUS_25330 181428 180010 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027796.1 protein_id gnl|my_center|LOCUS_25330 181496 182194 gene locus_tag LOCUS_25340 gene nucS 181496 182194 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467679.1 protein_id gnl|my_center|LOCUS_25340 182552 182196 gene locus_tag LOCUS_25350 182552 182196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 183825 182608 gene locus_tag LOCUS_25360 183825 182608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 184270 185949 gene locus_tag LOCUS_25370 184270 185949 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229498.1 protein_id gnl|my_center|LOCUS_25370 185962 186228 gene locus_tag LOCUS_25380 185962 186228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229497.1 protein_id gnl|my_center|LOCUS_25380 186687 186487 gene locus_tag LOCUS_25390 186687 186487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 187079 188602 gene locus_tag LOCUS_25400 187079 188602 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_25400 188641 189627 gene locus_tag LOCUS_25410 gene dhaK 188641 189627 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229495.1 protein_id gnl|my_center|LOCUS_25410 189641 190294 gene locus_tag LOCUS_25420 gene dhaL 189641 190294 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229494.1 protein_id gnl|my_center|LOCUS_25420 190291 190977 gene locus_tag LOCUS_25430 gene dhaM 190291 190977 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229493.1 protein_id gnl|my_center|LOCUS_25430 191065 192063 gene locus_tag LOCUS_25440 191065 192063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 192103 192408 gene locus_tag LOCUS_25450 192103 192408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229480.1 protein_id gnl|my_center|LOCUS_25450 192460 193209 gene locus_tag LOCUS_25460 192460 193209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 193559 193221 gene locus_tag LOCUS_25470 193559 193221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 193813 193556 gene locus_tag LOCUS_25480 193813 193556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 193985 195742 gene locus_tag LOCUS_25490 gene argS 193985 195742 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028896.1 protein_id gnl|my_center|LOCUS_25490 195821 196633 gene locus_tag LOCUS_25500 195821 196633 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229478.1 protein_id gnl|my_center|LOCUS_25500 196743 199085 gene locus_tag LOCUS_25510 196743 199085 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228011.1 protein_id gnl|my_center|LOCUS_25510 200673 199111 gene locus_tag LOCUS_25520 200673 199111 CDS product chromosome segregation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091306094.1 protein_id gnl|my_center|LOCUS_25520 201266 200817 gene locus_tag LOCUS_25530 gene mce 201266 200817 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223476.1 protein_id gnl|my_center|LOCUS_25530 201399 202586 gene locus_tag LOCUS_25540 201399 202586 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223477.1 protein_id gnl|my_center|LOCUS_25540 202622 203515 gene locus_tag LOCUS_25550 202622 203515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 204852 203512 gene locus_tag LOCUS_25560 204852 203512 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728865.1 protein_id gnl|my_center|LOCUS_25560 205322 204903 gene locus_tag LOCUS_25570 205322 204903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 205743 205516 gene locus_tag LOCUS_25580 205743 205516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 205624 206136 gene locus_tag LOCUS_25590 205624 206136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 206917 206417 gene locus_tag LOCUS_25600 206917 206417 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223498.1 protein_id gnl|my_center|LOCUS_25600 207060 207362 gene locus_tag LOCUS_25610 207060 207362 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726762.1 protein_id gnl|my_center|LOCUS_25610 207717 207430 gene locus_tag LOCUS_25620 207717 207430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 208031 208993 gene locus_tag LOCUS_25630 208031 208993 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223501.1 protein_id gnl|my_center|LOCUS_25630 210663 209254 gene locus_tag LOCUS_25640 210663 209254 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284439.1 protein_id gnl|my_center|LOCUS_25640 212176 210854 gene locus_tag LOCUS_25650 212176 210854 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110137.1 protein_id gnl|my_center|LOCUS_25650 212241 214793 gene locus_tag LOCUS_25660 gene glgP 212241 214793 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223503.1 protein_id gnl|my_center|LOCUS_25660 216003 214840 gene locus_tag LOCUS_25670 216003 214840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 216207 216995 gene locus_tag LOCUS_25680 216207 216995 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_25680 217071 217853 gene locus_tag LOCUS_25690 217071 217853 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223512.1 protein_id gnl|my_center|LOCUS_25690 217972 219135 gene locus_tag LOCUS_25700 217972 219135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223514.1 protein_id gnl|my_center|LOCUS_25700 219417 223349 gene locus_tag LOCUS_25710 gene hrpA 219417 223349 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_25710 224263 223355 gene locus_tag LOCUS_25720 224263 223355 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_25720 224391 225659 gene locus_tag LOCUS_25730 224391 225659 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230802.1 protein_id gnl|my_center|LOCUS_25730 226256 225723 gene locus_tag LOCUS_25740 226256 225723 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065204181.1 protein_id gnl|my_center|LOCUS_25740 227115 226273 gene locus_tag LOCUS_25750 227115 226273 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223549.1 protein_id gnl|my_center|LOCUS_25750 227404 228186 gene locus_tag LOCUS_25760 227404 228186 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_25760 228224 229183 gene locus_tag LOCUS_25770 228224 229183 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223551.1 protein_id gnl|my_center|LOCUS_25770 229357 230193 gene locus_tag LOCUS_25780 229357 230193 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223552.1 protein_id gnl|my_center|LOCUS_25780 230295 231041 gene locus_tag LOCUS_25790 230295 231041 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223553.1 protein_id gnl|my_center|LOCUS_25790 231109 232344 gene locus_tag LOCUS_25800 231109 232344 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223557.1 protein_id gnl|my_center|LOCUS_25800 232347 233435 gene locus_tag LOCUS_25810 gene mnmA 232347 233435 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223558.1 protein_id gnl|my_center|LOCUS_25810 234372 233455 gene locus_tag LOCUS_25820 234372 233455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 235141 234311 gene locus_tag LOCUS_25830 235141 234311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 235453 236484 gene locus_tag LOCUS_25840 235453 236484 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284403.1 protein_id gnl|my_center|LOCUS_25840 236626 236551 gene locus_tag LOCUS_t00200 236626 236551 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 237381 236746 gene locus_tag LOCUS_25850 gene orn 237381 236746 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831683.1 protein_id gnl|my_center|LOCUS_25850 239133 237457 gene locus_tag LOCUS_25860 239133 237457 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227752.1 protein_id gnl|my_center|LOCUS_25860 239396 239815 gene locus_tag LOCUS_25870 239396 239815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 240602 239862 gene locus_tag LOCUS_25880 240602 239862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 240977 240675 gene locus_tag LOCUS_25890 240977 240675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 241296 242093 gene locus_tag LOCUS_25900 gene thiD 241296 242093 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534771.1 protein_id gnl|my_center|LOCUS_25900 242137 242835 gene locus_tag LOCUS_25910 gene tenA 242137 242835 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066884.1 protein_id gnl|my_center|LOCUS_25910 243995 242847 gene locus_tag LOCUS_25920 243995 242847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 244624 244193 gene locus_tag LOCUS_25930 244624 244193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 245578 244640 gene locus_tag LOCUS_25940 245578 244640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 246357 245695 gene locus_tag LOCUS_25950 246357 245695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 247431 246364 gene locus_tag LOCUS_25960 247431 246364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 247775 249172 gene locus_tag LOCUS_25970 247775 249172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 249319 256443 gene locus_tag LOCUS_25980 gene dhbF 249319 256443 CDS product non-ribosomal peptide synthetase DhbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968094.1 protein_id gnl|my_center|LOCUS_25980 256473 256730 gene locus_tag LOCUS_25990 256473 256730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 256741 258195 gene locus_tag LOCUS_26000 256741 258195 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644775.1 protein_id gnl|my_center|LOCUS_26000 258300 259133 gene locus_tag LOCUS_26010 258300 259133 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977203.1 protein_id gnl|my_center|LOCUS_26010 259361 260746 gene locus_tag LOCUS_26020 259361 260746 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062698019.1 protein_id gnl|my_center|LOCUS_26020 260794 261456 gene locus_tag LOCUS_26030 260794 261456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 261574 262704 gene locus_tag LOCUS_26040 261574 262704 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028601.1 protein_id gnl|my_center|LOCUS_26040 262900 263274 gene locus_tag LOCUS_26050 262900 263274 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666291.1 protein_id gnl|my_center|LOCUS_26050 263271 264185 gene locus_tag LOCUS_26060 263271 264185 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224678.1 protein_id gnl|my_center|LOCUS_26060 265503 264187 gene locus_tag LOCUS_26070 265503 264187 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227055.1 protein_id gnl|my_center|LOCUS_26070 266324 265722 gene locus_tag LOCUS_26080 266324 265722 CDS product maleylpyruvate isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462751.1 protein_id gnl|my_center|LOCUS_26080 266456 267025 gene locus_tag LOCUS_26090 266456 267025 CDS product snapalysin family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971509.1 protein_id gnl|my_center|LOCUS_26090 267341 267117 gene locus_tag LOCUS_26100 267341 267117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 268309 269133 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtccgcaccgtccctacgagggatcgcaac 269662 269219 gene locus_tag LOCUS_26110 269662 269219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 270915 269659 gene locus_tag LOCUS_26120 270915 269659 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258138.1 protein_id gnl|my_center|LOCUS_26120 272096 270912 gene locus_tag LOCUS_26130 272096 270912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 272686 272135 gene locus_tag LOCUS_26140 272686 272135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 274065 272683 gene locus_tag LOCUS_26150 274065 272683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 276053 274065 gene locus_tag LOCUS_26160 276053 274065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 276160 277251 gene locus_tag LOCUS_26170 276160 277251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 277360 277652 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctcgcaccgtccctacgagggatcgcaac 277726 278457 gene locus_tag LOCUS_26180 277726 278457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 278660 279287 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcacccgtccctacgagggatcgcaac 279405 279668 gene locus_tag LOCUS_26190 279405 279668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 280420 279992 gene locus_tag LOCUS_26200 280420 279992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 280631 281806 gene locus_tag LOCUS_26210 280631 281806 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816310.1 protein_id gnl|my_center|LOCUS_26210 281937 282689 gene locus_tag LOCUS_26220 281937 282689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 282975 282826 gene locus_tag LOCUS_26230 282975 282826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 284100 283213 gene locus_tag LOCUS_26240 284100 283213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 284940 284242 gene locus_tag LOCUS_26250 284940 284242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973403.1 protein_id gnl|my_center|LOCUS_26250 285369 285109 gene locus_tag LOCUS_26260 285369 285109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 285950 285369 gene locus_tag LOCUS_26270 285950 285369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 286144 285950 gene locus_tag LOCUS_26280 286144 285950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 286312 286617 gene locus_tag LOCUS_26290 286312 286617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 288443 286626 gene locus_tag LOCUS_26300 288443 286626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 289699 288515 gene locus_tag LOCUS_26310 289699 288515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 290117 289701 gene locus_tag LOCUS_26320 290117 289701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 290679 290131 gene locus_tag LOCUS_26330 290679 290131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 291107 290679 gene locus_tag LOCUS_26340 291107 290679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 291327 291088 gene locus_tag LOCUS_26350 291327 291088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 292430 291324 gene locus_tag LOCUS_26360 292430 291324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 292735 292427 gene locus_tag LOCUS_26370 292735 292427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 293301 292735 gene locus_tag LOCUS_26380 293301 292735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 293571 293389 gene locus_tag LOCUS_26390 293571 293389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 293860 293654 gene locus_tag LOCUS_26400 293860 293654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 294755 293841 gene locus_tag LOCUS_26410 294755 293841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 295241 294759 gene locus_tag LOCUS_26420 295241 294759 CDS product DUF5706 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749530.1 protein_id gnl|my_center|LOCUS_26420 295497 295243 gene locus_tag LOCUS_26430 295497 295243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 295640 296005 gene locus_tag LOCUS_26440 295640 296005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 296262 297659 gene locus_tag LOCUS_26450 296262 297659 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141748495.1 protein_id gnl|my_center|LOCUS_26450 297872 298519 gene locus_tag LOCUS_26460 297872 298519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 298512 298820 gene locus_tag LOCUS_26470 298512 298820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 298892 300067 gene locus_tag LOCUS_26480 298892 300067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 300115 300768 gene locus_tag LOCUS_26490 300115 300768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 300989 301681 gene locus_tag LOCUS_26500 300989 301681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 302608 301694 gene locus_tag LOCUS_26510 302608 301694 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230494.1 protein_id gnl|my_center|LOCUS_26510 302890 303330 gene locus_tag LOCUS_26520 302890 303330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 303642 304454 gene locus_tag LOCUS_26530 gene cas1b 303642 304454 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393228.1 protein_id gnl|my_center|LOCUS_26530 304457 304720 gene locus_tag LOCUS_26540 304457 304720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 304833 305460 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgcactgtccctacgagggatcgcaac 307869 306052 gene locus_tag LOCUS_26550 307869 306052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 308034 307958 gene locus_tag LOCUS_t00210 308034 307958 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 308501 308938 gene locus_tag LOCUS_26560 308501 308938 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909031.1 protein_id gnl|my_center|LOCUS_26560 309062 310738 gene locus_tag LOCUS_26570 gene ettA 309062 310738 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412708.1 protein_id gnl|my_center|LOCUS_26570 310759 312843 gene locus_tag LOCUS_26580 310759 312843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 312986 317953 gene locus_tag LOCUS_26590 312986 317953 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228597.1 protein_id gnl|my_center|LOCUS_26590 318182 318625 gene locus_tag LOCUS_26600 318182 318625 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228596.1 protein_id gnl|my_center|LOCUS_26600 318618 319259 gene locus_tag LOCUS_26610 318618 319259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228595.1 protein_id gnl|my_center|LOCUS_26610 320609 319290 gene locus_tag LOCUS_26620 320609 319290 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775829.1 protein_id gnl|my_center|LOCUS_26620 321898 320702 gene locus_tag LOCUS_26630 321898 320702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 322340 321957 gene locus_tag LOCUS_26640 322340 321957 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742154.1 protein_id gnl|my_center|LOCUS_26640 323340 322363 gene locus_tag LOCUS_26650 323340 322363 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228591.1 protein_id gnl|my_center|LOCUS_26650 325632 323512 gene locus_tag LOCUS_26660 325632 323512 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_26660 325857 326471 gene locus_tag LOCUS_26670 325857 326471 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840499.1 protein_id gnl|my_center|LOCUS_26670 326809 326483 gene locus_tag LOCUS_26680 326809 326483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 327173 327430 gene locus_tag LOCUS_26690 327173 327430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228588.1 protein_id gnl|my_center|LOCUS_26690 327417 327920 gene locus_tag LOCUS_26700 327417 327920 CDS product DUF5130 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228587.1 protein_id gnl|my_center|LOCUS_26700 328737 327976 gene locus_tag LOCUS_26710 328737 327976 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083699.1 protein_id gnl|my_center|LOCUS_26710 331448 328869 gene locus_tag LOCUS_26720 gene pepN 331448 328869 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228585.1 protein_id gnl|my_center|LOCUS_26720 331648 332289 gene locus_tag LOCUS_26730 331648 332289 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730011.1 protein_id gnl|my_center|LOCUS_26730 333295 332498 gene locus_tag LOCUS_26740 333295 332498 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228583.1 protein_id gnl|my_center|LOCUS_26740 334079 333300 gene locus_tag LOCUS_26750 334079 333300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 334057 334557 gene locus_tag LOCUS_26760 334057 334557 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467526.1 protein_id gnl|my_center|LOCUS_26760 334562 334915 gene locus_tag LOCUS_26770 334562 334915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 334919 335728 gene locus_tag LOCUS_26780 334919 335728 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_26780 336508 335753 gene locus_tag LOCUS_26790 336508 335753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 337818 336595 gene locus_tag LOCUS_26800 gene eis2 337818 336595 CDS product amikacin resistance N-acetyltransferase Eis2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079811.1 protein_id gnl|my_center|LOCUS_26800 338491 337865 gene locus_tag LOCUS_26810 338491 337865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 340065 338593 gene locus_tag LOCUS_26820 340065 338593 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644775.1 protein_id gnl|my_center|LOCUS_26820 340331 340260 gene locus_tag LOCUS_t00220 340331 340260 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 340429 340503 gene locus_tag LOCUS_t00230 340429 340503 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 340579 340773 gene locus_tag LOCUS_26830 340579 340773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 341712 340786 gene locus_tag LOCUS_26840 341712 340786 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 protein_id gnl|my_center|LOCUS_26840 341924 343327 gene locus_tag LOCUS_26850 gene tig 341924 343327 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228513.1 protein_id gnl|my_center|LOCUS_26850 343501 344127 gene locus_tag LOCUS_26860 343501 344127 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228512.1 protein_id gnl|my_center|LOCUS_26860 344178 344810 gene locus_tag LOCUS_26870 344178 344810 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228511.1 protein_id gnl|my_center|LOCUS_26870 345015 346304 gene locus_tag LOCUS_26880 gene clpX 345015 346304 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004562779.1 protein_id gnl|my_center|LOCUS_26880 346436 347065 gene locus_tag LOCUS_26890 346436 347065 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887590.1 protein_id gnl|my_center|LOCUS_26890 348537 347137 gene locus_tag LOCUS_26900 348537 347137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 348717 350057 gene locus_tag LOCUS_26910 348717 350057 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223028.1 protein_id gnl|my_center|LOCUS_26910 350925 350065 gene locus_tag LOCUS_26920 350925 350065 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228508.1 protein_id gnl|my_center|LOCUS_26920 351826 350981 gene locus_tag LOCUS_26930 gene fdhD 351826 350981 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228505.1 protein_id gnl|my_center|LOCUS_26930 352791 352330 gene locus_tag LOCUS_26940 352791 352330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 352947 353984 gene locus_tag LOCUS_26950 352947 353984 CDS product SEC-C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028623.1 protein_id gnl|my_center|LOCUS_26950 353915 354124 gene locus_tag LOCUS_26960 353915 354124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 354151 354615 gene locus_tag LOCUS_26970 354151 354615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 354612 354917 gene locus_tag LOCUS_26980 354612 354917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 354918 356225 gene locus_tag LOCUS_26990 354918 356225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 356209 357540 gene locus_tag LOCUS_27000 356209 357540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 358261 357569 gene locus_tag LOCUS_27010 358261 357569 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028067.1 protein_id gnl|my_center|LOCUS_27010 358331 360964 gene locus_tag LOCUS_27020 358331 360964 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228497.1 protein_id gnl|my_center|LOCUS_27020 361052 362419 gene locus_tag LOCUS_27030 361052 362419 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228491.1 protein_id gnl|my_center|LOCUS_27030 362416 362868 gene locus_tag LOCUS_27040 362416 362868 CDS product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228490.1 protein_id gnl|my_center|LOCUS_27040 362923 363183 gene locus_tag LOCUS_27050 362923 363183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 363180 363617 gene locus_tag LOCUS_27060 363180 363617 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414624.1 protein_id gnl|my_center|LOCUS_27060 364714 363614 gene locus_tag LOCUS_27070 364714 363614 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762008.1 protein_id gnl|my_center|LOCUS_27070 364876 365112 gene locus_tag LOCUS_27080 364876 365112 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969018.1 protein_id gnl|my_center|LOCUS_27080 365096 365521 gene locus_tag LOCUS_27090 365096 365521 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243822.1 protein_id gnl|my_center|LOCUS_27090 365626 366042 gene locus_tag LOCUS_27100 gene ndk 365626 366042 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228487.1 protein_id gnl|my_center|LOCUS_27100 366039 366575 gene locus_tag LOCUS_27110 366039 366575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 366637 368604 gene locus_tag LOCUS_27120 366637 368604 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_27120 368901 369599 gene locus_tag LOCUS_27130 368901 369599 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_27130 369781 372918 gene locus_tag LOCUS_27140 369781 372918 CDS product translation initiation factor IF-2 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228480.1 protein_id gnl|my_center|LOCUS_27140 373171 373812 gene locus_tag LOCUS_27150 373171 373812 CDS product DUF6230 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030235.1 protein_id gnl|my_center|LOCUS_27150 373856 374386 gene locus_tag LOCUS_27160 373856 374386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 374383 375195 gene locus_tag LOCUS_27170 374383 375195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 376265 375252 gene locus_tag LOCUS_27180 376265 375252 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405124.1 protein_id gnl|my_center|LOCUS_27180 378025 376298 gene locus_tag LOCUS_27190 378025 376298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 378417 378725 gene locus_tag LOCUS_27200 gene rplU 378417 378725 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067132.1 protein_id gnl|my_center|LOCUS_27200 378740 378997 gene locus_tag LOCUS_27210 gene rpmA 378740 378997 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228479.1 protein_id gnl|my_center|LOCUS_27210 379094 380602 gene locus_tag LOCUS_27220 gene obgE 379094 380602 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228478.1 protein_id gnl|my_center|LOCUS_27220 380599 381729 gene locus_tag LOCUS_27230 gene proB 380599 381729 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228477.1 protein_id gnl|my_center|LOCUS_27230 381793 382035 gene locus_tag LOCUS_27240 381793 382035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 382032 382364 gene locus_tag LOCUS_27250 382032 382364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 383774 382479 gene locus_tag LOCUS_27260 383774 382479 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270331.1 protein_id gnl|my_center|LOCUS_27260 386050 383882 gene locus_tag LOCUS_27270 386050 383882 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228470.1 protein_id gnl|my_center|LOCUS_27270 386090 387400 gene locus_tag LOCUS_27280 386090 387400 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_27280 387578 388180 gene locus_tag LOCUS_27290 387578 388180 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228785.1 protein_id gnl|my_center|LOCUS_27290 388291 389502 gene locus_tag LOCUS_27300 388291 389502 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285235.1 protein_id gnl|my_center|LOCUS_27300 389539 389760 gene locus_tag LOCUS_27310 389539 389760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 389757 390446 gene locus_tag LOCUS_27320 gene nadD 389757 390446 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081655767.1 protein_id gnl|my_center|LOCUS_27320 390540 390941 gene locus_tag LOCUS_27330 gene rsfS 390540 390941 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067112.1 protein_id gnl|my_center|LOCUS_27330 390938 391552 gene locus_tag LOCUS_27340 390938 391552 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228468.1 protein_id gnl|my_center|LOCUS_27340 391622 392485 gene locus_tag LOCUS_27350 391622 392485 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228466.1 protein_id gnl|my_center|LOCUS_27350 392644 393501 gene locus_tag LOCUS_27360 392644 393501 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228465.1 protein_id gnl|my_center|LOCUS_27360 393706 395886 gene locus_tag LOCUS_27370 393706 395886 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228464.1 protein_id gnl|my_center|LOCUS_27370 397161 395890 gene locus_tag LOCUS_27380 gene thrC 397161 395890 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228462.1 protein_id gnl|my_center|LOCUS_27380 397411 398379 gene locus_tag LOCUS_27390 gene holA 397411 398379 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228461.1 protein_id gnl|my_center|LOCUS_27390 398697 398437 gene locus_tag LOCUS_27400 gene rpsT 398697 398437 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228460.1 protein_id gnl|my_center|LOCUS_27400 399066 398851 gene locus_tag LOCUS_27410 399066 398851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015423.1 protein_id gnl|my_center|LOCUS_27410 399257 399063 gene locus_tag LOCUS_27420 399257 399063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 399602 399805 gene locus_tag LOCUS_27430 399602 399805 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011562175.1 protein_id gnl|my_center|LOCUS_27430 400341 400721 gene locus_tag LOCUS_27440 400341 400721 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228458.1 protein_id gnl|my_center|LOCUS_27440 400834 402702 gene locus_tag LOCUS_27450 gene lepA 400834 402702 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228456.1 protein_id gnl|my_center|LOCUS_27450 403259 402837 gene locus_tag LOCUS_27460 403259 402837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 404985 403519 gene locus_tag LOCUS_27470 404985 403519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 405093 406424 gene locus_tag LOCUS_27480 gene aceA 405093 406424 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223536.1 protein_id gnl|my_center|LOCUS_27480 406664 407776 gene locus_tag LOCUS_27490 406664 407776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 407938 408564 gene locus_tag LOCUS_27500 407938 408564 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894928.1 protein_id gnl|my_center|LOCUS_27500 409129 408575 gene locus_tag LOCUS_27510 409129 408575 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973328.1 protein_id gnl|my_center|LOCUS_27510 409273 410772 gene locus_tag LOCUS_27520 409273 410772 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109992.1 protein_id gnl|my_center|LOCUS_27520 410806 411984 gene locus_tag LOCUS_27530 410806 411984 CDS product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086732.1 protein_id gnl|my_center|LOCUS_27530 411981 413033 gene locus_tag LOCUS_27540 411981 413033 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730435.1 protein_id gnl|my_center|LOCUS_27540 413085 413978 gene locus_tag LOCUS_27550 gene mmsB 413085 413978 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531206.1 protein_id gnl|my_center|LOCUS_27550 414095 414358 gene locus_tag LOCUS_27560 414095 414358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 414425 414601 gene locus_tag LOCUS_27570 414425 414601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 414645 415013 gene locus_tag LOCUS_27580 414645 415013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 415993 415022 gene locus_tag LOCUS_27590 415993 415022 CDS product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029244.1 protein_id gnl|my_center|LOCUS_27590 416179 416817 gene locus_tag LOCUS_27600 416179 416817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27600 416818 417291 gene locus_tag LOCUS_27610 416818 417291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27610 418018 417239 gene locus_tag LOCUS_27620 418018 417239 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_27620 420444 418081 gene locus_tag LOCUS_27630 420444 418081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 425277 420451 gene locus_tag LOCUS_27640 425277 420451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 427717 425693 gene locus_tag LOCUS_27650 427717 425693 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226130.1 protein_id gnl|my_center|LOCUS_27650 429008 427749 gene locus_tag LOCUS_27660 429008 427749 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226140.1 protein_id gnl|my_center|LOCUS_27660 429976 429215 gene locus_tag LOCUS_27670 429976 429215 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228436.1 protein_id gnl|my_center|LOCUS_27670 431355 430003 gene locus_tag LOCUS_27680 431355 430003 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228435.1 protein_id gnl|my_center|LOCUS_27680 432315 431356 gene locus_tag LOCUS_27690 gene cysD 432315 431356 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228434.1 protein_id gnl|my_center|LOCUS_27690 433052 432327 gene locus_tag LOCUS_27700 433052 432327 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228433.1 protein_id gnl|my_center|LOCUS_27700 433257 433096 gene locus_tag LOCUS_27710 433257 433096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228432.1 protein_id gnl|my_center|LOCUS_27710 434966 433254 gene locus_tag LOCUS_27720 434966 433254 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228431.1 protein_id gnl|my_center|LOCUS_27720 435266 436492 gene locus_tag LOCUS_27730 gene hemW 435266 436492 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285807.1 protein_id gnl|my_center|LOCUS_27730 436877 436575 gene locus_tag LOCUS_27740 436877 436575 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060335.1 protein_id gnl|my_center|LOCUS_27740 437066 438088 gene locus_tag LOCUS_27750 gene hrcA 437066 438088 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228404.1 protein_id gnl|my_center|LOCUS_27750 438160 439338 gene locus_tag LOCUS_27760 gene dnaJ 438160 439338 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228403.1 protein_id gnl|my_center|LOCUS_27760 439352 440101 gene locus_tag LOCUS_27770 439352 440101 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228402.1 protein_id gnl|my_center|LOCUS_27770 440207 441277 gene locus_tag LOCUS_27780 440207 441277 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228400.1 protein_id gnl|my_center|LOCUS_27780 441274 441819 gene locus_tag LOCUS_27790 gene ybeY 441274 441819 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228399.1 protein_id gnl|my_center|LOCUS_27790 441914 443284 gene locus_tag LOCUS_27800 441914 443284 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_27800 443277 443636 gene locus_tag LOCUS_27810 443277 443636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 444237 443971 gene locus_tag LOCUS_27820 444237 443971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 444305 444502 gene locus_tag LOCUS_27830 444305 444502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27830 444589 444996 gene locus_tag LOCUS_27840 444589 444996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27840 445650 445150 gene locus_tag LOCUS_27850 445650 445150 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487439.1 protein_id gnl|my_center|LOCUS_27850 445798 447483 gene locus_tag LOCUS_27860 445798 447483 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227541.1 protein_id gnl|my_center|LOCUS_27860 447506 448414 gene locus_tag LOCUS_27870 gene era 447506 448414 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228396.1 protein_id gnl|my_center|LOCUS_27870 448954 448571 gene locus_tag LOCUS_27880 448954 448571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 448878 449267 gene locus_tag LOCUS_27890 448878 449267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27890 449294 449698 gene locus_tag LOCUS_27900 449294 449698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 449840 450601 gene locus_tag LOCUS_27910 449840 450601 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804425.1 protein_id gnl|my_center|LOCUS_27910 450708 451541 gene locus_tag LOCUS_27920 gene recO 450708 451541 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228390.1 protein_id gnl|my_center|LOCUS_27920 451577 452194 gene locus_tag LOCUS_27930 451577 452194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 452218 453057 gene locus_tag LOCUS_27940 452218 453057 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228389.1 protein_id gnl|my_center|LOCUS_27940 453054 453485 gene locus_tag LOCUS_27950 453054 453485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228388.1 protein_id gnl|my_center|LOCUS_27950 453704 453495 gene locus_tag LOCUS_27960 453704 453495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 454276 453854 gene locus_tag LOCUS_27970 454276 453854 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228384.1 protein_id gnl|my_center|LOCUS_27970 454767 454273 gene locus_tag LOCUS_27980 454767 454273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 454766 455056 gene locus_tag LOCUS_27990 454766 455056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 455095 456480 gene locus_tag LOCUS_28000 455095 456480 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228379.1 protein_id gnl|my_center|LOCUS_28000 456677 457348 gene locus_tag LOCUS_28010 456677 457348 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228374.1 protein_id gnl|my_center|LOCUS_28010 457409 458695 gene locus_tag LOCUS_28020 457409 458695 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228373.1 protein_id gnl|my_center|LOCUS_28020 458833 459006 gene locus_tag LOCUS_28030 458833 459006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 459105 460232 gene locus_tag LOCUS_28040 459105 460232 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228372.1 protein_id gnl|my_center|LOCUS_28040 460403 460882 gene locus_tag LOCUS_28050 460403 460882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28050 462535 462311 gene locus_tag LOCUS_28060 462535 462311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28060 463211 462435 gene locus_tag LOCUS_28070 463211 462435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28070 463167 465167 gene locus_tag LOCUS_28080 gene dnaG 463167 465167 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228362.1 protein_id gnl|my_center|LOCUS_28080 465164 465724 gene locus_tag LOCUS_28090 465164 465724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467493.1 protein_id gnl|my_center|LOCUS_28090 465798 466556 gene locus_tag LOCUS_28100 465798 466556 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228360.1 protein_id gnl|my_center|LOCUS_28100 466756 466828 gene locus_tag LOCUS_t00240 466756 466828 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 466901 467830 gene locus_tag LOCUS_28110 466901 467830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 468324 468064 gene locus_tag LOCUS_28120 468324 468064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 468242 468451 gene locus_tag LOCUS_28130 468242 468451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 468575 468650 gene locus_tag LOCUS_t00250 468575 468650 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 468822 469001 gene locus_tag LOCUS_28140 468822 469001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 470096 469383 gene locus_tag LOCUS_28150 470096 469383 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031654.1 protein_id gnl|my_center|LOCUS_28150 471006 471287 gene locus_tag LOCUS_28160 471006 471287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 471910 471524 gene locus_tag LOCUS_28170 471910 471524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 472519 472911 gene locus_tag LOCUS_28180 472519 472911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 474247 473072 gene locus_tag LOCUS_28190 474247 473072 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089160.1 protein_id gnl|my_center|LOCUS_28190 474400 474804 gene locus_tag LOCUS_28200 474400 474804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 474801 475196 gene locus_tag LOCUS_28210 474801 475196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 475397 475203 gene locus_tag LOCUS_28220 475397 475203 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728261.1 protein_id gnl|my_center|LOCUS_28220 477565 475409 gene locus_tag LOCUS_28230 477565 475409 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084321.1 protein_id gnl|my_center|LOCUS_28230 478650 477832 gene locus_tag LOCUS_28240 478650 477832 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_28240 478958 479506 gene locus_tag LOCUS_28250 478958 479506 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229904.1 protein_id gnl|my_center|LOCUS_28250 479503 480552 gene locus_tag LOCUS_28260 479503 480552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 480602 482026 gene locus_tag LOCUS_28270 480602 482026 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284234.1 protein_id gnl|my_center|LOCUS_28270 482391 482906 gene locus_tag LOCUS_28280 482391 482906 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223984.1 protein_id gnl|my_center|LOCUS_28280 483037 483567 gene locus_tag LOCUS_28290 483037 483567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 485077 483641 gene locus_tag LOCUS_28300 485077 483641 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900487.1 protein_id gnl|my_center|LOCUS_28300 486365 485124 gene locus_tag LOCUS_28310 486365 485124 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223986.1 protein_id gnl|my_center|LOCUS_28310 486685 486362 gene locus_tag LOCUS_28320 486685 486362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 487665 486682 gene locus_tag LOCUS_28330 487665 486682 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223987.1 protein_id gnl|my_center|LOCUS_28330 488561 487662 gene locus_tag LOCUS_28340 488561 487662 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223988.1 protein_id gnl|my_center|LOCUS_28340 488893 489051 gene locus_tag LOCUS_28350 488893 489051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 489543 489851 gene locus_tag LOCUS_28360 489543 489851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 491085 489889 gene locus_tag LOCUS_28370 491085 489889 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223990.1 protein_id gnl|my_center|LOCUS_28370 491431 491198 gene locus_tag LOCUS_28380 491431 491198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 492125 491652 gene locus_tag LOCUS_28390 492125 491652 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839848.1 protein_id gnl|my_center|LOCUS_28390 495032 492213 gene locus_tag LOCUS_28400 gene aceE 495032 492213 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223999.1 protein_id gnl|my_center|LOCUS_28400 495358 495789 gene locus_tag LOCUS_28410 495358 495789 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224000.1 protein_id gnl|my_center|LOCUS_28410 495886 496350 gene locus_tag LOCUS_28420 495886 496350 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224001.1 protein_id gnl|my_center|LOCUS_28420 496403 496476 gene locus_tag LOCUS_t00260 496403 496476 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 496665 496934 gene locus_tag LOCUS_28430 496665 496934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 497587 498174 gene locus_tag LOCUS_28440 497587 498174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 498257 498922 gene locus_tag LOCUS_28450 498257 498922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 498950 499534 gene locus_tag LOCUS_28460 498950 499534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 499531 500196 gene locus_tag LOCUS_28470 499531 500196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 500984 500232 gene locus_tag LOCUS_28480 500984 500232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 501926 501222 gene locus_tag LOCUS_28490 501926 501222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 502059 502835 gene locus_tag LOCUS_28500 502059 502835 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030642.1 protein_id gnl|my_center|LOCUS_28500 502995 503474 gene locus_tag LOCUS_28510 502995 503474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 503775 504437 gene locus_tag LOCUS_28520 503775 504437 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896727.1 protein_id gnl|my_center|LOCUS_28520 504554 505699 gene locus_tag LOCUS_28530 gene dgoD 504554 505699 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230776.1 protein_id gnl|my_center|LOCUS_28530 505767 506819 gene locus_tag LOCUS_28540 505767 506819 CDS product trans-acting enoyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903604.1 protein_id gnl|my_center|LOCUS_28540 508050 506890 gene locus_tag LOCUS_28550 508050 506890 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975694.1 protein_id gnl|my_center|LOCUS_28550 508268 509578 gene locus_tag LOCUS_28560 508268 509578 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704524.1 protein_id gnl|my_center|LOCUS_28560 510873 509605 gene locus_tag LOCUS_28570 510873 509605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 514985 510870 gene locus_tag LOCUS_28580 514985 510870 CDS product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052667156.1 protein_id gnl|my_center|LOCUS_28580 516220 514988 gene locus_tag LOCUS_28590 516220 514988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 517746 516217 gene locus_tag LOCUS_28600 517746 516217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 517871 518818 gene locus_tag LOCUS_28610 517871 518818 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951710.