>Feature sequence01 402 650 gene locus_tag LOCUS_00010 402 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 654 1613 gene locus_tag LOCUS_00020 654 1613 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941847.1 protein_id gnl|my_center|LOCUS_00020 2865 1636 gene locus_tag LOCUS_00030 2865 1636 CDS product DUF4236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506893.1 protein_id gnl|my_center|LOCUS_00030 3485 3018 gene locus_tag LOCUS_00040 3485 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3542 4474 gene locus_tag LOCUS_00050 gene nfo 3542 4474 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097964.1 protein_id gnl|my_center|LOCUS_00050 4471 4959 gene locus_tag LOCUS_00060 4471 4959 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119093.1 protein_id gnl|my_center|LOCUS_00060 5059 6054 gene locus_tag LOCUS_00070 5059 6054 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039499.1 protein_id gnl|my_center|LOCUS_00070 6055 6597 gene locus_tag LOCUS_00080 6055 6597 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731582.1 protein_id gnl|my_center|LOCUS_00080 6594 7853 gene locus_tag LOCUS_00090 6594 7853 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820128.1 protein_id gnl|my_center|LOCUS_00090 7943 8140 gene locus_tag LOCUS_00100 7943 8140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 8792 8172 gene locus_tag LOCUS_00110 8792 8172 CDS product DUF938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525148.1 protein_id gnl|my_center|LOCUS_00110 9919 8843 gene locus_tag LOCUS_00120 9919 8843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10487 10071 gene locus_tag LOCUS_00130 10487 10071 CDS product DUF2703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940568.1 protein_id gnl|my_center|LOCUS_00130 10974 10513 gene locus_tag LOCUS_00140 10974 10513 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819879.1 protein_id gnl|my_center|LOCUS_00140 11156 13924 gene locus_tag LOCUS_00150 11156 13924 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 protein_id gnl|my_center|LOCUS_00150 16377 13927 gene locus_tag LOCUS_00160 gene hrpB 16377 13927 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114322.1 protein_id gnl|my_center|LOCUS_00160 16464 17480 gene locus_tag LOCUS_00170 16464 17480 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070877.1 protein_id gnl|my_center|LOCUS_00170 17477 18694 gene locus_tag LOCUS_00180 gene arsJ 17477 18694 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712457.1 protein_id gnl|my_center|LOCUS_00180 19346 18666 gene locus_tag LOCUS_00190 19346 18666 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770041.1 protein_id gnl|my_center|LOCUS_00190 19545 21032 gene locus_tag LOCUS_00200 gene xdhA 19545 21032 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083347.1 protein_id gnl|my_center|LOCUS_00200 21016 23568 gene locus_tag LOCUS_00210 gene xdhB 21016 23568 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_00210 23565 24449 gene locus_tag LOCUS_00220 gene xdhC 23565 24449 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083344.1 protein_id gnl|my_center|LOCUS_00220 24540 25865 gene locus_tag LOCUS_00230 gene guaD 24540 25865 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189962.1 protein_id gnl|my_center|LOCUS_00230 25947 27359 gene locus_tag LOCUS_00240 25947 27359 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189169.1 protein_id gnl|my_center|LOCUS_00240 27789 27439 gene locus_tag LOCUS_00250 27789 27439 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196851.1 protein_id gnl|my_center|LOCUS_00250 28435 27827 gene locus_tag LOCUS_00260 28435 27827 CDS product sulfoxide reductase heme-binding subunit YedZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388352.1 protein_id gnl|my_center|LOCUS_00260 29417 28452 gene locus_tag LOCUS_00270 gene msrP 29417 28452 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388351.1 protein_id gnl|my_center|LOCUS_00270 29654 30643 gene locus_tag LOCUS_00280 29654 30643 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_00280 31747 30752 gene locus_tag LOCUS_00290 31747 30752 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388524.1 protein_id gnl|my_center|LOCUS_00290 33954 31978 gene locus_tag LOCUS_00300 33954 31978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388856.1 protein_id gnl|my_center|LOCUS_00300 35772 34030 gene locus_tag LOCUS_00310 gene cydC 35772 34030 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706826.1 protein_id gnl|my_center|LOCUS_00310 37447 35765 gene locus_tag LOCUS_00320 gene cydD 37447 35765 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929714.1 protein_id gnl|my_center|LOCUS_00320 38453 37452 gene locus_tag LOCUS_00330 gene cydB 38453 37452 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974381.1 protein_id gnl|my_center|LOCUS_00330 39875 38457 gene locus_tag LOCUS_00340 gene cioA 39875 38457 CDS product cyanide-insensitive cytochrome bd quinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103027.1 protein_id gnl|my_center|LOCUS_00340 41157 40174 gene locus_tag LOCUS_00350 41157 40174 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_00350 41287 42705 gene locus_tag LOCUS_00360 41287 42705 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707506.1 protein_id gnl|my_center|LOCUS_00360 42702 44381 gene locus_tag LOCUS_00370 gene pqiB 42702 44381 CDS product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211290.1 protein_id gnl|my_center|LOCUS_00370 44415 45017 gene locus_tag LOCUS_00380 44415 45017 CDS product PqiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707504.1 protein_id gnl|my_center|LOCUS_00380 45114 45641 gene locus_tag LOCUS_00390 45114 45641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 45793 47127 gene locus_tag LOCUS_00400 45793 47127 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_00400 47197 47745 gene locus_tag LOCUS_00410 47197 47745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 47738 48952 gene locus_tag LOCUS_00420 47738 48952 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114593.1 protein_id gnl|my_center|LOCUS_00420 49364 48942 gene locus_tag LOCUS_00430 49364 48942 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167645.1 protein_id gnl|my_center|LOCUS_00430 49571 50494 gene locus_tag LOCUS_00440 gene rdgC 49571 50494 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115570.1 protein_id gnl|my_center|LOCUS_00440 50500 51669 gene locus_tag LOCUS_00450 50500 51669 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114706.1 protein_id gnl|my_center|LOCUS_00450 51687 52871 gene locus_tag LOCUS_00460 51687 52871 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958179.1 protein_id gnl|my_center|LOCUS_00460 52973 53653 gene locus_tag LOCUS_00470 52973 53653 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809046.1 protein_id gnl|my_center|LOCUS_00470 53663 55582 gene locus_tag LOCUS_00480 53663 55582 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112436.1 protein_id gnl|my_center|LOCUS_00480 56217 55879 gene locus_tag LOCUS_00490 56217 55879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 58601 56352 gene locus_tag LOCUS_00500 58601 56352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 60616 58598 gene locus_tag LOCUS_00510 60616 58598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 58627 58724 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 62680 60818 gene locus_tag LOCUS_00520 62680 60818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 61937 62034 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 63419 62796 gene locus_tag LOCUS_00530 63419 62796 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809051.1 protein_id gnl|my_center|LOCUS_00530 64849 63419 gene locus_tag LOCUS_00540 64849 63419 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809053.1 protein_id gnl|my_center|LOCUS_00540 67020 64849 gene locus_tag LOCUS_00550 67020 64849 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 protein_id gnl|my_center|LOCUS_00550 69095 67101 gene locus_tag LOCUS_00560 69095 67101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 69502 69783 gene locus_tag LOCUS_00570 69502 69783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 69916 71412 gene locus_tag LOCUS_00580 gene thiI 69916 71412 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095844.1 protein_id gnl|my_center|LOCUS_00580 71500 74670 gene locus_tag LOCUS_00590 71500 74670 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707626.1 protein_id gnl|my_center|LOCUS_00590 74725 75354 gene locus_tag LOCUS_00600 74725 75354 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144355.1 protein_id gnl|my_center|LOCUS_00600 75734 75465 gene locus_tag LOCUS_00610 75734 75465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 75954 77996 gene locus_tag LOCUS_00620 gene metG 75954 77996 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706089.1 protein_id gnl|my_center|LOCUS_00620 78004 78777 gene locus_tag LOCUS_00630 78004 78777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 79069 79704 gene locus_tag LOCUS_00640 gene nth 79069 79704 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210602.1 protein_id gnl|my_center|LOCUS_00640 79759 80406 gene locus_tag LOCUS_00650 gene rsxG 79759 80406 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_00650 80495 81571 gene locus_tag LOCUS_00660 80495 81571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 81571 82347 gene locus_tag LOCUS_00670 81571 82347 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268978.1 protein_id gnl|my_center|LOCUS_00670 83392 82385 gene locus_tag LOCUS_00680 83392 82385 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_00680 83702 83400 gene locus_tag LOCUS_00690 83702 83400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 85396 83720 gene locus_tag LOCUS_00700 85396 83720 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 protein_id gnl|my_center|LOCUS_00700 85614 85898 gene locus_tag LOCUS_00710 85614 85898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 86579 85902 gene locus_tag LOCUS_00720 86579 85902 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 protein_id gnl|my_center|LOCUS_00720 86714 87085 gene locus_tag LOCUS_00730 86714 87085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 87085 89148 gene locus_tag LOCUS_00740 87085 89148 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338328.1 protein_id gnl|my_center|LOCUS_00740 89132 89380 gene locus_tag LOCUS_00750 89132 89380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 89400 92138 gene locus_tag LOCUS_00760 89400 92138 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092687825.1 protein_id gnl|my_center|LOCUS_00760 93311 92184 gene locus_tag LOCUS_00770 93311 92184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 93765 93463 gene locus_tag LOCUS_00780 93765 93463 CDS product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707539.1 protein_id gnl|my_center|LOCUS_00780 95064 93844 gene locus_tag LOCUS_00790 95064 93844 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_00790 95232 95900 gene locus_tag LOCUS_00800 gene rnt 95232 95900 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 protein_id gnl|my_center|LOCUS_00800 96485 96150 gene locus_tag LOCUS_00810 gene grxD 96485 96150 CDS product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108172.1 protein_id gnl|my_center|LOCUS_00810 96638 97558 gene locus_tag LOCUS_00820 gene argF 96638 97558 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104892.1 protein_id gnl|my_center|LOCUS_00820 97674 97979 gene locus_tag LOCUS_00830 97674 97979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 98238 98163 gene locus_tag LOCUS_t00010 98238 98163 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 98435 99082 gene locus_tag LOCUS_00840 gene uvrY 98435 99082 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090351.1 protein_id gnl|my_center|LOCUS_00840 99093 100907 gene locus_tag LOCUS_00850 gene uvrC 99093 100907 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_00850 100401 100491 gene locus_tag LOCUS_t00020 100401 100491 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 100981 101529 gene locus_tag LOCUS_00860 gene pgsA 100981 101529 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_00860 101591 101665 gene locus_tag LOCUS_t00030 101591 101665 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 101702 101775 gene locus_tag LOCUS_t00040 101702 101775 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 101805 101891 gene locus_tag LOCUS_t00050 101805 101891 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 101951 103111 gene locus_tag LOCUS_00870 101951 103111 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200870.1 protein_id gnl|my_center|LOCUS_00870 103092 104672 gene locus_tag LOCUS_00880 gene nadB 103092 104672 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_00880 105127 104735 gene locus_tag LOCUS_00890 105127 104735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 105389 105096 gene locus_tag LOCUS_00900 105389 105096 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085532.1 protein_id gnl|my_center|LOCUS_00900 105591 105887 gene locus_tag LOCUS_00910 gene ihfB 105591 105887 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072380.1 protein_id gnl|my_center|LOCUS_00910 105933 106238 gene locus_tag LOCUS_00920 105933 106238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 106240 107421 gene locus_tag LOCUS_00930 gene lapB 106240 107421 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 protein_id gnl|my_center|LOCUS_00930 108124 107429 gene locus_tag LOCUS_00940 gene pyrF 108124 107429 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210613.1 protein_id gnl|my_center|LOCUS_00940 108379 108660 gene locus_tag LOCUS_00950 108379 108660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 108782 108791 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 108915 108828 gene locus_tag LOCUS_t00060 108915 108828 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 109686 108925 gene locus_tag LOCUS_00960 109686 108925 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 protein_id gnl|my_center|LOCUS_00960 109919 110455 gene locus_tag LOCUS_00970 gene fxsA 109919 110455 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768585.1 protein_id gnl|my_center|LOCUS_00970 110677 110970 gene locus_tag LOCUS_00980 110677 110970 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026276.1 protein_id gnl|my_center|LOCUS_00980 111063 112706 gene locus_tag LOCUS_00990 gene groL 111063 112706 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368665.1 protein_id gnl|my_center|LOCUS_00990 112909 113649 gene locus_tag LOCUS_01000 gene trmJ 112909 113649 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217034.1 protein_id gnl|my_center|LOCUS_01000 115183 113798 gene locus_tag LOCUS_01010 115183 113798 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114813.1 protein_id gnl|my_center|LOCUS_01010 116540 115524 gene locus_tag LOCUS_01020 116540 115524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 117653 116607 gene locus_tag LOCUS_01030 gene ilvE 117653 116607 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_01030 118807 117578 gene locus_tag LOCUS_01040 118807 117578 CDS product class II histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532992.1 protein_id gnl|my_center|LOCUS_01040 119745 118804 gene locus_tag LOCUS_01050 119745 118804 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434787.1 protein_id gnl|my_center|LOCUS_01050 120103 119747 gene locus_tag LOCUS_01060 120103 119747 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813850.1 protein_id gnl|my_center|LOCUS_01060 121189 120155 gene locus_tag LOCUS_01070 121189 120155 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532102.1 protein_id gnl|my_center|LOCUS_01070 122478 121201 gene locus_tag LOCUS_01080 122478 121201 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969469.1 protein_id gnl|my_center|LOCUS_01080 123020 122475 gene locus_tag LOCUS_01090 123020 122475 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731582.1 protein_id gnl|my_center|LOCUS_01090 124154 123087 gene locus_tag LOCUS_01100 124154 123087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 125121 124303 gene locus_tag LOCUS_01110 125121 124303 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544598.1 protein_id gnl|my_center|LOCUS_01110 126453 125158 gene locus_tag LOCUS_01120 126453 125158 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975184.1 protein_id gnl|my_center|LOCUS_01120 126995 126453 gene locus_tag LOCUS_01130 126995 126453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 128054 127080 gene locus_tag LOCUS_01140 gene dctP 128054 127080 CDS product TRAP transporter solute-binding subunit DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476112.1 protein_id gnl|my_center|LOCUS_01140 128334 129107 gene locus_tag LOCUS_01150 128334 129107 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095557.1 protein_id gnl|my_center|LOCUS_01150 129981 129082 gene locus_tag LOCUS_01160 129981 129082 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931595.1 protein_id gnl|my_center|LOCUS_01160 130133 131338 gene locus_tag LOCUS_01170 130133 131338 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267114.1 protein_id gnl|my_center|LOCUS_01170 131365 132291 gene locus_tag LOCUS_01180 131365 132291 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807822.1 protein_id gnl|my_center|LOCUS_01180 133069 132371 gene locus_tag LOCUS_01190 133069 132371 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228783.1 protein_id gnl|my_center|LOCUS_01190 133238 134818 gene locus_tag LOCUS_01200 133238 134818 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084030.1 protein_id gnl|my_center|LOCUS_01200 134927 135904 gene locus_tag LOCUS_01210 134927 135904 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084029.1 protein_id gnl|my_center|LOCUS_01210 135901 136737 gene locus_tag LOCUS_01220 135901 136737 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173684.1 protein_id gnl|my_center|LOCUS_01220 136747 138381 gene locus_tag LOCUS_01230 136747 138381 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965309.1 protein_id gnl|my_center|LOCUS_01230 138374 139807 gene locus_tag LOCUS_01240 138374 139807 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244205.1 protein_id gnl|my_center|LOCUS_01240 139817 140746 gene locus_tag LOCUS_01250 139817 140746 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230608.1 protein_id gnl|my_center|LOCUS_01250 140743 141189 gene locus_tag LOCUS_01260 140743 141189 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391205.1 protein_id gnl|my_center|LOCUS_01260 141223 142329 gene locus_tag LOCUS_01270 141223 142329 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974867.1 protein_id gnl|my_center|LOCUS_01270 142638 142375 gene locus_tag LOCUS_01280 142638 142375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 142917 142735 gene locus_tag LOCUS_01290 142917 142735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 143085 144293 gene locus_tag LOCUS_01300 143085 144293 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_01300 145021 144299 gene locus_tag LOCUS_01310 145021 144299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 146583 145087 gene locus_tag LOCUS_01320 146583 145087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 146794 149091 gene locus_tag LOCUS_01330 146794 149091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 149088 149633 gene locus_tag LOCUS_01340 149088 149633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 149748 150308 gene locus_tag LOCUS_01350 149748 150308 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943415.1 protein_id gnl|my_center|LOCUS_01350 150305 151630 gene locus_tag LOCUS_01360 150305 151630 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064836.1 protein_id gnl|my_center|LOCUS_01360 151786 152946 gene locus_tag LOCUS_01370 151786 152946 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941380.1 protein_id gnl|my_center|LOCUS_01370 153910 153017 gene locus_tag LOCUS_01380 153910 153017 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966578.1 protein_id gnl|my_center|LOCUS_01380 154033 154737 gene locus_tag LOCUS_01390 154033 154737 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304053.1 protein_id gnl|my_center|LOCUS_01390 154734 155468 gene locus_tag LOCUS_01400 154734 155468 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 protein_id gnl|my_center|LOCUS_01400 155492 156310 gene locus_tag LOCUS_01410 155492 156310 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966748.1 protein_id gnl|my_center|LOCUS_01410 157014 156430 gene locus_tag LOCUS_01420 gene idi 157014 156430 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890634.1 protein_id gnl|my_center|LOCUS_01420 158191 157043 gene locus_tag LOCUS_01430 158191 157043 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144046.1 protein_id gnl|my_center|LOCUS_01430 159345 158353 gene locus_tag LOCUS_01440 159345 158353 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073534.1 protein_id gnl|my_center|LOCUS_01440 159465 160406 gene locus_tag LOCUS_01450 159465 160406 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073535.1 protein_id gnl|my_center|LOCUS_01450 160669 161838 gene locus_tag LOCUS_01460 160669 161838 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946749.1 protein_id gnl|my_center|LOCUS_01460 162000 163607 gene locus_tag LOCUS_01470 gene liuB 162000 163607 CDS product methylcrotonyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100387.1 protein_id gnl|my_center|LOCUS_01470 163625 164488 gene locus_tag LOCUS_01480 163625 164488 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477148.1 protein_id gnl|my_center|LOCUS_01480 164485 166536 gene locus_tag LOCUS_01490 164485 166536 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929810.1 protein_id gnl|my_center|LOCUS_01490 166541 167440 gene locus_tag LOCUS_01500 gene liuE 166541 167440 CDS product bifunctional 3-hydroxy-3-isohexenylglutaryl-CoA lyase/hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088593.1 protein_id gnl|my_center|LOCUS_01500 169014 167638 gene locus_tag LOCUS_01510 169014 167638 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705005.1 protein_id gnl|my_center|LOCUS_01510 169048 169269 gene locus_tag LOCUS_01520 169048 169269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 170963 169341 gene locus_tag LOCUS_01530 170963 169341 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551607.1 protein_id gnl|my_center|LOCUS_01530 177232 170969 gene locus_tag LOCUS_01540 177232 170969 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970454.1 protein_id gnl|my_center|LOCUS_01540 180701 177264 gene locus_tag LOCUS_01550 180701 177264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 181434 180925 gene locus_tag LOCUS_01560 181434 180925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 182166 181666 gene locus_tag LOCUS_01570 182166 181666 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943074.1 protein_id gnl|my_center|LOCUS_01570 183070 182369 gene locus_tag LOCUS_01580 183070 182369 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707332.1 protein_id gnl|my_center|LOCUS_01580 183687 183082 gene locus_tag LOCUS_01590 183687 183082 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268298.1 protein_id gnl|my_center|LOCUS_01590 183783 185180 gene locus_tag LOCUS_01600 183783 185180 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167297427.1 protein_id gnl|my_center|LOCUS_01600 185367 185714 gene locus_tag LOCUS_01610 185367 185714 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088099.1 protein_id gnl|my_center|LOCUS_01610 186025 185777 gene locus_tag LOCUS_01620 186025 185777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 187242 186022 gene locus_tag LOCUS_01630 187242 186022 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943072.1 protein_id gnl|my_center|LOCUS_01630 189248 187239 gene locus_tag LOCUS_01640 189248 187239 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228884.1 protein_id gnl|my_center|LOCUS_01640 190966 189245 gene locus_tag LOCUS_01650 gene acsA 190966 189245 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862049.1 protein_id gnl|my_center|LOCUS_01650 193399 191177 gene locus_tag LOCUS_01660 