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28610 519710 518829 gene locus_tag LOCUS_28620 519710 518829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223073.1 protein_id gnl|my_center|LOCUS_28620 521366 520485 gene locus_tag LOCUS_28630 521366 520485 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226372.1 protein_id gnl|my_center|LOCUS_28630 521812 521381 gene locus_tag LOCUS_28640 521812 521381 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223074.1 protein_id gnl|my_center|LOCUS_28640 521940 523031 gene locus_tag LOCUS_28650 gene cobC 521940 523031 CDS product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005129968.1 protein_id gnl|my_center|LOCUS_28650 523028 523888 gene locus_tag LOCUS_28660 523028 523888 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223077.1 protein_id gnl|my_center|LOCUS_28660 523885 524619 gene locus_tag LOCUS_28670 523885 524619 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223078.1 protein_id gnl|my_center|LOCUS_28670 524622 525755 gene locus_tag LOCUS_28680 524622 525755 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729720.1 protein_id gnl|my_center|LOCUS_28680 526975 527262 gene locus_tag LOCUS_28690 526975 527262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004562703.1 protein_id gnl|my_center|LOCUS_28690 527269 527829 gene locus_tag LOCUS_28700 527269 527829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 527804 530695 gene locus_tag LOCUS_28710 527804 530695 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223090.1 protein_id gnl|my_center|LOCUS_28710 530698 532683 gene locus_tag LOCUS_28720 530698 532683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223091.1 protein_id gnl|my_center|LOCUS_28720 532717 533322 gene locus_tag LOCUS_28730 532717 533322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223092.1 protein_id gnl|my_center|LOCUS_28730 533324 534319 gene locus_tag LOCUS_28740 533324 534319 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223093.1 protein_id gnl|my_center|LOCUS_28740 534462 534923 gene locus_tag LOCUS_28750 534462 534923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 534946 535182 gene locus_tag LOCUS_28760 534946 535182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 535189 536649 gene locus_tag LOCUS_28770 535189 536649 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223097.1 protein_id gnl|my_center|LOCUS_28770 536715 537380 gene locus_tag LOCUS_28780 gene npdG 536715 537380 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_28780 537439 537861 gene locus_tag LOCUS_28790 537439 537861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 538926 538024 gene locus_tag LOCUS_28800 gene panB 538926 538024 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 protein_id gnl|my_center|LOCUS_28800 539121 539438 gene locus_tag LOCUS_28810 539121 539438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 539749 539940 gene locus_tag LOCUS_28820 539749 539940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 541716 539953 gene locus_tag LOCUS_28830 541716 539953 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223119.1 protein_id gnl|my_center|LOCUS_28830 541800 543377 gene locus_tag LOCUS_28840 541800 543377 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223121.1 protein_id gnl|my_center|LOCUS_28840 543428 544771 gene locus_tag LOCUS_28850 gene glnA 543428 544771 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223124.1 protein_id gnl|my_center|LOCUS_28850 >Feature sequence04 <1 768 gene locus_tag LOCUS_28860 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227826.1:tyrosine--tRNA ligase 1493 3022 gene locus_tag LOCUS_r00050 1493 3022 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3326 6409 gene locus_tag LOCUS_r00060 3326 6409 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 6693 7457 gene locus_tag LOCUS_28870 6693 7457 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223128.1 protein_id gnl|my_center|LOCUS_28870 7499 10585 gene locus_tag LOCUS_28880 7499 10585 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466641.1 protein_id gnl|my_center|LOCUS_28880 10647 11582 gene locus_tag LOCUS_28890 10647 11582 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973903.1 protein_id gnl|my_center|LOCUS_28890 12575 11646 gene locus_tag LOCUS_28900 12575 11646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 14158 12734 gene locus_tag LOCUS_28910 gene glnA 14158 12734 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074864.1 protein_id gnl|my_center|LOCUS_28910 14343 14801 gene locus_tag LOCUS_28920 14343 14801 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223134.1 protein_id gnl|my_center|LOCUS_28920 15592 14867 gene locus_tag LOCUS_28930 15592 14867 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223136.1 protein_id gnl|my_center|LOCUS_28930 15730 17091 gene locus_tag LOCUS_28940 15730 17091 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911099.1 protein_id gnl|my_center|LOCUS_28940 17091 17642 gene locus_tag LOCUS_28950 17091 17642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401230.1 protein_id gnl|my_center|LOCUS_28950 18678 17707 gene locus_tag LOCUS_28960 gene lipA 18678 17707 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466774.1 protein_id gnl|my_center|LOCUS_28960 19692 18757 gene locus_tag LOCUS_28970 19692 18757 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224044.1 protein_id gnl|my_center|LOCUS_28970 19859 20806 gene locus_tag LOCUS_28980 19859 20806 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224046.1 protein_id gnl|my_center|LOCUS_28980 21631 20882 gene locus_tag LOCUS_28990 gene lipB 21631 20882 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224047.1 protein_id gnl|my_center|LOCUS_28990 22540 21656 gene locus_tag LOCUS_29000 22540 21656 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729703.1 protein_id gnl|my_center|LOCUS_29000 24481 22643 gene locus_tag LOCUS_29010 24481 22643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 25900 24530 gene locus_tag LOCUS_29020 gene lpdA 25900 24530 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_29020 26154 26504 gene locus_tag LOCUS_29030 26154 26504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466777.1 protein_id gnl|my_center|LOCUS_29030 27035 26520 gene locus_tag LOCUS_29040 27035 26520 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891973.1 protein_id gnl|my_center|LOCUS_29040 28680 27190 gene locus_tag LOCUS_29050 28680 27190 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224057.1 protein_id gnl|my_center|LOCUS_29050 28855 30090 gene locus_tag LOCUS_29060 28855 30090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 30096 30785 gene locus_tag LOCUS_29070 30096 30785 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742102.1 protein_id gnl|my_center|LOCUS_29070 30841 31944 gene locus_tag LOCUS_29080 30841 31944 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284299.1 protein_id gnl|my_center|LOCUS_29080 32036 33124 gene locus_tag LOCUS_29090 32036 33124 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_29090 33134 33418 gene locus_tag LOCUS_29100 33134 33418 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223899.1 protein_id gnl|my_center|LOCUS_29100 34067 33426 gene locus_tag LOCUS_29110 34067 33426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 35308 34166 gene locus_tag LOCUS_29120 gene cobT 35308 34166 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224062.1 protein_id gnl|my_center|LOCUS_29120 35882 35334 gene locus_tag LOCUS_29130 35882 35334 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856625.1 protein_id gnl|my_center|LOCUS_29130 36865 35879 gene locus_tag LOCUS_29140 36865 35879 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_29140 37559 36915 gene locus_tag LOCUS_29150 37559 36915 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224069.1 protein_id gnl|my_center|LOCUS_29150 37746 38792 gene locus_tag LOCUS_29160 37746 38792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29160 39286 39651 gene locus_tag LOCUS_29170 39286 39651 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224070.1 protein_id gnl|my_center|LOCUS_29170 40029 39817 gene locus_tag LOCUS_29180 40029 39817 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222201.1 protein_id gnl|my_center|LOCUS_29180 40210 41694 gene locus_tag LOCUS_29190 40210 41694 CDS product carbohydrate-binding module family 20 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259365.1 protein_id gnl|my_center|LOCUS_29190 42662 41760 gene locus_tag LOCUS_29200 42662 41760 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_29200 43642 42665 gene locus_tag LOCUS_29210 43642 42665 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976584.1 protein_id gnl|my_center|LOCUS_29210 44910 43663 gene locus_tag LOCUS_29220 44910 43663 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976583.1 protein_id gnl|my_center|LOCUS_29220 45145 46182 gene locus_tag LOCUS_29230 45145 46182 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 protein_id gnl|my_center|LOCUS_29230 46213 47820 gene locus_tag LOCUS_29240 46213 47820 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_29240 47840 49969 gene locus_tag LOCUS_29250 47840 49969 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226430.1 protein_id gnl|my_center|LOCUS_29250 50346 51845 gene locus_tag LOCUS_29260 50346 51845 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224565.1 protein_id gnl|my_center|LOCUS_29260 52117 51917 gene locus_tag LOCUS_29270 52117 51917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 52272 52114 gene locus_tag LOCUS_29280 52272 52114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 52654 53160 gene locus_tag LOCUS_29290 52654 53160 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223648.1 protein_id gnl|my_center|LOCUS_29290 55132 53204 gene locus_tag LOCUS_29300 gene asnB 55132 53204 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224072.1 protein_id gnl|my_center|LOCUS_29300 55480 56409 gene locus_tag LOCUS_29310 55480 56409 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466782.1 protein_id gnl|my_center|LOCUS_29310 56453 56851 gene locus_tag LOCUS_29320 56453 56851 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224074.1 protein_id gnl|my_center|LOCUS_29320 56915 57196 gene locus_tag LOCUS_29330 56915 57196 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224084.1 protein_id gnl|my_center|LOCUS_29330 58288 57236 gene locus_tag LOCUS_29340 gene trpD 58288 57236 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224077.1 protein_id gnl|my_center|LOCUS_29340 58757 58302 gene locus_tag LOCUS_29350 58757 58302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224078.1 protein_id gnl|my_center|LOCUS_29350 59275 58814 gene locus_tag LOCUS_29360 59275 58814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224079.1 protein_id gnl|my_center|LOCUS_29360 59403 59972 gene locus_tag LOCUS_29370 59403 59972 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284302.1 protein_id gnl|my_center|LOCUS_29370 60026 60832 gene locus_tag LOCUS_29380 60026 60832 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224081.1 protein_id gnl|my_center|LOCUS_29380 60829 62019 gene locus_tag LOCUS_29390 60829 62019 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224082.1 protein_id gnl|my_center|LOCUS_29390 62016 63683 gene locus_tag LOCUS_29400 62016 63683 CDS product ubiquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184859936.1 protein_id gnl|my_center|LOCUS_29400 63823 64248 gene locus_tag LOCUS_29410 63823 64248 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027616.1 protein_id gnl|my_center|LOCUS_29410 64313 64735 gene locus_tag LOCUS_29420 64313 64735 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079669.1 protein_id gnl|my_center|LOCUS_29420 66461 64746 gene locus_tag LOCUS_29430 66461 64746 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_29430 66540 67910 gene locus_tag LOCUS_29440 66540 67910 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224086.1 protein_id gnl|my_center|LOCUS_29440 68381 69433 gene locus_tag LOCUS_29450 68381 69433 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227670.1 protein_id gnl|my_center|LOCUS_29450 69561 70859 gene locus_tag LOCUS_29460 69561 70859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869422.1 protein_id gnl|my_center|LOCUS_29460 72767 70959 gene locus_tag LOCUS_29470 72767 70959 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224318.1 protein_id gnl|my_center|LOCUS_29470 73070 73858 gene locus_tag LOCUS_29480 73070 73858 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224320.1 protein_id gnl|my_center|LOCUS_29480 73926 74369 gene locus_tag LOCUS_29490 73926 74369 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_29490 74409 75638 gene locus_tag LOCUS_29500 74409 75638 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224322.1 protein_id gnl|my_center|LOCUS_29500 75642 76091 gene locus_tag LOCUS_29510 75642 76091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 76085 77056 gene locus_tag LOCUS_29520 76085 77056 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224324.1 protein_id gnl|my_center|LOCUS_29520 77556 77077 gene locus_tag LOCUS_29530 77556 77077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224328.1 protein_id gnl|my_center|LOCUS_29530 78014 78760 gene locus_tag LOCUS_29540 78014 78760 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224330.1 protein_id gnl|my_center|LOCUS_29540 78813 79316 gene locus_tag LOCUS_29550 78813 79316 CDS product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224331.1 protein_id gnl|my_center|LOCUS_29550 79413 80450 gene locus_tag LOCUS_29560 79413 80450 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224333.1 protein_id gnl|my_center|LOCUS_29560 80573 81937 gene locus_tag LOCUS_29570 80573 81937 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449604.1 protein_id gnl|my_center|LOCUS_29570 83531 81978 gene locus_tag LOCUS_29580 gene mptB 83531 81978 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226496.1 protein_id gnl|my_center|LOCUS_29580 85828 83810 gene locus_tag LOCUS_29590 gene pknB 85828 83810 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224192.1 protein_id gnl|my_center|LOCUS_29590 85971 86360 gene locus_tag LOCUS_29600 85971 86360 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729669.1 protein_id gnl|my_center|LOCUS_29600 86697 87230 gene locus_tag LOCUS_29610 86697 87230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 88395 87265 gene locus_tag LOCUS_29620 88395 87265 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_29620 89133 88510 gene locus_tag LOCUS_29630 89133 88510 CDS product DUF3153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296496.1 protein_id gnl|my_center|LOCUS_29630 89317 90978 gene locus_tag LOCUS_29640 89317 90978 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742099.1 protein_id gnl|my_center|LOCUS_29640 91573 90989 gene locus_tag LOCUS_29650 91573 90989 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224203.1 protein_id gnl|my_center|LOCUS_29650 92517 91693 gene locus_tag LOCUS_29660 92517 91693 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223525.1 protein_id gnl|my_center|LOCUS_29660 92696 92574 gene locus_tag LOCUS_29670 92696 92574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 92737 92931 gene locus_tag LOCUS_29680 92737 92931 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224216.1 protein_id gnl|my_center|LOCUS_29680 93223 94287 gene locus_tag LOCUS_29690 gene recA 93223 94287 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224217.1 protein_id gnl|my_center|LOCUS_29690 94300 94821 gene locus_tag LOCUS_29700 94300 94821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 94866 95546 gene locus_tag LOCUS_29710 94866 95546 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112761.1 protein_id gnl|my_center|LOCUS_29710 96218 95595 gene locus_tag LOCUS_29720 gene eda 96218 95595 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224222.1 protein_id gnl|my_center|LOCUS_29720 98101 96245 gene locus_tag LOCUS_29730 gene edd 98101 96245 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086678338.1 protein_id gnl|my_center|LOCUS_29730 98283 98915 gene locus_tag LOCUS_29740 98283 98915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 99785 98922 gene locus_tag LOCUS_29750 99785 98922 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776274.1 protein_id gnl|my_center|LOCUS_29750 100432 99782 gene locus_tag LOCUS_29760 100432 99782 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776971.1 protein_id gnl|my_center|LOCUS_29760 101392 100490 gene locus_tag LOCUS_29770 101392 100490 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894111.1 protein_id gnl|my_center|LOCUS_29770 102196 101441 gene locus_tag LOCUS_29780 102196 101441 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466810.1 protein_id gnl|my_center|LOCUS_29780 102429 103901 gene locus_tag LOCUS_29790 gene miaB 102429 103901 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224253.1 protein_id gnl|my_center|LOCUS_29790 103895 104413 gene locus_tag LOCUS_29800 103895 104413 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224254.1 protein_id gnl|my_center|LOCUS_29800 105816 104494 gene locus_tag LOCUS_29810 105816 104494 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224256.1 protein_id gnl|my_center|LOCUS_29810 106369 107277 gene locus_tag LOCUS_29820 gene miaA 106369 107277 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224257.1 protein_id gnl|my_center|LOCUS_29820 107279 108151 gene locus_tag LOCUS_29830 gene dapF 107279 108151 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224258.1 protein_id gnl|my_center|LOCUS_29830 108211 109713 gene locus_tag LOCUS_29840 gene hflX 108211 109713 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 protein_id gnl|my_center|LOCUS_29840 109824 110765 gene locus_tag LOCUS_29850 109824 110765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224263.1 protein_id gnl|my_center|LOCUS_29850 111546 110824 gene locus_tag LOCUS_29860 gene lexA 111546 110824 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091617684.1 protein_id gnl|my_center|LOCUS_29860 111742 112101 gene locus_tag LOCUS_29870 111742 112101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 112319 112780 gene locus_tag LOCUS_29880 gene nrdR 112319 112780 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224266.1 protein_id gnl|my_center|LOCUS_29880 112881 115778 gene locus_tag LOCUS_29890 112881 115778 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_29890 116012 117787 gene locus_tag LOCUS_29900 116012 117787 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224280.1 protein_id gnl|my_center|LOCUS_29900 117821 121216 gene locus_tag LOCUS_29910 117821 121216 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228485.1 protein_id gnl|my_center|LOCUS_29910 121310 122410 gene locus_tag LOCUS_29920 121310 122410 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224286.1 protein_id gnl|my_center|LOCUS_29920 123381 122425 gene locus_tag LOCUS_29930 gene galE 123381 122425 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224287.1 protein_id gnl|my_center|LOCUS_29930 124647 123469 gene locus_tag LOCUS_29940 gene galK 124647 123469 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224288.1 protein_id gnl|my_center|LOCUS_29940 125405 124644 gene locus_tag LOCUS_29950 125405 124644 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224289.1 protein_id gnl|my_center|LOCUS_29950 125442 126293 gene locus_tag LOCUS_29960 125442 126293 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224290.1 protein_id gnl|my_center|LOCUS_29960 126356 127531 gene locus_tag LOCUS_29970 126356 127531 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224291.1 protein_id gnl|my_center|LOCUS_29970 127542 130214 gene locus_tag LOCUS_29980 127542 130214 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_29980 130255 130773 gene locus_tag LOCUS_29990 130255 130773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224436.1 protein_id gnl|my_center|LOCUS_29990 131088 131816 gene locus_tag LOCUS_30000 131088 131816 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972225.1 protein_id gnl|my_center|LOCUS_30000 132860 131889 gene locus_tag LOCUS_30010 132860 131889 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224439.1 protein_id gnl|my_center|LOCUS_30010 133635 133210 gene locus_tag LOCUS_30020 gene dtd 133635 133210 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224440.1 protein_id gnl|my_center|LOCUS_30020 135149 133632 gene locus_tag LOCUS_30030 135149 133632 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742165.1 protein_id gnl|my_center|LOCUS_30030 135296 135622 gene locus_tag LOCUS_30040 135296 135622 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224443.1 protein_id gnl|my_center|LOCUS_30040 135710 135955 gene locus_tag LOCUS_30050 135710 135955 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284335.1 protein_id gnl|my_center|LOCUS_30050 137147 135978 gene locus_tag LOCUS_30060 137147 135978 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224451.1 protein_id gnl|my_center|LOCUS_30060 137391 139172 gene locus_tag LOCUS_30070 137391 139172 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224452.1 protein_id gnl|my_center|LOCUS_30070 139441 139247 gene locus_tag LOCUS_30080 139441 139247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224457.1 protein_id gnl|my_center|LOCUS_30080 141485 139929 gene locus_tag LOCUS_30090 141485 139929 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224472.1 protein_id gnl|my_center|LOCUS_30090 142324 141563 gene locus_tag LOCUS_30100 142324 141563 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284355.1 protein_id gnl|my_center|LOCUS_30100 142358 143218 gene locus_tag LOCUS_30110 142358 143218 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224474.1 protein_id gnl|my_center|LOCUS_30110 143898 143239 gene locus_tag LOCUS_30120 gene cei 143898 143239 CDS product envelope integrity protein Cei inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224475.1 protein_id gnl|my_center|LOCUS_30120 144428 144730 gene locus_tag LOCUS_30130 144428 144730 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057245.1 protein_id gnl|my_center|LOCUS_30130 145194 144808 gene locus_tag LOCUS_30140 145194 144808 CDS product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224477.1 protein_id gnl|my_center|LOCUS_30140 145360 145863 gene locus_tag LOCUS_30150 gene dut 145360 145863 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_30150 145868 146503 gene locus_tag LOCUS_30160 145868 146503 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224479.1 protein_id gnl|my_center|LOCUS_30160 146646 147023 gene locus_tag LOCUS_30170 146646 147023 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224481.1 protein_id gnl|my_center|LOCUS_30170 147020 147823 gene locus_tag LOCUS_30180 147020 147823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 148553 147885 gene locus_tag LOCUS_30190 148553 147885 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067924.1 protein_id gnl|my_center|LOCUS_30190 149219 148554 gene locus_tag LOCUS_30200 149219 148554 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851807.1 protein_id gnl|my_center|LOCUS_30200 149457 151511 gene locus_tag LOCUS_30210 149457 151511 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742167.1 protein_id gnl|my_center|LOCUS_30210 151508 152761 gene locus_tag LOCUS_30220 151508 152761 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224485.1 protein_id gnl|my_center|LOCUS_30220 152944 154887 gene locus_tag LOCUS_30230 gene dxs 152944 154887 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224488.1 protein_id gnl|my_center|LOCUS_30230 154923 155639 gene locus_tag LOCUS_30240 154923 155639 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284338.1 protein_id gnl|my_center|LOCUS_30240 155643 156818 gene locus_tag LOCUS_30250 155643 156818 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224496.1 protein_id gnl|my_center|LOCUS_30250 157253 156867 gene locus_tag LOCUS_30260 157253 156867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 157660 157448 gene locus_tag LOCUS_30270 157660 157448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 160168 158060 gene locus_tag LOCUS_30280 160168 158060 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224500.1 protein_id gnl|my_center|LOCUS_30280 161421 160165 gene locus_tag LOCUS_30290 161421 160165 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224501.1 protein_id gnl|my_center|LOCUS_30290 162812 161574 gene locus_tag LOCUS_30300 162812 161574 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224510.1 protein_id gnl|my_center|LOCUS_30300 163619 162903 gene locus_tag LOCUS_30310 163619 162903 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156987.1 protein_id gnl|my_center|LOCUS_30310 164500 163937 gene locus_tag LOCUS_30320 164500 163937 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284339.1 protein_id gnl|my_center|LOCUS_30320 164692 165774 gene locus_tag LOCUS_30330 gene hemE 164692 165774 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224512.1 protein_id gnl|my_center|LOCUS_30330 165774 167228 gene locus_tag LOCUS_30340 gene hemG 165774 167228 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_30340 167216 167911 gene locus_tag LOCUS_30350 167216 167911 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224514.1 protein_id gnl|my_center|LOCUS_30350 168350 168610 gene locus_tag LOCUS_30360 168350 168610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 169039 168620 gene locus_tag LOCUS_30370 gene msrB 169039 168620 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224520.1 protein_id gnl|my_center|LOCUS_30370 169396 169082 gene locus_tag LOCUS_30380 169396 169082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 171341 169776 gene locus_tag LOCUS_30390 171341 169776 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224537.1 protein_id gnl|my_center|LOCUS_30390 171566 172480 gene locus_tag LOCUS_30400 171566 172480 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034357836.1 protein_id gnl|my_center|LOCUS_30400 173369 172482 gene locus_tag LOCUS_30410 173369 172482 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918150.1 protein_id gnl|my_center|LOCUS_30410 174014 173400 gene locus_tag LOCUS_30420 174014 173400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224539.1 protein_id gnl|my_center|LOCUS_30420 174547 174011 gene locus_tag LOCUS_30430 174547 174011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 174957 174550 gene locus_tag LOCUS_30440 174957 174550 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224541.1 protein_id gnl|my_center|LOCUS_30440 175133 174954 gene locus_tag LOCUS_30450 175133 174954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224542.1 protein_id gnl|my_center|LOCUS_30450 175811 175464 gene locus_tag LOCUS_30460 175811 175464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084306.1 protein_id gnl|my_center|LOCUS_30460 176381 175857 gene locus_tag LOCUS_30470 176381 175857 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224543.1 protein_id gnl|my_center|LOCUS_30470 177204 176437 gene locus_tag LOCUS_30480 177204 176437 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224546.1 protein_id gnl|my_center|LOCUS_30480 177329 178273 gene locus_tag LOCUS_30490 gene zapE 177329 178273 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224547.1 protein_id gnl|my_center|LOCUS_30490 179589 178348 gene locus_tag LOCUS_30500 gene rocD 179589 178348 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224552.1 protein_id gnl|my_center|LOCUS_30500 179747 180811 gene locus_tag LOCUS_30510 179747 180811 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668699.1 protein_id gnl|my_center|LOCUS_30510 180910 181746 gene locus_tag LOCUS_30520 180910 181746 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_30520 183302 181725 gene locus_tag LOCUS_30530 183302 181725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 183478 185052 gene locus_tag LOCUS_30540 183478 185052 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973344.1 protein_id gnl|my_center|LOCUS_30540 185045 186082 gene locus_tag LOCUS_30550 185045 186082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 186551 186018 gene locus_tag LOCUS_30560 186551 186018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30560 187364 186561 gene locus_tag LOCUS_30570 187364 186561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30570 187496 188494 gene locus_tag LOCUS_30580 gene rhaS 187496 188494 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973083.1 protein_id gnl|my_center|LOCUS_30580 189006 188554 gene locus_tag LOCUS_30590 189006 188554 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971790.1 protein_id gnl|my_center|LOCUS_30590 189154 189726 gene locus_tag LOCUS_30600 189154 189726 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119882.1 protein_id gnl|my_center|LOCUS_30600 189800 190942 gene locus_tag LOCUS_30610 189800 190942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 191032 191316 gene locus_tag LOCUS_30620 191032 191316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 192594 191362 gene locus_tag LOCUS_30630 192594 191362 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_30630 192751 193284 gene locus_tag LOCUS_30640 192751 193284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 193274 193957 gene locus_tag LOCUS_30650 193274 193957 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522757.1 protein_id gnl|my_center|LOCUS_30650 194068 194928 gene locus_tag LOCUS_30660 194068 194928 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_30660 195632 194970 gene locus_tag LOCUS_30670 195632 194970 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893820.1 protein_id gnl|my_center|LOCUS_30670 195791 196993 gene locus_tag LOCUS_30680 195791 196993 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113287.1 protein_id gnl|my_center|LOCUS_30680 197007 198197 gene locus_tag LOCUS_30690 197007 198197 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977076.1 protein_id gnl|my_center|LOCUS_30690 198230 199402 gene locus_tag LOCUS_30700 198230 199402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 199688 200197 gene locus_tag LOCUS_30710 199688 200197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 200448 201533 gene locus_tag LOCUS_30720 200448 201533 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115042.1 protein_id gnl|my_center|LOCUS_30720 201530 202156 gene locus_tag LOCUS_30730 201530 202156 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229801.1 protein_id gnl|my_center|LOCUS_30730 202276 203505 gene locus_tag LOCUS_30740 202276 203505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 203518 204237 gene locus_tag LOCUS_30750 203518 204237 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975186.1 protein_id gnl|my_center|LOCUS_30750 204481 205539 gene locus_tag LOCUS_30760 204481 205539 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975953.1 protein_id gnl|my_center|LOCUS_30760 205865 205554 gene locus_tag LOCUS_30770 205865 205554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 207305 206496 gene locus_tag LOCUS_30780 207305 206496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 207384 208346 gene locus_tag LOCUS_30790 207384 208346 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224591.1 protein_id gnl|my_center|LOCUS_30790 209400 208348 gene locus_tag LOCUS_30800 209400 208348 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224840.1 protein_id gnl|my_center|LOCUS_30800 209613 209999 gene locus_tag LOCUS_30810 209613 209999 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_30810 210027 210959 gene locus_tag LOCUS_30820 210027 210959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225109.1 protein_id gnl|my_center|LOCUS_30820 211081 211803 gene locus_tag LOCUS_30830 gene pepE 211081 211803 CDS product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027213.1 protein_id gnl|my_center|LOCUS_30830 211933 211860 gene locus_tag LOCUS_t00270 211933 211860 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 212330 211980 gene locus_tag LOCUS_30840 212330 211980 CDS product TIGR02611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728698.1 protein_id gnl|my_center|LOCUS_30840 213292 213720 gene locus_tag LOCUS_30850 213292 213720 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227152.1 protein_id gnl|my_center|LOCUS_30850 213862 213934 gene locus_tag LOCUS_t00280 213862 213934 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 213977 214049 gene locus_tag LOCUS_t00290 213977 214049 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 214050 214124 gene locus_tag LOCUS_t00300 214050 214124 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 215511 214591 gene locus_tag LOCUS_30860 215511 214591 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776954.1 protein_id gnl|my_center|LOCUS_30860 217007 215508 gene locus_tag LOCUS_30870 217007 215508 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227765.1 protein_id gnl|my_center|LOCUS_30870 218059 217046 gene locus_tag LOCUS_30880 218059 217046 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976404.1 protein_id gnl|my_center|LOCUS_30880 219213 218056 gene locus_tag LOCUS_30890 219213 218056 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_30890 220163 219237 gene locus_tag LOCUS_30900 220163 219237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028332.1 protein_id gnl|my_center|LOCUS_30900 220356 221123 gene locus_tag LOCUS_30910 220356 221123 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976366.1 protein_id gnl|my_center|LOCUS_30910 221405 221094 gene locus_tag LOCUS_30920 221405 221094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 223162 221432 gene locus_tag LOCUS_30930 223162 221432 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_30930 223413 224798 gene locus_tag LOCUS_30940 223413 224798 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225849.1 protein_id gnl|my_center|LOCUS_30940 225125 224904 gene locus_tag LOCUS_30950 225125 224904 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224345.1 protein_id gnl|my_center|LOCUS_30950 225338 225186 gene locus_tag LOCUS_30960 225338 225186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 225606 226274 gene locus_tag LOCUS_30970 225606 226274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 227294 226365 gene locus_tag LOCUS_30980 227294 226365 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_30980 228950 227322 gene locus_tag LOCUS_30990 gene pruA 228950 227322 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 protein_id gnl|my_center|LOCUS_30990 229073 230764 gene locus_tag LOCUS_31000 229073 230764 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224529.1 protein_id gnl|my_center|LOCUS_31000 232228 230768 gene locus_tag LOCUS_31010 232228 230768 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027457.1 protein_id gnl|my_center|LOCUS_31010 232622 233608 gene locus_tag LOCUS_31020 232622 233608 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223470.1 protein_id gnl|my_center|LOCUS_31020 233922 235304 gene locus_tag LOCUS_31030 233922 235304 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226360.1 protein_id gnl|my_center|LOCUS_31030 235328 236557 gene locus_tag LOCUS_31040 235328 236557 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226359.1 protein_id gnl|my_center|LOCUS_31040 238010 236577 gene locus_tag LOCUS_31050 238010 236577 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893142.1 protein_id gnl|my_center|LOCUS_31050 239581 238229 gene locus_tag LOCUS_31060 239581 238229 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221998.1 protein_id gnl|my_center|LOCUS_31060 239508 239699 gene locus_tag LOCUS_31070 239508 239699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 239939 240748 gene locus_tag LOCUS_31080 239939 240748 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229627.1 protein_id gnl|my_center|LOCUS_31080 240797 242926 gene locus_tag LOCUS_31090 gene rmdA 240797 242926 CDS product cyclic Di-GMP phosphodiesterase RmdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027451.1 protein_id gnl|my_center|LOCUS_31090 243039 245072 gene locus_tag LOCUS_31100 gene thrS 243039 245072 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227149.1 protein_id gnl|my_center|LOCUS_31100 245069 245641 gene locus_tag LOCUS_31110 245069 245641 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227148.1 protein_id gnl|my_center|LOCUS_31110 246349 245813 gene locus_tag LOCUS_31120 246349 245813 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854913.1 protein_id gnl|my_center|LOCUS_31120 246571 247140 gene locus_tag LOCUS_31130 246571 247140 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227146.1 protein_id gnl|my_center|LOCUS_31130 248018 247194 gene locus_tag LOCUS_31140 248018 247194 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224126.1 protein_id gnl|my_center|LOCUS_31140 248123 249712 gene locus_tag LOCUS_31150 248123 249712 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030930.1 protein_id gnl|my_center|LOCUS_31150 249709 250713 gene locus_tag LOCUS_31160 249709 250713 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270309.1 protein_id gnl|my_center|LOCUS_31160 250787 251629 gene locus_tag LOCUS_31170 250787 251629 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469199.1 protein_id gnl|my_center|LOCUS_31170 251626 252627 gene locus_tag LOCUS_31180 251626 252627 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030933.1 protein_id gnl|my_center|LOCUS_31180 252621 253250 gene locus_tag LOCUS_31190 252621 253250 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972523.1 protein_id gnl|my_center|LOCUS_31190 253358 253510 gene locus_tag LOCUS_31200 253358 253510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 254834 253560 gene locus_tag LOCUS_31210 254834 253560 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230482.1 protein_id gnl|my_center|LOCUS_31210 255053 255847 gene locus_tag LOCUS_31220 255053 255847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 255939 257264 gene locus_tag LOCUS_31230 gene hisD 255939 257264 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224127.1 protein_id gnl|my_center|LOCUS_31230 257367 258485 gene locus_tag LOCUS_31240 257367 258485 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224128.1 protein_id gnl|my_center|LOCUS_31240 258482 259096 gene locus_tag LOCUS_31250 gene hisB 258482 259096 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224129.1 protein_id gnl|my_center|LOCUS_31250 259288 261573 gene locus_tag LOCUS_31260 259288 261573 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228501.1 protein_id gnl|my_center|LOCUS_31260 261656 261811 gene locus_tag LOCUS_31270 261656 261811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 263347 261893 gene locus_tag LOCUS_31280 263347 261893 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728094.1 protein_id gnl|my_center|LOCUS_31280 263418 265076 gene locus_tag LOCUS_31290 263418 265076 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227865.1 protein_id gnl|my_center|LOCUS_31290 265073 265753 gene locus_tag LOCUS_31300 265073 265753 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030245.1 protein_id gnl|my_center|LOCUS_31300 266219 265758 gene locus_tag LOCUS_31310 gene soxR 266219 265758 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224136.1 protein_id gnl|my_center|LOCUS_31310 266376 266525 gene locus_tag LOCUS_31320 266376 266525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31320 266735 267358 gene locus_tag LOCUS_31330 gene hisH 266735 267358 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057924.1 protein_id gnl|my_center|LOCUS_31330 267379 267561 gene locus_tag LOCUS_31340 267379 267561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 267587 268324 gene locus_tag LOCUS_31350 gene priA 267587 268324 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466797.1 protein_id gnl|my_center|LOCUS_31350 268372 269145 gene locus_tag LOCUS_31360 gene hisF 268372 269145 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466799.1 protein_id gnl|my_center|LOCUS_31360 269142 269516 gene locus_tag LOCUS_31370 gene hisI 269142 269516 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728899.1 protein_id gnl|my_center|LOCUS_31370 270179 269547 gene locus_tag LOCUS_31380 270179 269547 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224164.1 protein_id gnl|my_center|LOCUS_31380 270299 271594 gene locus_tag LOCUS_31390 270299 271594 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057329.1 protein_id gnl|my_center|LOCUS_31390 271663 273261 gene locus_tag LOCUS_31400 271663 273261 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224165.1 protein_id gnl|my_center|LOCUS_31400 273239 273862 gene locus_tag LOCUS_31410 273239 273862 CDS product Trp biosynthesis-associated membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224166.1 protein_id gnl|my_center|LOCUS_31410 274120 274932 gene locus_tag LOCUS_31420 gene trpC 274120 274932 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224167.1 protein_id gnl|my_center|LOCUS_31420 274943 276187 gene locus_tag LOCUS_31430 gene trpB 274943 276187 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284348.1 protein_id gnl|my_center|LOCUS_31430 276184 276981 gene locus_tag LOCUS_31440 gene trpA 276184 276981 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224169.1 protein_id gnl|my_center|LOCUS_31440 277030 278067 gene locus_tag LOCUS_31450 gene lgt 277030 278067 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466801.1 protein_id gnl|my_center|LOCUS_31450 278111 278308 gene locus_tag LOCUS_31460 278111 278308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 278299 278712 gene locus_tag LOCUS_31470 278299 278712 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911071.1 protein_id gnl|my_center|LOCUS_31470 279489 278716 gene locus_tag LOCUS_31480 279489 278716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856445.1 protein_id gnl|my_center|LOCUS_31480 280560 279520 gene locus_tag LOCUS_31490 280560 279520 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014890.1 protein_id gnl|my_center|LOCUS_31490 281577 280567 gene locus_tag LOCUS_31500 281577 280567 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265874.1 protein_id gnl|my_center|LOCUS_31500 284223 281935 gene locus_tag LOCUS_31510 284223 281935 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449606.1 protein_id gnl|my_center|LOCUS_31510 284705 284355 gene locus_tag LOCUS_31520 284705 284355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 285466 284702 gene locus_tag LOCUS_31530 285466 284702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 285691 286389 gene locus_tag LOCUS_31540 285691 286389 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223069.1 protein_id gnl|my_center|LOCUS_31540 287696 286452 gene locus_tag LOCUS_31550 287696 286452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 290173 287840 gene locus_tag LOCUS_31560 290173 287840 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225184.1 protein_id gnl|my_center|LOCUS_31560 290613 290203 gene locus_tag LOCUS_31570 290613 290203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 290698 292059 gene locus_tag LOCUS_31580 gene pyk 290698 292059 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466825.1 protein_id gnl|my_center|LOCUS_31580 292141 293088 gene locus_tag LOCUS_31590 292141 293088 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_31590 293161 294927 gene locus_tag LOCUS_31600 293161 294927 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230694.1 protein_id gnl|my_center|LOCUS_31600 295455 294952 gene locus_tag LOCUS_31610 295455 294952 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225559.1 protein_id gnl|my_center|LOCUS_31610 295557 296168 gene locus_tag LOCUS_31620 295557 296168 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230026.1 protein_id gnl|my_center|LOCUS_31620 296306 297889 gene locus_tag LOCUS_31630 gene dacB 296306 297889 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 protein_id gnl|my_center|LOCUS_31630 297991 298662 gene locus_tag LOCUS_31640 297991 298662 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224042.1 protein_id gnl|my_center|LOCUS_31640 299208 298669 gene locus_tag LOCUS_31650 299208 298669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 301363 300083 gene locus_tag LOCUS_31660 301363 300083 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973528.1 protein_id gnl|my_center|LOCUS_31660 302508 301405 gene locus_tag LOCUS_31670 gene gcvT 302508 301405 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223708.1 protein_id gnl|my_center|LOCUS_31670 303534 302938 gene locus_tag LOCUS_31680 303534 302938 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406104.1 protein_id gnl|my_center|LOCUS_31680 303641 304384 gene locus_tag LOCUS_31690 303641 304384 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224370.1 protein_id gnl|my_center|LOCUS_31690 305057 304404 gene locus_tag LOCUS_31700 305057 304404 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977123.1 protein_id gnl|my_center|LOCUS_31700 305226 306794 gene locus_tag LOCUS_31710 305226 306794 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972177.1 protein_id gnl|my_center|LOCUS_31710 306825 307592 gene locus_tag LOCUS_31720 gene fabG 306825 307592 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_31720 307615 308793 gene locus_tag LOCUS_31730 307615 308793 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_31730 308870 309037 gene locus_tag LOCUS_31740 308870 309037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 309481 309098 gene locus_tag LOCUS_31750 309481 309098 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727560.1 protein_id gnl|my_center|LOCUS_31750 309645 309478 gene locus_tag LOCUS_31760 309645 309478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 309893 311086 gene locus_tag LOCUS_31770 309893 311086 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546897.1 protein_id gnl|my_center|LOCUS_31770 311083 311919 gene locus_tag LOCUS_31780 311083 311919 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201924.1 protein_id gnl|my_center|LOCUS_31780 311916 312353 gene locus_tag LOCUS_31790 311916 312353 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810461.1 protein_id gnl|my_center|LOCUS_31790 312568 313425 gene locus_tag LOCUS_31800 312568 313425 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284614.1 protein_id gnl|my_center|LOCUS_31800 313422 315719 gene locus_tag LOCUS_31810 313422 315719 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226811.1 protein_id gnl|my_center|LOCUS_31810 316152 315688 gene locus_tag LOCUS_31820 316152 315688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 316477 317646 gene locus_tag LOCUS_31830 316477 317646 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226810.1 protein_id gnl|my_center|LOCUS_31830 318675 317743 gene locus_tag LOCUS_31840 318675 317743 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002024365.1 protein_id gnl|my_center|LOCUS_31840 319486 320466 gene locus_tag LOCUS_31850 319486 320466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 321371 320556 gene locus_tag LOCUS_31860 321371 320556 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227037.1 protein_id gnl|my_center|LOCUS_31860 321865 321368 gene locus_tag LOCUS_31870 321865 321368 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973726.1 protein_id gnl|my_center|LOCUS_31870 322698 322054 gene locus_tag LOCUS_31880 322698 322054 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728325.1 protein_id gnl|my_center|LOCUS_31880 323432 322695 gene locus_tag LOCUS_31890 323432 322695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 323738 323586 gene locus_tag LOCUS_31900 323738 323586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 324431 323829 gene locus_tag LOCUS_31910 324431 323829 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728072.1 protein_id gnl|my_center|LOCUS_31910 324430 324759 gene locus_tag LOCUS_31920 324430 324759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 324749 326008 gene locus_tag LOCUS_31930 324749 326008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 326308 327783 gene locus_tag LOCUS_31940 gene lpdA 326308 327783 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949165.1 protein_id gnl|my_center|LOCUS_31940 327818 328942 gene locus_tag LOCUS_31950 gene pdhA 327818 328942 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257841.1 protein_id gnl|my_center|LOCUS_31950 329017 330012 gene locus_tag LOCUS_31960 329017 330012 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257842.1 protein_id gnl|my_center|LOCUS_31960 330040 331329 gene locus_tag LOCUS_31970 330040 331329 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404704.1 protein_id gnl|my_center|LOCUS_31970 332391 331384 gene locus_tag LOCUS_31980 332391 331384 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013789.1 protein_id gnl|my_center|LOCUS_31980 332540 332803 gene locus_tag LOCUS_31990 332540 332803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 332878 333651 gene locus_tag LOCUS_32000 332878 333651 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028326.1 protein_id gnl|my_center|LOCUS_32000 334135 333668 gene locus_tag LOCUS_32010 334135 333668 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225198.1 protein_id gnl|my_center|LOCUS_32010 334235 334657 gene locus_tag LOCUS_32020 334235 334657 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222912.1 protein_id gnl|my_center|LOCUS_32020 334831 335553 gene locus_tag LOCUS_32030 334831 335553 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977652.1 protein_id gnl|my_center|LOCUS_32030 335618 336949 gene locus_tag LOCUS_32040 335618 336949 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228841.1 protein_id gnl|my_center|LOCUS_32040 337095 337796 gene locus_tag LOCUS_32050 337095 337796 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 protein_id gnl|my_center|LOCUS_32050 337845 338768 gene locus_tag LOCUS_32060 337845 338768 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096857.1 protein_id gnl|my_center|LOCUS_32060 338942 341179 gene locus_tag LOCUS_32070 338942 341179 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086847355.1 protein_id gnl|my_center|LOCUS_32070 341882 341184 gene locus_tag LOCUS_32080 341882 341184 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_32080 343470 342082 gene locus_tag LOCUS_32090 343470 342082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977727.1 protein_id gnl|my_center|LOCUS_32090 343735 344403 gene locus_tag LOCUS_32100 343735 344403 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977726.1 protein_id gnl|my_center|LOCUS_32100 344825 344469 gene locus_tag LOCUS_32110 344825 344469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 345576 344953 gene locus_tag LOCUS_32120 345576 344953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 346745 345756 gene locus_tag LOCUS_32130 gene meaB 346745 345756 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222827.1 protein_id gnl|my_center|LOCUS_32130 348978 346753 gene locus_tag LOCUS_32140 gene scpA 348978 346753 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_32140 350813 348975 gene locus_tag LOCUS_32150 350813 348975 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742071.1 protein_id gnl|my_center|LOCUS_32150 352148 350946 gene locus_tag LOCUS_32160 352148 350946 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227234.1 protein_id gnl|my_center|LOCUS_32160 353047 352370 gene locus_tag LOCUS_32170 353047 352370 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224977.1 protein_id gnl|my_center|LOCUS_32170 354512 353202 gene locus_tag LOCUS_32180 354512 353202 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028649.1 protein_id gnl|my_center|LOCUS_32180 355015 354779 gene locus_tag LOCUS_32190 355015 354779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 355893 355012 gene locus_tag LOCUS_32200 355893 355012 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_32200 356023 356376 gene locus_tag LOCUS_32210 356023 356376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 356806 357633 gene locus_tag LOCUS_32220 356806 357633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 358055 357666 gene locus_tag LOCUS_32230 358055 357666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 358408 358052 gene locus_tag LOCUS_32240 358408 358052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 358574 358314 gene locus_tag LOCUS_32250 358574 358314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 358936 358697 gene locus_tag LOCUS_32260 358936 358697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 358830 361367 gene locus_tag LOCUS_32270 358830 361367 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222778.1 protein_id gnl|my_center|LOCUS_32270 361525 361947 gene locus_tag LOCUS_32280 361525 361947 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026899.1 protein_id gnl|my_center|LOCUS_32280 362886 361960 gene locus_tag LOCUS_32290 362886 361960 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079766.1 protein_id gnl|my_center|LOCUS_32290 363608 363024 gene locus_tag LOCUS_32300 363608 363024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 365302 363605 gene locus_tag LOCUS_32310 365302 363605 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258493.1 protein_id gnl|my_center|LOCUS_32310 366141 365299 gene locus_tag LOCUS_32320 366141 365299 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775992.1 protein_id gnl|my_center|LOCUS_32320 367346 366138 gene locus_tag LOCUS_32330 367346 366138 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_32330 367796 367458 gene locus_tag LOCUS_32340 367796 367458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 368621 367950 gene locus_tag LOCUS_32350 368621 367950 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229311.1 protein_id gnl|my_center|LOCUS_32350 368739 369965 gene locus_tag LOCUS_32360 368739 369965 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229309.1 protein_id gnl|my_center|LOCUS_32360 370038 370307 gene locus_tag LOCUS_32370 370038 370307 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229308.1 protein_id gnl|my_center|LOCUS_32370 370312 373206 gene locus_tag LOCUS_32380 370312 373206 CDS product sarcosine oxidase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202495.1 protein_id gnl|my_center|LOCUS_32380 373184 373813 gene locus_tag LOCUS_32390 373184 373813 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205601.1 protein_id gnl|my_center|LOCUS_32390 375044 373833 gene locus_tag LOCUS_32400 375044 373833 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229319.1 protein_id gnl|my_center|LOCUS_32400 375175 376008 gene locus_tag LOCUS_32410 375175 376008 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_32410 376338 376033 gene locus_tag LOCUS_32420 376338 376033 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888479.1 protein_id gnl|my_center|LOCUS_32420 376661 376443 gene locus_tag LOCUS_32430 376661 376443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 377026 378828 gene locus_tag LOCUS_32440 377026 378828 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031645.1 protein_id gnl|my_center|LOCUS_32440 378878 380020 gene locus_tag LOCUS_32450 378878 380020 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031648.1 protein_id gnl|my_center|LOCUS_32450 380141 380374 gene locus_tag LOCUS_32460 380141 380374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 380437 380724 gene locus_tag LOCUS_32470 380437 380724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 380721 381059 gene locus_tag LOCUS_32480 380721 381059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 381694 381143 gene locus_tag LOCUS_32490 381694 381143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 381868 382584 gene locus_tag LOCUS_32500 381868 382584 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031564.1 protein_id gnl|my_center|LOCUS_32500 383255 385378 gene locus_tag LOCUS_32510 383255 385378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 386319 386870 gene locus_tag LOCUS_32520 386319 386870 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977232.1 protein_id gnl|my_center|LOCUS_32520 387091 386867 gene locus_tag LOCUS_32530 387091 386867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 387129 387383 gene locus_tag LOCUS_32540 387129 387383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 387463 389016 gene locus_tag LOCUS_32550 387463 389016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 389426 389351 gene locus_tag LOCUS_t00310 389426 389351 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 389624 390235 gene locus_tag LOCUS_32560 389624 390235 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227937.1 protein_id gnl|my_center|LOCUS_32560 390701 390246 gene locus_tag LOCUS_32570 390701 390246 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227928.1 protein_id gnl|my_center|LOCUS_32570 390769 393459 gene locus_tag LOCUS_32580 gene polA 390769 393459 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_32580 393638 394036 gene locus_tag LOCUS_32590 393638 394036 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085915.1 protein_id gnl|my_center|LOCUS_32590 396142 394079 gene locus_tag LOCUS_32600 396142 394079 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227921.1 protein_id gnl|my_center|LOCUS_32600 396810 396139 gene locus_tag LOCUS_32610 396810 396139 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227920.1 protein_id gnl|my_center|LOCUS_32610 397806 396859 gene locus_tag LOCUS_32620 397806 396859 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227919.1 protein_id gnl|my_center|LOCUS_32620 398705 397803 gene locus_tag LOCUS_32630 398705 397803 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_32630 398598 400607 gene locus_tag LOCUS_32640 398598 400607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 400852 402051 gene locus_tag LOCUS_32650 gene coaE 400852 402051 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286284.1 protein_id gnl|my_center|LOCUS_32650 402549 402052 gene locus_tag LOCUS_32660 402549 402052 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858618.1 protein_id gnl|my_center|LOCUS_32660 403256 402708 gene locus_tag LOCUS_32670 403256 402708 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519677.1 protein_id gnl|my_center|LOCUS_32670 403349 405511 gene locus_tag LOCUS_32680 gene uvrB 403349 405511 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958334.1 protein_id gnl|my_center|LOCUS_32680 406526 405564 gene locus_tag LOCUS_32690 406526 405564 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225042.1 protein_id gnl|my_center|LOCUS_32690 406615 407994 gene locus_tag LOCUS_32700 406615 407994 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106243816.1 protein_id gnl|my_center|LOCUS_32700 409292 408108 gene locus_tag LOCUS_32710 409292 408108 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228153.1 protein_id gnl|my_center|LOCUS_32710 410327 409374 gene locus_tag LOCUS_32720 410327 409374 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228152.1 protein_id gnl|my_center|LOCUS_32720 411081 410341 gene locus_tag LOCUS_32730 411081 410341 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228151.1 protein_id gnl|my_center|LOCUS_32730 411885 411094 gene locus_tag LOCUS_32740 411885 411094 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228150.1 protein_id gnl|my_center|LOCUS_32740 413096 411885 gene locus_tag LOCUS_32750 413096 411885 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228149.1 protein_id gnl|my_center|LOCUS_32750 414153 413236 gene locus_tag LOCUS_32760 414153 413236 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228148.1 protein_id gnl|my_center|LOCUS_32760 415115 414210 gene locus_tag LOCUS_32770 415115 414210 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227901.1 protein_id gnl|my_center|LOCUS_32770 417946 415115 gene locus_tag LOCUS_32780 417946 415115 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227899.1 protein_id gnl|my_center|LOCUS_32780 418302 419318 gene locus_tag LOCUS_32790 418302 419318 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227898.1 protein_id gnl|my_center|LOCUS_32790 420087 419431 gene locus_tag LOCUS_32800 420087 419431 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227895.1 protein_id gnl|my_center|LOCUS_32800 420704 420120 gene locus_tag LOCUS_32810 420704 420120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227894.1 protein_id gnl|my_center|LOCUS_32810 421871 420858 gene locus_tag LOCUS_32820 421871 420858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 422042 423721 gene locus_tag LOCUS_32830 422042 423721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 423773 424528 gene locus_tag LOCUS_32840 423773 424528 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224989.1 protein_id gnl|my_center|LOCUS_32840 424529 425299 gene locus_tag LOCUS_32850 424529 425299 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224990.1 protein_id gnl|my_center|LOCUS_32850 425363 425962 gene locus_tag LOCUS_32860 425363 425962 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224998.1 protein_id gnl|my_center|LOCUS_32860 426029 427015 gene locus_tag LOCUS_32870 426029 427015 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_32870 427528 427959 gene locus_tag LOCUS_32880 427528 427959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 427956 428762 gene locus_tag LOCUS_32890 427956 428762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32890 428759 430216 gene locus_tag LOCUS_32900 428759 430216 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173762.1 protein_id gnl|my_center|LOCUS_32900 430235 430444 gene locus_tag LOCUS_32910 430235 430444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 430445 431887 gene locus_tag LOCUS_32920 430445 431887 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182573247.1 protein_id gnl|my_center|LOCUS_32920 432451 431999 gene locus_tag LOCUS_32930 432451 431999 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225005.1 protein_id gnl|my_center|LOCUS_32930 433617 432496 gene locus_tag LOCUS_32940 433617 432496 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225001.1 protein_id gnl|my_center|LOCUS_32940 434795 433614 gene locus_tag LOCUS_32950 434795 433614 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_32950 436034 434826 gene locus_tag LOCUS_32960 436034 434826 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_32960 437093 436035 gene locus_tag LOCUS_32970 437093 436035 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_32970 437755 437090 gene locus_tag LOCUS_32980 437755 437090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 438256 437984 gene locus_tag LOCUS_32990 438256 437984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 438156 438797 gene locus_tag LOCUS_33000 438156 438797 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228439.1 protein_id gnl|my_center|LOCUS_33000 440551 439004 gene locus_tag LOCUS_33010 440551 439004 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776259.1 protein_id gnl|my_center|LOCUS_33010 440949 440572 gene locus_tag LOCUS_33020 440949 440572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 442514 440979 gene locus_tag LOCUS_33030 442514 440979 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224487.1 protein_id gnl|my_center|LOCUS_33030 442964 443554 gene locus_tag LOCUS_33040 442964 443554 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229313.1 protein_id gnl|my_center|LOCUS_33040 443662 444774 gene locus_tag LOCUS_33050 443662 444774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 444925 446316 gene locus_tag LOCUS_33060 444925 446316 CDS product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028568.1 protein_id gnl|my_center|LOCUS_33060 446489 447274 gene locus_tag LOCUS_33070 446489 447274 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730322.1 protein_id gnl|my_center|LOCUS_33070 447673 447281 gene locus_tag LOCUS_33080 447673 447281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 447971 448999 gene locus_tag LOCUS_33090 gene corA 447971 448999 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027906.1 protein_id gnl|my_center|LOCUS_33090 449985 449227 gene locus_tag LOCUS_33100 449985 449227 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067241.1 protein_id gnl|my_center|LOCUS_33100 451446 450055 gene locus_tag LOCUS_33110 451446 450055 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266195.1 protein_id gnl|my_center|LOCUS_33110 451729 452430 gene locus_tag LOCUS_33120 451729 452430 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230987.1 protein_id gnl|my_center|LOCUS_33120 452430 454160 gene locus_tag LOCUS_33130 452430 454160 CDS product dihydroxyacetone kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027218.1 protein_id gnl|my_center|LOCUS_33130 454166 454654 gene locus_tag LOCUS_33140 454166 454654 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027217.1 protein_id gnl|my_center|LOCUS_33140 454668 455705 gene locus_tag LOCUS_33150 454668 455705 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393144.1 protein_id gnl|my_center|LOCUS_33150 455702 457156 gene locus_tag LOCUS_33160 455702 457156 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976289.1 protein_id gnl|my_center|LOCUS_33160 457188 457916 gene locus_tag LOCUS_33170 457188 457916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 457906 459342 gene locus_tag LOCUS_33180 457906 459342 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928604.1 protein_id gnl|my_center|LOCUS_33180 459536 460894 gene locus_tag LOCUS_33190 459536 460894 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028355.1 protein_id gnl|my_center|LOCUS_33190 461015 461554 gene locus_tag LOCUS_33200 461015 461554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 461551 462993 gene locus_tag LOCUS_33210 461551 462993 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031600.1 protein_id gnl|my_center|LOCUS_33210 463727 463017 gene locus_tag LOCUS_33220 463727 463017 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976364.1 protein_id gnl|my_center|LOCUS_33220 463859 464614 gene locus_tag LOCUS_33230 463859 464614 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972249.1 protein_id gnl|my_center|LOCUS_33230 464767 465741 gene locus_tag LOCUS_33240 464767 465741 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224997.1 protein_id gnl|my_center|LOCUS_33240 466080 465748 gene locus_tag LOCUS_33250 466080 465748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 466273 466452 gene locus_tag LOCUS_33260 466273 466452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 466590 466799 gene locus_tag LOCUS_33270 466590 466799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 466846 467139 gene locus_tag LOCUS_33280 466846 467139 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259014.1 protein_id gnl|my_center|LOCUS_33280 468582 467218 gene locus_tag LOCUS_33290 468582 467218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230051.1 protein_id gnl|my_center|LOCUS_33290 469283 468690 gene locus_tag LOCUS_33300 469283 468690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 469686 469342 gene locus_tag LOCUS_33310 469686 469342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 470134 471156 gene locus_tag LOCUS_33320 470134 471156 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729924.1 protein_id gnl|my_center|LOCUS_33320 471153 472190 gene locus_tag LOCUS_33330 471153 472190 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510662.1 protein_id gnl|my_center|LOCUS_33330 472212 473006 gene locus_tag LOCUS_33340 472212 473006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729922.1 protein_id gnl|my_center|LOCUS_33340 473080 473544 gene locus_tag LOCUS_33350 473080 473544 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899475.1 protein_id gnl|my_center|LOCUS_33350 473640 473942 gene locus_tag LOCUS_33360 473640 473942 CDS product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858604.1 protein_id gnl|my_center|LOCUS_33360 474224 478786 gene locus_tag LOCUS_33370 gene gltB 474224 478786 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742213.1 protein_id gnl|my_center|LOCUS_33370 478779 480230 gene locus_tag LOCUS_33380 478779 480230 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228800.1 protein_id gnl|my_center|LOCUS_33380 480454 481092 gene locus_tag LOCUS_33390 gene phzG 480454 481092 CDS product phenazine biosynthesis FMN-dependent oxidase PhzG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118953.1 protein_id gnl|my_center|LOCUS_33390 481617 481096 gene locus_tag LOCUS_33400 481617 481096 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229804.1 protein_id gnl|my_center|LOCUS_33400 482064 481672 gene locus_tag LOCUS_33410 482064 481672 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728346.1 protein_id gnl|my_center|LOCUS_33410 482142 482930 gene locus_tag LOCUS_33420 482142 482930 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228155.1 protein_id gnl|my_center|LOCUS_33420 484010 483462 gene locus_tag LOCUS_33430 484010 483462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 484200 484748 gene locus_tag LOCUS_33440 484200 484748 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225943.1 protein_id gnl|my_center|LOCUS_33440 485509 484832 gene locus_tag LOCUS_33450 485509 484832 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227876.1 protein_id gnl|my_center|LOCUS_33450 486320 485544 gene locus_tag LOCUS_33460 486320 485544 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222689.1 protein_id gnl|my_center|LOCUS_33460 486730 489591 gene locus_tag LOCUS_33470 gene uvrA 486730 489591 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467399.1 protein_id gnl|my_center|LOCUS_33470 489809 492211 gene locus_tag LOCUS_33480 489809 492211 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226376.1 protein_id gnl|my_center|LOCUS_33480 492278 493606 gene locus_tag LOCUS_33490 492278 493606 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029752.1 protein_id gnl|my_center|LOCUS_33490 493618 494262 gene locus_tag LOCUS_33500 493618 494262 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974351.1 protein_id gnl|my_center|LOCUS_33500 494324 495430 gene locus_tag LOCUS_33510 494324 495430 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225217.1 protein_id gnl|my_center|LOCUS_33510 497048 495456 gene locus_tag LOCUS_33520 497048 495456 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028675.1 protein_id gnl|my_center|LOCUS_33520 497929 497051 gene locus_tag LOCUS_33530 497929 497051 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227861.1 protein_id gnl|my_center|LOCUS_33530 498900 497926 gene locus_tag LOCUS_33540 498900 497926 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742190.1 protein_id gnl|my_center|LOCUS_33540 498785 498881 gene locus_tag LOCUS_t00320 498785 498881 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 500187 498904 gene locus_tag LOCUS_33550 500187 498904 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227859.1 protein_id gnl|my_center|LOCUS_33550 501447 500305 gene locus_tag LOCUS_33560 501447 500305 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227858.1 protein_id gnl|my_center|LOCUS_33560 502918 501524 gene locus_tag LOCUS_33570 502918 501524 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227857.1 protein_id gnl|my_center|LOCUS_33570 504576 502987 gene locus_tag LOCUS_33580 504576 502987 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227856.1 protein_id gnl|my_center|LOCUS_33580 505905 504598 gene locus_tag LOCUS_33590 505905 504598 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227855.1 protein_id gnl|my_center|LOCUS_33590 506013 507041 gene locus_tag LOCUS_33600 506013 507041 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227854.1 protein_id gnl|my_center|LOCUS_33600 507038 507844 gene locus_tag LOCUS_33610 507038 507844 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227853.1 protein_id gnl|my_center|LOCUS_33610 507816 508202 gene locus_tag LOCUS_33620 507816 508202 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031872.1 protein_id gnl|my_center|LOCUS_33620 508716 508291 gene locus_tag LOCUS_33630 508716 508291 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729332.1 protein_id gnl|my_center|LOCUS_33630 508889 509515 gene locus_tag LOCUS_33640 gene infC 508889 509515 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227848.1 protein_id gnl|my_center|LOCUS_33640 509652 509846 gene locus_tag LOCUS_33650 gene rpmI 509652 509846 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776198.1 protein_id gnl|my_center|LOCUS_33650 509959 510327 gene locus_tag LOCUS_33660 gene rplT 509959 510327 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895237.1 protein_id gnl|my_center|LOCUS_33660 510519 511190 gene locus_tag LOCUS_33670 510519 511190 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084642168.1 protein_id gnl|my_center|LOCUS_33670 511359 512426 gene locus_tag LOCUS_33680 gene pheS 511359 512426 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227844.1 protein_id gnl|my_center|LOCUS_33680 512484 514976 gene locus_tag LOCUS_33690 gene pheT 512484 514976 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093159782.1 protein_id gnl|my_center|LOCUS_33690 515073 516611 gene locus_tag LOCUS_33700 515073 516611 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731180.1 protein_id gnl|my_center|LOCUS_33700 516726 517979 gene locus_tag LOCUS_33710 516726 517979 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731181.1 protein_id gnl|my_center|LOCUS_33710 517976 518158 gene locus_tag LOCUS_33720 517976 518158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 518155 518376 gene locus_tag LOCUS_33730 518155 518376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 518637 519662 gene locus_tag LOCUS_33740 gene argC 518637 519662 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227838.1 protein_id gnl|my_center|LOCUS_33740 519659 520084 gene locus_tag LOCUS_33750 519659 520084 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228089.1 protein_id gnl|my_center|LOCUS_33750 520081 521241 gene locus_tag LOCUS_33760 gene argJ 520081 521241 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227837.1 protein_id gnl|my_center|LOCUS_33760 521238 522167 gene locus_tag LOCUS_33770 gene argB 521238 522167 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_33770 522167 523369 gene locus_tag LOCUS_33780 522167 523369 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227835.1 protein_id gnl|my_center|LOCUS_33780 523369 524295 gene locus_tag LOCUS_33790 gene argF 523369 524295 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729314.1 protein_id gnl|my_center|LOCUS_33790 524292 524846 gene locus_tag LOCUS_33800 524292 524846 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227833.1 protein_id gnl|my_center|LOCUS_33800 524839 526035 gene locus_tag LOCUS_33810 524839 526035 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776176.1 protein_id gnl|my_center|LOCUS_33810 >Feature sequence05 <1 1145 gene locus_tag LOCUS_33820 <1 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223100.1:4-aminobutyrate--2-oxoglutarate transaminase 2698 1280 gene locus_tag LOCUS_33830 2698 1280 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728731.1 protein_id gnl|my_center|LOCUS_33830 4168 2711 gene locus_tag LOCUS_33840 4168 2711 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223101.1 protein_id gnl|my_center|LOCUS_33840 5324 4848 gene locus_tag LOCUS_33850 5324 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 5480 7054 gene locus_tag LOCUS_33860 5480 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 7150 7380 gene locus_tag LOCUS_33870 7150 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33870 7361 7696 gene locus_tag LOCUS_33880 7361 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33880 7725 8894 gene locus_tag LOCUS_33890 7725 8894 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977757.1 protein_id gnl|my_center|LOCUS_33890 9877 10002 gene locus_tag LOCUS_33900 9877 10002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 12046 10220 gene locus_tag LOCUS_33910 12046 10220 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226167.1 protein_id gnl|my_center|LOCUS_33910 12241 13875 gene locus_tag LOCUS_33920 12241 13875 CDS product methane monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893346.1 protein_id gnl|my_center|LOCUS_33920 14010 15065 gene locus_tag LOCUS_33930 14010 15065 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728054.1 protein_id gnl|my_center|LOCUS_33930 15159 16265 gene locus_tag LOCUS_33940 15159 16265 CDS product toluene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226171.1 protein_id gnl|my_center|LOCUS_33940 16262 16612 gene locus_tag LOCUS_33950 16262 16612 CDS product MmoB/DmpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893349.1 protein_id gnl|my_center|LOCUS_33950 16800 17294 gene locus_tag LOCUS_33960 16800 17294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 17361 19010 gene locus_tag LOCUS_33970 gene groL 17361 19010 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893353.1 protein_id gnl|my_center|LOCUS_33970 19193 20221 gene locus_tag LOCUS_33980 19193 20221 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226175.1 protein_id gnl|my_center|LOCUS_33980 20294 21337 gene locus_tag LOCUS_33990 20294 21337 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026966.1 protein_id gnl|my_center|LOCUS_33990 21334 22056 gene locus_tag LOCUS_34000 21334 22056 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893351.1 protein_id gnl|my_center|LOCUS_34000 22216 22827 gene locus_tag LOCUS_34010 22216 22827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 23218 22949 gene locus_tag LOCUS_34020 23218 22949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 23156 23497 gene locus_tag LOCUS_34030 23156 23497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 23661 24878 gene locus_tag LOCUS_34040 23661 24878 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467629.1 protein_id gnl|my_center|LOCUS_34040 24875 25519 gene locus_tag LOCUS_34050 24875 25519 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225313.1 protein_id gnl|my_center|LOCUS_34050 25547 25747 gene locus_tag LOCUS_34060 25547 25747 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229193.1 protein_id gnl|my_center|LOCUS_34060 25744 26943 gene locus_tag LOCUS_34070 25744 26943 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165781113.1 protein_id gnl|my_center|LOCUS_34070 27091 28431 gene locus_tag LOCUS_34080 27091 28431 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057329.1 protein_id gnl|my_center|LOCUS_34080 29097 28432 gene locus_tag LOCUS_34090 gene lexA 29097 28432 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225332.1 protein_id gnl|my_center|LOCUS_34090 29542 29742 gene locus_tag LOCUS_34100 29542 29742 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_34100 31135 29876 gene locus_tag LOCUS_34110 31135 29876 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966466.1 protein_id gnl|my_center|LOCUS_34110 32019 31132 gene locus_tag LOCUS_34120 32019 31132 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030092.1 protein_id gnl|my_center|LOCUS_34120 33235 32057 gene locus_tag LOCUS_34130 33235 32057 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227234.1 protein_id gnl|my_center|LOCUS_34130 33884 34264 gene locus_tag LOCUS_34140 33884 34264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34140 34261 34488 gene locus_tag LOCUS_34150 34261 34488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34150 35283 34675 gene locus_tag LOCUS_34160 gene idi 35283 34675 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898999.1 protein_id gnl|my_center|LOCUS_34160 35590 37011 gene locus_tag LOCUS_34170 35590 37011 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225101.1 protein_id gnl|my_center|LOCUS_34170 37020 39368 gene locus_tag LOCUS_34180 37020 39368 CDS product germacradienol/geosmin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630266.1 protein_id gnl|my_center|LOCUS_34180 39419 40825 gene locus_tag LOCUS_34190 39419 40825 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225101.1 protein_id gnl|my_center|LOCUS_34190 40839 41876 gene locus_tag LOCUS_34200 40839 41876 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134732678.1 protein_id gnl|my_center|LOCUS_34200 42781 41927 gene locus_tag LOCUS_34210 42781 41927 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_34210 42979 43350 gene locus_tag LOCUS_34220 42979 43350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 43646 43912 gene locus_tag LOCUS_34230 43646 43912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 44852 43947 gene locus_tag LOCUS_34240 44852 43947 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730689.1 protein_id gnl|my_center|LOCUS_34240 44924 46252 gene locus_tag LOCUS_34250 gene hisD 44924 46252 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897070.1 protein_id gnl|my_center|LOCUS_34250 46252 47448 gene locus_tag LOCUS_34260 46252 47448 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969925.1 protein_id gnl|my_center|LOCUS_34260 47477 48283 gene locus_tag LOCUS_34270 47477 48283 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114860.1 protein_id gnl|my_center|LOCUS_34270 49082 48366 gene locus_tag LOCUS_34280 49082 48366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 49855 49079 gene locus_tag LOCUS_34290 49855 49079 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728087.1 protein_id gnl|my_center|LOCUS_34290 50550 49843 gene locus_tag LOCUS_34300 50550 49843 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920935.1 protein_id gnl|my_center|LOCUS_34300 51700 50561 gene locus_tag LOCUS_34310 51700 50561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 51851 52885 gene locus_tag LOCUS_34320 51851 52885 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728085.1 protein_id gnl|my_center|LOCUS_34320 54298 52952 gene locus_tag LOCUS_34330 54298 52952 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104732.1 protein_id gnl|my_center|LOCUS_34330 56141 54483 gene locus_tag LOCUS_34340 56141 54483 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_34340 57243 56482 gene locus_tag LOCUS_34350 57243 56482 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495356.1 protein_id gnl|my_center|LOCUS_34350 57406 58269 gene locus_tag LOCUS_34360 57406 58269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 58326 59699 gene locus_tag LOCUS_34370 58326 59699 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113879.1 protein_id gnl|my_center|LOCUS_34370 60271 59981 gene locus_tag LOCUS_34380 60271 59981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 60374 60856 gene locus_tag LOCUS_34390 60374 60856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34390 60951 62084 gene locus_tag LOCUS_34400 60951 62084 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223573.1 protein_id gnl|my_center|LOCUS_34400 62081 63001 gene locus_tag LOCUS_34410 62081 63001 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223574.1 protein_id gnl|my_center|LOCUS_34410 63581 64921 gene locus_tag LOCUS_34420 63581 64921 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088210.1 protein_id gnl|my_center|LOCUS_34420 65154 66314 gene locus_tag LOCUS_34430 65154 66314 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223576.1 protein_id gnl|my_center|LOCUS_34430 67707 66490 gene locus_tag LOCUS_34440 67707 66490 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224419.1 protein_id gnl|my_center|LOCUS_34440 69206 67704 gene locus_tag LOCUS_34450 69206 67704 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355315.1 protein_id gnl|my_center|LOCUS_34450 69376 70323 gene locus_tag LOCUS_34460 69376 70323 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727229.1 protein_id gnl|my_center|LOCUS_34460 71707 70496 gene locus_tag LOCUS_34470 71707 70496 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027309.1 protein_id gnl|my_center|LOCUS_34470 71865 73418 gene locus_tag LOCUS_34480 71865 73418 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228610.1 protein_id gnl|my_center|LOCUS_34480 73477 75813 gene locus_tag LOCUS_34490 73477 75813 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224857.1 protein_id gnl|my_center|LOCUS_34490 75825 76301 gene locus_tag LOCUS_34500 75825 76301 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224858.1 protein_id gnl|my_center|LOCUS_34500 76494 77126 gene locus_tag LOCUS_34510 76494 77126 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224746.1 protein_id gnl|my_center|LOCUS_34510 77325 77555 gene locus_tag LOCUS_34520 77325 77555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 77556 78272 gene locus_tag LOCUS_34530 77556 78272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 79691 78282 gene locus_tag LOCUS_34540 79691 78282 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978046.1 protein_id gnl|my_center|LOCUS_34540 81753 79705 gene locus_tag LOCUS_34550 81753 79705 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876809.1 protein_id gnl|my_center|LOCUS_34550 82856 81783 gene locus_tag LOCUS_34560 gene rhaI 82856 81783 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727048.1 protein_id gnl|my_center|LOCUS_34560 83320 82955 gene locus_tag LOCUS_34570 83320 82955 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226382.1 protein_id gnl|my_center|LOCUS_34570 84621 83317 gene locus_tag LOCUS_34580 84621 83317 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727047.1 protein_id gnl|my_center|LOCUS_34580 85267 85437 gene locus_tag LOCUS_34590 85267 85437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 85589 85768 gene locus_tag LOCUS_34600 85589 85768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 86401 85904 gene locus_tag LOCUS_34610 86401 85904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 86930 90004 gene locus_tag LOCUS_34620 86930 90004 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441479.1 protein_id gnl|my_center|LOCUS_34620 90432 90070 gene locus_tag LOCUS_34630 90432 90070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 91269 90478 gene locus_tag LOCUS_34640 91269 90478 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027270.1 protein_id gnl|my_center|LOCUS_34640 91466 91909 gene locus_tag LOCUS_34650 91466 91909 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170054.1 protein_id gnl|my_center|LOCUS_34650 92319 92041 gene locus_tag LOCUS_34660 92319 92041 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222678.1 protein_id gnl|my_center|LOCUS_34660 92545 93480 gene locus_tag LOCUS_34670 92545 93480 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_34670 93765 94004 gene locus_tag LOCUS_34680 93765 94004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 94436 94245 gene locus_tag LOCUS_34690 94436 94245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 95329 94901 gene locus_tag LOCUS_34700 95329 94901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 95508 95909 gene locus_tag LOCUS_34710 95508 95909 CDS product ChaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225977.1 protein_id gnl|my_center|LOCUS_34710 96201 96758 gene locus_tag LOCUS_34720 96201 96758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 97455 96856 gene locus_tag LOCUS_34730 97455 96856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 98483 97761 gene locus_tag LOCUS_34740 98483 97761 CDS product NPP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031599.1 protein_id gnl|my_center|LOCUS_34740 98446 98634 gene locus_tag LOCUS_34750 98446 98634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 99016 99219 gene locus_tag LOCUS_34760 99016 99219 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003488188.1 protein_id gnl|my_center|LOCUS_34760 100279 99386 gene locus_tag LOCUS_34770 100279 99386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227417.1 protein_id gnl|my_center|LOCUS_34770 100881 101216 gene locus_tag LOCUS_34780 100881 101216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 101223 101570 gene locus_tag LOCUS_34790 101223 101570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873079.1 protein_id gnl|my_center|LOCUS_34790 102005 102682 gene locus_tag LOCUS_34800 102005 102682 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222750.1 protein_id gnl|my_center|LOCUS_34800 104170 102965 gene locus_tag LOCUS_34810 104170 102965 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083868.1 protein_id gnl|my_center|LOCUS_34810 105168 104200 gene locus_tag LOCUS_34820 105168 104200 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972317.1 protein_id gnl|my_center|LOCUS_34820 105996 105241 gene locus_tag LOCUS_34830 105996 105241 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229336.1 protein_id gnl|my_center|LOCUS_34830 106857 106255 gene locus_tag LOCUS_34840 106857 106255 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222379.1 protein_id gnl|my_center|LOCUS_34840 106956 108023 gene locus_tag LOCUS_34850 106956 108023 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222380.1 protein_id gnl|my_center|LOCUS_34850 108584 109462 gene locus_tag LOCUS_34860 108584 109462 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971569.1 protein_id gnl|my_center|LOCUS_34860 109610 111406 gene locus_tag LOCUS_34870 109610 111406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031030.1 protein_id gnl|my_center|LOCUS_34870 112485 111553 gene locus_tag LOCUS_34880 112485 111553 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870653.1 protein_id gnl|my_center|LOCUS_34880 112790 112482 gene locus_tag LOCUS_34890 112790 112482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 114498 112780 gene locus_tag LOCUS_34900 114498 112780 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 protein_id gnl|my_center|LOCUS_34900 114606 115421 gene locus_tag LOCUS_34910 114606 115421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 116243 115422 gene locus_tag LOCUS_34920 116243 115422 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_34920 117405 116401 gene locus_tag LOCUS_34930 117405 116401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 118319 117687 gene locus_tag LOCUS_34940 118319 117687 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225120.1 protein_id gnl|my_center|LOCUS_34940 119256 118441 gene locus_tag LOCUS_34950 119256 118441 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230442.1 protein_id gnl|my_center|LOCUS_34950 120287 119253 gene locus_tag LOCUS_34960 120287 119253 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230441.1 protein_id gnl|my_center|LOCUS_34960 121049 120303 gene locus_tag LOCUS_34970 121049 120303 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228176.1 protein_id gnl|my_center|LOCUS_34970 121110 121502 gene locus_tag LOCUS_34980 121110 121502 CDS product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285721.1 protein_id gnl|my_center|LOCUS_34980 122036 121602 gene locus_tag LOCUS_34990 122036 121602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978009.1 protein_id gnl|my_center|LOCUS_34990 122662 122189 gene locus_tag LOCUS_35000 122662 122189 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029646.1 protein_id gnl|my_center|LOCUS_35000 125266 122771 gene locus_tag LOCUS_35010 125266 122771 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461688.1 protein_id gnl|my_center|LOCUS_35010 126175 125495 gene locus_tag LOCUS_35020 126175 125495 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227485.1 protein_id gnl|my_center|LOCUS_35020 126305 127489 gene locus_tag LOCUS_35030 126305 127489 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222788.1 protein_id gnl|my_center|LOCUS_35030 127502 127696 gene locus_tag LOCUS_35040 127502 127696 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222786.1 protein_id gnl|my_center|LOCUS_35040 128310 127801 gene locus_tag LOCUS_35050 128310 127801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 128261 129052 gene locus_tag LOCUS_35060 128261 129052 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_35060 129049 129933 gene locus_tag LOCUS_35070 129049 129933 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225728.1 protein_id gnl|my_center|LOCUS_35070 131682 130981 gene locus_tag LOCUS_35080 131682 130981 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977126.1 protein_id gnl|my_center|LOCUS_35080 131838 132287 gene locus_tag LOCUS_35090 131838 132287 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894320.1 protein_id gnl|my_center|LOCUS_35090 132284 133654 gene locus_tag LOCUS_35100 132284 133654 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729117.1 protein_id gnl|my_center|LOCUS_35100 134025 133792 gene locus_tag LOCUS_35110 134025 133792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 135210 134206 gene locus_tag LOCUS_35120 135210 134206 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028064.1 protein_id gnl|my_center|LOCUS_35120 135494 136963 gene locus_tag LOCUS_35130 135494 136963 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730628.1 protein_id gnl|my_center|LOCUS_35130 137018 138367 gene locus_tag LOCUS_35140 137018 138367 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896979.1 protein_id gnl|my_center|LOCUS_35140 138364 139266 gene locus_tag LOCUS_35150 138364 139266 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896978.1 protein_id gnl|my_center|LOCUS_35150 139266 140201 gene locus_tag LOCUS_35160 139266 140201 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896977.1 protein_id gnl|my_center|LOCUS_35160 140237 141334 gene locus_tag LOCUS_35170 gene ugpC 140237 141334 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730626.1 protein_id gnl|my_center|LOCUS_35170 142675 141539 gene locus_tag LOCUS_35180 142675 141539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 143187 144161 gene locus_tag LOCUS_35190 143187 144161 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265764.1 protein_id gnl|my_center|LOCUS_35190 144192 144803 gene locus_tag LOCUS_35200 144192 144803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 144814 146241 gene locus_tag LOCUS_35210 144814 146241 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031044.1 protein_id gnl|my_center|LOCUS_35210 146402 147424 gene locus_tag LOCUS_35220 146402 147424 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223417.1 protein_id gnl|my_center|LOCUS_35220 147567 148760 gene locus_tag LOCUS_35230 147567 148760 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727175.1 protein_id gnl|my_center|LOCUS_35230 148781 148990 gene locus_tag LOCUS_35240 148781 148990 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228974.1 protein_id gnl|my_center|LOCUS_35240 149074 150891 gene locus_tag LOCUS_35250 149074 150891 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227785.1 protein_id gnl|my_center|LOCUS_35250 150894 151274 gene locus_tag LOCUS_35260 150894 151274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 151327 152520 gene locus_tag LOCUS_35270 151327 152520 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229126.1 protein_id gnl|my_center|LOCUS_35270 152601 153341 gene locus_tag LOCUS_35280 152601 153341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 153975 153400 gene locus_tag LOCUS_35290 153975 153400 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229849.1 protein_id gnl|my_center|LOCUS_35290 156954 154261 gene locus_tag LOCUS_35300 156954 154261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 157393 160227 gene locus_tag LOCUS_35310 157393 160227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 161408 160254 gene locus_tag LOCUS_35320 gene ispG 161408 160254 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284254.1 protein_id gnl|my_center|LOCUS_35320 163213 161405 gene locus_tag LOCUS_35330 163213 161405 CDS product 1-deoxy-D-xylulose-5-phosphate synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417910.1 protein_id gnl|my_center|LOCUS_35330 164227 163250 gene locus_tag LOCUS_35340 gene ispH 164227 163250 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417912.1 protein_id gnl|my_center|LOCUS_35340 164531 165283 gene locus_tag LOCUS_35350 164531 165283 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227511.1 protein_id gnl|my_center|LOCUS_35350 165342 165761 gene locus_tag LOCUS_35360 165342 165761 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029513.1 protein_id gnl|my_center|LOCUS_35360 166284 165943 gene locus_tag LOCUS_35370 166284 165943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 166320 166679 gene locus_tag LOCUS_35380 166320 166679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 167103 168734 gene locus_tag LOCUS_35390 167103 168734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 168737 169291 gene locus_tag LOCUS_35400 168737 169291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 169288 170670 gene locus_tag LOCUS_35410 gene accC 169288 170670 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259259.1 protein_id gnl|my_center|LOCUS_35410 170667 171683 gene locus_tag LOCUS_35420 170667 171683 CDS product ScbA/BarX family gamma-butyrolactone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190059139.1 protein_id gnl|my_center|LOCUS_35420 171680 172717 gene locus_tag LOCUS_35430 171680 172717 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078864641.1 protein_id gnl|my_center|LOCUS_35430 172714 172953 gene locus_tag LOCUS_35440 172714 172953 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106204.1 protein_id gnl|my_center|LOCUS_35440 172950 174185 gene locus_tag LOCUS_35450 172950 174185 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030513.1 protein_id gnl|my_center|LOCUS_35450 174305 175012 gene locus_tag LOCUS_35460 174305 175012 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227005.1 protein_id gnl|my_center|LOCUS_35460 175009 175692 gene locus_tag LOCUS_35470 175009 175692 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142822.1 protein_id gnl|my_center|LOCUS_35470 176182 175583 gene locus_tag LOCUS_35480 176182 175583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 176593 176228 gene locus_tag LOCUS_35490 176593 176228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35490 177108 176512 gene locus_tag LOCUS_35500 177108 176512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35500 177692 177928 gene locus_tag LOCUS_35510 177692 177928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 178645 177956 gene locus_tag LOCUS_35520 178645 177956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 180134 178884 gene locus_tag LOCUS_35530 180134 178884 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026832.1 protein_id gnl|my_center|LOCUS_35530 180571 180170 gene locus_tag LOCUS_35540 180571 180170 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254740.1 protein_id gnl|my_center|LOCUS_35540 181606 180578 gene locus_tag LOCUS_35550 181606 180578 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028313.1 protein_id gnl|my_center|LOCUS_35550 181776 182651 gene locus_tag LOCUS_35560 181776 182651 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727008.1 protein_id gnl|my_center|LOCUS_35560 183104 183538 gene locus_tag LOCUS_35570 183104 183538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35570 183551 184111 gene locus_tag LOCUS_35580 183551 184111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35580 184626 186065 gene locus_tag LOCUS_35590 184626 186065 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225325.1 protein_id gnl|my_center|LOCUS_35590 187593 187159 gene locus_tag LOCUS_35600 187593 187159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 189348 188686 gene locus_tag LOCUS_35610 189348 188686 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085604.