193399 191177 CDS product OsmC domain/YcaO domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206168.1 protein_id gnl|my_center|LOCUS_01660 193570 194880 gene locus_tag LOCUS_01670 193570 194880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 196056 195028 gene locus_tag LOCUS_01680 196056 195028 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965886.1 protein_id gnl|my_center|LOCUS_01680 196181 196834 gene locus_tag LOCUS_01690 196181 196834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 197724 196846 gene locus_tag LOCUS_01700 197724 196846 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989572.1 protein_id gnl|my_center|LOCUS_01700 197969 197769 gene locus_tag LOCUS_01710 197969 197769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 198909 198220 gene locus_tag LOCUS_01720 198909 198220 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_01720 199032 199202 gene locus_tag LOCUS_01730 199032 199202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 200578 199199 gene locus_tag LOCUS_01740 200578 199199 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_01740 201749 203332 gene locus_tag LOCUS_01750 201749 203332 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242442.1 protein_id gnl|my_center|LOCUS_01750 204910 203357 gene locus_tag LOCUS_01760 204910 203357 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106349.1 protein_id gnl|my_center|LOCUS_01760 206074 205055 gene locus_tag LOCUS_01770 206074 205055 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525362.1 protein_id gnl|my_center|LOCUS_01770 206176 207261 gene locus_tag LOCUS_01780 206176 207261 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411622.1 protein_id gnl|my_center|LOCUS_01780 207367 208272 gene locus_tag LOCUS_01790 207367 208272 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816754.1 protein_id gnl|my_center|LOCUS_01790 209923 208280 gene locus_tag LOCUS_01800 209923 208280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 210421 210068 gene locus_tag LOCUS_01810 210421 210068 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 protein_id gnl|my_center|LOCUS_01810 210828 210418 gene locus_tag LOCUS_01820 210828 210418 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_01820 211670 210825 gene locus_tag LOCUS_01830 211670 210825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 213008 211761 gene locus_tag LOCUS_01840 213008 211761 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 protein_id gnl|my_center|LOCUS_01840 213130 213564 gene locus_tag LOCUS_01850 213130 213564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 214374 213580 gene locus_tag LOCUS_01860 214374 213580 CDS product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192322.1 protein_id gnl|my_center|LOCUS_01860 215015 214371 gene locus_tag LOCUS_01870 215015 214371 CDS product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192970.1 protein_id gnl|my_center|LOCUS_01870 214984 215187 gene locus_tag LOCUS_01880 214984 215187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 215738 215157 gene locus_tag LOCUS_01890 215738 215157 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530047.1 protein_id gnl|my_center|LOCUS_01890 217599 215878 gene locus_tag LOCUS_01900 217599 215878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 217813 218436 gene locus_tag LOCUS_01910 217813 218436 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921316.1 protein_id gnl|my_center|LOCUS_01910 219376 218447 gene locus_tag LOCUS_01920 219376 218447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 220584 219373 gene locus_tag LOCUS_01930 220584 219373 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123736.1 protein_id gnl|my_center|LOCUS_01930 221381 220584 gene locus_tag LOCUS_01940 221381 220584 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_01940 222373 221381 gene locus_tag LOCUS_01950 222373 221381 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427752.1 protein_id gnl|my_center|LOCUS_01950 223568 222510 gene locus_tag LOCUS_01960 gene gntR 223568 222510 CDS product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209514.1 protein_id gnl|my_center|LOCUS_01960 224076 223558 gene locus_tag LOCUS_01970 224076 223558 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208329.1 protein_id gnl|my_center|LOCUS_01970 225374 224091 gene locus_tag LOCUS_01980 225374 224091 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395804.1 protein_id gnl|my_center|LOCUS_01980 226007 225378 gene locus_tag LOCUS_01990 226007 225378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 227193 226108 gene locus_tag LOCUS_02000 227193 226108 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253036.1 protein_id gnl|my_center|LOCUS_02000 228479 227427 gene locus_tag LOCUS_02010 228479 227427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 229612 228479 gene locus_tag LOCUS_02020 229612 228479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 229986 229642 gene locus_tag LOCUS_02030 229986 229642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 230168 230641 gene locus_tag LOCUS_02040 230168 230641 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974302.1 protein_id gnl|my_center|LOCUS_02040 231013 230717 gene locus_tag LOCUS_02050 231013 230717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 230915 231919 gene locus_tag LOCUS_02060 230915 231919 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940512.1 protein_id gnl|my_center|LOCUS_02060 231916 233955 gene locus_tag LOCUS_02070 231916 233955 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943762.1 protein_id gnl|my_center|LOCUS_02070 233952 234356 gene locus_tag LOCUS_02080 233952 234356 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482613.1 protein_id gnl|my_center|LOCUS_02080 234476 234952 gene locus_tag LOCUS_02090 234476 234952 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545179.1 protein_id gnl|my_center|LOCUS_02090 236189 234975 gene locus_tag LOCUS_02100 236189 234975 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706206.1 protein_id gnl|my_center|LOCUS_02100 236329 237090 gene locus_tag LOCUS_02110 236329 237090 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336944.1 protein_id gnl|my_center|LOCUS_02110 >Feature sequence02 1400 159 gene locus_tag LOCUS_02120 gene glcF 1400 159 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268367.1 protein_id gnl|my_center|LOCUS_02120 2535 1420 gene locus_tag LOCUS_02130 gene glcE 2535 1420 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114371.1 protein_id gnl|my_center|LOCUS_02130 4055 2550 gene locus_tag LOCUS_02140 gene glcD 4055 2550 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268365.1 protein_id gnl|my_center|LOCUS_02140 5931 4231 gene locus_tag LOCUS_02150 5931 4231 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462890.1 protein_id gnl|my_center|LOCUS_02150 6298 7005 gene locus_tag LOCUS_02160 6298 7005 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532474.1 protein_id gnl|my_center|LOCUS_02160 7207 7566 gene locus_tag LOCUS_02170 7207 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 8283 7663 gene locus_tag LOCUS_02180 8283 7663 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228697.1 protein_id gnl|my_center|LOCUS_02180 9796 8408 gene locus_tag LOCUS_02190 9796 8408 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 protein_id gnl|my_center|LOCUS_02190 10592 10065 gene locus_tag LOCUS_02200 gene uraD 10592 10065 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104660.1 protein_id gnl|my_center|LOCUS_02200 10746 11099 gene locus_tag LOCUS_02210 gene uraH 10746 11099 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329197.1 protein_id gnl|my_center|LOCUS_02210 11194 12393 gene locus_tag LOCUS_02220 11194 12393 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550272.1 protein_id gnl|my_center|LOCUS_02220 12529 13263 gene locus_tag LOCUS_02230 12529 13263 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463915.1 protein_id gnl|my_center|LOCUS_02230 14744 13362 gene locus_tag LOCUS_02240 14744 13362 CDS product NCS1 family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272625.1 protein_id gnl|my_center|LOCUS_02240 15607 14861 gene locus_tag LOCUS_02250 15607 14861 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406417.1 protein_id gnl|my_center|LOCUS_02250 15976 16914 gene locus_tag LOCUS_02260 gene puuE 15976 16914 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521217.1 protein_id gnl|my_center|LOCUS_02260 17150 17983 gene locus_tag LOCUS_02270 17150 17983 CDS product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969931.1 protein_id gnl|my_center|LOCUS_02270 18222 18707 gene locus_tag LOCUS_02280 18222 18707 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083329.1 protein_id gnl|my_center|LOCUS_02280 18887 20662 gene locus_tag LOCUS_02290 gene gcl 18887 20662 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527189.1 protein_id gnl|my_center|LOCUS_02290 20689 21468 gene locus_tag LOCUS_02300 gene hyi 20689 21468 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087181.1 protein_id gnl|my_center|LOCUS_02300 21650 22537 gene locus_tag LOCUS_02310 21650 22537 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531399.1 protein_id gnl|my_center|LOCUS_02310 22737 24086 gene locus_tag LOCUS_02320 22737 24086 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 protein_id gnl|my_center|LOCUS_02320 24083 25567 gene locus_tag LOCUS_02330 gene pyk 24083 25567 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814419.1 protein_id gnl|my_center|LOCUS_02330 25577 26845 gene locus_tag LOCUS_02340 25577 26845 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762472.1 protein_id gnl|my_center|LOCUS_02340 26952 27662 gene locus_tag LOCUS_02350 26952 27662 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083340.1 protein_id gnl|my_center|LOCUS_02350 27713 28597 gene locus_tag LOCUS_02360 gene modA 27713 28597 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074080.1 protein_id gnl|my_center|LOCUS_02360 28597 29265 gene locus_tag LOCUS_02370 gene modB 28597 29265 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074079.1 protein_id gnl|my_center|LOCUS_02370 29258 30403 gene locus_tag LOCUS_02380 29258 30403 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074078.1 protein_id gnl|my_center|LOCUS_02380 30523 30972 gene locus_tag LOCUS_02390 30523 30972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 31093 32103 gene locus_tag LOCUS_02400 gene dctP 31093 32103 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389894.1 protein_id gnl|my_center|LOCUS_02400 32168 32647 gene locus_tag LOCUS_02410 32168 32647 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389893.1 protein_id gnl|my_center|LOCUS_02410 32637 33944 gene locus_tag LOCUS_02420 32637 33944 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389892.1 protein_id gnl|my_center|LOCUS_02420 34505 33969 gene locus_tag LOCUS_02430 34505 33969 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838224.1 protein_id gnl|my_center|LOCUS_02430 34810 36198 gene locus_tag LOCUS_02440 34810 36198 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_02440 36479 37459 gene locus_tag LOCUS_02450 36479 37459 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723317.1 protein_id gnl|my_center|LOCUS_02450 37606 40203 gene locus_tag LOCUS_02460 37606 40203 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704330.1 protein_id gnl|my_center|LOCUS_02460 40217 40645 gene locus_tag LOCUS_02470 40217 40645 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454686.1 protein_id gnl|my_center|LOCUS_02470 40921 41748 gene locus_tag LOCUS_02480 40921 41748 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967317.1 protein_id gnl|my_center|LOCUS_02480 41893 42375 gene locus_tag LOCUS_02490 41893 42375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 42466 42975 gene locus_tag LOCUS_02500 42466 42975 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315770.1 protein_id gnl|my_center|LOCUS_02500 43001 45184 gene locus_tag LOCUS_02510 43001 45184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 45270 46460 gene locus_tag LOCUS_02520 45270 46460 CDS product FIST signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106998.1 protein_id gnl|my_center|LOCUS_02520 46438 47802 gene locus_tag LOCUS_02530 46438 47802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 48458 47793 gene locus_tag LOCUS_02540 gene agmR 48458 47793 CDS product response regulator AgmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107754.1 protein_id gnl|my_center|LOCUS_02540 48597 50117 gene locus_tag LOCUS_02550 48597 50117 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115507.1 protein_id gnl|my_center|LOCUS_02550 50366 50989 gene locus_tag LOCUS_02560 50366 50989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 52247 51021 gene locus_tag LOCUS_02570 52247 51021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 52530 52267 gene locus_tag LOCUS_02580 52530 52267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 53150 52527 gene locus_tag LOCUS_02590 53150 52527 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_02590 53429 54223 gene locus_tag LOCUS_02600 53429 54223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 54272 54751 gene locus_tag LOCUS_02610 54272 54751 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395796.1 protein_id gnl|my_center|LOCUS_02610 56893 54845 gene locus_tag LOCUS_02620 gene betT 56893 54845 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704693.1 protein_id gnl|my_center|LOCUS_02620 57288 58490 gene locus_tag LOCUS_02630 57288 58490 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810994.1 protein_id gnl|my_center|LOCUS_02630 58603 59199 gene locus_tag LOCUS_02640 58603 59199 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810992.1 protein_id gnl|my_center|LOCUS_02640 59196 60515 gene locus_tag LOCUS_02650 59196 60515 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339250.1 protein_id gnl|my_center|LOCUS_02650 61314 60622 gene locus_tag LOCUS_02660 61314 60622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 62124 61405 gene locus_tag LOCUS_02670 62124 61405 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546865.1 protein_id gnl|my_center|LOCUS_02670 63557 62121 gene locus_tag LOCUS_02680 gene baeS 63557 62121 CDS product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675178.1 protein_id gnl|my_center|LOCUS_02680 66655 63554 gene locus_tag LOCUS_02690 66655 63554 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_02690 67977 66652 gene locus_tag LOCUS_02700 67977 66652 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 protein_id gnl|my_center|LOCUS_02700 68946 68020 gene locus_tag LOCUS_02710 68946 68020 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705573.1 protein_id gnl|my_center|LOCUS_02710 69776 69066 gene locus_tag LOCUS_02720 69776 69066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 71289 69943 gene locus_tag LOCUS_02730 71289 69943 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403127.1 protein_id gnl|my_center|LOCUS_02730 71852 71286 gene locus_tag LOCUS_02740 71852 71286 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868100.1 protein_id gnl|my_center|LOCUS_02740 72866 71931 gene locus_tag LOCUS_02750 72866 71931 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550325.1 protein_id gnl|my_center|LOCUS_02750 73127 74326 gene locus_tag LOCUS_02760 gene doeA 73127 74326 CDS product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974131.1 protein_id gnl|my_center|LOCUS_02760 74527 75540 gene locus_tag LOCUS_02770 gene doeB 74527 75540 CDS product N(2)-acetyl-L-2,4-diaminobutanoate deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401275.1 protein_id gnl|my_center|LOCUS_02770 75557 76033 gene locus_tag LOCUS_02780 75557 76033 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530324.1 protein_id gnl|my_center|LOCUS_02780 76262 77131 gene locus_tag LOCUS_02790 76262 77131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 77172 78788 gene locus_tag LOCUS_02800 77172 78788 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950580.1 protein_id gnl|my_center|LOCUS_02800 78785 79837 gene locus_tag LOCUS_02810 78785 79837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 79896 82679 gene locus_tag LOCUS_02820 79896 82679 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899363.1 protein_id gnl|my_center|LOCUS_02820 82917 84383 gene locus_tag LOCUS_02830 gene gabD 82917 84383 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971372.1 protein_id gnl|my_center|LOCUS_02830 84454 85881 gene locus_tag LOCUS_02840 84454 85881 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969340.1 protein_id gnl|my_center|LOCUS_02840 87290 86025 gene locus_tag LOCUS_02850 87290 86025 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070471.1 protein_id gnl|my_center|LOCUS_02850 87637 88320 gene locus_tag LOCUS_02860 87637 88320 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258735.1 protein_id gnl|my_center|LOCUS_02860 89361 88405 gene locus_tag LOCUS_02870 89361 88405 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970702.1 protein_id gnl|my_center|LOCUS_02870 90078 89509 gene locus_tag LOCUS_02880 90078 89509 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 protein_id gnl|my_center|LOCUS_02880 90770 90180 gene locus_tag LOCUS_02890 90770 90180 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 protein_id gnl|my_center|LOCUS_02890 90926 93295 gene locus_tag LOCUS_02900 90926 93295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 93505 93798 gene locus_tag LOCUS_02910 93505 93798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 93965 94471 gene locus_tag LOCUS_02920 93965 94471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953879.1 protein_id gnl|my_center|LOCUS_02920 94471 94968 gene locus_tag LOCUS_02930 94471 94968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 95270 95737 gene locus_tag LOCUS_02940 95270 95737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 96416 95760 gene locus_tag LOCUS_02950 96416 95760 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 protein_id gnl|my_center|LOCUS_02950 96678 98003 gene locus_tag LOCUS_02960 96678 98003 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042595882.1 protein_id gnl|my_center|LOCUS_02960 98087 99127 gene locus_tag LOCUS_02970 98087 99127 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294576.1 protein_id gnl|my_center|LOCUS_02970 99124 99714 gene locus_tag LOCUS_02980 99124 99714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 99745 100200 gene locus_tag LOCUS_02990 99745 100200 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053808215.1 protein_id gnl|my_center|LOCUS_02990 100444 100211 gene locus_tag LOCUS_03000 100444 100211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 100834 101166 gene locus_tag LOCUS_03010 100834 101166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 101879 101262 gene locus_tag LOCUS_03020 101879 101262 CDS product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194486.1 protein_id gnl|my_center|LOCUS_03020 102145 102555 gene locus_tag LOCUS_03030 102145 102555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 102629 103039 gene locus_tag LOCUS_03040 102629 103039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 103085 103951 gene locus_tag LOCUS_03050 103085 103951 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083528.1 protein_id gnl|my_center|LOCUS_03050 104476 103835 gene locus_tag LOCUS_03060 104476 103835 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113134.1 protein_id gnl|my_center|LOCUS_03060 105179 104466 gene locus_tag LOCUS_03070 105179 104466 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045801381.1 protein_id gnl|my_center|LOCUS_03070 105805 105176 gene locus_tag LOCUS_03080 105805 105176 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968331.1 protein_id gnl|my_center|LOCUS_03080 107496 105802 gene locus_tag LOCUS_03090 107496 105802 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338059.1 protein_id gnl|my_center|LOCUS_03090 108720 107509 gene locus_tag LOCUS_03100 108720 107509 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398095.1 protein_id gnl|my_center|LOCUS_03100 109835 108756 gene locus_tag LOCUS_03110 109835 108756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 110090 110815 gene locus_tag LOCUS_03120 110090 110815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 111042 112592 gene locus_tag LOCUS_03130 111042 112592 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037468799.1 protein_id gnl|my_center|LOCUS_03130 112685 113491 gene locus_tag LOCUS_03140 112685 113491 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063818.1 protein_id gnl|my_center|LOCUS_03140 113921 115411 gene locus_tag LOCUS_03150 113921 115411 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_03150 115413 116267 gene locus_tag LOCUS_03160 115413 116267 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813546.1 protein_id gnl|my_center|LOCUS_03160 116371 116712 gene locus_tag LOCUS_03170 116371 116712 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_03170 116802 117656 gene locus_tag LOCUS_03180 116802 117656 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813546.1 protein_id gnl|my_center|LOCUS_03180 118706 117816 gene locus_tag LOCUS_03190 gene malG 118706 117816 CDS product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299600.1 protein_id gnl|my_center|LOCUS_03190 120299 118722 gene locus_tag LOCUS_03200 gene malF 120299 118722 CDS product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368773.1 protein_id gnl|my_center|LOCUS_03200 121549 120359 gene locus_tag LOCUS_03210 gene malE 121549 120359 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705558.1 protein_id gnl|my_center|LOCUS_03210 122788 121736 gene locus_tag LOCUS_03220 122788 121736 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208596183.1 protein_id gnl|my_center|LOCUS_03220 123982 122876 gene locus_tag LOCUS_03230 gene ugpC 123982 122876 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266610.1 protein_id gnl|my_center|LOCUS_03230 125708 124086 gene locus_tag LOCUS_03240 125708 124086 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037608.1 protein_id gnl|my_center|LOCUS_03240 126586 125744 gene locus_tag LOCUS_03250 126586 125744 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266611.1 protein_id gnl|my_center|LOCUS_03250 127563 126583 gene locus_tag LOCUS_03260 127563 126583 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403357.1 protein_id gnl|my_center|LOCUS_03260 128879 127578 gene locus_tag LOCUS_03270 128879 127578 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266612.1 protein_id gnl|my_center|LOCUS_03270 129276 130760 gene locus_tag LOCUS_03280 129276 130760 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706779.1 protein_id gnl|my_center|LOCUS_03280 130865 133552 gene locus_tag LOCUS_03290 gene malT 130865 133552 CDS product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907046.1 protein_id gnl|my_center|LOCUS_03290 133688 135358 gene locus_tag LOCUS_03300 133688 135358 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037608.1 protein_id gnl|my_center|LOCUS_03300 135346 136461 gene locus_tag LOCUS_03310 gene malK 135346 136461 CDS product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212091.1 protein_id gnl|my_center|LOCUS_03310 137665 136475 gene locus_tag LOCUS_03320 137665 136475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 137754 138125 gene locus_tag LOCUS_03330 137754 138125 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262907.1 protein_id gnl|my_center|LOCUS_03330 140499 138133 gene locus_tag LOCUS_03340 140499 138133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 141366 140512 gene locus_tag LOCUS_03350 141366 140512 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_03350 142307 141438 gene locus_tag LOCUS_03360 142307 141438 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552324.1 protein_id gnl|my_center|LOCUS_03360 142536 144032 gene locus_tag LOCUS_03370 gene zwf 142536 144032 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266836.1 protein_id gnl|my_center|LOCUS_03370 144140 144808 gene locus_tag LOCUS_03380 gene pgl 144140 144808 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113441.1 protein_id