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35610 190544 189633 gene locus_tag LOCUS_35620 gene bla 190544 189633 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226950.1 protein_id gnl|my_center|LOCUS_35620 190633 191547 gene locus_tag LOCUS_35630 190633 191547 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226949.1 protein_id gnl|my_center|LOCUS_35630 191617 192519 gene locus_tag LOCUS_35640 191617 192519 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226948.1 protein_id gnl|my_center|LOCUS_35640 192799 192599 gene locus_tag LOCUS_35650 192799 192599 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_35650 194024 193113 gene locus_tag LOCUS_35660 194024 193113 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226795.1 protein_id gnl|my_center|LOCUS_35660 194183 195436 gene locus_tag LOCUS_35670 194183 195436 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339317.1 protein_id gnl|my_center|LOCUS_35670 195433 196761 gene locus_tag LOCUS_35680 gene proP 195433 196761 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028291.1 protein_id gnl|my_center|LOCUS_35680 196812 198065 gene locus_tag LOCUS_35690 196812 198065 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731181.1 protein_id gnl|my_center|LOCUS_35690 198528 198301 gene locus_tag LOCUS_35700 198528 198301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 198631 199515 gene locus_tag LOCUS_35710 198631 199515 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222148.1 protein_id gnl|my_center|LOCUS_35710 199512 199709 gene locus_tag LOCUS_35720 199512 199709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 199883 201034 gene locus_tag LOCUS_35730 199883 201034 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224312.1 protein_id gnl|my_center|LOCUS_35730 201470 201120 gene locus_tag LOCUS_35740 201470 201120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 201382 202833 gene locus_tag LOCUS_35750 201382 202833 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070148.1 protein_id gnl|my_center|LOCUS_35750 203028 203582 gene locus_tag LOCUS_35760 203028 203582 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532352.1 protein_id gnl|my_center|LOCUS_35760 203904 203593 gene locus_tag LOCUS_35770 203904 203593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 204553 203951 gene locus_tag LOCUS_35780 204553 203951 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730499.1 protein_id gnl|my_center|LOCUS_35780 206004 204586 gene locus_tag LOCUS_35790 206004 204586 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_35790 206688 206419 gene locus_tag LOCUS_35800 206688 206419 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064709.1 protein_id gnl|my_center|LOCUS_35800 207808 207428 gene locus_tag LOCUS_35810 207808 207428 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_35810 208092 207805 gene locus_tag LOCUS_35820 208092 207805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 208458 208156 gene locus_tag LOCUS_35830 208458 208156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 208382 208588 gene locus_tag LOCUS_35840 208382 208588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 208891 209532 gene locus_tag LOCUS_35850 208891 209532 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896924.1 protein_id gnl|my_center|LOCUS_35850 209631 210788 gene locus_tag LOCUS_35860 209631 210788 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030553.1 protein_id gnl|my_center|LOCUS_35860 210833 211996 gene locus_tag LOCUS_35870 210833 211996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 213266 212100 gene locus_tag LOCUS_35880 213266 212100 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767507.1 protein_id gnl|my_center|LOCUS_35880 214655 213423 gene locus_tag LOCUS_35890 214655 213423 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727175.1 protein_id gnl|my_center|LOCUS_35890 215315 215713 gene locus_tag LOCUS_35900 215315 215713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 216256 215861 gene locus_tag LOCUS_35910 216256 215861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35910 216473 217270 gene locus_tag LOCUS_35920 216473 217270 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_35920 217563 218609 gene locus_tag LOCUS_35930 217563 218609 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383135.1 protein_id gnl|my_center|LOCUS_35930 218609 219787 gene locus_tag LOCUS_35940 gene rhmD 218609 219787 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427822.1 protein_id gnl|my_center|LOCUS_35940 219810 220685 gene locus_tag LOCUS_35950 219810 220685 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027038.1 protein_id gnl|my_center|LOCUS_35950 220859 221173 gene locus_tag LOCUS_35960 220859 221173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 221408 221875 gene locus_tag LOCUS_35970 221408 221875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 222330 221905 gene locus_tag LOCUS_35980 222330 221905 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259444.1 protein_id gnl|my_center|LOCUS_35980 222284 223084 gene locus_tag LOCUS_35990 222284 223084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 223371 224198 gene locus_tag LOCUS_36000 223371 224198 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935658.1 protein_id gnl|my_center|LOCUS_36000 224195 225187 gene locus_tag LOCUS_36010 224195 225187 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098398.1 protein_id gnl|my_center|LOCUS_36010 225184 226032 gene locus_tag LOCUS_36020 225184 226032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 226034 226792 gene locus_tag LOCUS_36030 226034 226792 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728425.1 protein_id gnl|my_center|LOCUS_36030 226912 227136 gene locus_tag LOCUS_36040 226912 227136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 227204 228586 gene locus_tag LOCUS_36050 227204 228586 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728094.1 protein_id gnl|my_center|LOCUS_36050 230016 228514 gene locus_tag LOCUS_36060 230016 228514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 230190 230912 gene locus_tag LOCUS_36070 230190 230912 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026967.1 protein_id gnl|my_center|LOCUS_36070 231066 231494 gene locus_tag LOCUS_36080 231066 231494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 232097 231534 gene locus_tag LOCUS_36090 232097 231534 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402846.1 protein_id gnl|my_center|LOCUS_36090 232594 232202 gene locus_tag LOCUS_36100 232594 232202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 233711 232728 gene locus_tag LOCUS_36110 233711 232728 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094369.1 protein_id gnl|my_center|LOCUS_36110 233919 234797 gene locus_tag LOCUS_36120 233919 234797 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971907.1 protein_id gnl|my_center|LOCUS_36120 235677 234910 gene locus_tag LOCUS_36130 235677 234910 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971784.1 protein_id gnl|my_center|LOCUS_36130 236729 235842 gene locus_tag LOCUS_36140 236729 235842 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385588.1 protein_id gnl|my_center|LOCUS_36140 237905 236898 gene locus_tag LOCUS_36150 gene adhP 237905 236898 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 protein_id gnl|my_center|LOCUS_36150 238713 238090 gene locus_tag LOCUS_36160 238713 238090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 239224 238832 gene locus_tag LOCUS_36170 239224 238832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 239632 239423 gene locus_tag LOCUS_36180 239632 239423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 240041 239646 gene locus_tag LOCUS_36190 240041 239646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 240488 240730 gene locus_tag LOCUS_36200 240488 240730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 240970 241473 gene locus_tag LOCUS_36210 240970 241473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 241492 242346 gene locus_tag LOCUS_36220 241492 242346 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877268.1 protein_id gnl|my_center|LOCUS_36220 242598 242350 gene locus_tag LOCUS_36230 242598 242350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 243051 243806 gene locus_tag LOCUS_36240 243051 243806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 244471 243794 gene locus_tag LOCUS_36250 244471 243794 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225121.1 protein_id gnl|my_center|LOCUS_36250 244641 245705 gene locus_tag LOCUS_36260 244641 245705 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079769.1 protein_id gnl|my_center|LOCUS_36260 245791 246450 gene locus_tag LOCUS_36270 245791 246450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 246618 247427 gene locus_tag LOCUS_36280 246618 247427 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_36280 247412 249013 gene locus_tag LOCUS_36290 247412 249013 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029630.1 protein_id gnl|my_center|LOCUS_36290 250423 249110 gene locus_tag LOCUS_36300 250423 249110 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_36300 250617 251981 gene locus_tag LOCUS_36310 250617 251981 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225330.1 protein_id gnl|my_center|LOCUS_36310 252951 251992 gene locus_tag LOCUS_36320 252951 251992 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227667.1 protein_id gnl|my_center|LOCUS_36320 253199 252948 gene locus_tag LOCUS_36330 253199 252948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 253237 254580 gene locus_tag LOCUS_36340 253237 254580 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484585.1 protein_id gnl|my_center|LOCUS_36340 254632 256533 gene locus_tag LOCUS_36350 254632 256533 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227746.1 protein_id gnl|my_center|LOCUS_36350 256708 257082 gene locus_tag LOCUS_36360 256708 257082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 257079 257243 gene locus_tag LOCUS_36370 257079 257243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 257334 257606 gene locus_tag LOCUS_36380 257334 257606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36380 257657 258007 gene locus_tag LOCUS_36390 257657 258007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 258022 258510 gene locus_tag LOCUS_36400 258022 258510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224682.1 protein_id gnl|my_center|LOCUS_36400 258507 259037 gene locus_tag LOCUS_36410 258507 259037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 259653 259426 gene locus_tag LOCUS_36420 259653 259426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 259852 260622 gene locus_tag LOCUS_36430 259852 260622 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222148.1 protein_id gnl|my_center|LOCUS_36430 260619 260816 gene locus_tag LOCUS_36440 260619 260816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 261001 261333 gene locus_tag LOCUS_36450 261001 261333 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978605.1 protein_id gnl|my_center|LOCUS_36450 262099 261452 gene locus_tag LOCUS_36460 262099 261452 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225313.1 protein_id gnl|my_center|LOCUS_36460 262342 262563 gene locus_tag LOCUS_36470 262342 262563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 262625 262843 gene locus_tag LOCUS_36480 262625 262843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 262926 263681 gene locus_tag LOCUS_36490 262926 263681 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027048.1 protein_id gnl|my_center|LOCUS_36490 263779 264780 gene locus_tag LOCUS_36500 263779 264780 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223734.1 protein_id gnl|my_center|LOCUS_36500 264801 265640 gene locus_tag LOCUS_36510 264801 265640 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223735.1 protein_id gnl|my_center|LOCUS_36510 266488 265670 gene locus_tag LOCUS_36520 266488 265670 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_36520 267561 266665 gene locus_tag LOCUS_36530 267561 266665 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704494.1 protein_id gnl|my_center|LOCUS_36530 267701 268717 gene locus_tag LOCUS_36540 267701 268717 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023619.1 protein_id gnl|my_center|LOCUS_36540 268898 269701 gene locus_tag LOCUS_36550 268898 269701 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027387.1 protein_id gnl|my_center|LOCUS_36550 269818 270465 gene locus_tag LOCUS_36560 269818 270465 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258352.1 protein_id gnl|my_center|LOCUS_36560 270539 270904 gene locus_tag LOCUS_36570 270539 270904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086839875.1 protein_id gnl|my_center|LOCUS_36570 272005 270947 gene locus_tag LOCUS_36580 272005 270947 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742197.1 protein_id gnl|my_center|LOCUS_36580 272254 272084 gene locus_tag LOCUS_36590 272254 272084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 273132 272332 gene locus_tag LOCUS_36600 273132 272332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 274086 273241 gene locus_tag LOCUS_36610 274086 273241 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030730.1 protein_id gnl|my_center|LOCUS_36610 274186 275892 gene locus_tag LOCUS_36620 274186 275892 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226824.1 protein_id gnl|my_center|LOCUS_36620 275918 276721 gene locus_tag LOCUS_36630 275918 276721 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445567.1 protein_id gnl|my_center|LOCUS_36630 276908 277165 gene locus_tag LOCUS_36640 276908 277165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 277193 278185 gene locus_tag LOCUS_36650 277193 278185 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_36650 279383 278208 gene locus_tag LOCUS_36660 279383 278208 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228355.1 protein_id gnl|my_center|LOCUS_36660 279521 280441 gene locus_tag LOCUS_36670 279521 280441 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167379699.1 protein_id gnl|my_center|LOCUS_36670 281146 280469 gene locus_tag LOCUS_36680 281146 280469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 284145 281431 gene locus_tag LOCUS_36690 284145 281431 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226193.1 protein_id gnl|my_center|LOCUS_36690 284725 285429 gene locus_tag LOCUS_36700 284725 285429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224938.1 protein_id gnl|my_center|LOCUS_36700 285929 285492 gene locus_tag LOCUS_36710 285929 285492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36710 286279 286710 gene locus_tag LOCUS_36720 286279 286710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 286946 286626 gene locus_tag LOCUS_36730 286946 286626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36730 286977 287105 gene locus_tag LOCUS_36740 286977 287105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36740 287211 287891 gene locus_tag LOCUS_36750 287211 287891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36750 288479 287967 gene locus_tag LOCUS_36760 288479 287967 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729409.1 protein_id gnl|my_center|LOCUS_36760 289089 288640 gene locus_tag LOCUS_36770 289089 288640 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223540.1 protein_id gnl|my_center|LOCUS_36770 290784 289243 gene locus_tag LOCUS_36780 290784 289243 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225258.1 protein_id gnl|my_center|LOCUS_36780 291706 290789 gene locus_tag LOCUS_36790 291706 290789 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225257.1 protein_id gnl|my_center|LOCUS_36790 293000 291906 gene locus_tag LOCUS_36800 293000 291906 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972497.1 protein_id gnl|my_center|LOCUS_36800 293985 293377 gene locus_tag LOCUS_36810 293985 293377 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975967.1 protein_id gnl|my_center|LOCUS_36810 294386 295135 gene locus_tag LOCUS_36820 294386 295135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36820 295154 295705 gene locus_tag LOCUS_36830 295154 295705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36830 296349 295948 gene locus_tag LOCUS_36840 296349 295948 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975554.1 protein_id gnl|my_center|LOCUS_36840 297274 296873 gene locus_tag LOCUS_36850 297274 296873 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895709.1 protein_id gnl|my_center|LOCUS_36850 297933 298052 gene locus_tag LOCUS_36860 297933 298052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 298149 299399 gene locus_tag LOCUS_36870 298149 299399 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878598.1 protein_id gnl|my_center|LOCUS_36870 299408 300775 gene locus_tag LOCUS_36880 gene mnoS 299408 300775 CDS product two-component system sensor histidine kinase MnoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731147.1 protein_id gnl|my_center|LOCUS_36880 300768 301451 gene locus_tag LOCUS_36890 gene mnoR 300768 301451 CDS product two-component system response regulator MnoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897657.1 protein_id gnl|my_center|LOCUS_36890 302464 301544 gene locus_tag LOCUS_36900 gene mftM 302464 301544 CDS product mycofactocin oligosaccharide methyltransferase MftM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731146.1 protein_id gnl|my_center|LOCUS_36900 303981 302461 gene locus_tag LOCUS_36910 303981 302461 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731149.1 protein_id gnl|my_center|LOCUS_36910 305140 303992 gene locus_tag LOCUS_36920 305140 303992 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258665.1 protein_id gnl|my_center|LOCUS_36920 306516 305224 gene locus_tag LOCUS_36930 gene mdo 306516 305224 CDS product NDMA-dependent methanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731151.1 protein_id gnl|my_center|LOCUS_36930 306827 307024 gene locus_tag LOCUS_36940 306827 307024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 307014 307328 gene locus_tag LOCUS_36950 gene mftB 307014 307328 CDS product mycofactocin biosynthesis chaperone MftB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892808.1 protein_id gnl|my_center|LOCUS_36950 307367 308587 gene locus_tag LOCUS_36960 gene mftC 307367 308587 CDS product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112050.1 protein_id gnl|my_center|LOCUS_36960 308641 309837 gene locus_tag LOCUS_36970 gene mftD 308641 309837 CDS product mycofactocin biosynthesis FMN-dependent deaminase MftD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898557.1 protein_id gnl|my_center|LOCUS_36970 309925 310653 gene locus_tag LOCUS_36980 gene mftE 309925 310653 CDS product mycofactocin biosynthesis peptidyl-dipeptidase MftE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877069.1 protein_id gnl|my_center|LOCUS_36980 310750 311538 gene locus_tag LOCUS_36990 310750 311538 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088823.1 protein_id gnl|my_center|LOCUS_36990 311535 312908 gene locus_tag LOCUS_37000 gene mftF 311535 312908 CDS product mycofactocin biosynthesis glycosyltransferase MftF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112043.1 protein_id gnl|my_center|LOCUS_37000 314732 313050 gene locus_tag LOCUS_37010 314732 313050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 315718 314741 gene locus_tag LOCUS_37020 315718 314741 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878166.1 protein_id gnl|my_center|LOCUS_37020 315908 316825 gene locus_tag LOCUS_37030 315908 316825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 316962 318332 gene locus_tag LOCUS_37040 316962 318332 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_37040 318469 319173 gene locus_tag LOCUS_37050 318469 319173 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_37050 319198 319941 gene locus_tag LOCUS_37060 319198 319941 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111142.1 protein_id gnl|my_center|LOCUS_37060 321012 319942 gene locus_tag LOCUS_37070 321012 319942 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729758.1 protein_id gnl|my_center|LOCUS_37070 321452 322252 gene locus_tag LOCUS_37080 321452 322252 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_37080 322673 322278 gene locus_tag LOCUS_37090 322673 322278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 323902 322736 gene locus_tag LOCUS_37100 323902 322736 CDS product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728393.1 protein_id gnl|my_center|LOCUS_37100 324129 325142 gene locus_tag LOCUS_37110 324129 325142 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973334.1 protein_id gnl|my_center|LOCUS_37110 325283 326509 gene locus_tag LOCUS_37120 325283 326509 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226191.1 protein_id gnl|my_center|LOCUS_37120 326644 327495 gene locus_tag LOCUS_37130 326644 327495 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226190.1 protein_id gnl|my_center|LOCUS_37130 327495 328313 gene locus_tag LOCUS_37140 327495 328313 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226189.1 protein_id gnl|my_center|LOCUS_37140 328392 330425 gene locus_tag LOCUS_37150 328392 330425 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226188.1 protein_id gnl|my_center|LOCUS_37150 330596 330823 gene locus_tag LOCUS_37160 330596 330823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 330838 332073 gene locus_tag LOCUS_37170 330838 332073 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029184.1 protein_id gnl|my_center|LOCUS_37170 333381 332176 gene locus_tag LOCUS_37180 333381 332176 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808460.1 protein_id gnl|my_center|LOCUS_37180 334512 333475 gene locus_tag LOCUS_37190 334512 333475 CDS product phenol 2-monooxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206216.1 protein_id gnl|my_center|LOCUS_37190 335792 334572 gene locus_tag LOCUS_37200 335792 334572 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173501.1 protein_id gnl|my_center|LOCUS_37200 335755 335922 gene locus_tag LOCUS_37210 335755 335922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 336086 337039 gene locus_tag LOCUS_37220 336086 337039 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392461.1 protein_id gnl|my_center|LOCUS_37220 338571 337087 gene locus_tag LOCUS_37230 338571 337087 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222293.1 protein_id gnl|my_center|LOCUS_37230 338739 340262 gene locus_tag LOCUS_37240 338739 340262 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027628.1 protein_id gnl|my_center|LOCUS_37240 340262 340657 gene locus_tag LOCUS_37250 340262 340657 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027643.1 protein_id gnl|my_center|LOCUS_37250 340784 341926 gene locus_tag LOCUS_37260 340784 341926 CDS product glutathione-independent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974908.1 protein_id gnl|my_center|LOCUS_37260 341991 343073 gene locus_tag LOCUS_37270 341991 343073 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526892.1 protein_id gnl|my_center|LOCUS_37270 343172 344083 gene locus_tag LOCUS_37280 343172 344083 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226940.1 protein_id gnl|my_center|LOCUS_37280 345354 344194 gene locus_tag LOCUS_37290 345354 344194 CDS product L-talarate/galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218254.1 protein_id gnl|my_center|LOCUS_37290 346663 345380 gene locus_tag LOCUS_37300 346663 345380 CDS product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028417.1 protein_id gnl|my_center|LOCUS_37300 348047 346839 gene locus_tag LOCUS_37310 348047 346839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 349443 348103 gene locus_tag LOCUS_37320 349443 348103 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368950.1 protein_id gnl|my_center|LOCUS_37320 351071 349746 gene locus_tag LOCUS_37330 351071 349746 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731050.1 protein_id gnl|my_center|LOCUS_37330 352757 351159 gene locus_tag LOCUS_37340 352757 351159 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731065.1 protein_id gnl|my_center|LOCUS_37340 353724 352783 gene locus_tag LOCUS_37350 gene kdgD 353724 352783 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088612.1 protein_id gnl|my_center|LOCUS_37350 353919 354797 gene locus_tag LOCUS_37360 353919 354797 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897528.1 protein_id gnl|my_center|LOCUS_37360 355299 354865 gene locus_tag LOCUS_37370 355299 354865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 355367 355642 gene locus_tag LOCUS_37380 355367 355642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 355716 356165 gene locus_tag LOCUS_37390 355716 356165 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876692.1 protein_id gnl|my_center|LOCUS_37390 356762 356259 gene locus_tag LOCUS_37400 356762 356259 CDS product YfcE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228757.1 protein_id gnl|my_center|LOCUS_37400 357708 356806 gene locus_tag LOCUS_37410 357708 356806 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531164.1 protein_id gnl|my_center|LOCUS_37410 359349 357805 gene locus_tag LOCUS_37420 359349 357805 CDS product SagB family peptide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176762.1 protein_id gnl|my_center|LOCUS_37420 361265 359361 gene locus_tag LOCUS_37430 361265 359361 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075677560.1 protein_id gnl|my_center|LOCUS_37430 362270 361362 gene locus_tag LOCUS_37440 362270 361362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 362704 363324 gene locus_tag LOCUS_37450 362704 363324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 364810 363470 gene locus_tag LOCUS_37460 364810 363470 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267168.1 protein_id gnl|my_center|LOCUS_37460 366060 364852 gene locus_tag LOCUS_37470 366060 364852 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729450.1 protein_id gnl|my_center|LOCUS_37470 366173 367198 gene locus_tag LOCUS_37480 366173 367198 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729449.1 protein_id gnl|my_center|LOCUS_37480 367931 367305 gene locus_tag LOCUS_37490 367931 367305 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_37490 369462 367987 gene locus_tag LOCUS_37500 gene tcuA 369462 367987 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 protein_id gnl|my_center|LOCUS_37500 369610 370581 gene locus_tag LOCUS_37510 369610 370581 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966067.1 protein_id gnl|my_center|LOCUS_37510 370589 371146 gene locus_tag LOCUS_37520 370589 371146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 371148 372638 gene locus_tag LOCUS_37530 371148 372638 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392179.1 protein_id gnl|my_center|LOCUS_37530 372841 372677 gene locus_tag LOCUS_37540 372841 372677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 373756 372980 gene locus_tag LOCUS_37550 373756 372980 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722299.1 protein_id gnl|my_center|LOCUS_37550 374184 373921 gene locus_tag LOCUS_37560 374184 373921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 374346 374540 gene locus_tag LOCUS_37570 374346 374540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 374537 374719 gene locus_tag LOCUS_37580 374537 374719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 375147 375623 gene locus_tag LOCUS_37590 375147 375623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 375804 376646 gene locus_tag LOCUS_37600 375804 376646 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095420.1 protein_id gnl|my_center|LOCUS_37600 377932 376733 gene locus_tag LOCUS_37610 377932 376733 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104472.1 protein_id gnl|my_center|LOCUS_37610 378158 379201 gene locus_tag LOCUS_37620 378158 379201 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978054.1 protein_id gnl|my_center|LOCUS_37620 379518 380057 gene locus_tag LOCUS_37630 379518 380057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229320.1 protein_id gnl|my_center|LOCUS_37630 382091 380202 gene locus_tag LOCUS_37640 gene rhgW 382091 380202 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_37640 383424 382141 gene locus_tag LOCUS_37650 383424 382141 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227054.1 protein_id gnl|my_center|LOCUS_37650 383814 386543 gene locus_tag LOCUS_37660 383814 386543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229177.1 protein_id gnl|my_center|LOCUS_37660 387500 386661 gene locus_tag LOCUS_37670 387500 386661 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728493.1 protein_id gnl|my_center|LOCUS_37670 388711 387497 gene locus_tag LOCUS_37680 388711 387497 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894021.1 protein_id gnl|my_center|LOCUS_37680 388808 389839 gene locus_tag LOCUS_37690 388808 389839 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226898.1 protein_id gnl|my_center|LOCUS_37690 390114 389965 gene locus_tag LOCUS_37700 390114 389965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 390061 390300 gene locus_tag LOCUS_37710 390061 390300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 390563 390381 gene locus_tag LOCUS_37720 390563 390381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 391033 390488 gene locus_tag LOCUS_37730 391033 390488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37730 391191 391012 gene locus_tag LOCUS_37740 391191 391012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 392052 391420 gene locus_tag LOCUS_37750 392052 391420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 392928 394100 gene locus_tag LOCUS_37760 392928 394100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 395293 396480 gene locus_tag LOCUS_37770 395293 396480 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015557.1 protein_id gnl|my_center|LOCUS_37770 397047 396559 gene locus_tag LOCUS_37780 397047 396559 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027466.1 protein_id gnl|my_center|LOCUS_37780 397669 397025 gene locus_tag LOCUS_37790 gene hxlB 397669 397025 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963719.1 protein_id gnl|my_center|LOCUS_37790 398030 398728 gene locus_tag LOCUS_37800 398030 398728 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229311.1 protein_id gnl|my_center|LOCUS_37800 398765 401281 gene locus_tag LOCUS_37810 398765 401281 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775989.1 protein_id gnl|my_center|LOCUS_37810 401295 402059 gene locus_tag LOCUS_37820 401295 402059 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_37820 402063 403043 gene locus_tag LOCUS_37830 402063 403043 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877364.1 protein_id gnl|my_center|LOCUS_37830 403341 404615 gene locus_tag LOCUS_37840 403341 404615 CDS product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289401.1 protein_id gnl|my_center|LOCUS_37840 405383 404754 gene locus_tag LOCUS_37850 405383 404754 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029436.1 protein_id gnl|my_center|LOCUS_37850 406210 406082 gene locus_tag LOCUS_37860 406210 406082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 407526 406207 gene locus_tag LOCUS_37870 407526 406207 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228504.1 protein_id gnl|my_center|LOCUS_37870 409208 407856 gene locus_tag LOCUS_37880 gene gntP 409208 407856 CDS product gluconate permease GntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131724.1 protein_id gnl|my_center|LOCUS_37880 411049 409313 gene locus_tag LOCUS_37890 411049 409313 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528172.1 protein_id gnl|my_center|LOCUS_37890 411960 411046 gene locus_tag LOCUS_37900 411960 411046 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227980.1 protein_id gnl|my_center|LOCUS_37900 412360 411989 gene locus_tag LOCUS_37910 412360 411989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 413883 412420 gene locus_tag LOCUS_37920 413883 412420 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385749.1 protein_id gnl|my_center|LOCUS_37920 414040 414747 gene locus_tag LOCUS_37930 414040 414747 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024324453.1 protein_id gnl|my_center|LOCUS_37930 414853 416151 gene locus_tag LOCUS_37940 414853 416151 CDS product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039138.1 protein_id gnl|my_center|LOCUS_37940 416133 417578 gene locus_tag LOCUS_37950 416133 417578 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975885.1 protein_id gnl|my_center|LOCUS_37950 417873 418550 gene locus_tag LOCUS_37960 417873 418550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 419435 418569 gene locus_tag LOCUS_37970 419435 418569 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228350.1 protein_id gnl|my_center|LOCUS_37970 419590 419432 gene locus_tag LOCUS_37980 419590 419432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 419538 420437 gene locus_tag LOCUS_37990 419538 420437 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 protein_id gnl|my_center|LOCUS_37990 420570 421172 gene locus_tag LOCUS_38000 420570 421172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 421752 421162 gene locus_tag LOCUS_38010 421752 421162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38010 423604 422651 gene locus_tag LOCUS_38020 423604 422651 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106275831.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38020 424060 425028 gene locus_tag LOCUS_38030 424060 425028 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715389.1 protein_id gnl|my_center|LOCUS_38030 426087 425050 gene locus_tag LOCUS_38040 426087 425050 CDS product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170068.1 protein_id gnl|my_center|LOCUS_38040 428052 426385 gene locus_tag LOCUS_38050 428052 426385 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030975.1 protein_id gnl|my_center|LOCUS_38050 429191 428190 gene locus_tag LOCUS_38060 429191 428190 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259666.1 protein_id gnl|my_center|LOCUS_38060 429365 430216 gene locus_tag LOCUS_38070 429365 430216 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225695.1 protein_id gnl|my_center|LOCUS_38070 430438 431142 gene locus_tag LOCUS_38080 430438 431142 CDS product class III extradiol dioxygenase subunit B-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030454.1 protein_id gnl|my_center|LOCUS_38080 431204 432073 gene locus_tag LOCUS_38090 gene folP 431204 432073 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228969.1 protein_id gnl|my_center|LOCUS_38090 432167 433126 gene locus_tag LOCUS_38100 432167 433126 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831595.1 protein_id gnl|my_center|LOCUS_38100 434053 433196 gene locus_tag LOCUS_38110 434053 433196 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229628.1 protein_id gnl|my_center|LOCUS_38110 434320 435147 gene locus_tag LOCUS_38120 434320 435147 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225460.1 protein_id gnl|my_center|LOCUS_38120 435242 436300 gene locus_tag LOCUS_38130 435242 436300 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223562.1 protein_id gnl|my_center|LOCUS_38130 436466 437716 gene locus_tag LOCUS_38140 436466 437716 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731311.1 protein_id gnl|my_center|LOCUS_38140 437716 438441 gene locus_tag LOCUS_38150 437716 438441 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_38150 438434 439540 gene locus_tag LOCUS_38160 438434 439540 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_38160 439733 440107 gene locus_tag LOCUS_38170 439733 440107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 440338 440523 gene locus_tag LOCUS_38180 440338 440523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 441350 440670 gene locus_tag LOCUS_38190 441350 440670 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 protein_id gnl|my_center|LOCUS_38190 441422 442069 gene locus_tag LOCUS_38200 441422 442069 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064806.1 protein_id gnl|my_center|LOCUS_38200 442237 443448 gene locus_tag LOCUS_38210 442237 443448 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804855.1 protein_id gnl|my_center|LOCUS_38210 443500 444438 gene locus_tag LOCUS_38220 443500 444438 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466931.1 protein_id gnl|my_center|LOCUS_38220 444494 445390 gene locus_tag LOCUS_38230 444494 445390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 446389 445403 gene locus_tag LOCUS_38240 446389 445403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 446749 446396 gene locus_tag LOCUS_38250 446749 446396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38250 447658 447068 gene locus_tag LOCUS_38260 gene nthA 447658 447068 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174055.1 protein_id gnl|my_center|LOCUS_38260 447945 447655 gene locus_tag LOCUS_38270 447945 447655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38270 448288 447938 gene locus_tag LOCUS_38280 448288 447938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38280 448810 448352 gene locus_tag LOCUS_38290 448810 448352 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029897.1 protein_id gnl|my_center|LOCUS_38290 449715 448789 gene locus_tag LOCUS_38300 449715 448789 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 protein_id gnl|my_center|LOCUS_38300 450499 449783 gene locus_tag LOCUS_38310 450499 449783 CDS product putative protein N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226080.1 protein_id gnl|my_center|LOCUS_38310 450896 451822 gene locus_tag LOCUS_38320 450896 451822 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027325.1 protein_id gnl|my_center|LOCUS_38320 452793 451813 gene locus_tag LOCUS_38330 452793 451813 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976631.1 protein_id gnl|my_center|LOCUS_38330 454086 452815 gene locus_tag LOCUS_38340 454086 452815 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410039.1 protein_id gnl|my_center|LOCUS_38340 454887 454111 gene locus_tag LOCUS_38350 454887 454111 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027245.1 protein_id gnl|my_center|LOCUS_38350 455896 454982 gene locus_tag LOCUS_38360 455896 454982 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098657.1 protein_id gnl|my_center|LOCUS_38360 456077 456730 gene locus_tag LOCUS_38370 456077 456730 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224827.1 protein_id gnl|my_center|LOCUS_38370 457390 456770 gene locus_tag LOCUS_38380 457390 456770 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328048.1 protein_id gnl|my_center|LOCUS_38380 457543 457725 gene locus_tag LOCUS_38390 457543 457725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 457758 458567 gene locus_tag LOCUS_38400 457758 458567 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030841.1 protein_id gnl|my_center|LOCUS_38400 458929 458492 gene locus_tag LOCUS_38410 458929 458492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 460255 459557 gene locus_tag LOCUS_38420 460255 459557 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730148.1 protein_id gnl|my_center|LOCUS_38420 460359 462053 gene locus_tag LOCUS_38430 460359 462053 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083178.1 protein_id gnl|my_center|LOCUS_38430 462050 462244 gene locus_tag LOCUS_38440 462050 462244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 462286 463479 gene locus_tag LOCUS_38450 462286 463479 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083253.1 protein_id gnl|my_center|LOCUS_38450 463476 464336 gene locus_tag LOCUS_38460 463476 464336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222109.1 protein_id gnl|my_center|LOCUS_38460 464333 465535 gene locus_tag LOCUS_38470 gene fahA 464333 465535 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224839.1 protein_id gnl|my_center|LOCUS_38470 466002 465814 gene locus_tag LOCUS_38480 466002 465814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 466095 466355 gene locus_tag LOCUS_38490 466095 466355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 467125 468138 gene locus_tag LOCUS_38500 467125 468138 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231015.1 protein_id gnl|my_center|LOCUS_38500 469490 468453 gene locus_tag LOCUS_38510 469490 468453 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969672.1 protein_id gnl|my_center|LOCUS_38510 469714 469962 gene locus_tag LOCUS_38520 469714 469962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 470210 470016 gene locus_tag LOCUS_38530 470210 470016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 472250 470613 gene locus_tag LOCUS_38540 472250 470613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 472297 472845 gene locus_tag LOCUS_38550 472297 472845 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027573.1 protein_id gnl|my_center|LOCUS_38550 472957 473754 gene locus_tag LOCUS_38560 472957 473754 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567940.1 protein_id gnl|my_center|LOCUS_38560 >Feature sequence06 384 1487 gene locus_tag LOCUS_38570 384 1487 CDS product CpaE-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510600.1 protein_id gnl|my_center|LOCUS_38570 1487 2656 gene locus_tag LOCUS_38580 1487 2656 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731088.1 protein_id gnl|my_center|LOCUS_38580 2650 3483 gene locus_tag LOCUS_38590 2650 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 3483 4214 gene locus_tag LOCUS_38600 3483 4214 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230523.1 protein_id gnl|my_center|LOCUS_38600 4255 4500 gene locus_tag LOCUS_38610 4255 4500 CDS product DUF4244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855827.1 protein_id gnl|my_center|LOCUS_38610 4500 4919 gene locus_tag LOCUS_38620 4500 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 4916 5275 gene locus_tag LOCUS_38630 4916 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 5497 6120 gene locus_tag LOCUS_38640 5497 6120 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230520.1 protein_id gnl|my_center|LOCUS_38640 8542 6137 gene locus_tag LOCUS_38650 8542 6137 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419652.1 protein_id gnl|my_center|LOCUS_38650 8844 11237 gene locus_tag LOCUS_38660 8844 11237 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449634.1 protein_id gnl|my_center|LOCUS_38660 11364 12020 gene locus_tag LOCUS_38670 11364 12020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 12105 12689 gene locus_tag LOCUS_38680 12105 12689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419642.1 protein_id gnl|my_center|LOCUS_38680 12968 15793 gene locus_tag LOCUS_38690 gene topA 12968 15793 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742226.1 protein_id gnl|my_center|LOCUS_38690 15811 17028 gene locus_tag LOCUS_38700 15811 17028 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230507.1 protein_id gnl|my_center|LOCUS_38700 17201 17276 gene locus_tag LOCUS_t00330 17201 17276 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 17514 18302 gene locus_tag LOCUS_38710 17514 18302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 18473 18868 gene locus_tag LOCUS_38720 18473 18868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 19500 19012 gene locus_tag LOCUS_38730 19500 19012 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230477.1 protein_id gnl|my_center|LOCUS_38730 19645 21666 gene locus_tag LOCUS_38740 19645 21666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 21856 22917 gene locus_tag LOCUS_38750 21856 22917 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230475.1 protein_id gnl|my_center|LOCUS_38750 22939 23931 gene locus_tag LOCUS_38760 gene tilS 22939 23931 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230474.1 protein_id gnl|my_center|LOCUS_38760 23967 24524 gene locus_tag LOCUS_38770 gene hpt 23967 24524 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230473.1 protein_id gnl|my_center|LOCUS_38770 24810 27329 gene locus_tag LOCUS_38780 gene ftsH 24810 27329 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230468.1 protein_id gnl|my_center|LOCUS_38780 27395 29002 gene locus_tag LOCUS_38790 27395 29002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 29002 29856 gene locus_tag LOCUS_38800 gene folP 29002 29856 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467816.1 protein_id gnl|my_center|LOCUS_38800 29849 30238 gene locus_tag LOCUS_38810 gene folB 29849 30238 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230465.1 protein_id gnl|my_center|LOCUS_38810 30247 30729 gene locus_tag LOCUS_38820 gene folK 30247 30729 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230464.1 protein_id gnl|my_center|LOCUS_38820 31670 30726 gene locus_tag LOCUS_38830 31670 30726 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230463.1 protein_id gnl|my_center|LOCUS_38830 31770 32276 gene locus_tag LOCUS_38840 31770 32276 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113140.1 protein_id gnl|my_center|LOCUS_38840 32490 33497 gene locus_tag LOCUS_38850 32490 33497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 33567 34790 gene locus_tag LOCUS_38860 33567 34790 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230460.1 protein_id gnl|my_center|LOCUS_38860 35017 35847 gene locus_tag LOCUS_38870 35017 35847 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230459.1 protein_id gnl|my_center|LOCUS_38870 35847 36758 gene locus_tag LOCUS_38880 gene panC 35847 36758 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230458.1 protein_id gnl|my_center|LOCUS_38880 36787 37278 gene locus_tag LOCUS_38890 36787 37278 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230457.1 protein_id gnl|my_center|LOCUS_38890 37347 38147 gene locus_tag LOCUS_38900 37347 38147 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230456.1 protein_id gnl|my_center|LOCUS_38900 38375 39823 gene locus_tag LOCUS_38910 gene lysS 38375 39823 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230454.1 protein_id gnl|my_center|LOCUS_38910 40011 40361 gene locus_tag LOCUS_38920 40011 40361 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_38920 41420 42511 gene locus_tag LOCUS_38930 41420 42511 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226862.1 protein_id gnl|my_center|LOCUS_38930 42508 43608 gene locus_tag LOCUS_38940 42508 43608 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009675.1 protein_id gnl|my_center|LOCUS_38940 43605 44489 gene locus_tag LOCUS_38950 43605 44489 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027158.1 protein_id gnl|my_center|LOCUS_38950 44757 47327 gene locus_tag LOCUS_38960 44757 47327 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284160.1 protein_id gnl|my_center|LOCUS_38960 48005 47490 gene locus_tag LOCUS_38970 48005 47490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 48134 48358 gene locus_tag LOCUS_38980 48134 48358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 48990 48241 gene locus_tag LOCUS_38990 48990 48241 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038724.1 protein_id gnl|my_center|LOCUS_38990 49151 48987 gene locus_tag LOCUS_39000 49151 48987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 49401 49174 gene locus_tag LOCUS_39010 49401 49174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 49396 49530 gene locus_tag LOCUS_39020 49396 49530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 50307 49567 gene locus_tag LOCUS_39030 50307 49567 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897986.1 protein_id gnl|my_center|LOCUS_39030 50494 53667 gene locus_tag LOCUS_39040 50494 53667 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230443.1 protein_id gnl|my_center|LOCUS_39040 53762 55312 gene locus_tag LOCUS_39050 53762 55312 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_39050 56342 55512 gene locus_tag LOCUS_39060 56342 55512 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230442.1 protein_id gnl|my_center|LOCUS_39060 57304 56339 gene locus_tag LOCUS_39070 57304 56339 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230441.1 protein_id gnl|my_center|LOCUS_39070 57455 58471 gene locus_tag LOCUS_39080 57455 58471 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230440.1 protein_id gnl|my_center|LOCUS_39080 58951 58637 gene locus_tag LOCUS_39090 58951 58637 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230429.1 protein_id gnl|my_center|LOCUS_39090 60922 58979 gene locus_tag LOCUS_39100 60922 58979 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878409.1 protein_id gnl|my_center|LOCUS_39100 61632 60919 gene locus_tag LOCUS_39110 61632 60919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 62230 61703 gene locus_tag LOCUS_39120 62230 61703 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730399.1 protein_id gnl|my_center|LOCUS_39120 63147 62230 gene locus_tag LOCUS_39130 63147 62230 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230424.1 protein_id gnl|my_center|LOCUS_39130 64396 63323 gene locus_tag LOCUS_39140 gene disA 64396 63323 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_39140 65802 64393 gene locus_tag LOCUS_39150 gene radA 65802 64393 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230399.1 protein_id gnl|my_center|LOCUS_39150 66474 65860 gene locus_tag LOCUS_39160 66474 65860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 66745 67233 gene locus_tag LOCUS_39170 66745 67233 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559016.1 protein_id gnl|my_center|LOCUS_39170 67248 67952 gene locus_tag LOCUS_39180 gene ispD 67248 67952 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029521.1 protein_id gnl|my_center|LOCUS_39180 67949 68425 gene locus_tag LOCUS_39190 gene ispF 67949 68425 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230402.1 protein_id gnl|my_center|LOCUS_39190 68539 69234 gene locus_tag LOCUS_39200 68539 69234 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230405.1 protein_id gnl|my_center|LOCUS_39200 69294 70685 gene locus_tag LOCUS_39210 gene cysS 69294 70685 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284151.1 protein_id gnl|my_center|LOCUS_39210 70746 71648 gene locus_tag LOCUS_39220 gene rlmB 70746 71648 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230407.1 protein_id gnl|my_center|LOCUS_39220 71733 72008 gene locus_tag LOCUS_39230 71733 72008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 72938 72708 gene locus_tag LOCUS_39240 72938 72708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 75434 73071 gene locus_tag LOCUS_39250 75434 73071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 75514 76155 gene locus_tag LOCUS_39260 75514 76155 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086013.1 protein_id gnl|my_center|LOCUS_39260 77043 76459 gene locus_tag LOCUS_39270 77043 76459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 78062 77148 gene locus_tag LOCUS_39280 78062 77148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 78934 78140 gene locus_tag LOCUS_39290 78934 78140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 80393 79176 gene locus_tag LOCUS_39300 80393 79176 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_39300 80797 80468 gene locus_tag LOCUS_39310 80797 80468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 82567 81845 gene locus_tag LOCUS_39320 82567 81845 CDS product phospholipid scramblase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223563.1 protein_id gnl|my_center|LOCUS_39320 82836 84269 gene locus_tag LOCUS_39330 82836 84269 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230408.1 protein_id gnl|my_center|LOCUS_39330 84502 84846 gene locus_tag LOCUS_39340 84502 84846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 85577 84918 gene locus_tag LOCUS_39350 85577 84918 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030136.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39350 85760 86332 gene locus_tag LOCUS_39360 85760 86332 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973714.1 protein_id gnl|my_center|LOCUS_39360 86696 86364 gene locus_tag LOCUS_39370 86696 86364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 86795 88102 gene locus_tag LOCUS_39380 86795 88102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222070.1 protein_id gnl|my_center|LOCUS_39380 90289 88103 gene locus_tag LOCUS_39390 90289 88103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 91406 90507 gene locus_tag LOCUS_39400 91406 90507 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230418.1 protein_id gnl|my_center|LOCUS_39400 92254 91403 gene locus_tag LOCUS_39410 92254 91403 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230419.1 protein_id gnl|my_center|LOCUS_39410 93224 92271 gene locus_tag LOCUS_39420 93224 92271 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230420.1 protein_id gnl|my_center|LOCUS_39420 94506 93403 gene locus_tag LOCUS_39430 gene ugpC 94506 93403 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222655.1 protein_id gnl|my_center|LOCUS_39430 94727 95815 gene locus_tag LOCUS_39440 94727 95815 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284156.1 protein_id gnl|my_center|LOCUS_39440 97607 95976 gene locus_tag LOCUS_39450 97607 95976 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976349.1 protein_id gnl|my_center|LOCUS_39450 98081 97656 gene locus_tag LOCUS_39460 98081 97656 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222140.1 protein_id gnl|my_center|LOCUS_39460 99173 98103 gene locus_tag LOCUS_39470 99173 98103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 99607 99170 gene locus_tag LOCUS_39480 99607 99170 CDS product DUF4247 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976347.1 protein_id gnl|my_center|LOCUS_39480 100255 99632 gene locus_tag LOCUS_39490 100255 99632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 102950 100392 gene locus_tag LOCUS_39500 gene otsB 102950 100392 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230393.1 protein_id gnl|my_center|LOCUS_39500 104516 103092 gene locus_tag LOCUS_39510 104516 103092 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230392.1 protein_id gnl|my_center|LOCUS_39510 106208 104766 gene locus_tag LOCUS_39520 106208 104766 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230391.1 protein_id gnl|my_center|LOCUS_39520 107565 106396 gene locus_tag LOCUS_39530 107565 106396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 106516 106591 gene locus_tag LOCUS_t00340 106516 106591 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 108047 107628 gene locus_tag LOCUS_39540 108047 107628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 108750 108097 gene locus_tag LOCUS_39550 108750 108097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 109405 108752 gene locus_tag LOCUS_39560 109405 108752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 110629 109448 gene locus_tag LOCUS_39570 110629 109448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 110991 110683 gene locus_tag LOCUS_39580 110991 110683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 111625 110984 gene locus_tag LOCUS_39590 111625 110984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 112074 113033 gene locus_tag LOCUS_39600 112074 113033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 113251 113973 gene locus_tag LOCUS_39610 113251 113973 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228306.1 protein_id gnl|my_center|LOCUS_39610 114025 114744 gene locus_tag LOCUS_39620 114025 114744 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031654.1 protein_id gnl|my_center|LOCUS_39620 116029 114905 gene locus_tag LOCUS_39630 116029 114905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225426.1 protein_id gnl|my_center|LOCUS_39630 116352 116011 gene locus_tag LOCUS_39640 116352 116011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 116240 117412 gene locus_tag LOCUS_39650 116240 117412 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224029.1 protein_id gnl|my_center|LOCUS_39650 117748 118461 gene locus_tag LOCUS_39660 117748 118461 CDS product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222282.1 protein_id gnl|my_center|LOCUS_39660 118810 119364 gene locus_tag LOCUS_39670 gene ectA 118810 119364 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449632.1 protein_id gnl|my_center|LOCUS_39670 119501 120748 gene locus_tag LOCUS_39680 gene ectB 119501 120748 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230319.1 protein_id gnl|my_center|LOCUS_39680 120826 121218 gene locus_tag LOCUS_39690 120826 121218 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003071625.1 protein_id gnl|my_center|LOCUS_39690 121429 122328 gene locus_tag LOCUS_39700 gene thpD 121429 122328 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230318.1 protein_id gnl|my_center|LOCUS_39700 123560 122520 gene locus_tag LOCUS_39710 123560 122520 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091813.1 protein_id gnl|my_center|LOCUS_39710 123926 126730 gene locus_tag LOCUS_39720 123926 126730 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230317.1 protein_id gnl|my_center|LOCUS_39720 128314 127499 gene locus_tag LOCUS_39730 128314 127499 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972223.1 protein_id gnl|my_center|LOCUS_39730 129473 130051 gene locus_tag LOCUS_39740 129473 130051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 130062 130775 gene locus_tag LOCUS_39750 130062 130775 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228048.1 protein_id gnl|my_center|LOCUS_39750 130838 131515 gene locus_tag LOCUS_39760 130838 131515 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230310.1 protein_id gnl|my_center|LOCUS_39760 131551 131898 gene locus_tag LOCUS_39770 131551 131898 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226991.1 protein_id gnl|my_center|LOCUS_39770 133172 131889 gene locus_tag LOCUS_39780 133172 131889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 133459 133812 gene locus_tag LOCUS_39790 133459 133812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 134823 133870 gene locus_tag LOCUS_39800 134823 133870 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230309.1 protein_id gnl|my_center|LOCUS_39800 136035 134974 gene locus_tag LOCUS_39810 136035 134974 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230308.1 protein_id gnl|my_center|LOCUS_39810 136299 137057 gene locus_tag LOCUS_39820 136299 137057 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230307.1 protein_id gnl|my_center|LOCUS_39820 137997 137038 gene locus_tag LOCUS_39830 137997 137038 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230305.1 protein_id gnl|my_center|LOCUS_39830 138146 139099 gene locus_tag LOCUS_39840 138146 139099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 139331 140464 gene locus_tag LOCUS_39850 139331 140464 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226964.1 protein_id gnl|my_center|LOCUS_39850 141206 140541 gene locus_tag LOCUS_39860 gene thiE 141206 140541 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230303.1 protein_id gnl|my_center|LOCUS_39860 141459 142520 gene locus_tag LOCUS_39870 gene thiO 141459 142520 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230302.1 protein_id gnl|my_center|LOCUS_39870 142517 142717 gene locus_tag LOCUS_39880 gene thiS 142517 142717 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062394.1 protein_id gnl|my_center|LOCUS_39880 142722 143486 gene locus_tag LOCUS_39890 142722 143486 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230300.1 protein_id gnl|my_center|LOCUS_39890 144759 143551 gene locus_tag LOCUS_39900 144759 143551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 145449 144760 gene locus_tag LOCUS_39910 145449 144760 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037424.1 protein_id gnl|my_center|LOCUS_39910 146368 145466 gene locus_tag LOCUS_39920 146368 145466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 148584 146611 gene locus_tag LOCUS_39930 148584 146611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 149654 148782 gene locus_tag LOCUS_39940 gene thiD 149654 148782 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230298.1 protein_id gnl|my_center|LOCUS_39940 151463 149811 gene locus_tag LOCUS_39950 gene thiC 151463 149811 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230295.1 protein_id gnl|my_center|LOCUS_39950 151917 152330 gene locus_tag LOCUS_39960 151917 152330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 152925 152350 gene locus_tag LOCUS_39970 152925 152350 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230292.1 protein_id gnl|my_center|LOCUS_39970 153072 153491 gene locus_tag LOCUS_39980 153072 153491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 153488 154156 gene locus_tag LOCUS_39990 153488 154156 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091390221.1 protein_id gnl|my_center|LOCUS_39990 156419 154197 gene locus_tag LOCUS_40000 156419 154197 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230289.1 protein_id gnl|my_center|LOCUS_40000 157391 156453 gene locus_tag LOCUS_40010 gene pssA 157391 156453 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230288.1 protein_id gnl|my_center|LOCUS_40010 158104 157388 gene locus_tag LOCUS_40020 158104 157388 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230287.1 protein_id gnl|my_center|LOCUS_40020 160549 158585 gene locus_tag LOCUS_40030 160549 158585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 161161 160607 gene locus_tag LOCUS_40040 161161 160607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 162209 162066 gene locus_tag LOCUS_40050 162209 162066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 162629 162267 gene locus_tag LOCUS_40060 162629 162267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 163898 162672 gene locus_tag LOCUS_40070 163898 162672 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230283.1 protein_id gnl|my_center|LOCUS_40070 164008 164685 gene locus_tag LOCUS_40080 164008 164685 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230282.1 protein_id gnl|my_center|LOCUS_40080 164853 165056 gene locus_tag LOCUS_40090 164853 165056 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085446.1 protein_id gnl|my_center|LOCUS_40090 165155 166372 gene locus_tag LOCUS_40100 165155 166372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 166596 168260 gene locus_tag LOCUS_40110 gene groL 166596 168260 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230279.1 protein_id gnl|my_center|LOCUS_40110 168418 170418 gene locus_tag LOCUS_40120 168418 170418 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037191.1 protein_id gnl|my_center|LOCUS_40120 170648 170424 gene locus_tag LOCUS_40130 170648 170424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 171424 170867 gene locus_tag LOCUS_40140 171424 170867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 171571 172437 gene locus_tag LOCUS_40150 171571 172437 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223759.1 protein_id gnl|my_center|LOCUS_40150 172434 173558 gene locus_tag LOCUS_40160 172434 173558 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_40160 173685 174236 gene locus_tag LOCUS_40170 173685 174236 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223763.1 protein_id gnl|my_center|LOCUS_40170 174233 176683 gene locus_tag LOCUS_40180 174233 176683 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223764.1 protein_id gnl|my_center|LOCUS_40180 176680 177534 gene locus_tag LOCUS_40190 176680 177534 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_40190 177556 178356 gene locus_tag LOCUS_40200 177556 178356 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223766.1 protein_id gnl|my_center|LOCUS_40200 179476 178490 gene locus_tag LOCUS_40210 179476 178490 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230276.1 protein_id gnl|my_center|LOCUS_40210 180225 179629 gene locus_tag LOCUS_40220 180225 179629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 181976 180315 gene locus_tag LOCUS_40230 181976 180315 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230272.1 protein_id gnl|my_center|LOCUS_40230 183450 182422 gene locus_tag LOCUS_40240 183450 182422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 184163 187405 gene locus_tag LOCUS_40250 184163 187405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 187402 187830 gene locus_tag LOCUS_40260 187402 187830 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085368.1 protein_id gnl|my_center|LOCUS_40260 187862 188605 gene locus_tag LOCUS_40270 187862 188605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 188586 189188 gene locus_tag LOCUS_40280 188586 189188 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224365.1 protein_id gnl|my_center|LOCUS_40280 191561 189297 gene locus_tag LOCUS_40290 191561 189297 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230251.1 protein_id gnl|my_center|LOCUS_40290 191661 191873 gene locus_tag LOCUS_40300 191661 191873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 191956 193416 gene locus_tag LOCUS_40310 191956 193416 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230249.1 protein_id gnl|my_center|LOCUS_40310 193465 193971 gene locus_tag LOCUS_40320 gene moaC 193465 193971 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230248.1 protein_id gnl|my_center|LOCUS_40320 193968 194900 gene locus_tag LOCUS_40330 193968 194900 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230247.1 protein_id gnl|my_center|LOCUS_40330 196141 195479 gene locus_tag LOCUS_40340 196141 195479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 197229 196918 gene locus_tag LOCUS_40350 197229 196918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 198293 197235 gene locus_tag LOCUS_40360 gene moaA 198293 197235 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_40360 198501 198881 gene locus_tag LOCUS_40370 198501 198881 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467790.1 protein_id gnl|my_center|LOCUS_40370 198878 199633 gene locus_tag LOCUS_40380 gene modA 198878 199633 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728090.1 protein_id gnl|my_center|LOCUS_40380 199711 200466 gene locus_tag LOCUS_40390 199711 200466 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230239.1 protein_id gnl|my_center|LOCUS_40390 200463 201554 gene locus_tag LOCUS_40400 200463 201554 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230238.1 protein_id gnl|my_center|LOCUS_40400 201563 202357 gene locus_tag LOCUS_40410 201563 202357 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230236.1 protein_id gnl|my_center|LOCUS_40410 202807 202406 gene locus_tag LOCUS_40420 202807 202406 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029761.1 protein_id gnl|my_center|LOCUS_40420 203631 202870 gene locus_tag LOCUS_40430 203631 202870 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230233.1 protein_id gnl|my_center|LOCUS_40430 203778 205433 gene locus_tag LOCUS_40440 203778 205433 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 protein_id gnl|my_center|LOCUS_40440 205738 205523 gene locus_tag LOCUS_40450 205738 205523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467787.1 protein_id gnl|my_center|LOCUS_40450 206060 206455 gene locus_tag LOCUS_40460 206060 206455 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230216.1 protein_id gnl|my_center|LOCUS_40460 206988 206491 gene locus_tag LOCUS_40470 206988 206491 CDS product DUF2771 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230215.1 protein_id gnl|my_center|LOCUS_40470 207741 207055 gene locus_tag LOCUS_40480 207741 207055 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230213.1 protein_id gnl|my_center|LOCUS_40480 207631 208800 gene locus_tag LOCUS_40490 207631 208800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 208797 211760 gene locus_tag LOCUS_40500 208797 211760 CDS product molecular chaperone Hsp90 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230211.1 protein_id gnl|my_center|LOCUS_40500 212033 212251 gene locus_tag LOCUS_40510 212033 212251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 212929 212306 gene locus_tag LOCUS_40520 212929 212306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 213197 212937 gene locus_tag LOCUS_40530 213197 212937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 213341 213772 gene locus_tag LOCUS_40540 213341 213772 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230207.1 protein_id gnl|my_center|LOCUS_40540 213795 215117 gene locus_tag LOCUS_40550 213795 215117 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230206.1 protein_id gnl|my_center|LOCUS_40550 215649 215915 gene locus_tag LOCUS_40560 215649 215915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 215917 217410 gene locus_tag LOCUS_40570 gene panF 215917 217410 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175738.1 protein_id gnl|my_center|LOCUS_40570 218136 217507 gene locus_tag LOCUS_40580 218136 217507 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230204.1 protein_id gnl|my_center|LOCUS_40580 219789 218269 gene locus_tag LOCUS_40590 219789 218269 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033261568.1 protein_id gnl|my_center|LOCUS_40590 220835 219957 gene locus_tag LOCUS_40600 220835 219957 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230820.1 protein_id gnl|my_center|LOCUS_40600 222308 220989 gene locus_tag LOCUS_40610 222308 220989 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223726.1 protein_id gnl|my_center|LOCUS_40610 222481 223287 gene locus_tag LOCUS_40620 222481 223287 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230200.1 protein_id gnl|my_center|LOCUS_40620 223292 223906 gene locus_tag LOCUS_40630 223292 223906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 225058 224105 gene locus_tag LOCUS_40640 gene sepH 225058 224105 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230196.1 protein_id gnl|my_center|LOCUS_40640 226414 225272 gene locus_tag LOCUS_40650 gene serC 226414 225272 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230187.1 protein_id gnl|my_center|LOCUS_40650 227232 226669 gene locus_tag LOCUS_40660 227232 226669 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221471091.1 protein_id gnl|my_center|LOCUS_40660 227334 228128 gene locus_tag LOCUS_40670 227334 228128 CDS product DUF2275 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094014.1 protein_id gnl|my_center|LOCUS_40670 228252 230519 gene locus_tag LOCUS_40680 228252 230519 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225368.1 protein_id gnl|my_center|LOCUS_40680 233211 231202 gene locus_tag LOCUS_40690 233211 231202 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228600.1 protein_id gnl|my_center|LOCUS_40690 233894 233295 gene locus_tag LOCUS_40700 233894 233295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 235044 234031 gene locus_tag LOCUS_40710 235044 234031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 236258 235080 gene locus_tag LOCUS_40720 236258 235080 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230178.1 protein_id gnl|my_center|LOCUS_40720 236742 236515 gene locus_tag LOCUS_40730 236742 236515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 236711 237364 gene locus_tag LOCUS_40740 gene pdxH 236711 237364 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230168.1 protein_id gnl|my_center|LOCUS_40740 237490 238881 gene locus_tag LOCUS_40750 237490 238881 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897250.1 protein_id gnl|my_center|LOCUS_40750 238941 239870 gene locus_tag LOCUS_40760 238941 239870 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 protein_id gnl|my_center|LOCUS_40760 241064 239928 gene locus_tag LOCUS_40770 241064 239928 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230156.1 protein_id gnl|my_center|LOCUS_40770 241259 241900 gene locus_tag LOCUS_40780 241259 241900 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230155.1 protein_id gnl|my_center|LOCUS_40780 241897 242835 gene locus_tag LOCUS_40790 241897 242835 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230154.1 protein_id gnl|my_center|LOCUS_40790 243297 244601 gene locus_tag LOCUS_40800 243297 244601 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230153.1 protein_id gnl|my_center|LOCUS_40800 246015 244795 gene locus_tag LOCUS_40810 246015 244795 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230150.1 protein_id gnl|my_center|LOCUS_40810 246923 246012 gene locus_tag LOCUS_40820 246923 246012 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223991.1 protein_id gnl|my_center|LOCUS_40820 247485 246916 gene locus_tag LOCUS_40830 247485 246916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 247754 247482 gene locus_tag LOCUS_40840 247754 247482 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230147.1 protein_id gnl|my_center|LOCUS_40840 249531 247921 gene locus_tag LOCUS_40850 249531 247921 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230146.1 protein_id gnl|my_center|LOCUS_40850 250175 249528 gene locus_tag LOCUS_40860 250175 249528 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230145.1 protein_id gnl|my_center|LOCUS_40860 250273 251844 gene locus_tag LOCUS_40870 250273 251844 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230144.1 protein_id gnl|my_center|LOCUS_40870 252219 253541 gene locus_tag LOCUS_40880 252219 253541 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190163775.1 protein_id gnl|my_center|LOCUS_40880 254630 253611 gene locus_tag LOCUS_40890 254630 253611 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222377.1 protein_id gnl|my_center|LOCUS_40890 255161 254748 gene locus_tag LOCUS_40900 255161 254748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 258006 255154 gene locus_tag LOCUS_40910 258006 255154 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230656.1 protein_id gnl|my_center|LOCUS_40910 258391 258140 gene locus_tag LOCUS_40920 258391 258140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 258655 258395 gene locus_tag LOCUS_40930 258655 258395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003056176.1 protein_id gnl|my_center|LOCUS_40930 259275 258832 gene locus_tag LOCUS_40940 259275 258832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 260139 259330 gene locus_tag LOCUS_40950 260139 259330 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107019904.1 protein_id gnl|my_center|LOCUS_40950 260601 260266 gene locus_tag LOCUS_40960 260601 260266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 260657 260896 gene locus_tag LOCUS_40970 260657 260896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 261236 262027 gene locus_tag LOCUS_40980 261236 262027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 262599 263525 gene locus_tag LOCUS_40990 262599 263525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40990 263538 264773 gene locus_tag LOCUS_41000 263538 264773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41000 264792 265691 gene locus_tag LOCUS_41010 264792 265691 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_41010 265732 266823 gene locus_tag LOCUS_41020 265732 266823 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 protein_id gnl|my_center|LOCUS_41020 267227 266859 gene locus_tag LOCUS_41030 267227 266859 CDS product peptidase inhibitor family I36 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228604.1 protein_id gnl|my_center|LOCUS_41030 267556 269211 gene locus_tag LOCUS_41040 267556 269211 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528300.1 protein_id gnl|my_center|LOCUS_41040 269240 270214 gene locus_tag LOCUS_41050 gene akrN 269240 270214 CDS product aldo/keto reductase AkrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245422.1 protein_id gnl|my_center|LOCUS_41050 270283 270579 gene locus_tag LOCUS_41060 270283 270579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 270689 272296 gene locus_tag LOCUS_41070 270689 272296 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225847.1 protein_id gnl|my_center|LOCUS_41070 274240 272636 gene locus_tag LOCUS_41080 gene mdlC 274240 272636 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189354.1 protein_id gnl|my_center|LOCUS_41080 274806 274342 gene locus_tag LOCUS_41090 274806 274342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 274901 277405 gene locus_tag LOCUS_41100 274901 277405 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715412.1 protein_id gnl|my_center|LOCUS_41100 278623 277433 gene locus_tag LOCUS_41110 278623 277433 CDS product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043376805.1 protein_id gnl|my_center|LOCUS_41110 278519 279013 gene locus_tag LOCUS_41120 278519 279013 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229426.1 protein_id gnl|my_center|LOCUS_41120 279651 279025 gene locus_tag LOCUS_41130 279651 279025 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225195.1 protein_id gnl|my_center|LOCUS_41130 279979 281286 gene locus_tag LOCUS_41140 279979 281286 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028977.1 protein_id gnl|my_center|LOCUS_41140 282199 281330 gene locus_tag LOCUS_41150 282199 281330 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224926.1 protein_id gnl|my_center|LOCUS_41150 282862 282341 gene locus_tag LOCUS_41160 282862 282341 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040531169.1 protein_id gnl|my_center|LOCUS_41160 283389 282880 gene locus_tag LOCUS_41170 283389 282880 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404532.1 protein_id gnl|my_center|LOCUS_41170 283560 285647 gene locus_tag LOCUS_41180 283560 285647 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 protein_id gnl|my_center|LOCUS_41180 286209 285862 gene locus_tag LOCUS_41190 286209 285862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 286341 286553 gene locus_tag LOCUS_41200 286341 286553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 287543 286605 gene locus_tag LOCUS_41210 287543 286605 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015613.1 protein_id gnl|my_center|LOCUS_41210 287943 289526 gene locus_tag LOCUS_41220 287943 289526 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028098.1 protein_id gnl|my_center|LOCUS_41220 289523 291220 gene locus_tag LOCUS_41230 289523 291220 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485565.1 protein_id gnl|my_center|LOCUS_41230 291217 292515 gene locus_tag LOCUS_41240 291217 292515 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224562.1 protein_id gnl|my_center|LOCUS_41240 292542 294335 gene locus_tag LOCUS_41250 292542 294335 CDS product IucA/IucC family siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904090.1 protein_id gnl|my_center|LOCUS_41250 294339 294635 gene locus_tag LOCUS_41260 294339 294635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 294765 296111 gene locus_tag LOCUS_41270 294765 296111 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 protein_id gnl|my_center|LOCUS_41270 296299 297516 gene locus_tag LOCUS_41280 296299 297516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 297717 298766 gene locus_tag LOCUS_41290 297717 298766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 299379 299918 gene locus_tag LOCUS_41300 299379 299918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 300214 300417 gene locus_tag LOCUS_41310 300214 300417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 301834 300872 gene locus_tag LOCUS_41320 301834 300872 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222703.1 protein_id gnl|my_center|LOCUS_41320 301976 303091 gene locus_tag LOCUS_41330 301976 303091 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243787.1 protein_id gnl|my_center|LOCUS_41330 303126 304409 gene locus_tag LOCUS_41340 303126 304409 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729962.1 protein_id gnl|my_center|LOCUS_41340 305010 304937 gene locus_tag LOCUS_t00350 305010 304937 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 306861 305329 gene locus_tag LOCUS_41350 306861 305329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 307594 306914 gene locus_tag LOCUS_41360 gene bluB 307594 306914 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228822.1 protein_id gnl|my_center|LOCUS_41360 307588 307761 gene locus_tag LOCUS_41370 307588 307761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 307772 308464 gene locus_tag LOCUS_41380 307772 308464 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230061.1 protein_id gnl|my_center|LOCUS_41380 308461 309912 gene locus_tag LOCUS_41390 308461 309912 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230060.1 protein_id gnl|my_center|LOCUS_41390 310019 310843 gene locus_tag LOCUS_41400 310019 310843 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230059.1 protein_id gnl|my_center|LOCUS_41400 310840 311922 gene locus_tag LOCUS_41410 gene galT 310840 311922 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230058.1 protein_id gnl|my_center|LOCUS_41410 312532 312209 gene locus_tag LOCUS_41420 312532 312209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 312551 313672 gene locus_tag LOCUS_41430 312551 313672 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230057.1 protein_id gnl|my_center|LOCUS_41430 313761 314369 gene locus_tag LOCUS_41440 313761 314369 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230045.1 protein_id gnl|my_center|LOCUS_41440 314446 314625 gene locus_tag LOCUS_41450 314446 314625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 315246 314635 gene locus_tag LOCUS_41460 315246 314635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 315355 315624 gene locus_tag LOCUS_41470 315355 315624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 316504 315908 gene locus_tag LOCUS_41480 316504 315908 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230040.1 protein_id gnl|my_center|LOCUS_41480 316660 317448 gene locus_tag LOCUS_41490 316660 317448 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230039.1 protein_id gnl|my_center|LOCUS_41490 317506 318714 gene locus_tag LOCUS_41500 317506 318714 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230038.1 protein_id gnl|my_center|LOCUS_41500 318726 319394 gene locus_tag LOCUS_41510 318726 319394 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230037.1 protein_id gnl|my_center|LOCUS_41510 319664 320440 gene locus_tag LOCUS_41520 319664 320440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230036.1 protein_id gnl|my_center|LOCUS_41520 320541 320615 gene locus_tag LOCUS_t00360 320541 320615 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 321542 320751 gene locus_tag LOCUS_41530 321542 320751 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224187.1 protein_id gnl|my_center|LOCUS_41530 321616 322329 gene locus_tag LOCUS_41540 321616 322329 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027419.1 protein_id gnl|my_center|LOCUS_41540 322429 323406 gene locus_tag LOCUS_41550 322429 323406 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229677.1 protein_id gnl|my_center|LOCUS_41550 324971 323487 gene locus_tag LOCUS_41560 324971 323487 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188420.1 protein_id gnl|my_center|LOCUS_41560 325747 326631 gene locus_tag LOCUS_41570 325747 326631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 327522 326737 gene locus_tag LOCUS_41580 327522 326737 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_41580 327571 327774 gene locus_tag LOCUS_41590 327571 327774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 328150 327812 gene locus_tag LOCUS_41600 328150 327812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 328770 328252 gene locus_tag LOCUS_41610 328770 328252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41610 329743 328982 gene locus_tag LOCUS_41620 329743 328982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41620 329852 331240 gene locus_tag LOCUS_41630 329852 331240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 332833 331355 gene locus_tag LOCUS_41640 332833 331355 CDS product heme peroxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929330.1 protein_id gnl|my_center|LOCUS_41640 333294 334637 gene locus_tag LOCUS_41650 gene lat 333294 334637 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893146.1 protein_id gnl|my_center|LOCUS_41650 336225 334717 gene locus_tag LOCUS_41660 336225 334717 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803919.1 protein_id gnl|my_center|LOCUS_41660 336305 336856 gene locus_tag LOCUS_41670 336305 336856 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803918.1 protein_id gnl|my_center|LOCUS_41670 338318 336864 gene locus_tag LOCUS_41680 338318 336864 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229989.1 protein_id gnl|my_center|LOCUS_41680 338465 339313 gene locus_tag LOCUS_41690 gene rsmI 338465 339313 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229988.1 protein_id gnl|my_center|LOCUS_41690 339393 340016 gene locus_tag LOCUS_41700 gene upp 339393 340016 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222797.1 protein_id gnl|my_center|LOCUS_41700 340030 340917 gene locus_tag LOCUS_41710 340030 340917 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035685.1 protein_id gnl|my_center|LOCUS_41710 341064 342167 gene locus_tag LOCUS_41720 341064 342167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41720 342059 342592 gene locus_tag LOCUS_41730 342059 342592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41730 342942 344057 gene locus_tag LOCUS_41740 342942 344057 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530058.1 protein_id gnl|my_center|LOCUS_41740 344503 344165 gene locus_tag LOCUS_41750 344503 344165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230128.1 protein_id gnl|my_center|LOCUS_41750 345129 344668 gene locus_tag LOCUS_41760 345129 344668 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 protein_id gnl|my_center|LOCUS_41760 346838 345153 gene locus_tag LOCUS_41770 346838 345153 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222818.1 protein_id gnl|my_center|LOCUS_41770 347690 346875 gene locus_tag LOCUS_41780 347690 346875 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222820.1 protein_id gnl|my_center|LOCUS_41780 348588 347728 gene locus_tag LOCUS_41790 348588 347728 CDS product IS5-like element ISCgl6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014728.1 protein_id gnl|my_center|LOCUS_41790 350402 348684 gene locus_tag LOCUS_41800 350402 348684 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222824.1 protein_id gnl|my_center|LOCUS_41800 350698 350408 gene locus_tag LOCUS_41810 350698 350408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 350723 350893 gene locus_tag LOCUS_41820 350723 350893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 351253 353637 gene locus_tag LOCUS_41830 351253 353637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41830 353634 354200 gene locus_tag LOCUS_41840 353634 354200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 354197 354604 gene locus_tag LOCUS_41850 354197 354604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 354601 356130 gene locus_tag LOCUS_41860 354601 356130 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853718.1 protein_id gnl|my_center|LOCUS_41860 356127 356729 gene locus_tag LOCUS_41870 356127 356729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 356726 356992 gene locus_tag LOCUS_41880 356726 356992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 356989 357336 gene locus_tag LOCUS_41890 gene mnhG 356989 357336 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031338.1 protein_id gnl|my_center|LOCUS_41890 358003 359643 gene locus_tag LOCUS_41900 358003 359643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 359866 360234 gene locus_tag LOCUS_41910 359866 360234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 360636 360815 gene locus_tag LOCUS_41920 360636 360815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 360850 362244 gene locus_tag LOCUS_41930 360850 362244 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222829.1 protein_id gnl|my_center|LOCUS_41930 362839 362324 gene locus_tag LOCUS_41940 362839 362324 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229692.1 protein_id gnl|my_center|LOCUS_41940 362930 363637 gene locus_tag LOCUS_41950 362930 363637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 364122 363670 gene locus_tag LOCUS_41960 364122 363670 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222831.1 protein_id gnl|my_center|LOCUS_41960 364286 365689 gene locus_tag LOCUS_41970 364286 365689 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222832.1 protein_id gnl|my_center|LOCUS_41970 365728 366120 gene locus_tag LOCUS_41980 365728 366120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 366324 367505 gene locus_tag LOCUS_41990 366324 367505 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202991912.1 protein_id gnl|my_center|LOCUS_41990 367645 368127 gene locus_tag LOCUS_42000 367645 368127 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208613322.1 protein_id gnl|my_center|LOCUS_42000 