gnl|my_center|LOCUS_03380 144827 145489 gene locus_tag LOCUS_03390 144827 145489 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113440.1 protein_id gnl|my_center|LOCUS_03390 147313 145649 gene locus_tag LOCUS_03400 gene pgi 147313 145649 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932668.1 protein_id gnl|my_center|LOCUS_03400 149222 147471 gene locus_tag LOCUS_03410 gene fruA 149222 147471 CDS product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706188.1 protein_id gnl|my_center|LOCUS_03410 150193 149219 gene locus_tag LOCUS_03420 gene pfkB 150193 149219 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112874.1 protein_id gnl|my_center|LOCUS_03420 153105 150193 gene locus_tag LOCUS_03430 gene ptsP 153105 150193 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119534.1 protein_id gnl|my_center|LOCUS_03430 153295 154296 gene locus_tag LOCUS_03440 gene cra 153295 154296 CDS product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104372.1 protein_id gnl|my_center|LOCUS_03440 155315 154293 gene locus_tag LOCUS_03450 155315 154293 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_03450 156183 155341 gene locus_tag LOCUS_03460 156183 155341 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092770593.1 protein_id gnl|my_center|LOCUS_03460 157070 156180 gene locus_tag LOCUS_03470 157070 156180 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389016.1 protein_id gnl|my_center|LOCUS_03470 158514 157156 gene locus_tag LOCUS_03480 158514 157156 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529494.1 protein_id gnl|my_center|LOCUS_03480 158962 160044 gene locus_tag LOCUS_03490 gene ugpC 158962 160044 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244133.1 protein_id gnl|my_center|LOCUS_03490 160047 161537 gene locus_tag LOCUS_03500 gene xylB 160047 161537 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970274.1 protein_id gnl|my_center|LOCUS_03500 161721 161506 gene locus_tag LOCUS_03510 161721 161506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 162719 161751 gene locus_tag LOCUS_03520 162719 161751 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275390.1 protein_id gnl|my_center|LOCUS_03520 163650 162760 gene locus_tag LOCUS_03530 163650 162760 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146943968.1 protein_id gnl|my_center|LOCUS_03530 164537 163647 gene locus_tag LOCUS_03540 164537 163647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 165543 164578 gene locus_tag LOCUS_03550 165543 164578 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216974.1 protein_id gnl|my_center|LOCUS_03550 167478 165592 gene locus_tag LOCUS_03560 gene edd 167478 165592 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091478.1 protein_id gnl|my_center|LOCUS_03560 169009 167612 gene locus_tag LOCUS_03570 169009 167612 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529049.1 protein_id gnl|my_center|LOCUS_03570 169340 170479 gene locus_tag LOCUS_03580 169340 170479 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813554.1 protein_id gnl|my_center|LOCUS_03580 170564 170902 gene locus_tag LOCUS_03590 170564 170902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 170899 171648 gene locus_tag LOCUS_03600 gene ispD 170899 171648 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406223.1 protein_id gnl|my_center|LOCUS_03600 171648 172139 gene locus_tag LOCUS_03610 gene ispF 171648 172139 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_03610 172132 173196 gene locus_tag LOCUS_03620 gene truD 172132 173196 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113870.1 protein_id gnl|my_center|LOCUS_03620 173225 173971 gene locus_tag LOCUS_03630 gene surE 173225 173971 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092341.1 protein_id gnl|my_center|LOCUS_03630 174003 174638 gene locus_tag LOCUS_03640 174003 174638 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704775.1 protein_id gnl|my_center|LOCUS_03640 174652 175653 gene locus_tag LOCUS_03650 174652 175653 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 protein_id gnl|my_center|LOCUS_03650 175646 176830 gene locus_tag LOCUS_03660 175646 176830 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819395.1 protein_id gnl|my_center|LOCUS_03660 176957 177958 gene locus_tag LOCUS_03670 gene rpoS 176957 177958 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113871.1 protein_id gnl|my_center|LOCUS_03670 178042 179472 gene locus_tag LOCUS_03680 gene opmH 178042 179472 CDS product efflux transporter outer membrane subunit OpmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_03680 179606 180709 gene locus_tag LOCUS_03690 gene alr 179606 180709 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114351.1 protein_id gnl|my_center|LOCUS_03690 180730 181647 gene locus_tag LOCUS_03700 180730 181647 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 protein_id gnl|my_center|LOCUS_03700 181792 181947 gene locus_tag LOCUS_03710 181792 181947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 183695 182034 gene locus_tag LOCUS_03720 gene ettA 183695 182034 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_03720 183974 183768 gene locus_tag LOCUS_03730 183974 183768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 184835 184401 gene locus_tag LOCUS_03740 184835 184401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 186336 184966 gene locus_tag LOCUS_03750 186336 184966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 186367 186666 gene locus_tag LOCUS_03760 186367 186666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 186666 187163 gene locus_tag LOCUS_03770 186666 187163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 187160 188056 gene locus_tag LOCUS_03780 187160 188056 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704312.1 protein_id gnl|my_center|LOCUS_03780 188255 188085 gene locus_tag LOCUS_03790 188255 188085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 188877 188248 gene locus_tag LOCUS_03800 188877 188248 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103924.1 protein_id gnl|my_center|LOCUS_03800 188912 189628 gene locus_tag LOCUS_03810 188912 189628 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707237.1 protein_id gnl|my_center|LOCUS_03810 189625 192207 gene locus_tag LOCUS_03820 189625 192207 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122524.1 protein_id gnl|my_center|LOCUS_03820 192217 193644 gene locus_tag LOCUS_03830 gene pap 192217 193644 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091935.1 protein_id gnl|my_center|LOCUS_03830 193699 195099 gene locus_tag LOCUS_03840 193699 195099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 195228 196493 gene locus_tag LOCUS_03850 195228 196493 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419083.1 protein_id gnl|my_center|LOCUS_03850 196690 198474 gene locus_tag LOCUS_03860 196690 198474 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266723.1 protein_id gnl|my_center|LOCUS_03860 198471 199868 gene locus_tag LOCUS_03870 198471 199868 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266724.1 protein_id gnl|my_center|LOCUS_03870 202896 199888 gene locus_tag LOCUS_03880 202896 199888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 204197 203214 gene locus_tag LOCUS_03890 204197 203214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 204662 206071 gene locus_tag LOCUS_03900 204662 206071 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_03900 206322 206513 gene locus_tag LOCUS_03910 206322 206513 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_03910 206711 207622 gene locus_tag LOCUS_03920 206711 207622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 207777 208658 gene locus_tag LOCUS_03930 207777 208658 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_03930 208683 209117 gene locus_tag LOCUS_03940 208683 209117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 209121 210890 gene locus_tag LOCUS_03950 209121 210890 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_03950 210946 211419 gene locus_tag LOCUS_03960 210946 211419 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184577.1 protein_id gnl|my_center|LOCUS_03960 211416 211844 gene locus_tag LOCUS_03970 211416 211844 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479357.1 protein_id gnl|my_center|LOCUS_03970 212025 212720 gene locus_tag LOCUS_03980 212025 212720 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103570.1 protein_id gnl|my_center|LOCUS_03980 212717 214036 gene locus_tag LOCUS_03990 212717 214036 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103567.1 protein_id gnl|my_center|LOCUS_03990 214094 214765 gene locus_tag LOCUS_04000 214094 214765 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113296.1 protein_id gnl|my_center|LOCUS_04000 214779 215825 gene locus_tag LOCUS_04010 214779 215825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 >Feature sequence03 1691 822 gene locus_tag LOCUS_04020 gene cas7c 1691 822 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_04020 3487 1688 gene locus_tag LOCUS_04030 gene cas8c 3487 1688 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388585.1 protein_id gnl|my_center|LOCUS_04030 4152 3484 gene locus_tag LOCUS_04040 gene cas5c 4152 3484 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 protein_id gnl|my_center|LOCUS_04040 6414 4189 gene locus_tag LOCUS_04050 6414 4189 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388583.1 protein_id gnl|my_center|LOCUS_04050 6566 7435 gene locus_tag LOCUS_04060 6566 7435 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_04060 8648 7422 gene locus_tag LOCUS_04070 8648 7422 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532852.1 protein_id gnl|my_center|LOCUS_04070 8882 9478 gene locus_tag LOCUS_04080 8882 9478 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941233.1 protein_id gnl|my_center|LOCUS_04080 9493 10491 gene locus_tag LOCUS_04090 9493 10491 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888889.1 protein_id gnl|my_center|LOCUS_04090 11395 10502 gene locus_tag LOCUS_04100 11395 10502 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216246.1 protein_id gnl|my_center|LOCUS_04100 11531 13129 gene locus_tag LOCUS_04110 11531 13129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 13126 15498 gene locus_tag LOCUS_04120 13126 15498 CDS product YbcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993482.1 protein_id gnl|my_center|LOCUS_04120 16417 15731 gene locus_tag LOCUS_04130 16417 15731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 17641 16442 gene locus_tag LOCUS_04140 17641 16442 CDS product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 protein_id gnl|my_center|LOCUS_04140 17772 18950 gene locus_tag LOCUS_04150 17772 18950 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707015.1 protein_id gnl|my_center|LOCUS_04150 19019 19696 gene locus_tag LOCUS_04160 19019 19696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 19779 19928 gene locus_tag LOCUS_04170 19779 19928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 19928 20662 gene locus_tag LOCUS_04180 gene aztA 19928 20662 CDS product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807167.1 protein_id gnl|my_center|LOCUS_04180 20646 21536 gene locus_tag LOCUS_04190 20646 21536 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064718.1 protein_id gnl|my_center|LOCUS_04190 21575 22624 gene locus_tag LOCUS_04200 21575 22624 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931286.1 protein_id gnl|my_center|LOCUS_04200 22939 24162 gene locus_tag LOCUS_04210 22939 24162 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089388.1 protein_id gnl|my_center|LOCUS_04210 24174 25718 gene locus_tag LOCUS_04220 24174 25718 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031537.1 protein_id gnl|my_center|LOCUS_04220 25715 26869 gene locus_tag LOCUS_04230 25715 26869 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_04230 26885 28072 gene locus_tag LOCUS_04240 26885 28072 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905810.1 protein_id gnl|my_center|LOCUS_04240 28106 29758 gene locus_tag LOCUS_04250 28106 29758 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103012.1 protein_id gnl|my_center|LOCUS_04250 30915 29908 gene locus_tag LOCUS_04260 30915 29908 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207597.1 protein_id gnl|my_center|LOCUS_04260 31065 31748 gene locus_tag LOCUS_04270 31065 31748 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140035.1 protein_id gnl|my_center|LOCUS_04270 31735 32418 gene locus_tag LOCUS_04280 31735 32418 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366169.1 protein_id gnl|my_center|LOCUS_04280 32445 34970 gene locus_tag LOCUS_04290 32445 34970 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268626.1 protein_id gnl|my_center|LOCUS_04290 34967 36193 gene locus_tag LOCUS_04300 34967 36193 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336817.1 protein_id gnl|my_center|LOCUS_04300 37001 36219 gene locus_tag LOCUS_04310 37001 36219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 38993 37134 gene locus_tag LOCUS_04320 38993 37134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 41139 38986 gene locus_tag LOCUS_04330 41139 38986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 43016 41139 gene locus_tag LOCUS_04340 43016 41139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 43434 43078 gene locus_tag LOCUS_04350 43434 43078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 60807 43528 gene locus_tag LOCUS_04360 60807 43528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 61393 61758 gene locus_tag LOCUS_04370 61393 61758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 62362 61829 gene locus_tag LOCUS_04380 gene gloA 62362 61829 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101793.1 protein_id gnl|my_center|LOCUS_04380 62580 62924 gene locus_tag LOCUS_04390 62580 62924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 62985 63479 gene locus_tag LOCUS_04400 62985 63479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 64868 63486 gene locus_tag LOCUS_04410 64868 63486 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 protein_id gnl|my_center|LOCUS_04410 65536 64865 gene locus_tag LOCUS_04420 65536 64865 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532639.1 protein_id gnl|my_center|LOCUS_04420 65895 65533 gene locus_tag LOCUS_04430 65895 65533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 66020 66490 gene locus_tag LOCUS_04440 66020 66490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 66645 67307 gene locus_tag LOCUS_04450 66645 67307 CDS product thermostable hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803562.1 protein_id gnl|my_center|LOCUS_04450 67291 68766 gene locus_tag LOCUS_04460 67291 68766 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 protein_id gnl|my_center|LOCUS_04460 68763 69455 gene locus_tag LOCUS_04470 68763 69455 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_04470 69442 70284 gene locus_tag LOCUS_04480 69442 70284 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 protein_id gnl|my_center|LOCUS_04480 70281 70964 gene locus_tag LOCUS_04490 70281 70964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_04490 70972 71652 gene locus_tag LOCUS_04500 70972 71652 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103755.1 protein_id gnl|my_center|LOCUS_04500 71649 73034 gene locus_tag LOCUS_04510 71649 73034 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406386.1 protein_id gnl|my_center|LOCUS_04510 73624 73106 gene locus_tag LOCUS_04520 73624 73106 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106133.1 protein_id gnl|my_center|LOCUS_04520 73878 74138 gene locus_tag LOCUS_04530 73878 74138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 74429 74226 gene locus_tag LOCUS_04540 74429 74226 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528379.1 protein_id gnl|my_center|LOCUS_04540 74598 76352 gene locus_tag LOCUS_04550 gene dauA 74598 76352 CDS product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817880.1 protein_id gnl|my_center|LOCUS_04550 76567 77388 gene locus_tag LOCUS_04560 gene thiM 76567 77388 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338388.1 protein_id gnl|my_center|LOCUS_04560 77378 77995 gene locus_tag LOCUS_04570 gene thiE 77378 77995 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338387.1 protein_id gnl|my_center|LOCUS_04570 78886 78011 gene locus_tag LOCUS_04580 78886 78011 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811290.1 protein_id gnl|my_center|LOCUS_04580 80354 79002 gene locus_tag LOCUS_04590 80354 79002 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626309.1 protein_id gnl|my_center|LOCUS_04590 81306 80533 gene locus_tag LOCUS_04600 81306 80533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 82372 81317 gene locus_tag LOCUS_04610 82372 81317 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065037.1 protein_id gnl|my_center|LOCUS_04610 83409 82369 gene locus_tag LOCUS_04620 83409 82369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814268.1 protein_id gnl|my_center|LOCUS_04620 84397 83432 gene locus_tag LOCUS_04630 84397 83432 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384486.1 protein_id gnl|my_center|LOCUS_04630 85371 84394 gene locus_tag LOCUS_04640 85371 84394 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906119.1 protein_id gnl|my_center|LOCUS_04640 87020 85440 gene locus_tag LOCUS_04650 87020 85440 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384484.1 protein_id gnl|my_center|LOCUS_04650 88185 87196 gene locus_tag LOCUS_04660 gene moaA 88185 87196 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059643243.1 protein_id gnl|my_center|LOCUS_04660 88592 88182 gene locus_tag LOCUS_04670 88592 88182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 89378 88635 gene locus_tag LOCUS_04680 89378 88635 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476586.1 protein_id gnl|my_center|LOCUS_04680 90588 89338 gene locus_tag LOCUS_04690 gene moeA 90588 89338 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397348.1 protein_id gnl|my_center|LOCUS_04690 91187 90585 gene locus_tag LOCUS_04700 gene moaB 91187 90585 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091240.1 protein_id gnl|my_center|LOCUS_04700 92090 91269 gene locus_tag LOCUS_04710 92090 91269 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105307.1 protein_id gnl|my_center|LOCUS_04710 92962 92273 gene locus_tag LOCUS_04720 gene narI 92962 92273 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366445.1 protein_id gnl|my_center|LOCUS_04720 93755 92976 gene locus_tag LOCUS_04730 gene narJ 93755 92976 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705098.1 protein_id gnl|my_center|LOCUS_04730 95328 93748 gene locus_tag LOCUS_04740 gene narH 95328 93748 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092958.1 protein_id gnl|my_center|LOCUS_04740 99092 95325 gene locus_tag LOCUS_04750 99092 95325 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705096.1 protein_id gnl|my_center|LOCUS_04750 100578 99307 gene locus_tag LOCUS_04760 100578 99307 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113773.1 protein_id gnl|my_center|LOCUS_04760 100719 102656 gene locus_tag LOCUS_04770 gene narX 100719 102656 CDS product two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105296.1 protein_id gnl|my_center|LOCUS_04770 102663 103328 gene locus_tag LOCUS_04780 gene narL 102663 103328 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856701.1 protein_id gnl|my_center|LOCUS_04780 103617 105209 gene locus_tag LOCUS_04790 103617 105209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 105285 105740 gene locus_tag LOCUS_04800 105285 105740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 105778 107277 gene locus_tag LOCUS_04810 105778 107277 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_04810 107453 107875 gene locus_tag LOCUS_04820 107453 107875 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327476.1 protein_id gnl|my_center|LOCUS_04820 107889 108440 gene locus_tag LOCUS_04830 107889 108440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 108442 109059 gene locus_tag LOCUS_04840 108442 109059 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085996.1 protein_id gnl|my_center|LOCUS_04840 109064 109375 gene locus_tag LOCUS_04850 109064 109375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 109664 109452 gene locus_tag LOCUS_04860 109664 109452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 111617 109677 gene locus_tag LOCUS_04870 111617 109677 CDS product nitric oxide reductase activation protein NorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973799.1 protein_id gnl|my_center|LOCUS_04870 112446 111637 gene locus_tag LOCUS_04880 112446 111637 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_04880 113852 112506 gene locus_tag LOCUS_04890 113852 112506 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327923.1 protein_id gnl|my_center|LOCUS_04890 114349 113903 gene locus_tag LOCUS_04900 114349 113903 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707559.1 protein_id gnl|my_center|LOCUS_04900 114906 114589 gene locus_tag LOCUS_04910 114906 114589 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255937.1 protein_id gnl|my_center|LOCUS_04910 115380 114985 gene locus_tag LOCUS_04920 115380 114985 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 protein_id gnl|my_center|LOCUS_04920 116597 115401 gene locus_tag LOCUS_04930 116597 115401 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072738.1 protein_id gnl|my_center|LOCUS_04930 118228 116702 gene locus_tag LOCUS_04940 gene nirN 118228 116702 CDS product dihydro-heme d1 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113244.1 protein_id gnl|my_center|LOCUS_04940 119094 118225 gene locus_tag LOCUS_04950 119094 118225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 120342 119143 gene locus_tag LOCUS_04960 gene nirJ 120342 119143 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 protein_id gnl|my_center|LOCUS_04960 120894 120367 gene locus_tag LOCUS_04970 120894 120367 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084858.1 protein_id gnl|my_center|LOCUS_04970 121351 120869 gene locus_tag LOCUS_04980 121351 120869 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 protein_id gnl|my_center|LOCUS_04980 121866 121348 gene locus_tag LOCUS_04990 121866 121348 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111534.1 protein_id gnl|my_center|LOCUS_04990 122336 121863 gene locus_tag LOCUS_05000 122336 121863 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084864.1 protein_id gnl|my_center|LOCUS_05000 122588 122929 gene locus_tag LOCUS_05010 gene nirC 122588 122929 CDS product cytochrome c55X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084870.1 protein_id gnl|my_center|LOCUS_05010 122948 124156 gene locus_tag LOCUS_05020 gene nirF 122948 124156 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_05020 124616 124200 gene locus_tag LOCUS_05030 124616 124200 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524104.1 protein_id gnl|my_center|LOCUS_05030 124761 125327 gene locus_tag LOCUS_05040 124761 125327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 125437 126606 gene locus_tag LOCUS_05050 gene hmpA 125437 126606 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113387.1 protein_id gnl|my_center|LOCUS_05050 129850 126692 gene locus_tag LOCUS_05060 129850 126692 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_05060 131214 129847 gene locus_tag LOCUS_05070 131214 129847 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086651.1 protein_id gnl|my_center|LOCUS_05070 131828 131211 gene locus_tag LOCUS_05080 gene slmA 131828 131211 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417043.1 protein_id gnl|my_center|LOCUS_05080 132130 132786 gene locus_tag LOCUS_05090 gene ytfE 132130 132786 CDS product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210159.1 protein_id gnl|my_center|LOCUS_05090 132981 133976 gene locus_tag LOCUS_05100 132981 133976 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421309.1 protein_id gnl|my_center|LOCUS_05100 133988 134908 gene locus_tag LOCUS_05110 133988 134908 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110916.1 protein_id gnl|my_center|LOCUS_05110 134916 135653 gene locus_tag