368159 368524 gene locus_tag LOCUS_42010 368159 368524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 368686 369021 gene locus_tag LOCUS_42020 368686 369021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 370631 369126 gene locus_tag LOCUS_42030 gene glpK 370631 369126 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222837.1 protein_id gnl|my_center|LOCUS_42030 371410 370667 gene locus_tag LOCUS_42040 371410 370667 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742072.1 protein_id gnl|my_center|LOCUS_42040 371689 372522 gene locus_tag LOCUS_42050 371689 372522 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393168.1 protein_id gnl|my_center|LOCUS_42050 372618 374357 gene locus_tag LOCUS_42060 372618 374357 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222839.1 protein_id gnl|my_center|LOCUS_42060 375317 374511 gene locus_tag LOCUS_42070 375317 374511 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230790.1 protein_id gnl|my_center|LOCUS_42070 376186 375320 gene locus_tag LOCUS_42080 376186 375320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 376586 376215 gene locus_tag LOCUS_42090 376586 376215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 376891 376754 gene locus_tag LOCUS_42100 376891 376754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 377616 376957 gene locus_tag LOCUS_42110 377616 376957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 378151 377657 gene locus_tag LOCUS_42120 378151 377657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 380009 378213 gene locus_tag LOCUS_42130 380009 378213 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222846.1 protein_id gnl|my_center|LOCUS_42130 381479 380151 gene locus_tag LOCUS_42140 381479 380151 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286026.1 protein_id gnl|my_center|LOCUS_42140 382348 381707 gene locus_tag LOCUS_42150 382348 381707 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222850.1 protein_id gnl|my_center|LOCUS_42150 382538 383683 gene locus_tag LOCUS_42160 382538 383683 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229985.1 protein_id gnl|my_center|LOCUS_42160 383842 384108 gene locus_tag LOCUS_42170 383842 384108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 384507 384256 gene locus_tag LOCUS_42180 384507 384256 CDS product acyl-CoA carboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222857.1 protein_id gnl|my_center|LOCUS_42180 386218 384581 gene locus_tag LOCUS_42190 386218 384581 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222858.1 protein_id gnl|my_center|LOCUS_42190 386166 387215 gene locus_tag LOCUS_42200 386166 387215 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_42200 387288 387806 gene locus_tag LOCUS_42210 387288 387806 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222885.1 protein_id gnl|my_center|LOCUS_42210 387806 388756 gene locus_tag LOCUS_42220 387806 388756 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222886.1 protein_id gnl|my_center|LOCUS_42220 388753 389421 gene locus_tag LOCUS_42230 388753 389421 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031658.1 protein_id gnl|my_center|LOCUS_42230 389867 389424 gene locus_tag LOCUS_42240 389867 389424 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529991.1 protein_id gnl|my_center|LOCUS_42240 390013 390495 gene locus_tag LOCUS_42250 390013 390495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 390492 390800 gene locus_tag LOCUS_42260 390492 390800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 390800 392854 gene locus_tag LOCUS_42270 390800 392854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 392851 393153 gene locus_tag LOCUS_42280 392851 393153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105220.1 protein_id gnl|my_center|LOCUS_42280 393935 393159 gene locus_tag LOCUS_42290 gene hisN 393935 393159 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222889.1 protein_id gnl|my_center|LOCUS_42290 394104 394772 gene locus_tag LOCUS_42300 394104 394772 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222890.1 protein_id gnl|my_center|LOCUS_42300 394849 396096 gene locus_tag LOCUS_42310 394849 396096 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222891.1 protein_id gnl|my_center|LOCUS_42310 396665 396120 gene locus_tag LOCUS_42320 396665 396120 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286038.1 protein_id gnl|my_center|LOCUS_42320 396973 398097 gene locus_tag LOCUS_42330 396973 398097 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222902.1 protein_id gnl|my_center|LOCUS_42330 398397 398197 gene locus_tag LOCUS_42340 398397 398197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 398551 399414 gene locus_tag LOCUS_42350 398551 399414 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_42350 399417 399626 gene locus_tag LOCUS_42360 399417 399626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 400737 399577 gene locus_tag LOCUS_42370 400737 399577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 401102 401626 gene locus_tag LOCUS_42380 401102 401626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 402468 402995 gene locus_tag LOCUS_42390 gene purE 402468 402995 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222903.1 protein_id gnl|my_center|LOCUS_42390 403238 403960 gene locus_tag LOCUS_42400 403238 403960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 404106 404285 gene locus_tag LOCUS_42410 404106 404285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 404282 404575 gene locus_tag LOCUS_42420 gene relE 404282 404575 CDS product type II toxin-antitoxin system mRNA interferase RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898789.1 protein_id gnl|my_center|LOCUS_42420 405341 404559 gene locus_tag LOCUS_42430 405341 404559 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921367.1 protein_id gnl|my_center|LOCUS_42430 406116 405391 gene locus_tag LOCUS_42440 406116 405391 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222913.1 protein_id gnl|my_center|LOCUS_42440 407482 406160 gene locus_tag LOCUS_42450 407482 406160 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876538.1 protein_id gnl|my_center|LOCUS_42450 409021 407576 gene locus_tag LOCUS_42460 409021 407576 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229437.1 protein_id gnl|my_center|LOCUS_42460 409338 409000 gene locus_tag LOCUS_42470 409338 409000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 409587 410600 gene locus_tag LOCUS_42480 gene rfbB 409587 410600 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_42480 410600 411514 gene locus_tag LOCUS_42490 gene rfbD 410600 411514 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222918.1 protein_id gnl|my_center|LOCUS_42490 412597 411530 gene locus_tag LOCUS_42500 412597 411530 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222919.1 protein_id gnl|my_center|LOCUS_42500 415091 412590 gene locus_tag LOCUS_42510 415091 412590 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222920.1 protein_id gnl|my_center|LOCUS_42510 415285 416025 gene locus_tag LOCUS_42520 415285 416025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 416331 416591 gene locus_tag LOCUS_42530 416331 416591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 417496 416606 gene locus_tag LOCUS_42540 417496 416606 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742155.1 protein_id gnl|my_center|LOCUS_42540 417583 418698 gene locus_tag LOCUS_42550 417583 418698 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222922.1 protein_id gnl|my_center|LOCUS_42550 418733 419905 gene locus_tag LOCUS_42560 418733 419905 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222923.1 protein_id gnl|my_center|LOCUS_42560 419874 420950 gene locus_tag LOCUS_42570 419874 420950 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742156.1 protein_id gnl|my_center|LOCUS_42570 421323 420958 gene locus_tag LOCUS_42580 421323 420958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 421670 421485 gene locus_tag LOCUS_42590 421670 421485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 421576 422628 gene locus_tag LOCUS_42600 421576 422628 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222926.1 protein_id gnl|my_center|LOCUS_42600 422676 422933 gene locus_tag LOCUS_42610 422676 422933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 422930 423328 gene locus_tag LOCUS_42620 422930 423328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 423882 423334 gene locus_tag LOCUS_42630 423882 423334 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222931.1 protein_id gnl|my_center|LOCUS_42630 >Feature sequence07 2255 561 gene locus_tag LOCUS_42640 gene gcl 2255 561 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125316584.1 protein_id gnl|my_center|LOCUS_42640 3310 2432 gene locus_tag LOCUS_42650 3310 2432 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804444.1 protein_id gnl|my_center|LOCUS_42650 4254 3454 gene locus_tag LOCUS_42660 4254 3454 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730562.1 protein_id gnl|my_center|LOCUS_42660 4447 4698 gene locus_tag LOCUS_42670 4447 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 4691 5062 gene locus_tag LOCUS_42680 4691 5062 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972719.1 protein_id gnl|my_center|LOCUS_42680 5151 5756 gene locus_tag LOCUS_42690 5151 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 5753 6103 gene locus_tag LOCUS_42700 gene uraH 5753 6103 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223819.1 protein_id gnl|my_center|LOCUS_42700 6111 7001 gene locus_tag LOCUS_42710 gene pucL 6111 7001 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223818.1 protein_id gnl|my_center|LOCUS_42710 7192 8733 gene locus_tag LOCUS_42720 7192 8733 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972712.1 protein_id gnl|my_center|LOCUS_42720 8897 9829 gene locus_tag LOCUS_42730 8897 9829 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225116.1 protein_id gnl|my_center|LOCUS_42730 9954 10130 gene locus_tag LOCUS_42740 9954 10130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 10142 11080 gene locus_tag LOCUS_42750 10142 11080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 12500 11256 gene locus_tag LOCUS_42760 12500 11256 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_42760 14179 12575 gene locus_tag LOCUS_42770 gene aceB 14179 12575 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223803.1 protein_id gnl|my_center|LOCUS_42770 14478 15221 gene locus_tag LOCUS_42780 gene allR 14478 15221 CDS product allantoin degradation transcriptional regulator AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972681.1 protein_id gnl|my_center|LOCUS_42780 15734 15240 gene locus_tag LOCUS_42790 15734 15240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 16253 15765 gene locus_tag LOCUS_42800 gene tsaE 16253 15765 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466589.1 protein_id gnl|my_center|LOCUS_42800 17361 16264 gene locus_tag LOCUS_42810 17361 16264 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285971.1 protein_id gnl|my_center|LOCUS_42810 18413 17358 gene locus_tag LOCUS_42820 gene alr 18413 17358 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222656.1 protein_id gnl|my_center|LOCUS_42820 18381 18596 gene locus_tag LOCUS_42830 18381 18596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 18692 19201 gene locus_tag LOCUS_42840 18692 19201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 20779 19289 gene locus_tag LOCUS_42850 20779 19289 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222652.1 protein_id gnl|my_center|LOCUS_42850 22733 20871 gene locus_tag LOCUS_42860 gene glmS 22733 20871 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466588.1 protein_id gnl|my_center|LOCUS_42860 24410 23064 gene locus_tag LOCUS_42870 24410 23064 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029732907.1 protein_id gnl|my_center|LOCUS_42870 24637 24443 gene locus_tag LOCUS_42880 24637 24443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 24896 25657 gene locus_tag LOCUS_42890 24896 25657 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222650.1 protein_id gnl|my_center|LOCUS_42890 25931 25665 gene locus_tag LOCUS_42900 25931 25665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 25971 26426 gene locus_tag LOCUS_42910 25971 26426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 28000 27464 gene locus_tag LOCUS_42920 28000 27464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 30922 28034 gene locus_tag LOCUS_42930 30922 28034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 31234 30926 gene locus_tag LOCUS_42940 31234 30926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 31309 31890 gene locus_tag LOCUS_42950 31309 31890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 33272 31938 gene locus_tag LOCUS_42960 gene glmM 33272 31938 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_42960 33947 33393 gene locus_tag LOCUS_42970 33947 33393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 34393 33944 gene locus_tag LOCUS_42980 gene rplM 34393 33944 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560141.1 protein_id gnl|my_center|LOCUS_42980 35131 34841 gene locus_tag LOCUS_42990 35131 34841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 35494 35183 gene locus_tag LOCUS_43000 35494 35183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 37532 35736 gene locus_tag LOCUS_43010 37532 35736 CDS product type VII secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222636.1 protein_id gnl|my_center|LOCUS_43010 41788 37730 gene locus_tag LOCUS_43020 41788 37730 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222635.1 protein_id gnl|my_center|LOCUS_43020 42079 43488 gene locus_tag LOCUS_43030 gene eccD 42079 43488 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222634.1 protein_id gnl|my_center|LOCUS_43030 43500 44918 gene locus_tag LOCUS_43040 43500 44918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 46548 45019 gene locus_tag LOCUS_43050 gene eccB 46548 45019 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081911197.1 protein_id gnl|my_center|LOCUS_43050 46672 48102 gene locus_tag LOCUS_43060 gene eccE 46672 48102 CDS product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304772.1 protein_id gnl|my_center|LOCUS_43060 48099 48833 gene locus_tag LOCUS_43070 48099 48833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222627.1 protein_id gnl|my_center|LOCUS_43070 49754 48876 gene locus_tag LOCUS_43080 49754 48876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407537.1 protein_id gnl|my_center|LOCUS_43080 50733 49897 gene locus_tag LOCUS_43090 gene truA 50733 49897 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086862314.1 protein_id gnl|my_center|LOCUS_43090 51341 50799 gene locus_tag LOCUS_43100 gene rplQ 51341 50799 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222625.1 protein_id gnl|my_center|LOCUS_43100 52508 51393 gene locus_tag LOCUS_43110 52508 51393 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558887.1 protein_id gnl|my_center|LOCUS_43110 53261 52656 gene locus_tag LOCUS_43120 gene rpsD 53261 52656 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222624.1 protein_id gnl|my_center|LOCUS_43120 53688 53284 gene locus_tag LOCUS_43130 gene rpsK 53688 53284 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558885.1 protein_id gnl|my_center|LOCUS_43130 54094 53714 gene locus_tag LOCUS_43140 gene rpsM 54094 53714 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055954.1 protein_id gnl|my_center|LOCUS_43140 55014 54454 gene locus_tag LOCUS_43150 55014 54454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 55113 55754 gene locus_tag LOCUS_43160 55113 55754 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176077.1 protein_id gnl|my_center|LOCUS_43160 56806 56015 gene locus_tag LOCUS_43170 gene map 56806 56015 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 protein_id gnl|my_center|LOCUS_43170 57371 56817 gene locus_tag LOCUS_43180 57371 56817 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222620.1 protein_id gnl|my_center|LOCUS_43180 58927 57617 gene locus_tag LOCUS_43190 gene secY 58927 57617 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222619.1 protein_id gnl|my_center|LOCUS_43190 59656 59207 gene locus_tag LOCUS_43200 gene rplO 59656 59207 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222616.1 protein_id gnl|my_center|LOCUS_43200 59842 59660 gene locus_tag LOCUS_43210 gene rpmD 59842 59660 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727688.1 protein_id gnl|my_center|LOCUS_43210 60461 59844 gene locus_tag LOCUS_43220 gene rpsE 60461 59844 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222614.1 protein_id gnl|my_center|LOCUS_43220 60931 60527 gene locus_tag LOCUS_43230 gene rplR 60931 60527 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130474831.1 protein_id gnl|my_center|LOCUS_43230 61467 60928 gene locus_tag LOCUS_43240 gene rplF 61467 60928 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222612.1 protein_id gnl|my_center|LOCUS_43240 61878 61480 gene locus_tag LOCUS_43250 gene rpsH 61878 61480 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558871.1 protein_id gnl|my_center|LOCUS_43250 62317 62132 gene locus_tag LOCUS_43260 62317 62132 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908573.1 protein_id gnl|my_center|LOCUS_43260 62938 62360 gene locus_tag LOCUS_43270 gene rplE 62938 62360 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892854.1 protein_id gnl|my_center|LOCUS_43270 63256 62942 gene locus_tag LOCUS_43280 gene rplX 63256 62942 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222610.1 protein_id gnl|my_center|LOCUS_43280 63624 63256 gene locus_tag LOCUS_43290 gene rplN 63624 63256 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_43290 64039 63746 gene locus_tag LOCUS_43300 gene rpsQ 64039 63746 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222609.1 protein_id gnl|my_center|LOCUS_43300 64278 64036 gene locus_tag LOCUS_43310 gene rpmC 64278 64036 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222608.1 protein_id gnl|my_center|LOCUS_43310 64697 64278 gene locus_tag LOCUS_43320 gene rplP 64697 64278 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558864.1 protein_id gnl|my_center|LOCUS_43320 65636 64701 gene locus_tag LOCUS_43330 65636 64701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 66064 65636 gene locus_tag LOCUS_43340 gene rplV 66064 65636 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222606.1 protein_id gnl|my_center|LOCUS_43340 66416 66135 gene locus_tag LOCUS_43350 gene rpsS 66416 66135 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102083.1 protein_id gnl|my_center|LOCUS_43350 67271 66435 gene locus_tag LOCUS_43360 gene rplB 67271 66435 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102084.1 protein_id gnl|my_center|LOCUS_43360 67604 67305 gene locus_tag LOCUS_43370 gene rplW 67604 67305 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102087.1 protein_id gnl|my_center|LOCUS_43370 68278 67601 gene locus_tag LOCUS_43380 gene rplD 68278 67601 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_43380 68928 68278 gene locus_tag LOCUS_43390 gene rplC 68928 68278 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222604.1 protein_id gnl|my_center|LOCUS_43390 69288 68983 gene locus_tag LOCUS_43400 gene rpsJ 69288 68983 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003883485.1 protein_id gnl|my_center|LOCUS_43400 70990 69797 gene locus_tag LOCUS_43410 gene tuf 70990 69797 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055596.1 protein_id gnl|my_center|LOCUS_43410 73203 71101 gene locus_tag LOCUS_43420 gene fusA 73203 71101 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222602.1 protein_id gnl|my_center|LOCUS_43420 73752 73282 gene locus_tag LOCUS_43430 gene rpsG 73752 73282 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102106.1 protein_id gnl|my_center|LOCUS_43430 74126 73752 gene locus_tag LOCUS_43440 gene rpsL 74126 73752 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102113.1 protein_id gnl|my_center|LOCUS_43440 76155 74839 gene locus_tag LOCUS_43450 76155 74839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 76775 76191 gene locus_tag LOCUS_43460 76775 76191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 77300 76779 gene locus_tag LOCUS_43470 77300 76779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 78184 77297 gene locus_tag LOCUS_43480 78184 77297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 78489 78298 gene locus_tag LOCUS_43490 78489 78298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 79324 78446 gene locus_tag LOCUS_43500 79324 78446 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_43500 79457 79711 gene locus_tag LOCUS_43510 79457 79711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 79711 79935 gene locus_tag LOCUS_43520 79711 79935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 80415 80624 gene locus_tag LOCUS_43530 80415 80624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 80983 80714 gene locus_tag LOCUS_43540 80983 80714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 81622 81332 gene locus_tag LOCUS_43550 81622 81332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 85340 81891 gene locus_tag LOCUS_43560 85340 81891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 87282 85450 gene locus_tag LOCUS_43570 87282 85450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 87235 87435 gene locus_tag LOCUS_43580 87235 87435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 88144 87554 gene locus_tag LOCUS_43590 88144 87554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 88509 88108 gene locus_tag LOCUS_43600 88509 88108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 88846 89340 gene locus_tag LOCUS_43610 88846 89340 CDS product DUF6319 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230538.1 protein_id gnl|my_center|LOCUS_43610 93408 89494 gene locus_tag LOCUS_43620 93408 89494 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222587.1 protein_id gnl|my_center|LOCUS_43620 96987 93505 gene locus_tag LOCUS_43630 96987 93505 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222586.1 protein_id gnl|my_center|LOCUS_43630 97811 100954 gene locus_tag LOCUS_43640 97811 100954 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007510795.1 protein_id gnl|my_center|LOCUS_43640 101965 101168 gene locus_tag LOCUS_43650 101965 101168 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974001.1 protein_id gnl|my_center|LOCUS_43650 102436 101999 gene locus_tag LOCUS_43660 102436 101999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 103384 102995 gene locus_tag LOCUS_43670 gene rplL 103384 102995 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403353.1 protein_id gnl|my_center|LOCUS_43670 103981 103445 gene locus_tag LOCUS_43680 gene rplJ 103981 103445 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055400.1 protein_id gnl|my_center|LOCUS_43680 104257 105108 gene locus_tag LOCUS_43690 104257 105108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 105970 105257 gene locus_tag LOCUS_43700 gene rplA 105970 105257 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222526.1 protein_id gnl|my_center|LOCUS_43700 106476 106042 gene locus_tag LOCUS_43710 gene rplK 106476 106042 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222525.1 protein_id gnl|my_center|LOCUS_43710 107478 106624 gene locus_tag LOCUS_43720 gene nusG 107478 106624 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222524.1 protein_id gnl|my_center|LOCUS_43720 107965 107561 gene locus_tag LOCUS_43730 gene secE 107965 107561 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222523.1 protein_id gnl|my_center|LOCUS_43730 108150 108077 gene locus_tag LOCUS_t00370 108150 108077 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 108402 109592 gene locus_tag LOCUS_43740 108402 109592 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_43740 110096 109674 gene locus_tag LOCUS_43750 110096 109674 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_43750 110557 110093 gene locus_tag LOCUS_43760 110557 110093 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285884.1 protein_id gnl|my_center|LOCUS_43760 110864 110694 gene locus_tag LOCUS_43770 gene rpmG 110864 110694 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948671.1 protein_id gnl|my_center|LOCUS_43770 111028 110956 gene locus_tag LOCUS_t00380 111028 110956 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 111189 111115 gene locus_tag LOCUS_t00390 111189 111115 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 113910 111274 gene locus_tag LOCUS_43780 113910 111274 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222516.1 protein_id gnl|my_center|LOCUS_43780 115018 114203 gene locus_tag LOCUS_43790 115018 114203 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964530.1 protein_id gnl|my_center|LOCUS_43790 114962 115159 gene locus_tag LOCUS_43800 114962 115159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 115200 115619 gene locus_tag LOCUS_43810 115200 115619 CDS product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226497.1 protein_id gnl|my_center|LOCUS_43810 115933 115667 gene locus_tag LOCUS_43820 115933 115667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 116080 116382 gene locus_tag LOCUS_43830 116080 116382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 117138 116527 gene locus_tag LOCUS_43840 117138 116527 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224365.1 protein_id gnl|my_center|LOCUS_43840 117817 117119 gene locus_tag LOCUS_43850 117817 117119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 118265 117825 gene locus_tag LOCUS_43860 118265 117825 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561253.1 protein_id gnl|my_center|LOCUS_43860 121544 118335 gene locus_tag LOCUS_43870 121544 118335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43870 122179 122598 gene locus_tag LOCUS_43880 122179 122598 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049745379.1 protein_id gnl|my_center|LOCUS_43880 122595 124208 gene locus_tag LOCUS_43890 122595 124208 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224361.1 protein_id gnl|my_center|LOCUS_43890 124560 124255 gene locus_tag LOCUS_43900 124560 124255 CDS product YiaA/YiaB family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977125.1 protein_id gnl|my_center|LOCUS_43900 125763 124867 gene locus_tag LOCUS_43910 125763 124867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 125738 126538 gene locus_tag LOCUS_43920 125738 126538 CDS product MEDS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229164.1 protein_id gnl|my_center|LOCUS_43920 127076 126822 gene locus_tag LOCUS_43930 127076 126822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 127347 128087 gene locus_tag LOCUS_43940 127347 128087 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079514.1 protein_id gnl|my_center|LOCUS_43940 128267 128989 gene locus_tag LOCUS_43950 128267 128989 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227393.1 protein_id gnl|my_center|LOCUS_43950 129043 129801 gene locus_tag LOCUS_43960 129043 129801 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_43960 129847 130395 gene locus_tag LOCUS_43970 129847 130395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 130564 131127 gene locus_tag LOCUS_43980 130564 131127 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137208463.1 protein_id gnl|my_center|LOCUS_43980 131281 131568 gene locus_tag LOCUS_43990 131281 131568 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228474.1 protein_id gnl|my_center|LOCUS_43990 132794 131658 gene locus_tag LOCUS_44000 132794 131658 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728729.1 protein_id gnl|my_center|LOCUS_44000 132970 133308 gene locus_tag LOCUS_44010 132970 133308 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039540.1 protein_id gnl|my_center|LOCUS_44010 133932 133456 gene locus_tag LOCUS_44020 133932 133456 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030185.1 protein_id gnl|my_center|LOCUS_44020 134644 133943 gene locus_tag LOCUS_44030 134644 133943 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030186.1 protein_id gnl|my_center|LOCUS_44030 134868 135080 gene locus_tag LOCUS_44040 134868 135080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 135439 135092 gene locus_tag LOCUS_44050 135439 135092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 135591 135899 gene locus_tag LOCUS_44060 135591 135899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 135896 136207 gene locus_tag LOCUS_44070 135896 136207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 136207 137052 gene locus_tag LOCUS_44080 136207 137052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 137084 137266 gene locus_tag LOCUS_44090 137084 137266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 137341 137526 gene locus_tag LOCUS_44100 137341 137526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 137556 137717 gene locus_tag LOCUS_44110 137556 137717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 137804 138046 gene locus_tag LOCUS_44120 137804 138046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 138043 138255 gene locus_tag LOCUS_44130 138043 138255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 138255 139352 gene locus_tag LOCUS_44140 138255 139352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 139349 139777 gene locus_tag LOCUS_44150 139349 139777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 139770 141989 gene locus_tag LOCUS_44160 139770 141989 CDS product cell division protein FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227950.1 protein_id gnl|my_center|LOCUS_44160 142199 142384 gene locus_tag LOCUS_44170 142199 142384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 142416 142868 gene locus_tag LOCUS_44180 142416 142868 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898320.1 protein_id gnl|my_center|LOCUS_44180 142974 143930 gene locus_tag LOCUS_44190 142974 143930 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467412.1 protein_id gnl|my_center|LOCUS_44190 143927 145153 gene locus_tag LOCUS_44200 143927 145153 CDS product DUF3631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091506663.1 protein_id gnl|my_center|LOCUS_44200 145356 145550 gene locus_tag LOCUS_44210 145356 145550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 145547 146911 gene locus_tag LOCUS_44220 145547 146911 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227938.1 protein_id gnl|my_center|LOCUS_44220 147113 147032 gene locus_tag LOCUS_t00400 147113 147032 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 147250 147741 gene locus_tag LOCUS_44230 147250 147741 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222510.1 protein_id gnl|my_center|LOCUS_44230 147752 148633 gene locus_tag LOCUS_44240 gene rfbA 147752 148633 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222507.1 protein_id gnl|my_center|LOCUS_44240 149512 148640 gene locus_tag LOCUS_44250 gene htpX 149512 148640 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974338.1 protein_id gnl|my_center|LOCUS_44250 149805 150701 gene locus_tag LOCUS_44260 149805 150701 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028430.1 protein_id gnl|my_center|LOCUS_44260 151572 150757 gene locus_tag LOCUS_44270 151572 150757 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222475.1 protein_id gnl|my_center|LOCUS_44270 151699 152139 gene locus_tag LOCUS_44280 151699 152139 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033261465.1 protein_id gnl|my_center|LOCUS_44280 153228 152143 gene locus_tag LOCUS_44290 153228 152143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222469.1 protein_id gnl|my_center|LOCUS_44290 153476 154885 gene locus_tag LOCUS_44300 153476 154885 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230444.1 protein_id gnl|my_center|LOCUS_44300 155947 154943 gene locus_tag LOCUS_44310 155947 154943 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222468.1 protein_id gnl|my_center|LOCUS_44310 157686 156028 gene locus_tag LOCUS_44320 gene nuoN 157686 156028 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222464.1 protein_id gnl|my_center|LOCUS_44320 159275 157689 gene locus_tag LOCUS_44330 159275 157689 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222463.1 protein_id gnl|my_center|LOCUS_44330 161352 159370 gene locus_tag LOCUS_44340 gene nuoL 161352 159370 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222462.1 protein_id gnl|my_center|LOCUS_44340 161663 161364 gene locus_tag LOCUS_44350 gene nuoK 161663 161364 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_44350 162688 161660 gene locus_tag LOCUS_44360 162688 161660 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222461.1 protein_id gnl|my_center|LOCUS_44360 163251 162688 gene locus_tag LOCUS_44370 gene nuoI 163251 162688 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222460.1 protein_id gnl|my_center|LOCUS_44370 164554 163238 gene locus_tag LOCUS_44380 gene nuoH 164554 163238 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222459.1 protein_id gnl|my_center|LOCUS_44380 167163 164551 gene locus_tag LOCUS_44390 167163 164551 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222458.1 protein_id gnl|my_center|LOCUS_44390 168485 167160 gene locus_tag LOCUS_44400 gene nuoF 168485 167160 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222457.1 protein_id gnl|my_center|LOCUS_44400 169269 168496 gene locus_tag LOCUS_44410 gene nuoE 169269 168496 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222456.1 protein_id gnl|my_center|LOCUS_44410 170619 169270 gene locus_tag LOCUS_44420 170619 169270 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222455.1 protein_id gnl|my_center|LOCUS_44420 171415 170642 gene locus_tag LOCUS_44430 171415 170642 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222454.1 protein_id gnl|my_center|LOCUS_44430 172146 171421 gene locus_tag LOCUS_44440 172146 171421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 172594 172229 gene locus_tag LOCUS_44450 172594 172229 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222453.1 protein_id gnl|my_center|LOCUS_44450 174062 172761 gene locus_tag LOCUS_44460 174062 172761 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285867.1 protein_id gnl|my_center|LOCUS_44460 174904 174215 gene locus_tag LOCUS_44470 174904 174215 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061581.1 protein_id gnl|my_center|LOCUS_44470 175067 175936 gene locus_tag LOCUS_44480 175067 175936 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222446.1 protein_id gnl|my_center|LOCUS_44480 176476 175913 gene locus_tag LOCUS_44490 176476 175913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 177025 176603 gene locus_tag LOCUS_44500 177025 176603 CDS product DUF3592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222445.1 protein_id gnl|my_center|LOCUS_44500 177198 176980 gene locus_tag LOCUS_44510 177198 176980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 177423 178481 gene locus_tag LOCUS_44520 177423 178481 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929999.1 protein_id gnl|my_center|LOCUS_44520 180147 178633 gene locus_tag LOCUS_44530 180147 178633 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854953.1 protein_id gnl|my_center|LOCUS_44530 181982 180303 gene locus_tag LOCUS_44540 gene menD 181982 180303 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466562.1 protein_id gnl|my_center|LOCUS_44540 182132 183004 gene locus_tag LOCUS_44550 182132 183004 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094646.1 protein_id gnl|my_center|LOCUS_44550 183093 184325 gene locus_tag LOCUS_44560 gene menE 183093 184325 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742122.1 protein_id gnl|my_center|LOCUS_44560 184309 185181 gene locus_tag LOCUS_44570 184309 185181 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466560.1 protein_id gnl|my_center|LOCUS_44570 185712 185218 gene locus_tag LOCUS_44580 185712 185218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 186019 185747 gene locus_tag LOCUS_44590 186019 185747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 186412 186218 gene locus_tag LOCUS_44600 186412 186218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 187154 186345 gene locus_tag LOCUS_44610 187154 186345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 187493 187164 gene locus_tag LOCUS_44620 187493 187164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 188179 187607 gene locus_tag LOCUS_44630 188179 187607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 188651 188304 gene locus_tag LOCUS_44640 188651 188304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 188935 189156 gene locus_tag LOCUS_44650 188935 189156 CDS product BldC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081896.1 protein_id gnl|my_center|LOCUS_44650 189227 189403 gene locus_tag LOCUS_44660 189227 189403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 190918 189419 gene locus_tag LOCUS_44670 190918 189419 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222435.1 protein_id gnl|my_center|LOCUS_44670 192071 191058 gene locus_tag LOCUS_44680 gene ccsB 192071 191058 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222434.1 protein_id gnl|my_center|LOCUS_44680 193720 192071 gene locus_tag LOCUS_44690 193720 192071 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222433.1 protein_id gnl|my_center|LOCUS_44690 194532 193720 gene locus_tag LOCUS_44700 194532 193720 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222432.1 protein_id gnl|my_center|LOCUS_44700 195204 194662 gene locus_tag LOCUS_44710 195204 194662 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402846.1 protein_id gnl|my_center|LOCUS_44710 195884 195249 gene locus_tag LOCUS_44720 195884 195249 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222430.1 protein_id gnl|my_center|LOCUS_44720 197079 195874 gene locus_tag LOCUS_44730 gene hemL 197079 195874 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222429.1 protein_id gnl|my_center|LOCUS_44730 197650 197270 gene locus_tag LOCUS_44740 197650 197270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 198086 197637 gene locus_tag LOCUS_44750 198086 197637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 198841 198086 gene locus_tag LOCUS_44760 198841 198086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 199514 198954 gene locus_tag LOCUS_44770 199514 198954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225070.1 protein_id gnl|my_center|LOCUS_44770 200512 199511 gene locus_tag LOCUS_44780 gene hemB 200512 199511 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831526.1 protein_id gnl|my_center|LOCUS_44780 202148 200601 gene locus_tag LOCUS_44790 202148 200601 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222417.1 protein_id gnl|my_center|LOCUS_44790 203087 202152 gene locus_tag LOCUS_44800 gene hemC 203087 202152 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222416.1 protein_id gnl|my_center|LOCUS_44800 204493 203084 gene locus_tag LOCUS_44810 204493 203084 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222415.1 protein_id gnl|my_center|LOCUS_44810 205359 204490 gene locus_tag LOCUS_44820 205359 204490 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222414.1 protein_id gnl|my_center|LOCUS_44820 205617 205405 gene locus_tag LOCUS_44830 205617 205405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 205980 205738 gene locus_tag LOCUS_44840 205980 205738 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222412.1 protein_id gnl|my_center|LOCUS_44840 206344 206997 gene locus_tag LOCUS_44850 206344 206997 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222410.1 protein_id gnl|my_center|LOCUS_44850 207280 208173 gene locus_tag LOCUS_44860 207280 208173 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878084.1 protein_id gnl|my_center|LOCUS_44860 209236 208259 gene locus_tag LOCUS_44870 209236 208259 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222404.1 protein_id gnl|my_center|LOCUS_44870 210275 209229 gene locus_tag LOCUS_44880 210275 209229 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222403.1 protein_id gnl|my_center|LOCUS_44880 211572 210715 gene locus_tag LOCUS_44890 gene proC 211572 210715 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222401.1 protein_id gnl|my_center|LOCUS_44890 212839 211592 gene locus_tag LOCUS_44900 212839 211592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 213816 213067 gene locus_tag LOCUS_44910 213816 213067 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742120.1 protein_id gnl|my_center|LOCUS_44910 215242 214019 gene locus_tag LOCUS_44920 215242 214019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 216186 215239 gene locus_tag LOCUS_44930 216186 215239 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222397.1 protein_id gnl|my_center|LOCUS_44930 217035 216355 gene locus_tag LOCUS_44940 217035 216355 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222396.1 protein_id gnl|my_center|LOCUS_44940 218303 217032 gene locus_tag LOCUS_44950 218303 217032 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285858.1 protein_id gnl|my_center|LOCUS_44950 219227 218478 gene locus_tag LOCUS_44960 219227 218478 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222392.1 protein_id gnl|my_center|LOCUS_44960 220198 219680 gene locus_tag LOCUS_44970 220198 219680 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222390.1 protein_id gnl|my_center|LOCUS_44970 221484 220195 gene locus_tag LOCUS_44980 gene mshA 221484 220195 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_44980 222909 221725 gene locus_tag LOCUS_44990 222909 221725 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222387.1 protein_id gnl|my_center|LOCUS_44990 223134 223850 gene locus_tag LOCUS_45000 223134 223850 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727295.1 protein_id gnl|my_center|LOCUS_45000 224847 223855 gene locus_tag LOCUS_45010 224847 223855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 226060 224903 gene locus_tag LOCUS_45020 226060 224903 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222386.1 protein_id gnl|my_center|LOCUS_45020 226077 226589 gene locus_tag LOCUS_45030 226077 226589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 227150 226590 gene locus_tag LOCUS_45040 227150 226590 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_45040 227955 227188 gene locus_tag LOCUS_45050 227955 227188 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229360.1 protein_id gnl|my_center|LOCUS_45050 228239 227955 gene locus_tag LOCUS_45060 228239 227955 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222364.1 protein_id gnl|my_center|LOCUS_45060 228926 228309 gene locus_tag LOCUS_45070 228926 228309 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222363.1 protein_id gnl|my_center|LOCUS_45070 229375 228932 gene locus_tag LOCUS_45080 229375 228932 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222362.1 protein_id gnl|my_center|LOCUS_45080 229924 229532 gene locus_tag LOCUS_45090 229924 229532 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222358.1 protein_id gnl|my_center|LOCUS_45090 229987 230580 gene locus_tag LOCUS_45100 229987 230580 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222357.1 protein_id gnl|my_center|LOCUS_45100 232103 230844 gene locus_tag LOCUS_45110 232103 230844 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_45110 232194 233363 gene locus_tag LOCUS_45120 232194 233363 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222355.1 protein_id gnl|my_center|LOCUS_45120 234859 233570 gene locus_tag LOCUS_45130 234859 233570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 235587 235102 gene locus_tag LOCUS_45140 235587 235102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 236168 235584 gene locus_tag LOCUS_45150 236168 235584 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222253.1 protein_id gnl|my_center|LOCUS_45150 238342 236930 gene locus_tag LOCUS_45160 238342 236930 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878083.1 protein_id gnl|my_center|LOCUS_45160 238421 239062 gene locus_tag LOCUS_45170 238421 239062 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222352.1 protein_id gnl|my_center|LOCUS_45170 239071 239880 gene locus_tag LOCUS_45180 239071 239880 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466552.1 protein_id gnl|my_center|LOCUS_45180 240235 240495 gene locus_tag LOCUS_45190 240235 240495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 240927 240853 gene locus_tag LOCUS_t00410 240927 240853 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 241033 240957 gene locus_tag LOCUS_t00420 241033 240957 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 241122 241049 gene locus_tag LOCUS_t00430 241122 241049 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 241115 241300 gene locus_tag LOCUS_45200 241115 241300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 241979 241353 gene locus_tag LOCUS_45210 241979 241353 CDS product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972614.1 protein_id gnl|my_center|LOCUS_45210 242595 242356 gene locus_tag LOCUS_45220 242595 242356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222297.1 protein_id gnl|my_center|LOCUS_45220 242891 243139 gene locus_tag LOCUS_45230 242891 243139 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228661.1 protein_id gnl|my_center|LOCUS_45230 243199 243420 gene locus_tag LOCUS_45240 243199 243420 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228663.1 protein_id gnl|my_center|LOCUS_45240 243524 245785 gene locus_tag LOCUS_45250 243524 245785 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 protein_id gnl|my_center|LOCUS_45250 246022 246591 gene locus_tag LOCUS_45260 246022 246591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 248009 246858 gene locus_tag LOCUS_45270 248009 246858 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229659.1 protein_id gnl|my_center|LOCUS_45270 250065 248011 gene locus_tag LOCUS_45280 250065 248011 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229660.1 protein_id gnl|my_center|LOCUS_45280 251687 250074 gene locus_tag LOCUS_45290 251687 250074 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_45290 251767 252372 gene locus_tag LOCUS_45300 251767 252372 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283977.1 protein_id gnl|my_center|LOCUS_45300 253381 252596 gene locus_tag LOCUS_45310 253381 252596 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532886.1 protein_id gnl|my_center|LOCUS_45310 253532 255241 gene locus_tag LOCUS_45320 gene ctaD 253532 255241 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111140.1 protein_id gnl|my_center|LOCUS_45320 255776 255222 gene locus_tag LOCUS_45330 255776 255222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244421.1 protein_id gnl|my_center|LOCUS_45330 255823 256311 gene locus_tag LOCUS_45340 255823 