LOCUS_05120 134916 135653 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196980.1 protein_id gnl|my_center|LOCUS_05120 135681 136808 gene locus_tag LOCUS_05130 135681 136808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 137013 137606 gene locus_tag LOCUS_05140 137013 137606 CDS product DUF6448 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943772.1 protein_id gnl|my_center|LOCUS_05140 137774 137862 gene locus_tag LOCUS_t00070 137774 137862 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 140627 138516 gene locus_tag LOCUS_05150 140627 138516 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 protein_id gnl|my_center|LOCUS_05150 141154 140660 gene locus_tag LOCUS_05160 141154 140660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 142838 141453 gene locus_tag LOCUS_05170 gene hemN 142838 141453 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185893.1 protein_id gnl|my_center|LOCUS_05170 143239 143033 gene locus_tag LOCUS_05180 143239 143033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 143660 144073 gene locus_tag LOCUS_05190 143660 144073 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456625.1 protein_id gnl|my_center|LOCUS_05190 144132 144605 gene locus_tag LOCUS_05200 gene nsrR 144132 144605 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_05200 144779 145090 gene locus_tag LOCUS_05210 144779 145090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 145731 145204 gene locus_tag LOCUS_05220 145731 145204 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113109.1 protein_id gnl|my_center|LOCUS_05220 146577 145747 gene locus_tag LOCUS_05230 146577 145747 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113110.1 protein_id gnl|my_center|LOCUS_05230 147551 146574 gene locus_tag LOCUS_05240 147551 146574 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113111.1 protein_id gnl|my_center|LOCUS_05240 148852 147548 gene locus_tag LOCUS_05250 148852 147548 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113112.1 protein_id gnl|my_center|LOCUS_05250 150846 148933 gene locus_tag LOCUS_05260 gene nosZ 150846 148933 CDS product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098686.1 protein_id gnl|my_center|LOCUS_05260 153178 150974 gene locus_tag LOCUS_05270 153178 150974 CDS product regulatory protein NosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004345196.1 protein_id gnl|my_center|LOCUS_05270 153344 153676 gene locus_tag LOCUS_05280 153344 153676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 153765 154088 gene locus_tag LOCUS_05290 153765 154088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 154156 154710 gene locus_tag LOCUS_05300 154156 154710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 155372 154788 gene locus_tag LOCUS_05310 155372 154788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 157052 155385 gene locus_tag LOCUS_05320 157052 155385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 158822 157209 gene locus_tag LOCUS_05330 gene nirS 158822 157209 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_05330 159831 159058 gene locus_tag LOCUS_05340 159831 159058 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944031.1 protein_id gnl|my_center|LOCUS_05340 160784 159897 gene locus_tag LOCUS_05350 160784 159897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 161273 160800 gene locus_tag LOCUS_05360 161273 160800 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214855.1 protein_id gnl|my_center|LOCUS_05360 161815 161270 gene locus_tag LOCUS_05370 161815 161270 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070641.1 protein_id gnl|my_center|LOCUS_05370 163809 161812 gene locus_tag LOCUS_05380 163809 161812 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926646.1 protein_id gnl|my_center|LOCUS_05380 164237 164824 gene locus_tag LOCUS_05390 164237 164824 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 protein_id gnl|my_center|LOCUS_05390 164834 165397 gene locus_tag LOCUS_05400 164834 165397 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776684.1 protein_id gnl|my_center|LOCUS_05400 165421 165786 gene locus_tag LOCUS_05410 165421 165786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 166605 165799 gene locus_tag LOCUS_05420 166605 165799 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390684.1 protein_id gnl|my_center|LOCUS_05420 167327 166638 gene locus_tag LOCUS_05430 167327 166638 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545014.1 protein_id gnl|my_center|LOCUS_05430 168135 167320 gene locus_tag LOCUS_05440 168135 167320 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 protein_id gnl|my_center|LOCUS_05440 168318 169517 gene locus_tag LOCUS_05450 168318 169517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 170391 169690 gene locus_tag LOCUS_05460 170391 169690 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160341.1 protein_id gnl|my_center|LOCUS_05460 170846 170424 gene locus_tag LOCUS_05470 gene flhe 170846 170424 CDS product flagellar protein FlhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233619.1 protein_id gnl|my_center|LOCUS_05470 171427 170843 gene locus_tag LOCUS_05480 171427 170843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 173549 171429 gene locus_tag LOCUS_05490 173549 171429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 175627 173546 gene locus_tag LOCUS_05500 gene flhA 175627 173546 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002392.1 protein_id gnl|my_center|LOCUS_05500 176781 175624 gene locus_tag LOCUS_05510 gene flhB 176781 175624 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938913.1 protein_id gnl|my_center|LOCUS_05510 177599 176910 gene locus_tag LOCUS_05520 gene cheZ 177599 176910 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367337.1 protein_id gnl|my_center|LOCUS_05520 178026 177637 gene locus_tag LOCUS_05530 gene cheY 178026 177637 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164479.1 protein_id gnl|my_center|LOCUS_05530 179800 178082 gene locus_tag LOCUS_05540 179800 178082 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063733.1 protein_id gnl|my_center|LOCUS_05540 180899 179838 gene locus_tag LOCUS_05550 180899 179838 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367339.1 protein_id gnl|my_center|LOCUS_05550 181906 181037 gene locus_tag LOCUS_05560 181906 181037 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811915.1 protein_id gnl|my_center|LOCUS_05560 184092 181903 gene locus_tag LOCUS_05570 184092 181903 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930331.1 protein_id gnl|my_center|LOCUS_05570 185543 184200 gene locus_tag LOCUS_05580 185543 184200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 187298 185661 gene locus_tag LOCUS_05590 187298 185661 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543739.1 protein_id gnl|my_center|LOCUS_05590 187902 187405 gene locus_tag LOCUS_05600 gene cheW 187902 187405 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199265.1 protein_id gnl|my_center|LOCUS_05600 190046 187899 gene locus_tag LOCUS_05610 gene cheA 190046 187899 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063729.1 protein_id gnl|my_center|LOCUS_05610 191038 190067 gene locus_tag LOCUS_05620 191038 190067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05620 191907 191035 gene locus_tag LOCUS_05630 gene motA 191907 191035 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210888.1 protein_id gnl|my_center|LOCUS_05630 192689 192123 gene locus_tag LOCUS_05640 gene flhC 192689 192123 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198198.1 protein_id gnl|my_center|LOCUS_05640 193022 192693 gene locus_tag LOCUS_05650 gene flhD 193022 192693 CDS product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295647.1 protein_id gnl|my_center|LOCUS_05650 193651 193358 gene locus_tag LOCUS_05660 193651 193358 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523065.1 protein_id gnl|my_center|LOCUS_05660 194883 193648 gene locus_tag LOCUS_05670 194883 193648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05670 195293 194880 gene locus_tag LOCUS_05680 195293 194880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 195715 195296 gene locus_tag LOCUS_05690 gene fliS 195715 195296 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211149.1 protein_id gnl|my_center|LOCUS_05690 197533 195851 gene locus_tag LOCUS_05700 197533 195851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 197781 199268 gene locus_tag LOCUS_05710 197781 199268 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064374.1 protein_id gnl|my_center|LOCUS_05710 202489 199256 gene locus_tag LOCUS_05720 202489 199256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 202770 202549 gene locus_tag LOCUS_05730 202770 202549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 204731 202752 gene locus_tag LOCUS_05740 204731 202752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 205057 206796 gene locus_tag LOCUS_05750 205057 206796 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543739.1 protein_id gnl|my_center|LOCUS_05750 207568 207140 gene locus_tag LOCUS_05760 207568 207140 CDS product DUF4870 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918299.1 protein_id gnl|my_center|LOCUS_05760 208235 207642 gene locus_tag LOCUS_05770 208235 207642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 209296 208289 gene locus_tag LOCUS_05780 209296 208289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 >Feature sequence04 450 1418 gene locus_tag LOCUS_05790 450 1418 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185661.1 protein_id gnl|my_center|LOCUS_05790 1570 3300 gene locus_tag LOCUS_05800 1570 3300 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 protein_id gnl|my_center|LOCUS_05800 3287 3505 gene locus_tag LOCUS_05810 3287 3505 CDS product DUF2783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085116.1 protein_id gnl|my_center|LOCUS_05810 3521 4831 gene locus_tag LOCUS_05820 gene hmgA 3521 4831 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194851.1 protein_id gnl|my_center|LOCUS_05820 4934 5965 gene locus_tag LOCUS_05830 4934 5965 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034855886.1 protein_id gnl|my_center|LOCUS_05830 5992 6636 gene locus_tag LOCUS_05840 gene maiA 5992 6636 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930265.1 protein_id gnl|my_center|LOCUS_05840 6750 7967 gene locus_tag LOCUS_05850 6750 7967 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770075.1 protein_id gnl|my_center|LOCUS_05850 11610 8101 gene locus_tag LOCUS_05860 11610 8101 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090318.1 protein_id gnl|my_center|LOCUS_05860 11786 12256 gene locus_tag LOCUS_05870 11786 12256 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090317.1 protein_id gnl|my_center|LOCUS_05870 12270 13493 gene locus_tag LOCUS_05880 12270 13493 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814920.1 protein_id gnl|my_center|LOCUS_05880 13693 13490 gene locus_tag LOCUS_05890 13693 13490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 15387 13696 gene locus_tag LOCUS_05900 15387 13696 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 protein_id gnl|my_center|LOCUS_05900 15522 16316 gene locus_tag LOCUS_05910 15522 16316 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089754.1 protein_id gnl|my_center|LOCUS_05910 16821 16393 gene locus_tag LOCUS_05920 16821 16393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 17988 16918 gene locus_tag LOCUS_05930 17988 16918 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 protein_id gnl|my_center|LOCUS_05930 20384 18045 gene locus_tag LOCUS_05940 20384 18045 CDS product cytochrome P450/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187052.1 protein_id gnl|my_center|LOCUS_05940 20575 21270 gene locus_tag LOCUS_05950 20575 21270 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975875.1 protein_id gnl|my_center|LOCUS_05950 21334 22362 gene locus_tag LOCUS_05960 21334 22362 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926366.1 protein_id gnl|my_center|LOCUS_05960 22465 23094 gene locus_tag LOCUS_05970 22465 23094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 