256311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 256709 256515 gene locus_tag LOCUS_45350 256709 256515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 257624 256734 gene locus_tag LOCUS_45360 257624 256734 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_45360 257755 258147 gene locus_tag LOCUS_45370 257755 258147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 258147 258518 gene locus_tag LOCUS_45380 258147 258518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 259133 258564 gene locus_tag LOCUS_45390 259133 258564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 259332 260552 gene locus_tag LOCUS_45400 259332 260552 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222734.1 protein_id gnl|my_center|LOCUS_45400 260771 260604 gene locus_tag LOCUS_45410 260771 260604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 260728 261558 gene locus_tag LOCUS_45420 260728 261558 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228550.1 protein_id gnl|my_center|LOCUS_45420 262799 261648 gene locus_tag LOCUS_45430 262799 261648 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270078.1 protein_id gnl|my_center|LOCUS_45430 263481 263059 gene locus_tag LOCUS_45440 263481 263059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 263474 264088 gene locus_tag LOCUS_45450 263474 264088 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283908.1 protein_id gnl|my_center|LOCUS_45450 264393 264836 gene locus_tag LOCUS_45460 264393 264836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 265042 265248 gene locus_tag LOCUS_45470 265042 265248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 266593 265286 gene locus_tag LOCUS_45480 266593 265286 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803904.1 protein_id gnl|my_center|LOCUS_45480 266754 267716 gene locus_tag LOCUS_45490 266754 267716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 268942 267866 gene locus_tag LOCUS_45500 gene paaK 268942 267866 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838237.1 protein_id gnl|my_center|LOCUS_45500 269464 268958 gene locus_tag LOCUS_45510 gene paaJ 269464 268958 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868899.1 protein_id gnl|my_center|LOCUS_45510 270336 269458 gene locus_tag LOCUS_45520 gene paaC 270336 269458 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223465.1 protein_id gnl|my_center|LOCUS_45520 270652 270347 gene locus_tag LOCUS_45530 gene paaB 270652 270347 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454960.1 protein_id gnl|my_center|LOCUS_45530 271620 270649 gene locus_tag LOCUS_45540 gene paaA 271620 270649 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031683.1 protein_id gnl|my_center|LOCUS_45540 273849 271774 gene locus_tag LOCUS_45550 gene paaZ 273849 271774 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223462.1 protein_id gnl|my_center|LOCUS_45550 274108 274545 gene locus_tag LOCUS_45560 gene paaI 274108 274545 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270401.1 protein_id gnl|my_center|LOCUS_45560 274542 275864 gene locus_tag LOCUS_45570 gene paaF 274542 275864 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223460.1 protein_id gnl|my_center|LOCUS_45570 275901 276503 gene locus_tag LOCUS_45580 275901 276503 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223459.1 protein_id gnl|my_center|LOCUS_45580 276845 278464 gene locus_tag LOCUS_45590 276845 278464 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957525.1 protein_id gnl|my_center|LOCUS_45590 278587 279492 gene locus_tag LOCUS_45600 278587 279492 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525079.1 protein_id gnl|my_center|LOCUS_45600 279528 280469 gene locus_tag LOCUS_45610 279528 280469 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877923.1 protein_id gnl|my_center|LOCUS_45610 281066 282097 gene locus_tag LOCUS_45620 281066 282097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 282193 282390 gene locus_tag LOCUS_45630 282193 282390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45630 282861 283502 gene locus_tag LOCUS_45640 282861 283502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 283535 284251 gene locus_tag LOCUS_45650 283535 284251 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731052.1 protein_id gnl|my_center|LOCUS_45650 284264 284545 gene locus_tag LOCUS_45660 284264 284545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 285305 285231 gene locus_tag LOCUS_t00440 285305 285231 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 286284 285361 gene locus_tag LOCUS_45670 286284 285361 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272579.1 protein_id gnl|my_center|LOCUS_45670 286435 287049 gene locus_tag LOCUS_45680 286435 287049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 287185 288339 gene locus_tag LOCUS_45690 gene dusB 287185 288339 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230697.1 protein_id gnl|my_center|LOCUS_45690 288342 288785 gene locus_tag LOCUS_45700 288342 288785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 289050 289931 gene locus_tag LOCUS_45710 289050 289931 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230708.1 protein_id gnl|my_center|LOCUS_45710 290187 292883 gene locus_tag LOCUS_45720 290187 292883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 292988 293635 gene locus_tag LOCUS_45730 gene phoU 292988 293635 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230711.1 protein_id gnl|my_center|LOCUS_45730 293726 294553 gene locus_tag LOCUS_45740 293726 294553 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_45740 295409 294633 gene locus_tag LOCUS_45750 gene pstB 295409 294633 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230712.1 protein_id gnl|my_center|LOCUS_45750 296338 295424 gene locus_tag LOCUS_45760 gene pstA 296338 295424 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230713.1 protein_id gnl|my_center|LOCUS_45760 297381 296335 gene locus_tag LOCUS_45770 gene pstC 297381 296335 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230714.1 protein_id gnl|my_center|LOCUS_45770 298543 297428 gene locus_tag LOCUS_45780 gene pstS 298543 297428 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730786.1 protein_id gnl|my_center|LOCUS_45780 299704 298745 gene locus_tag LOCUS_45790 gene mshD 299704 298745 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230716.1 protein_id gnl|my_center|LOCUS_45790 300508 299759 gene locus_tag LOCUS_45800 300508 299759 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284398.1 protein_id gnl|my_center|LOCUS_45800 300831 301682 gene locus_tag LOCUS_45810 300831 301682 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230718.1 protein_id gnl|my_center|LOCUS_45810 301679 302149 gene locus_tag LOCUS_45820 301679 302149 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230719.1 protein_id gnl|my_center|LOCUS_45820 302389 302835 gene locus_tag LOCUS_45830 302389 302835 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230720.1 protein_id gnl|my_center|LOCUS_45830 302864 303724 gene locus_tag LOCUS_45840 302864 303724 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730790.1 protein_id gnl|my_center|LOCUS_45840 303727 304029 gene locus_tag LOCUS_45850 303727 304029 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467851.1 protein_id gnl|my_center|LOCUS_45850 307431 304348 gene locus_tag LOCUS_r00070 307431 304348 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 309264 307735 gene locus_tag LOCUS_r00080 309264 307735 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 310756 310010 gene locus_tag LOCUS_45860 310756 310010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 310865 310993 gene locus_tag LOCUS_45870 310865 310993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 311044 311703 gene locus_tag LOCUS_45880 311044 311703 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230723.1 protein_id gnl|my_center|LOCUS_45880 312849 312001 gene locus_tag LOCUS_45890 312849 312001 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230727.1 protein_id gnl|my_center|LOCUS_45890 313028 313417 gene locus_tag LOCUS_45900 313028 313417 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_45900 313414 314562 gene locus_tag LOCUS_45910 313414 314562 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230728.1 protein_id gnl|my_center|LOCUS_45910 314591 315346 gene locus_tag LOCUS_45920 314591 315346 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_45920 315412 316008 gene locus_tag LOCUS_45930 315412 316008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230729.1 protein_id gnl|my_center|LOCUS_45930 316005 316964 gene locus_tag LOCUS_45940 316005 316964 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230730.1 protein_id gnl|my_center|LOCUS_45940 318055 317162 gene locus_tag LOCUS_45950 318055 317162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467854.1 protein_id gnl|my_center|LOCUS_45950 318269 318451 gene locus_tag LOCUS_45960 318269 318451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 319161 318706 gene locus_tag LOCUS_45970 319161 318706 CDS product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466680.1 protein_id gnl|my_center|LOCUS_45970 319691 320266 gene locus_tag LOCUS_45980 319691 320266 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225371.1 protein_id gnl|my_center|LOCUS_45980 321427 320309 gene locus_tag LOCUS_45990 gene purM 321427 320309 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230742.1 protein_id gnl|my_center|LOCUS_45990 323167 321572 gene locus_tag LOCUS_46000 gene purF 323167 321572 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230743.1 protein_id gnl|my_center|LOCUS_46000 323675 323271 gene locus_tag LOCUS_46010 323675 323271 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284386.1 protein_id gnl|my_center|LOCUS_46010 324705 323941 gene locus_tag LOCUS_46020 324705 323941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 326125 324917 gene locus_tag LOCUS_46030 326125 324917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 326789 326352 gene locus_tag LOCUS_46040 326789 326352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 326953 327567 gene locus_tag LOCUS_46050 326953 327567 CDS product type VII secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230749.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46050 327608 329512 gene locus_tag LOCUS_46060 327608 329512 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223305.1 protein_id gnl|my_center|LOCUS_46060 329509 330552 gene locus_tag LOCUS_46070 329509 330552 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223306.1 protein_id gnl|my_center|LOCUS_46070 331779 330667 gene locus_tag LOCUS_46080 331779 330667 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230990.1 protein_id gnl|my_center|LOCUS_46080 332085 332594 gene locus_tag LOCUS_46090 332085 332594 CDS product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731617.1 protein_id gnl|my_center|LOCUS_46090 332734 332567 gene locus_tag LOCUS_46100 332734 332567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 332696 336016 gene locus_tag LOCUS_46110 332696 336016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 336108 337721 gene locus_tag LOCUS_46120 336108 337721 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230997.1 protein_id gnl|my_center|LOCUS_46120 337759 338301 gene locus_tag LOCUS_46130 337759 338301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 339046 338384 gene locus_tag LOCUS_46140 339046 338384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46140 339497 339039 gene locus_tag LOCUS_46150 339497 339039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 341884 339503 gene locus_tag LOCUS_46160 341884 339503 CDS product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029885.1 protein_id gnl|my_center|LOCUS_46160 342430 342852 gene locus_tag LOCUS_46170 342430 342852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 344263 342944 gene locus_tag LOCUS_46180 344263 342944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 345044 344355 gene locus_tag LOCUS_46190 345044 344355 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467888.1 protein_id gnl|my_center|LOCUS_46190 344946 345230 gene locus_tag LOCUS_46200 344946 345230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 346239 345781 gene locus_tag LOCUS_46210 346239 345781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 346238 346522 gene locus_tag LOCUS_46220 346238 346522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 346663 347043 gene locus_tag LOCUS_46230 346663 347043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 347104 347577 gene locus_tag LOCUS_46240 347104 347577 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231003.1 protein_id gnl|my_center|LOCUS_46240 347637 347876 gene locus_tag LOCUS_46250 gene rpsR 347637 347876 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_46250 347904 348356 gene locus_tag LOCUS_46260 gene rplI 347904 348356 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231004.1 protein_id gnl|my_center|LOCUS_46260 348830 352414 gene locus_tag LOCUS_46270 348830 352414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 352754 352425 gene locus_tag LOCUS_46280 352754 352425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46280 353397 353798 gene locus_tag LOCUS_46290 353397 353798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 354444 353785 gene locus_tag LOCUS_46300 354444 353785 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230987.1 protein_id gnl|my_center|LOCUS_46300 354671 355837 gene locus_tag LOCUS_46310 354671 355837 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230985.1 protein_id gnl|my_center|LOCUS_46310 356075 357913 gene locus_tag LOCUS_46320 356075 357913 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230984.1 protein_id gnl|my_center|LOCUS_46320 358164 360239 gene locus_tag LOCUS_46330 358164 360239 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230984.1 protein_id gnl|my_center|LOCUS_46330 360313 360999 gene locus_tag LOCUS_46340 360313 360999 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230982.1 protein_id gnl|my_center|LOCUS_46340 362404 361073 gene locus_tag LOCUS_46350 362404 361073 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230981.1 protein_id gnl|my_center|LOCUS_46350 363277 362618 gene locus_tag LOCUS_46360 363277 362618 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230978.1 protein_id gnl|my_center|LOCUS_46360 365082 363274 gene locus_tag LOCUS_46370 365082 363274 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092626645.1 protein_id gnl|my_center|LOCUS_46370 365297 366016 gene locus_tag LOCUS_46380 365297 366016 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230976.1 protein_id gnl|my_center|LOCUS_46380 366013 366753 gene locus_tag LOCUS_46390 366013 366753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 367735 367022 gene locus_tag LOCUS_46400 gene trmB 367735 367022 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230974.1 protein_id gnl|my_center|LOCUS_46400 368280 367801 gene locus_tag LOCUS_46410 368280 367801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230973.1 protein_id gnl|my_center|LOCUS_46410 368632 369075 gene locus_tag LOCUS_46420 368632 369075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 370146 369412 gene locus_tag LOCUS_46430 370146 369412 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230970.1 protein_id gnl|my_center|LOCUS_46430 371092 370151 gene locus_tag LOCUS_46440 371092 370151 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230969.1 protein_id gnl|my_center|LOCUS_46440 372087 371266 gene locus_tag LOCUS_46450 372087 371266 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897816.1 protein_id gnl|my_center|LOCUS_46450 372800 372147 gene locus_tag LOCUS_46460 372800 372147 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_46460 373751 372924 gene locus_tag LOCUS_46470 373751 372924 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_46470 375091 373754 gene locus_tag LOCUS_46480 375091 373754 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230940.1 protein_id gnl|my_center|LOCUS_46480 375191 376468 gene locus_tag LOCUS_46490 375191 376468 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230941.1 protein_id gnl|my_center|LOCUS_46490 376659 376483 gene locus_tag LOCUS_46500 376659 376483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 376768 377127 gene locus_tag LOCUS_46510 376768 377127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 377541 378296 gene locus_tag LOCUS_46520 377541 378296 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246384.1 protein_id gnl|my_center|LOCUS_46520 378792 379490 gene locus_tag LOCUS_46530 378792 379490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 379682 380053 gene locus_tag LOCUS_46540 379682 380053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 380181 380459 gene locus_tag LOCUS_46550 380181 380459 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265672.1 protein_id gnl|my_center|LOCUS_46550 380469 380768 gene locus_tag LOCUS_46560 380469 380768 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_46560 381211 381822 gene locus_tag LOCUS_46570 381211 381822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 381819 382235 gene locus_tag LOCUS_46580 381819 382235 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898500.1 protein_id gnl|my_center|LOCUS_46580 382281 384158 gene locus_tag LOCUS_46590 382281 384158 CDS product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230910.1 protein_id gnl|my_center|LOCUS_46590 384223 384543 gene locus_tag LOCUS_46600 384223 384543 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230909.1 protein_id gnl|my_center|LOCUS_46600 384667 386772 gene locus_tag LOCUS_46610 384667 386772 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 protein_id gnl|my_center|LOCUS_46610 386917 387951 gene locus_tag LOCUS_46620 386917 387951 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467337.1 protein_id gnl|my_center|LOCUS_46620 388884 388033 gene locus_tag LOCUS_46630 388884 388033 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029395.1 protein_id gnl|my_center|LOCUS_46630 389920 388937 gene locus_tag LOCUS_46640 389920 388937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 390606 390115 gene locus_tag LOCUS_46650 390606 390115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 391234 390770 gene locus_tag LOCUS_46660 391234 390770 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973682.1 protein_id gnl|my_center|LOCUS_46660 392115 391318 gene locus_tag LOCUS_46670 392115 391318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 392352 393506 gene locus_tag LOCUS_46680 392352 393506 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742063.1 protein_id gnl|my_center|LOCUS_46680 394091 393627 gene locus_tag LOCUS_46690 394091 393627 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467870.1 protein_id gnl|my_center|LOCUS_46690 395288 394095 gene locus_tag LOCUS_46700 gene dnaJ 395288 394095 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230872.1 protein_id gnl|my_center|LOCUS_46700 396068 395313 gene locus_tag LOCUS_46710 gene grpE 396068 395313 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230873.1 protein_id gnl|my_center|LOCUS_46710 397942 396065 gene locus_tag LOCUS_46720 gene dnaK 397942 396065 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230874.1 protein_id gnl|my_center|LOCUS_46720 398192 398731 gene locus_tag LOCUS_46730 398192 398731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 399546 398947 gene locus_tag LOCUS_46740 399546 398947 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449652.1 protein_id gnl|my_center|LOCUS_46740 >Feature sequence08 2118 1015 gene locus_tag LOCUS_46750 2118 1015 CDS product CpaE-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510600.1 protein_id gnl|my_center|LOCUS_46750 2593 3462 gene locus_tag LOCUS_46760 2593 3462 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083519.1 protein_id gnl|my_center|LOCUS_46760 3975 5810 gene locus_tag LOCUS_46770 3975 5810 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230528.1 protein_id gnl|my_center|LOCUS_46770 5807 7075 gene locus_tag LOCUS_46780 5807 7075 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230529.1 protein_id gnl|my_center|LOCUS_46780 7091 8839 gene locus_tag LOCUS_46790 7091 8839 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230530.1 protein_id gnl|my_center|LOCUS_46790 8921 9313 gene locus_tag LOCUS_46800 8921 9313 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112247.1 protein_id gnl|my_center|LOCUS_46800 9653 10579 gene locus_tag LOCUS_46810 9653 10579 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 protein_id gnl|my_center|LOCUS_46810 10609 11526 gene locus_tag LOCUS_46820 10609 11526 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230532.1 protein_id gnl|my_center|LOCUS_46820 12814 12281 gene locus_tag LOCUS_46830 12814 12281 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931173.1 protein_id gnl|my_center|LOCUS_46830 13804 12884 gene locus_tag LOCUS_46840 13804 12884 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 protein_id gnl|my_center|LOCUS_46840 13888 14298 gene locus_tag LOCUS_46850 13888 14298 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819713.1 protein_id gnl|my_center|LOCUS_46850 15308 14319 gene locus_tag LOCUS_46860 15308 14319 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079794.1 protein_id gnl|my_center|LOCUS_46860 16380 15433 gene locus_tag LOCUS_46870 16380 15433 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014308.1 protein_id gnl|my_center|LOCUS_46870 17233 16463 gene locus_tag LOCUS_46880 17233 16463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230534.1 protein_id gnl|my_center|LOCUS_46880 17479 17279 gene locus_tag LOCUS_46890 17479 17279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 17484 19439 gene locus_tag LOCUS_46900 gene acs 17484 19439 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230537.1 protein_id gnl|my_center|LOCUS_46900 19653 20891 gene locus_tag LOCUS_46910 gene nhaA 19653 20891 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230542.1 protein_id gnl|my_center|LOCUS_46910 20925 21449 gene locus_tag LOCUS_46920 20925 21449 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230543.1 protein_id gnl|my_center|LOCUS_46920 22837 21653 gene locus_tag LOCUS_46930 22837 21653 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230547.1 protein_id gnl|my_center|LOCUS_46930 23650 22940 gene locus_tag LOCUS_46940 23650 22940 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230548.1 protein_id gnl|my_center|LOCUS_46940 24306 23647 gene locus_tag LOCUS_46950 24306 23647 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230549.1 protein_id gnl|my_center|LOCUS_46950 25061 24303 gene locus_tag LOCUS_46960 gene nth 25061 24303 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078343767.1 protein_id gnl|my_center|LOCUS_46960 25264 25518 gene locus_tag LOCUS_46970 25264 25518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230551.1 protein_id gnl|my_center|LOCUS_46970 25615 26289 gene locus_tag LOCUS_46980 25615 26289 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081747.1 protein_id gnl|my_center|LOCUS_46980 26908 28140 gene locus_tag LOCUS_46990 26908 28140 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230552.1 protein_id gnl|my_center|LOCUS_46990 28969 28163 gene locus_tag LOCUS_47000 28969 28163 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230559.1 protein_id gnl|my_center|LOCUS_47000 29778 28966 gene locus_tag LOCUS_47010 29778 28966 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230560.1 protein_id gnl|my_center|LOCUS_47010 31166 29823 gene locus_tag LOCUS_47020 31166 29823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 31873 31214 gene locus_tag LOCUS_47030 31873 31214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230562.1 protein_id gnl|my_center|LOCUS_47030 32572 32114 gene locus_tag LOCUS_47040 32572 32114 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230563.1 protein_id gnl|my_center|LOCUS_47040 32834 32574 gene locus_tag LOCUS_47050 32834 32574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 32864 33871 gene locus_tag LOCUS_47060 32864 33871 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230565.1 protein_id gnl|my_center|LOCUS_47060 33868 34998 gene locus_tag LOCUS_47070 33868 34998 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_47070 35484 35185 gene locus_tag LOCUS_47080 35484 35185 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230567.1 protein_id gnl|my_center|LOCUS_47080 35737 38262 gene locus_tag LOCUS_47090 gene ponA2 35737 38262 CDS product transglycosylase/D,D-transpeptidase PonA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878583.1 protein_id gnl|my_center|LOCUS_47090 38355 38804 gene locus_tag LOCUS_47100 38355 38804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 38963 39739 gene locus_tag LOCUS_47110 38963 39739 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977203.1 protein_id gnl|my_center|LOCUS_47110 40336 39860 gene locus_tag LOCUS_47120 40336 39860 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_47120 40409 41371 gene locus_tag LOCUS_47130 40409 41371 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467832.1 protein_id gnl|my_center|LOCUS_47130 41421 41495 gene locus_tag LOCUS_t00450 41421 41495 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 42678 41611 gene locus_tag LOCUS_47140 42678 41611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 42922 44757 gene locus_tag LOCUS_47150 42922 44757 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230572.1 protein_id gnl|my_center|LOCUS_47150 44910 45971 gene locus_tag LOCUS_47160 44910 45971 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103575.1 protein_id gnl|my_center|LOCUS_47160 46540 46055 gene locus_tag LOCUS_47170 46540 46055 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230585.1 protein_id gnl|my_center|LOCUS_47170 47182 46625 gene locus_tag LOCUS_47180 47182 46625 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742094.1 protein_id gnl|my_center|LOCUS_47180 47375 48442 gene locus_tag LOCUS_47190 47375 48442 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230588.1 protein_id gnl|my_center|LOCUS_47190 51047 48552 gene locus_tag LOCUS_47200 51047 48552 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223386.1 protein_id gnl|my_center|LOCUS_47200 52505 51108 gene locus_tag LOCUS_47210 52505 51108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47210 52798 53748 gene locus_tag LOCUS_47220 52798 53748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 53954 55762 gene locus_tag LOCUS_47230 53954 55762 CDS product isoniazid inducible protein IniA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193353532.1 protein_id gnl|my_center|LOCUS_47230 55997 57409 gene locus_tag LOCUS_47240 55997 57409 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226994.1 protein_id gnl|my_center|LOCUS_47240 58999 57548 gene locus_tag LOCUS_47250 58999 57548 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971553.1 protein_id gnl|my_center|LOCUS_47250 59493 58996 gene locus_tag LOCUS_47260 gene furA3 59493 58996 CDS product fur family transcriptional regulator FurA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731162.1 protein_id gnl|my_center|LOCUS_47260 60970 59564 gene locus_tag LOCUS_47270 60970 59564 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371412.1 protein_id gnl|my_center|LOCUS_47270 62714 61224 gene locus_tag LOCUS_47280 62714 61224 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399854.1 protein_id gnl|my_center|LOCUS_47280 63341 62772 gene locus_tag LOCUS_47290 63341 62772 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230158.1 protein_id gnl|my_center|LOCUS_47290 64551 63484 gene locus_tag LOCUS_47300 64551 63484 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 protein_id gnl|my_center|LOCUS_47300 65817 64552 gene locus_tag LOCUS_47310 65817 64552 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230598.1 protein_id gnl|my_center|LOCUS_47310 66190 67431 gene locus_tag LOCUS_47320 66190 67431 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977073.1 protein_id gnl|my_center|LOCUS_47320 67488 68099 gene locus_tag LOCUS_47330 67488 68099 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086849840.1 protein_id gnl|my_center|LOCUS_47330 68180 69334 gene locus_tag LOCUS_47340 gene kynU 68180 69334 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531745.1 protein_id gnl|my_center|LOCUS_47340 69660 69349 gene locus_tag LOCUS_47350 69660 69349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 69923 71671 gene locus_tag LOCUS_47360 gene leuA 69923 71671 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285511.1 protein_id gnl|my_center|LOCUS_47360 72517 71747 gene locus_tag LOCUS_47370 72517 71747 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027790.1 protein_id gnl|my_center|LOCUS_47370 72642 73841 gene locus_tag LOCUS_47380 72642 73841 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339317.1 protein_id gnl|my_center|LOCUS_47380 72760 72666 gene locus_tag LOCUS_t00460 72760 72666 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 73878 75053 gene locus_tag LOCUS_47390 73878 75053 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969989.1 protein_id gnl|my_center|LOCUS_47390 75156 76820 gene locus_tag LOCUS_47400 75156 76820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 77100 76873 gene locus_tag LOCUS_47410 77100 76873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 77854 77258 gene locus_tag LOCUS_47420 gene recR 77854 77258 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230626.1 protein_id gnl|my_center|LOCUS_47420 78227 77868 gene locus_tag LOCUS_47430 78227 77868 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975320.1 protein_id gnl|my_center|LOCUS_47430 78490 80313 gene locus_tag LOCUS_47440 78490 80313 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_47440 82680 80476 gene locus_tag LOCUS_47450 82680 80476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 82945 83032 gene locus_tag LOCUS_t00470 82945 83032 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 83418 83741 gene locus_tag LOCUS_47460 83418 83741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 84090 84905 gene locus_tag LOCUS_47470 84090 84905 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061685.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_47470 86470 84920 gene locus_tag LOCUS_47480 86470 84920 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242442.1 protein_id gnl|my_center|LOCUS_47480 87875 86754 gene locus_tag LOCUS_47490 87875 86754 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974677.1 protein_id gnl|my_center|LOCUS_47490 88137 90062 gene locus_tag LOCUS_47500 88137 90062 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222767.1 protein_id gnl|my_center|LOCUS_47500 90178 91662 gene locus_tag LOCUS_47510 90178 91662 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107137.1 protein_id gnl|my_center|LOCUS_47510 94195 91679 gene locus_tag LOCUS_47520 94195 91679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 94450 94363 gene locus_tag LOCUS_t00480 94450 94363 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 94747 94514 gene locus_tag LOCUS_47530 94747 94514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 95304 94828 gene locus_tag LOCUS_47540 95304 94828 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420508.1 protein_id gnl|my_center|LOCUS_47540 95714 95301 gene locus_tag LOCUS_47550 95714 95301 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199198884.1 protein_id gnl|my_center|LOCUS_47550 95987 97006 gene locus_tag LOCUS_47560 95987 97006 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222259.1 protein_id gnl|my_center|LOCUS_47560 97078 98277 gene locus_tag LOCUS_47570 97078 98277 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031117.1 protein_id gnl|my_center|LOCUS_47570 98389 99093 gene locus_tag LOCUS_47580 98389 99093 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224576.1 protein_id gnl|my_center|LOCUS_47580 99120 100307 gene locus_tag LOCUS_47590 99120 100307 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224575.1 protein_id gnl|my_center|LOCUS_47590 101549 100350 gene locus_tag LOCUS_47600 101549 100350 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029306.1 protein_id gnl|my_center|LOCUS_47600 101924 102157 gene locus_tag LOCUS_47610 101924 102157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 102815 102426 gene locus_tag LOCUS_47620 102815 102426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 103225 104160 gene locus_tag LOCUS_47630 103225 104160 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084127.1 protein_id gnl|my_center|LOCUS_47630 104180 104533 gene locus_tag LOCUS_47640 104180 104533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 104523 104795 gene locus_tag LOCUS_47650 104523 104795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 104792 106402 gene locus_tag LOCUS_47660 104792 106402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 107135 106824 gene locus_tag LOCUS_47670 107135 106824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 107348 107163 gene locus_tag LOCUS_47680 107348 107163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 107339 107551 gene locus_tag LOCUS_47690 107339 107551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47690 107871 108119 gene locus_tag LOCUS_47700 107871 108119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 108620 108772 gene locus_tag LOCUS_47710 108620 108772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 108872 108799 gene locus_tag LOCUS_t00490 108872 108799 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 109001 108913 gene locus_tag LOCUS_t00500 109001 108913 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 111084 109093 gene locus_tag LOCUS_47720 111084 109093 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222224.1 protein_id gnl|my_center|LOCUS_47720 112628 111357 gene locus_tag LOCUS_47730 112628 111357 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249937.1 protein_id gnl|my_center|LOCUS_47730 112826 113878 gene locus_tag LOCUS_47740 gene hisC 112826 113878 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222222.1 protein_id gnl|my_center|LOCUS_47740 114060 114284 gene locus_tag LOCUS_47750 114060 114284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 115013 114279 gene locus_tag LOCUS_47760 115013 114279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 115541 115044 gene locus_tag LOCUS_47770 115541 115044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 116456 115605 gene locus_tag LOCUS_47780 116456 115605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 116436 116645 gene locus_tag LOCUS_47790 116436 116645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 118136 116901 gene locus_tag LOCUS_47800 118136 116901 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031650.1 protein_id gnl|my_center|LOCUS_47800 119420 118182 gene locus_tag LOCUS_47810 119420 118182 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223336.1 protein_id gnl|my_center|LOCUS_47810 120031 119417 gene locus_tag LOCUS_47820 120031 119417 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561734.1 protein_id gnl|my_center|LOCUS_47820 120368 120012 gene locus_tag LOCUS_47830 120368 120012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 120766 120371 gene locus_tag LOCUS_47840 120766 120371 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971678.1 protein_id gnl|my_center|LOCUS_47840 122139 120763 gene locus_tag LOCUS_47850 122139 120763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 122987 122902 gene locus_tag LOCUS_t00510 122987 122902 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 123504 123043 gene locus_tag LOCUS_47860 123504 123043 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742106.1 protein_id gnl|my_center|LOCUS_47860 123717 124697 gene locus_tag LOCUS_47870 123717 124697 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940689.1 protein_id gnl|my_center|LOCUS_47870 124703 125464 gene locus_tag LOCUS_47880 124703 125464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 126991 125537 gene locus_tag LOCUS_47890 126991 125537 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742107.1 protein_id gnl|my_center|LOCUS_47890 127196 128239 gene locus_tag LOCUS_47900 127196 128239 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222193.1 protein_id gnl|my_center|LOCUS_47900 129594 128368 gene locus_tag LOCUS_47910 129594 128368 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222192.1 protein_id gnl|my_center|LOCUS_47910 129653 130207 gene locus_tag LOCUS_47920 129653 130207 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731234.1 protein_id gnl|my_center|LOCUS_47920 130341 131189 gene locus_tag LOCUS_47930 130341 131189 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284954.1 protein_id gnl|my_center|LOCUS_47930 131208 132032 gene locus_tag LOCUS_47940 131208 132032 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222189.1 protein_id gnl|my_center|LOCUS_47940 132029 132961 gene locus_tag LOCUS_47950 132029 132961 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466521.1 protein_id gnl|my_center|LOCUS_47950 133255 132968 gene locus_tag LOCUS_47960 133255 132968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 133309 136653 gene locus_tag LOCUS_47970 133309 136653 CDS product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831681.1 protein_id gnl|my_center|LOCUS_47970 136711 136986 gene locus_tag LOCUS_47980 136711 136986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 137583 137131 gene locus_tag LOCUS_47990 137583 137131 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284971.1 protein_id gnl|my_center|LOCUS_47990 137714 139096 gene locus_tag LOCUS_48000 137714 139096 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222180.1 protein_id gnl|my_center|LOCUS_48000 139093 139260 gene locus_tag LOCUS_48010 139093 139260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 139257 140018 gene locus_tag LOCUS_48020 139257 140018 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222179.1 protein_id gnl|my_center|LOCUS_48020 140921 142447 gene locus_tag LOCUS_48030 140921 142447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222178.1 protein_id gnl|my_center|LOCUS_48030 142773 145748 gene locus_tag LOCUS_48040 142773 145748 CDS product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831681.1 protein_id gnl|my_center|LOCUS_48040 146145 146984 gene locus_tag LOCUS_48050 146145 146984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 147227 150421 gene locus_tag LOCUS_48060 147227 150421 CDS product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831681.1 protein_id gnl|my_center|LOCUS_48060 150393 151424 gene locus_tag LOCUS_48070 150393 151424 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229534.1 protein_id gnl|my_center|LOCUS_48070 151411 151836 gene locus_tag LOCUS_48080 151411 151836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 151833 153104 gene locus_tag LOCUS_48090 151833 153104 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256439.1 protein_id gnl|my_center|LOCUS_48090 153253 153819 gene locus_tag LOCUS_48100 153253 153819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 154708 153884 gene locus_tag LOCUS_48110 154708 153884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 155122 154928 gene locus_tag LOCUS_48120 155122 154928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 155874 155125 gene locus_tag LOCUS_48130 155874 155125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 156939 155947 gene locus_tag LOCUS_48140 156939 155947 CDS product DUF4073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754280.1 protein_id gnl|my_center|LOCUS_48140 158203 156971 gene locus_tag LOCUS_48150 158203 156971 CDS product DUF1205 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189188609.1 protein_id gnl|my_center|LOCUS_48150 158572 160824 gene locus_tag LOCUS_48160 158572 160824 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227744.1 protein_id gnl|my_center|LOCUS_48160 160843 162267 gene locus_tag LOCUS_48170 160843 162267 CDS product SagB family peptide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092398.1 protein_id gnl|my_center|LOCUS_48170 162270 162431 gene locus_tag LOCUS_48180 162270 162431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 162500 164602 gene locus_tag LOCUS_48190 162500 164602 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027333.1 protein_id gnl|my_center|LOCUS_48190 164602 166698 gene locus_tag LOCUS_48200 164602 166698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 167665 166886 gene locus_tag LOCUS_48210 167665 166886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 168612 167662 gene locus_tag LOCUS_48220 168612 167662 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462182.1 protein_id gnl|my_center|LOCUS_48220 169841 168591 gene locus_tag LOCUS_48230 169841 168591 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660660.1 protein_id gnl|my_center|LOCUS_48230 169974 170987 gene locus_tag LOCUS_48240 169974 170987 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_48240 171670 170996 gene locus_tag LOCUS_48250 171670 170996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 172249 171893 gene locus_tag LOCUS_48260 172249 171893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 173577 172576 gene locus_tag LOCUS_48270 173577 172576 CDS product IS630-like element ISMsm5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729527.1 protein_id gnl|my_center|LOCUS_48270 174821 173751 gene locus_tag LOCUS_48280 174821 173751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 protein_id gnl|my_center|LOCUS_48280 175792 174818 gene locus_tag LOCUS_48290 gene fabD 175792 174818 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392463.1 protein_id gnl|my_center|LOCUS_48290 175978 176961 gene locus_tag LOCUS_48300 175978 176961 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940689.1 protein_id gnl|my_center|LOCUS_48300 176958 177794 gene locus_tag LOCUS_48310 176958 177794 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582486.1 protein_id gnl|my_center|LOCUS_48310 177872 179104 gene locus_tag LOCUS_48320 177872 179104 CDS product DUF1205 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227231.1 protein_id gnl|my_center|LOCUS_48320 179140 180447 gene locus_tag LOCUS_48330 gene rfbH 179140 180447 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227240.1 protein_id gnl|my_center|LOCUS_48330 180486 182939 gene locus_tag LOCUS_48340 180486 182939 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227243.1 protein_id gnl|my_center|LOCUS_48340 182936 184126 gene locus_tag LOCUS_48350 182936 184126 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 protein_id gnl|my_center|LOCUS_48350 184313 185425 gene locus_tag LOCUS_48360 184313 185425 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_48360 186515 185484 gene locus_tag LOCUS_48370 186515 185484 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031816.1 protein_id gnl|my_center|LOCUS_48370 187012 186512 gene locus_tag LOCUS_48380 187012 186512 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031817.1 protein_id gnl|my_center|LOCUS_48380 187202 187966 gene locus_tag LOCUS_48390 187202 187966 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031819.1 protein_id gnl|my_center|LOCUS_48390 189395 187959 gene locus_tag LOCUS_48400 189395 187959 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972529.1 protein_id gnl|my_center|LOCUS_48400 190027 189434 gene locus_tag LOCUS_48410 190027 189434 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893937.1 protein_id gnl|my_center|LOCUS_48410 190862 190188 gene locus_tag LOCUS_48420 190862 190188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 192238 191042 gene locus_tag LOCUS_48430 192238 191042 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466510.1 protein_id gnl|my_center|LOCUS_48430 193165 192353 gene locus_tag LOCUS_48440 193165 192353 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222100.1 protein_id gnl|my_center|LOCUS_48440 194116 193337 gene locus_tag LOCUS_48450 194116 193337 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222102.1 protein_id gnl|my_center|LOCUS_48450 194255 195175 gene locus_tag LOCUS_48460 194255 195175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222109.1 protein_id gnl|my_center|LOCUS_48460 195210 195896 gene locus_tag LOCUS_48470 195210 195896 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222110.1 protein_id gnl|my_center|LOCUS_48470 196148 196906 gene locus_tag LOCUS_48480 196148 196906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 197125 199821 gene locus_tag LOCUS_48490 197125 199821 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257888.1 protein_id gnl|my_center|LOCUS_48490 200124 201677 gene locus_tag LOCUS_48500 200124 201677 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222114.1 protein_id gnl|my_center|LOCUS_48500 201689 202714 gene locus_tag LOCUS_48510 gene cydB 201689 202714 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222115.1 protein_id gnl|my_center|LOCUS_48510 202711 206019 gene locus_tag LOCUS_48520 gene cydC 202711 206019 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222116.1 protein_id gnl|my_center|LOCUS_48520 206016 207254 gene locus_tag LOCUS_48530 206016 207254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 208023 207379 gene locus_tag LOCUS_48540 208023 207379 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222118.1 protein_id gnl|my_center|LOCUS_48540 208584 208069 gene locus_tag LOCUS_48550 208584 208069 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230942.1 protein_id gnl|my_center|LOCUS_48550 209330 208725 gene locus_tag LOCUS_48560 209330 208725 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222130.1 protein_id gnl|my_center|LOCUS_48560 209443 210366 gene locus_tag LOCUS_48570 gene pheA 209443 210366 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222131.1 protein_id gnl|my_center|LOCUS_48570 210787 210443 gene locus_tag LOCUS_48580 210787 210443 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087492.1 protein_id gnl|my_center|LOCUS_48580 211820 210798 gene locus_tag LOCUS_48590 211820 210798 CDS product septum formation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222137.1 protein_id gnl|my_center|LOCUS_48590 211919 213175 gene locus_tag LOCUS_48600 gene serS 211919 213175 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831496.1 protein_id gnl|my_center|LOCUS_48600 213899 213258 gene locus_tag LOCUS_48610 213899 213258 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031342.1 protein_id gnl|my_center|LOCUS_48610 214820 213963 gene locus_tag LOCUS_48620 214820 213963 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222172.1 protein_id gnl|my_center|LOCUS_48620 214973 215782 gene locus_tag LOCUS_48630 214973 215782 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897816.1 protein_id gnl|my_center|LOCUS_48630 216845 215784 gene locus_tag LOCUS_48640 216845 215784 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028730.1 protein_id gnl|my_center|LOCUS_48640 216961 217323 gene locus_tag LOCUS_48650 216961 217323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 217320 217520 gene locus_tag LOCUS_48660 217320 217520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 218868 217633 gene locus_tag LOCUS_48670 218868 217633 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840295.1 protein_id gnl|my_center|LOCUS_48670 217883 217808 gene locus_tag LOCUS_t00520 217883 217808 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 218951 220195 gene locus_tag LOCUS_48680 gene glf 218951 220195 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222174.1 protein_id gnl|my_center|LOCUS_48680 220199 222250 gene locus_tag LOCUS_48690 gene glfT2 220199 222250 CDS product galactofuranosyl transferase GlfT2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900761.1 protein_id gnl|my_center|LOCUS_48690 222301 222891 gene locus_tag LOCUS_48700 222301 222891 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222175.1 protein_id gnl|my_center|LOCUS_48700 222884 224095 gene locus_tag LOCUS_48710 222884 224095 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222176.1 protein_id gnl|my_center|LOCUS_48710 224656 225060 gene locus_tag LOCUS_48720 224656 225060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 225154 225612 gene locus_tag LOCUS_48730 225154 225612 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467653.1 protein_id gnl|my_center|LOCUS_48730 226906 225617 gene locus_tag LOCUS_48740 226906 225617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 227559 227197 gene locus_tag LOCUS_48750 227559 227197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 228798 229142 gene locus_tag LOCUS_48760 228798 229142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 229171 229770 gene locus_tag LOCUS_48770 229171 229770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 229786 231144 gene locus_tag LOCUS_48780 229786 231144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 231790 231326 gene locus_tag LOCUS_48790 231790 231326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 232071 231790 gene locus_tag LOCUS_48800 232071 231790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 232267 233151 gene locus_tag LOCUS_48810 232267 233151 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_48810 233148 233366 gene locus_tag LOCUS_48820 233148 233366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 233438 233638 gene locus_tag LOCUS_48830 233438 233638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 233780 235294 gene locus_tag LOCUS_48840 233780 235294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 235675 236313 gene locus_tag LOCUS_48850 235675 236313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 236423 237037 gene locus_tag LOCUS_48860 236423 237037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 237031 238104 gene locus_tag LOCUS_48870 237031 238104 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233028.1 protein_id gnl|my_center|LOCUS_48870 238615 238169 gene locus_tag LOCUS_48880 238615 238169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 239334 238672 gene locus_tag LOCUS_48890 239334 238672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 239663 239352 gene locus_tag LOCUS_48900 239663 239352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 240018 240578 gene locus_tag LOCUS_48910 240018 240578 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284940.1 protein_id gnl|my_center|LOCUS_48910 241661 240708 gene locus_tag LOCUS_48920 241661 240708 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222094.1 protein_id gnl|my_center|LOCUS_48920 242699 241824 gene locus_tag LOCUS_48930 242699 241824 CDS product DUF4328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222089.1 protein_id gnl|my_center|LOCUS_48930 243052 242732 gene locus_tag LOCUS_48940 243052 242732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 244906 243128 gene locus_tag LOCUS_48950 244906 243128 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222087.1 protein_id gnl|my_center|LOCUS_48950 245485 245099 gene locus_tag LOCUS_48960 245485 245099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 246310 245489 gene locus_tag LOCUS_48970 246310 245489 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284934.1 protein_id gnl|my_center|LOCUS_48970 247299 246385 gene locus_tag LOCUS_48980 247299 246385 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222083.1 protein_id gnl|my_center|LOCUS_48980 248557 247292 gene locus_tag LOCUS_48990 248557 247292 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222082.1 protein_id gnl|my_center|LOCUS_48990 249167 248730 gene locus_tag LOCUS_49000 249167 248730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222080.1 protein_id gnl|my_center|LOCUS_49000 249392 249802 gene locus_tag LOCUS_49010 249392 249802 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 protein_id gnl|my_center|LOCUS_49010 249896 249968 gene locus_tag LOCUS_t00530 249896 249968 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 250283 250891 gene locus_tag LOCUS_49020 250283 250891 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975967.1 protein_id gnl|my_center|LOCUS_49020 251778 251149 gene locus_tag LOCUS_49030 gene msrA 251778 251149 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338316.1 protein_id gnl|my_center|LOCUS_49030 252200 253444 gene locus_tag LOCUS_49040 252200 253444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 256810 253538 gene locus_tag LOCUS_49050 256810 253538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 257022 257276 gene locus_tag LOCUS_49060 257022 257276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 257266 258690 gene locus_tag LOCUS_49070 257266 258690 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028162.1 protein_id gnl|my_center|LOCUS_49070 258695 259357 gene locus_tag LOCUS_49080 258695 259357 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976672.1 protein_id gnl|my_center|LOCUS_49080 259507 259770 gene locus_tag LOCUS_49090 259507 259770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 259788 260180 gene locus_tag LOCUS_49100 259788 260180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 260069 260464 gene locus_tag LOCUS_49110 260069 260464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49110 260464 261372 gene locus_tag LOCUS_49120 260464 261372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027378.1 protein_id gnl|my_center|LOCUS_49120 261550 261314 gene locus_tag LOCUS_49130 261550 261314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 262115 261795 gene locus_tag LOCUS_49140 262115 261795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 262545 264068 gene locus_tag LOCUS_49150 262545 264068 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028163.1 protein_id gnl|my_center|LOCUS_49150 264088 265242 gene locus_tag LOCUS_49160 264088 265242 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469535.1 protein_id gnl|my_center|LOCUS_49160 267152 265350 gene locus_tag LOCUS_49170 267152 265350 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284852.1 protein_id gnl|my_center|LOCUS_49170 268589 267270 gene locus_tag LOCUS_49180 268589 267270 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831529.1 protein_id gnl|my_center|LOCUS_49180 268722 269711 gene locus_tag LOCUS_49190 268722 269711 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_49190 269764 270522 gene locus_tag LOCUS_49200 269764 270522 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222055.1 protein_id gnl|my_center|LOCUS_49200 272188 270596 gene locus_tag LOCUS_49210 272188 270596 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284849.1 protein_id gnl|my_center|LOCUS_49210 272425 272961 gene locus_tag LOCUS_49220 272425 272961 CDS product DUF6474 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222051.1 protein_id gnl|my_center|LOCUS_49220 274744 273044 gene locus_tag LOCUS_49230 274744 273044 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972257.1 protein_id gnl|my_center|LOCUS_49230 276725 275088 gene locus_tag LOCUS_49240 276725 275088 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727978.1 protein_id gnl|my_center|LOCUS_49240 278799 277858 gene locus_tag LOCUS_49250 278799 277858 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222042.1 protein_id gnl|my_center|LOCUS_49250 280187 278811 gene locus_tag LOCUS_49260 280187 278811 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222041.1 protein_id gnl|my_center|LOCUS_49260 280447 280830 gene locus_tag LOCUS_49270 280447 280830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222039.1 protein_id gnl|my_center|LOCUS_49270 283925 281244 gene locus_tag LOCUS_49280 283925 281244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 284411 285058 gene locus_tag LOCUS_49290 284411 285058 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222036.1 protein_id gnl|my_center|LOCUS_49290 286212 285028 gene locus_tag LOCUS_49300 286212 285028 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222035.1 protein_id gnl|my_center|LOCUS_49300 286334 287650 gene locus_tag LOCUS_49310 286334 287650 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222034.1 protein_id gnl|my_center|LOCUS_49310 288505 287855 gene locus_tag LOCUS_49320 288505 287855 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222032.1 protein_id gnl|my_center|LOCUS_49320 288948 288610 gene locus_tag LOCUS_49330 288948 288610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 289720 289076 gene locus_tag LOCUS_49340 289720 289076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029884.1 protein_id gnl|my_center|LOCUS_49340 290183 289758 gene locus_tag LOCUS_49350 290183 289758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 290407 290183 gene locus_tag LOCUS_49360 290407 290183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 292367 290376 gene locus_tag LOCUS_49370 292367 290376 CDS product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244990.1 protein_id gnl|my_center|LOCUS_49370 293263 292613 gene locus_tag LOCUS_49380 293263 292613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222031.1 protein_id gnl|my_center|LOCUS_49380 294315 293542 gene locus_tag LOCUS_49390 294315 293542 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731472.1 protein_id gnl|my_center|LOCUS_49390 294495 294851 gene locus_tag LOCUS_49400 gene cmtR 294495 294851 CDS product Cd(II)/Pb(II)-sensing metalloregulatory transcriptional regulator CmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410018.1 protein_id gnl|my_center|LOCUS_49400 294965 295615 gene locus_tag LOCUS_49410 294965 295615 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029057.1 protein_id gnl|my_center|LOCUS_49410 295871 295788 gene locus_tag LOCUS_t00540 295871 295788 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 296090 297529 gene locus_tag LOCUS_49420 296090 297529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 297571 298059 gene locus_tag LOCUS_49430 297571 298059 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003079002.1 protein_id gnl|my_center|LOCUS_49430 298056 299528 gene locus_tag LOCUS_49440 298056 299528 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222007.1 protein_id gnl|my_center|LOCUS_49440 299528 300961 gene locus_tag LOCUS_49450 299528 300961 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222006.1 protein_id gnl|my_center|LOCUS_49450 300958 302421 gene locus_tag LOCUS_49460 300958 302421 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222005.1 protein_id gnl|my_center|LOCUS_49460 302425 303906 gene locus_tag LOCUS_49470 302425 303906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 303917 305911 gene locus_tag LOCUS_49480 gene pknB 303917 305911 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222003.1 protein_id gnl|my_center|LOCUS_49480 >Feature sequence09 3 479 gene locus_tag LOCUS_49490 3 479 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230780.1 protein_id gnl|my_center|LOCUS_49490 944 1117 gene locus_tag LOCUS_49500 944 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49500 1117 1896 gene locus_tag LOCUS_49510 1117 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 1973 3433 gene locus_tag LOCUS_49520 gene purB 1973 3433 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_49520 4461 3457 gene locus_tag LOCUS_49530 4461 3457 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027421.1 protein_id gnl|my_center|LOCUS_49530 5048 4704 gene locus_tag LOCUS_49540 5048 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 4948 5220 gene locus_tag LOCUS_49550 4948 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 5272 6459 gene locus_tag LOCUS_49560 5272 6459 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027711.1 protein_id gnl|my_center|LOCUS_49560 7148 6498 gene locus_tag LOCUS_49570 7148 6498 CDS product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993682.1 protein_id gnl|my_center|LOCUS_49570 7245 8138 gene locus_tag LOCUS_49580 7245 8138 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085602.1 protein_id gnl|my_center|LOCUS_49580 8241 9029 gene locus_tag LOCUS_49590 8241 9029 CDS product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208608267.1 protein_id gnl|my_center|LOCUS_49590 9166 9597 gene locus_tag LOCUS_49600 9166 9597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 10321 9683 gene locus_tag LOCUS_49610 10321 9683 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230765.1 protein_id gnl|my_center|LOCUS_49610 10527 10330 gene locus_tag LOCUS_49620 10527 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 11036 10605 gene locus_tag LOCUS_49630 11036 10605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 11961 11173 gene locus_tag LOCUS_49640 11961 11173 CDS product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208608267.1 protein_id gnl|my_center|LOCUS_49640 12957 12064 gene locus_tag LOCUS_49650 12957 12064 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085602.1 protein_id gnl|my_center|LOCUS_49650 13054 13704 gene locus_tag LOCUS_49660 13054 13704 CDS product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993682.1 protein_id gnl|my_center|LOCUS_49660 14930 13743 gene locus_tag LOCUS_49670 14930 13743 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027711.1 protein_id gnl|my_center|LOCUS_49670 15254 14982 gene locus_tag LOCUS_49680 15254 14982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 15154 15498 gene locus_tag LOCUS_49690 15154 15498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49690 15741 16745 gene locus_tag LOCUS_49700 15741 16745 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027421.1 protein_id gnl|my_center|LOCUS_49700 18229 16769 gene locus_tag LOCUS_49710 gene purB 18229 16769 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_49710 19085 18306 gene locus_tag LOCUS_49720 19085 18306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 19627 19085 gene locus_tag LOCUS_49730 19627 19085 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223685.1 protein_id gnl|my_center|LOCUS_49730 20302 19718 gene locus_tag LOCUS_49740 20302 19718 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230780.1 protein_id gnl|my_center|LOCUS_49740 20676 20353 gene locus_tag LOCUS_49750 gene sugE 20676 20353 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228124.1 protein_id gnl|my_center|LOCUS_49750 21525 20869 gene locus_tag LOCUS_49760 21525 20869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 22058 21540 gene locus_tag LOCUS_49770 22058 21540 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230782.1 protein_id gnl|my_center|LOCUS_49770 22289 23242 gene locus_tag LOCUS_49780 22289 23242 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230783.1 protein_id gnl|my_center|LOCUS_49780 23441 23262 gene locus_tag LOCUS_49790 23441 23262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230786.1 protein_id gnl|my_center|LOCUS_49790 24636 23596 gene locus_tag LOCUS_49800 24636 23596 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_49800 24899 27169 gene locus_tag LOCUS_49810 24899 27169 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230913.1 protein_id gnl|my_center|LOCUS_49810 27426 27235 gene locus_tag LOCUS_49820 27426 27235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 27739 28749 gene locus_tag LOCUS_49830 27739 28749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 29015 29524 gene locus_tag LOCUS_49840 29015 29524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 31425 29596 gene locus_tag LOCUS_49850 31425 29596 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909000.1 protein_id gnl|my_center|LOCUS_49850 32454 31768 gene locus_tag LOCUS_49860 32454 31768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230960.1 protein_id gnl|my_center|LOCUS_49860 34466 32565 gene locus_tag LOCUS_49870 34466 32565 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230961.1 protein_id gnl|my_center|LOCUS_49870 34924 34463 gene locus_tag LOCUS_49880 34924 34463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 36588 35065 gene locus_tag LOCUS_49890 36588 35065 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742061.1 protein_id gnl|my_center|LOCUS_49890 36762 37145 gene locus_tag LOCUS_49900 36762 37145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 37319 37558 gene locus_tag LOCUS_49910 gene purS 37319 37558 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878466.1 protein_id gnl|my_center|LOCUS_49910 37555 38244 gene locus_tag LOCUS_49920 gene purQ 37555 38244 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230758.1 protein_id gnl|my_center|LOCUS_49920 38241 40544 gene locus_tag LOCUS_49930 gene purL 38241 40544 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230755.1 protein_id gnl|my_center|LOCUS_49930 41478 40795 gene locus_tag LOCUS_49940 41478 40795 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230751.1 protein_id gnl|my_center|LOCUS_49940 41849 44119 gene locus_tag LOCUS_49950 gene rmdA 41849 44119 CDS product cyclic Di-GMP phosphodiesterase RmdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027451.1 protein_id gnl|my_center|LOCUS_49950 45017 44163 gene locus_tag LOCUS_49960 45017 44163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49960 45360 46583 gene locus_tag LOCUS_49970 45360 46583 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840295.1 protein_id gnl|my_center|LOCUS_49970 48052 46706 gene locus_tag LOCUS_49980 48052 46706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49980 49275 48253 gene locus_tag LOCUS_49990 49275 48253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 49535 50701 gene locus_tag LOCUS_50000 49535 50701 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231015.1 protein_id gnl|my_center|LOCUS_50000 51926 50730 gene locus_tag LOCUS_50010 51926 50730 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228763.1 protein_id gnl|my_center|LOCUS_50010 52102 53343 gene locus_tag LOCUS_50020 52102 53343 CDS product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231016.1 protein_id gnl|my_center|LOCUS_50020 53340 54002 gene locus_tag LOCUS_50030 53340 54002 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231017.1 protein_id gnl|my_center|LOCUS_50030 55797 54184 gene locus_tag LOCUS_50040 gene ptsP 55797 54184 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231021.1 protein_id gnl|my_center|LOCUS_50040 56093 56431 gene locus_tag LOCUS_50050 56093 56431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50050 57050 56718 gene locus_tag LOCUS_50060 57050 56718 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028983.1 protein_id gnl|my_center|LOCUS_50060 59234 57069 gene locus_tag LOCUS_50070 59234 57069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 59326 60105 gene locus_tag LOCUS_50080 59326 60105 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231033.1 protein_id gnl|my_center|LOCUS_50080 60167 60634 gene locus_tag LOCUS_50090 60167 60634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 62844 60595 gene locus_tag LOCUS_50100 62844 60595 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978566.1 protein_id gnl|my_center|LOCUS_50100 63211 62894 gene locus_tag LOCUS_50110 63211 62894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 63095 64066 gene locus_tag LOCUS_50120 63095 64066 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862312.1 protein_id gnl|my_center|LOCUS_50120 64653 64078 gene locus_tag LOCUS_50130 64653 64078 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978564.1 protein_id gnl|my_center|LOCUS_50130 64743 65003 gene locus_tag LOCUS_50140 64743 65003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 65083 65376 gene locus_tag LOCUS_50150 65083 65376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 67356 65383 gene locus_tag LOCUS_50160 67356 65383 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229814.1 protein_id gnl|my_center|LOCUS_50160 69071 67614 gene locus_tag LOCUS_50170 69071 67614 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384684.1 protein_id gnl|my_center|LOCUS_50170 69943 70146 gene locus_tag LOCUS_50180 69943 70146 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_50180 70698 70991 gene locus_tag LOCUS_50190 70698 70991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 70988 71980 gene locus_tag LOCUS_50200 70988 71980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 72058 73584 gene locus_tag LOCUS_50210 72058 73584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 73713 74567 gene locus_tag LOCUS_50220 73713 74567 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227989.1 protein_id gnl|my_center|LOCUS_50220 77532 74626 gene locus_tag LOCUS_50230 gene leuS 77532 74626 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231035.1 protein_id gnl|my_center|LOCUS_50230 77969 78349 gene locus_tag LOCUS_50240 77969 78349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50240 78947 78375 gene locus_tag LOCUS_50250 78947 78375 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231038.1 protein_id gnl|my_center|LOCUS_50250 80615 79092 gene locus_tag LOCUS_50260 80615 79092 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231051.1 protein_id gnl|my_center|LOCUS_50260 80685 81242 gene locus_tag LOCUS_50270 80685 81242 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284381.1 protein_id gnl|my_center|LOCUS_50270 81269 83539 gene locus_tag LOCUS_50280 81269 83539 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231053.1 protein_id gnl|my_center|LOCUS_50280 83567 85375 gene locus_tag LOCUS_50290 gene murJ 83567 85375 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231054.1 protein_id gnl|my_center|LOCUS_50290 85473 87044 gene locus_tag LOCUS_50300 85473 87044 CDS product protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231055.1 protein_id gnl|my_center|LOCUS_50300 87224 87832 gene locus_tag LOCUS_50310 gene sigM 87224 87832 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 protein_id gnl|my_center|LOCUS_50310 87829 88596 gene locus_tag LOCUS_50320 87829 88596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231057.1 protein_id gnl|my_center|LOCUS_50320 88721 89725 gene locus_tag LOCUS_50330 gene trxB 88721 89725 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231058.1 protein_id gnl|my_center|LOCUS_50330 89776 90102 gene locus_tag LOCUS_50340 gene trxA 89776 90102 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082899.1 protein_id gnl|my_center|LOCUS_50340 90388 91539 gene locus_tag LOCUS_50350 90388 91539 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231059.1 protein_id gnl|my_center|LOCUS_50350 92232 91606 gene locus_tag LOCUS_50360 92232 91606 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231060.1 protein_id gnl|my_center|LOCUS_50360 92420 93850 gene locus_tag LOCUS_50370 92420 93850 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_50370 93943 94911 gene locus_tag LOCUS_50380 93943 94911 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_50380 95977 94970 gene locus_tag LOCUS_50390 95977 94970 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231063.1 protein_id gnl|my_center|LOCUS_50390 96972 95974 gene locus_tag LOCUS_50400 96972 95974 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225439919.1 protein_id gnl|my_center|LOCUS_50400 97674 96976 gene locus_tag LOCUS_50410 gene rsmG 97674 96976 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231065.1 protein_id gnl|my_center|LOCUS_50410 98437 97880 gene locus_tag LOCUS_50420 98437 97880 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467902.1 protein_id gnl|my_center|LOCUS_50420 99365 98469 gene locus_tag LOCUS_50430 99365 98469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 99648 99373 gene locus_tag LOCUS_50440 99648 99373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 99965 99663 gene locus_tag LOCUS_50450 99965 99663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 100213 100070 gene locus_tag LOCUS_50460 100213 100070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 100876 102600 gene locus_tag LOCUS_50470 gene dnaA 100876 102600 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221955.1 protein_id gnl|my_center|LOCUS_50470 103401 103700 gene locus_tag LOCUS_50480 103401 103700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 103697 104815 gene locus_tag LOCUS_50490 gene dnaN 103697 104815 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221956.1 protein_id gnl|my_center|LOCUS_50490 104864 105763 gene locus_tag LOCUS_50500 gene gnd 104864 105763 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221957.1 protein_id gnl|my_center|LOCUS_50500 105897 107066 gene locus_tag LOCUS_50510 gene recF 105897 107066 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221958.1 protein_id gnl|my_center|LOCUS_50510 107056 107697 gene locus_tag LOCUS_50520 107056 107697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 108033 110006 gene locus_tag LOCUS_50530 gene gyrB 108033 110006 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221960.1 protein_id gnl|my_center|LOCUS_50530 110061 112553 gene locus_tag LOCUS_50540 gene gyrA 110061 112553 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221961.1 protein_id gnl|my_center|LOCUS_50540 112605 113402 gene locus_tag LOCUS_50550 112605 113402 CDS product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221962.1 protein_id gnl|my_center|LOCUS_50550 113740 113814 gene locus_tag LOCUS_t00550 113740 113814 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 114079 114152 gene locus_tag LOCUS_t00560 114079 114152 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 115109 114315 gene locus_tag LOCUS_50560 115109 114315 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081985.1 protein_id gnl|my_center|LOCUS_50560 115704 115081 gene locus_tag LOCUS_50570 115704 115081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 116385 115804 gene locus_tag LOCUS_50580 116385 115804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 116570 117124 gene locus_tag LOCUS_50590 116570 117124 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878080.1 protein_id gnl|my_center|LOCUS_50590 117258 118073 gene locus_tag LOCUS_50600 117258 118073 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221988.1 protein_id gnl|my_center|LOCUS_50600 118497 118075 gene locus_tag LOCUS_50610 118497 118075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 118965 118699 gene locus_tag LOCUS_50620 gene crgA 118965 118699 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221990.1 protein_id gnl|my_center|LOCUS_50620 119273 119914 gene locus_tag LOCUS_50630 119273 119914 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221999.1 protein_id gnl|my_center|LOCUS_50630 122045 120051 gene locus_tag LOCUS_50640 gene pknB 122045 120051 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222003.1 protein_id gnl|my_center|LOCUS_50640 123537 122056 gene locus_tag LOCUS_50650 123537 122056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50650 >Feature sequence10 <1 1002 gene locus_tag LOCUS_50660 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118493.1:replicative DNA helicase 1448 1227 gene locus_tag LOCUS_50670 1448 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50670 1515 2165 gene locus_tag LOCUS_50680 1515 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 3052 2117 gene locus_tag LOCUS_50690 3052 2117 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_50690 3269 3102 gene locus_tag LOCUS_50700 3269 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 3522 4025 gene locus_tag LOCUS_50710 3522 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 4331 4095 gene locus_tag LOCUS_50720 4331 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 4419 4643 gene locus_tag LOCUS_50730 4419 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 4637 4996 gene locus_tag LOCUS_50740 4637 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 5014 5178 gene locus_tag LOCUS_50750 5014 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 5638 5252 gene locus_tag LOCUS_50760 5638 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 5806 6222 gene locus_tag LOCUS_50770 5806 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50770 6528 6325 gene locus_tag LOCUS_50780 6528 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 6415 6936 gene locus_tag LOCUS_50790 6415 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 7085 7678 gene locus_tag LOCUS_50800 7085 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 8277 8768 gene locus_tag LOCUS_50810 8277 8768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 8765 10339 gene locus_tag LOCUS_50820 8765 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 10336 11700 gene locus_tag LOCUS_50830 10336 11700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50830 11742 12110 gene locus_tag LOCUS_50840 11742 12110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 12245 12538 gene locus_tag LOCUS_50850 12245 12538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 12906 12529 gene locus_tag LOCUS_50860 12906 12529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 13164 14156 gene locus_tag LOCUS_50870 13164 14156 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173142140.1 protein_id gnl|my_center|LOCUS_50870 14578 15276 gene locus_tag LOCUS_50880 14578 15276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 15379 15864 gene locus_tag LOCUS_50890 15379 15864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 16000 17244 gene locus_tag LOCUS_50900 16000 17244 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223277.1 protein_id gnl|my_center|LOCUS_50900 18409 17249 gene locus_tag LOCUS_50910 18409 17249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 18897 19367 gene locus_tag LOCUS_50920 18897 19367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 19701 20936 gene locus_tag LOCUS_50930 19701 20936 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209580.1 protein_id gnl|my_center|LOCUS_50930 20969 22363 gene locus_tag LOCUS_50940 20969 22363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 22360 23388 gene locus_tag LOCUS_50950 22360 23388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 23619 23903 gene locus_tag LOCUS_50960 23619 23903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 23908 24915 gene locus_tag LOCUS_50970 23908 24915 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534838.1 protein_id gnl|my_center|LOCUS_50970 24915 26012 gene locus_tag LOCUS_50980 24915 26012 CDS product beta-methylarginine biosynthesis bifunctional aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266203.1 protein_id gnl|my_center|LOCUS_50980 26063 27292 gene locus_tag LOCUS_50990 26063 27292 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973047.1 protein_id gnl|my_center|LOCUS_50990 27329 28477 gene locus_tag LOCUS_51000 27329 28477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 29097 28870 gene locus_tag LOCUS_51010 29097 28870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 45505 29312 gene locus_tag LOCUS_51020 45505 29312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 45960 45541 gene locus_tag LOCUS_51030 45960 45541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 46449 45970 gene locus_tag LOCUS_51040 46449 45970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 48287 46446 gene locus_tag LOCUS_51050 48287 46446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 49810 48284 gene locus_tag LOCUS_51060 49810 48284 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080790597.1 protein_id gnl|my_center|LOCUS_51060 51281 49800 gene locus_tag LOCUS_51070 51281 49800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068083.1 protein_id gnl|my_center|LOCUS_51070 52579 51278 gene locus_tag LOCUS_51080 52579 51278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51080 53259 52579 gene locus_tag LOCUS_51090 53259 52579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 53569 53273 gene locus_tag LOCUS_51100 53569 53273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51100 54103 53588 gene locus_tag LOCUS_51110 54103 53588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 54306 54881 gene locus_tag LOCUS_51120 54306 54881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 54878 55900 gene locus_tag LOCUS_51130 54878 55900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51130 56139 56774 gene locus_tag LOCUS_51140 56139 56774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51140 56778 57197 gene locus_tag LOCUS_51150 56778 57197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51150 57194 57781 gene locus_tag LOCUS_51160 57194 57781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052776.1 protein_id gnl|my_center|LOCUS_51160 58335 58075 gene locus_tag LOCUS_51170 58335 58075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 59660 58623 gene locus_tag LOCUS_51180 59660 58623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 59783 60013 gene locus_tag LOCUS_51190 59783 60013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 60084 60668 gene locus_tag LOCUS_51200 60084 60668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51200 60705 61301 gene locus_tag LOCUS_51210 60705 61301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 61531 61298 gene locus_tag LOCUS_51220 61531 61298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51220 61869 62057 gene locus_tag LOCUS_51230 61869 62057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 63058 62081 gene locus_tag LOCUS_51240 63058 62081 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083539905.1 protein_id gnl|my_center|LOCUS_51240 63755 64021 gene locus_tag LOCUS_51250 63755 64021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51250 65241 63955 gene locus_tag LOCUS_51260 65241 63955 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815826.1 protein_id gnl|my_center|LOCUS_51260 65498 65361 gene locus_tag LOCUS_51270 65498 65361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 65682 67067 gene locus_tag LOCUS_51280 65682 67067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51280 67998 67147 gene locus_tag LOCUS_51290 67998 67147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 68751 68239 gene locus_tag LOCUS_51300 68751 68239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 69576 69133 gene locus_tag LOCUS_51310 69576 69133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 69536 69796 gene locus_tag LOCUS_51320 69536 69796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 70603 69905 gene locus_tag LOCUS_51330 70603 69905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51330 71298 71023 gene locus_tag LOCUS_51340 71298 71023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 71585 71304 gene locus_tag LOCUS_51350 71585 71304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 72120 71575 gene locus_tag LOCUS_51360 72120 71575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 72276 73139 gene locus_tag LOCUS_51370 72276 73139 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_51370 73136 73336 gene locus_tag LOCUS_51380 73136 73336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51380 74113 73724 gene locus_tag LOCUS_51390 74113 73724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 76432 74120 gene locus_tag LOCUS_51400 76432 74120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51400 76849 76436 gene locus_tag LOCUS_51410 76849 76436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 77178 76849 gene locus_tag LOCUS_51420 77178 76849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 77663 77175 gene locus_tag LOCUS_51430 77663 77175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51430 77946 77656 gene locus_tag LOCUS_51440 77946 77656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 78302 77943 gene locus_tag LOCUS_51450 78302 77943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 79662 78466 gene locus_tag LOCUS_51460 79662 78466 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 protein_id gnl|my_center|LOCUS_51460 80943 79696 gene locus_tag LOCUS_51470 80943 79696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223893.1 protein_id gnl|my_center|LOCUS_51470 81500 80958 gene locus_tag LOCUS_51480 81500 80958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223694.1 protein_id gnl|my_center|LOCUS_51480 81835 81500 gene locus_tag LOCUS_51490 81835 81500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 82173 83489 gene locus_tag LOCUS_51500 82173 83489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51500 83612 84640 gene locus_tag LOCUS_51510 83612 84640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51510 85445 84867 gene locus_tag LOCUS_51520 85445 84867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51520 86329 85661 gene locus_tag LOCUS_51530 86329 85661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 86635 86474 gene locus_tag LOCUS_51540 86635 86474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 89212 86768 gene locus_tag LOCUS_51550 89212 86768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 90617 89289 gene locus_tag LOCUS_51560 90617 89289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 91280 90630 gene locus_tag LOCUS_51570 91280 90630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51570 92701 91277 gene locus_tag LOCUS_51580 92701 91277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 92961 92698 gene locus_tag LOCUS_51590 92961 92698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 93470 94237 gene locus_tag LOCUS_51600 93470 94237 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972171.1 protein_id gnl|my_center|LOCUS_51600 94234 95013 gene locus_tag LOCUS_51610 94234 95013 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030154.1 protein_id gnl|my_center|LOCUS_51610 95010 95387 gene locus_tag LOCUS_51620 95010 95387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 97689 98093 gene locus_tag LOCUS_51630 97689 98093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 98164 99603 gene locus_tag LOCUS_51640 gene dnaB 98164 99603 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231009.1 protein_id gnl|my_center|LOCUS_51640 100049 99828 gene locus_tag LOCUS_51650 100049 99828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 100116 100766 gene locus_tag LOCUS_51660 100116 100766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 <101391 100718 gene locus_tag LOCUS_51670 <101391 100718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389684.1:AAA family ATPase >Feature sequence11 255 536 gene locus_tag LOCUS_51680 255 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 569 871 gene locus_tag LOCUS_51690 569 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 989 1258 gene locus_tag LOCUS_51700 989 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 1350 1595 gene locus_tag LOCUS_51710 1350 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51710 1645 1899 gene locus_tag LOCUS_51720 1645 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 2051 2329 gene locus_tag LOCUS_51730 2051 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51730 2393 3106 gene locus_tag LOCUS_51740 2393 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 3176 4024 gene locus_tag LOCUS_51750 3176 4024 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977680.1 protein_id gnl|my_center|LOCUS_51750 4261 4647 gene locus_tag LOCUS_51760 4261 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 4748 6169 gene locus_tag LOCUS_51770 4748 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 6241 6840 gene locus_tag LOCUS_51780 6241 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51780 6876 7613 gene locus_tag LOCUS_51790 6876 7613 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030642.1 protein_id gnl|my_center|LOCUS_51790 8068 8283 gene locus_tag LOCUS_51800 8068 8283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 8400 8582 gene locus_tag LOCUS_51810 8400 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51810 8697 8870 gene locus_tag LOCUS_51820 8697 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 9079 9258 gene locus_tag LOCUS_51830 9079 9258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 9255 9872 gene locus_tag LOCUS_51840 9255 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 9869 10312 gene locus_tag LOCUS_51850 9869 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211831857.1 protein_id gnl|my_center|LOCUS_51850 10330 10821 gene locus_tag LOCUS_51860 10330 10821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 10818 11363 gene locus_tag LOCUS_51870 10818 11363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51870 11360 11788 gene locus_tag LOCUS_51880 11360 11788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 12215 11901 gene locus_tag LOCUS_51890 12215 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 12312 14255 gene locus_tag LOCUS_51900 12312 14255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 14358 16103 gene locus_tag LOCUS_51910 14358 16103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 16220 18643 gene locus_tag LOCUS_51920 16220 18643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 19070 18747 gene locus_tag LOCUS_51930 19070 18747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51930 19181 19810 gene locus_tag LOCUS_51940 19181 19810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51940 >Feature sequence12 859 386 gene locus_tag LOCUS_51950 859 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 1131 901 gene locus_tag LOCUS_51960 1131 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 1692 1144 gene locus_tag LOCUS_51970 1692 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 2164 1763 gene locus_tag LOCUS_51980 2164 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51980 2860 2252 gene locus_tag LOCUS_51990 2860 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51990 3105 2857 gene locus_tag LOCUS_52000 3105 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 3473 3102 gene locus_tag LOCUS_52010 3473 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 3967 3494 gene locus_tag LOCUS_52020 3967 3494 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227956.1 protein_id gnl|my_center|LOCUS_52020 4452 4057 gene locus_tag LOCUS_52030 4452 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 4955 4518 gene locus_tag LOCUS_52040 4955 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52040 5261 4968 gene locus_tag LOCUS_52050 5261 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 5383 6177 gene locus_tag LOCUS_52060 5383 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 6544 6257 gene locus_tag LOCUS_52070 6544 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52070 6817 7266 gene locus_tag LOCUS_52080 6817 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 7295 8122 gene locus_tag LOCUS_52090 7295 8122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 >Feature sequence13 873 292 gene locus_tag LOCUS_52100 873 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52100 1688 870 gene locus_tag LOCUS_52110 1688 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 1692 1946 gene locus_tag LOCUS_52120 1692 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52120 2162 2004 gene locus_tag LOCUS_52130 2162 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52130 2735 2295 gene locus_tag LOCUS_52140 2735 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 3094 2735 gene locus_tag LOCUS_52150 3094 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52150 3814 3398 gene locus_tag LOCUS_52160 3814 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 5082 4105 gene locus_tag LOCUS_52170 5082 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 5560 5324 gene locus_tag LOCUS_52180 5560 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 5814 6527 gene locus_tag LOCUS_52190 5814 6527 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228838.1 protein_id gnl|my_center|LOCUS_52190 8668 6524 gene locus_tag LOCUS_52200 8668 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52200 8011 8105 gene locus_tag LOCUS_t00570 8011 8105 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 9156 8665 gene locus_tag LOCUS_52210 9156 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52210 >Feature sequence14 2083 3465 gene locus_tag LOCUS_52220 2083 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52220 3467 4645 gene locus_tag LOCUS_52230 3467 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 4638 4886 gene locus_tag LOCUS_52240 4638 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52240 4879 6795 gene locus_tag LOCUS_52250 4879 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 7378 6905 gene locus_tag LOCUS_52260 7378 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 7650 7420 gene locus_tag LOCUS_52270 7650 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52270 8211 7663 gene locus_tag LOCUS_52280 8211 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 8683 8282 gene locus_tag LOCUS_52290 8683 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52290 >Feature sequence15 2476 1049 gene locus_tag LOCUS_52300 2476 1049 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275275.1 protein_id gnl|my_center|LOCUS_52300 3110 2478 gene locus_tag LOCUS_52310 3110 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 4546 3107 gene locus_tag LOCUS_52320 4546 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 4792 4550 gene locus_tag LOCUS_52330 4792 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 5448 4828 gene locus_tag LOCUS_52340 5448 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 >Feature sequence16 2362 2147 gene locus_tag LOCUS_52350 2362 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 2543 2367 gene locus_tag LOCUS_52360 2543 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 4158 2548 gene locus_tag LOCUS_52370 4158 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52370