23547 23104 gene locus_tag LOCUS_05980 gene ruvX 23547 23104 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706917.1 protein_id gnl|my_center|LOCUS_05980 24153 23581 gene locus_tag LOCUS_05990 24153 23581 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185441.1 protein_id gnl|my_center|LOCUS_05990 25094 24171 gene locus_tag LOCUS_06000 25094 24171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 26086 25118 gene locus_tag LOCUS_06010 gene gshB 26086 25118 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100943.1 protein_id gnl|my_center|LOCUS_06010 26837 26133 gene locus_tag LOCUS_06020 26837 26133 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_06020 27624 26881 gene locus_tag LOCUS_06030 27624 26881 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106127.1 protein_id gnl|my_center|LOCUS_06030 28159 27635 gene locus_tag LOCUS_06040 gene secB 28159 27635 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208976.1 protein_id gnl|my_center|LOCUS_06040 28613 28191 gene locus_tag LOCUS_06050 28613 28191 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208978.1 protein_id gnl|my_center|LOCUS_06050 28845 30416 gene locus_tag LOCUS_06060 gene gpmI 28845 30416 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 protein_id gnl|my_center|LOCUS_06060 30448 31590 gene locus_tag LOCUS_06070 30448 31590 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014505949.1 protein_id gnl|my_center|LOCUS_06070 31721 32965 gene locus_tag LOCUS_06080 gene cptA 31721 32965 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_06080 34223 32937 gene locus_tag LOCUS_06090 34223 32937 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 protein_id gnl|my_center|LOCUS_06090 35484 34297 gene locus_tag LOCUS_06100 gene ubiH 35484 34297 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103968835.1 protein_id gnl|my_center|LOCUS_06100 36932 35595 gene locus_tag LOCUS_06110 gene pepP 36932 35595 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_06110 37558 36980 gene locus_tag LOCUS_06120 37558 36980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 37750 38049 gene locus_tag LOCUS_06130 37750 38049 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096316.1 protein_id gnl|my_center|LOCUS_06130 38294 38950 gene locus_tag LOCUS_06140 38294 38950 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132451.1 protein_id gnl|my_center|LOCUS_06140 40834 39320 gene locus_tag LOCUS_06150 gene ilvA 40834 39320 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_06150 40815 41033 gene locus_tag LOCUS_06160 40815 41033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 41184 41858 gene locus_tag LOCUS_06170 gene rpiA 41184 41858 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084386.1 protein_id gnl|my_center|LOCUS_06170 43167 41890 gene locus_tag LOCUS_06180 gene waaA 43167 41890 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_06180 44597 43167 gene locus_tag LOCUS_06190 gene hldE 44597 43167 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707478.1 protein_id gnl|my_center|LOCUS_06190 45723 44587 gene locus_tag LOCUS_06200 45723 44587 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064632.1 protein_id gnl|my_center|LOCUS_06200 45686 46396 gene locus_tag LOCUS_06210 45686 46396 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616620.1 protein_id gnl|my_center|LOCUS_06210 47520 46393 gene locus_tag LOCUS_06220 47520 46393 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088671.1 protein_id gnl|my_center|LOCUS_06220 47559 48656 gene locus_tag LOCUS_06230 47559 48656 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704186.1 protein_id gnl|my_center|LOCUS_06230 49389 48607 gene locus_tag LOCUS_06240 49389 48607 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704187.1 protein_id gnl|my_center|LOCUS_06240 49518 51194 gene locus_tag LOCUS_06250 49518 51194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 52258 51209 gene locus_tag LOCUS_06260 gene waaF 52258 51209 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699268.1 protein_id gnl|my_center|LOCUS_06260 53207 52251 gene locus_tag LOCUS_06270 gene rfaD 53207 52251 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707885.1 protein_id gnl|my_center|LOCUS_06270 53305 54267 gene locus_tag LOCUS_06280 gene glyQ 53305 54267 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097276.1 protein_id gnl|my_center|LOCUS_06280 54267 56333 gene locus_tag LOCUS_06290 gene glyS 54267 56333 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401442.1 protein_id gnl|my_center|LOCUS_06290 56572 57141 gene locus_tag LOCUS_06300 gene gmhB 56572 57141 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120688.1 protein_id gnl|my_center|LOCUS_06300 57267 57359 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 59952 57532 gene locus_tag LOCUS_06310 gene gyrB 59952 57532 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097268.1 protein_id gnl|my_center|LOCUS_06310 61079 59964 gene locus_tag LOCUS_06320 gene recF 61079 59964 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377871.1 protein_id gnl|my_center|LOCUS_06320 62224 61121 gene locus_tag LOCUS_06330 gene dnaN 62224 61121 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768226.1 protein_id gnl|my_center|LOCUS_06330 63810 62341 gene locus_tag LOCUS_06340 gene dnaA 63810 62341 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102932.1 protein_id gnl|my_center|LOCUS_06340 64331 64465 gene locus_tag LOCUS_06350 64331 64465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 64479 64907 gene locus_tag LOCUS_06360 gene rnpA 64479 64907 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100251.1 protein_id gnl|my_center|LOCUS_06360 65093 66787 gene locus_tag LOCUS_06370 gene yidC 65093 66787 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401421.1 protein_id gnl|my_center|LOCUS_06370 66905 68275 gene locus_tag LOCUS_06380 gene mnmE 66905 68275 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269445.1 protein_id gnl|my_center|LOCUS_06380 69189 68341 gene locus_tag LOCUS_06390 69189 68341 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225266.1 protein_id gnl|my_center|LOCUS_06390 69969 69292 gene locus_tag LOCUS_06400 69969 69292 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435511.1 protein_id gnl|my_center|LOCUS_06400 71227 70064 gene locus_tag LOCUS_06410 gene hemW 71227 70064 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114885.1 protein_id gnl|my_center|LOCUS_06410 71841 71236 gene locus_tag LOCUS_06420 71841 71236 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174735.1 protein_id gnl|my_center|LOCUS_06420 72216 72932 gene locus_tag LOCUS_06430 72216 72932 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707638.1 protein_id gnl|my_center|LOCUS_06430 74154 72925 gene locus_tag LOCUS_06440 74154 72925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 75506 74193 gene locus_tag LOCUS_06450 gene hemL 75506 74193 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399812.1 protein_id gnl|my_center|LOCUS_06450 76439 75591 gene locus_tag LOCUS_06460 76439 75591 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_06460 76870 76439 gene locus_tag LOCUS_06470 gene hemJ 76870 76439 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113170.1 protein_id gnl|my_center|LOCUS_06470 78689 76923 gene locus_tag LOCUS_06480 78689 76923 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_06480 78974 80008 gene locus_tag LOCUS_06490 gene argC 78974 80008 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113169.1 protein_id gnl|my_center|LOCUS_06490 80107 80460 gene locus_tag LOCUS_06500 gene erpA 80107 80460 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085254.1 protein_id gnl|my_center|LOCUS_06500 80567 81355 gene locus_tag LOCUS_06510 gene glnH 80567 81355 CDS product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937418.1 protein_id gnl|my_center|LOCUS_06510 81462 82133 gene locus_tag LOCUS_06520 81462 82133 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937417.1 protein_id gnl|my_center|LOCUS_06520 82148 82915 gene locus_tag LOCUS_06530 82148 82915 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228477.1 protein_id gnl|my_center|LOCUS_06530 83444 85339 gene locus_tag LOCUS_06540 gene mnmG 83444 85339 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114649.1 protein_id gnl|my_center|LOCUS_06540 85336 85989 gene locus_tag LOCUS_06550 gene rsmG 85336 85989 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100242.1 protein_id gnl|my_center|LOCUS_06550 86050 86820 gene locus_tag LOCUS_06560 86050 86820 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038924.1 protein_id gnl|my_center|LOCUS_06560 86864 87778 gene locus_tag LOCUS_06570 86864 87778 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377885.1 protein_id gnl|my_center|LOCUS_06570 88034 88363 gene locus_tag LOCUS_06580 88034 88363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 88381 89208 gene locus_tag LOCUS_06590 gene atpB 88381 89208 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114072.1 protein_id gnl|my_center|LOCUS_06590 89281 89508 gene locus_tag LOCUS_06600 89281 89508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 89581 90051 gene locus_tag LOCUS_06610 89581 90051 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100235.1 protein_id gnl|my_center|LOCUS_06610 90063 90599 gene locus_tag LOCUS_06620 90063 90599 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_06620 90616 92160 gene locus_tag LOCUS_06630 gene atpA 90616 92160 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097134.1 protein_id gnl|my_center|LOCUS_06630 92232 93113 gene locus_tag LOCUS_06640 gene atpG 92232 93113 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_06640 93180 94556 gene locus_tag LOCUS_06650 gene atpD 93180 94556 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097130.1 protein_id gnl|my_center|LOCUS_06650 94582 95010 gene locus_tag LOCUS_06660 94582 95010 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097128.1 protein_id gnl|my_center|LOCUS_06660 95117 96490 gene locus_tag LOCUS_06670 gene mgtE 95117 96490 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071378.1 protein_id gnl|my_center|LOCUS_06670 96632 97429 gene locus_tag LOCUS_06680 96632 97429 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071506.1 protein_id gnl|my_center|LOCUS_06680 97465 98538 gene locus_tag LOCUS_06690 97465 98538 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227821.1 protein_id gnl|my_center|LOCUS_06690 98643 100007 gene locus_tag LOCUS_06700 gene glmU 98643 100007 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114651.1 protein_id gnl|my_center|LOCUS_06700 100019 101854 gene locus_tag LOCUS_06710 gene glmS 100019 101854 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105589.1 protein_id gnl|my_center|LOCUS_06710 101851 102717 gene locus_tag LOCUS_06720 101851 102717 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021454571.1 protein_id gnl|my_center|LOCUS_06720 103103 104410 gene locus_tag LOCUS_06730 103103 104410 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 protein_id gnl|my_center|LOCUS_06730 104721 104506 gene locus_tag LOCUS_06740 104721 104506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 104971 105828 gene locus_tag LOCUS_06750 gene hexR 104971 105828 CDS product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096857.1 protein_id gnl|my_center|LOCUS_06750 105880 108084 gene locus_tag LOCUS_06760 gene uvrD 105880 108084 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269405.1 protein_id gnl|my_center|LOCUS_06760 108231 109319 gene locus_tag LOCUS_06770 gene dctP 108231 109319 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_06770 109805 109398 gene locus_tag LOCUS_06780 gene yciA 109805 109398 CDS product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419162.1 protein_id gnl|my_center|LOCUS_06780 109940 110899 gene locus_tag LOCUS_06790 109940 110899 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215524.1 protein_id gnl|my_center|LOCUS_06790 110975 112198 gene locus_tag LOCUS_06800 110975 112198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 112195 113727 gene locus_tag LOCUS_06810 gene pstA 112195 113727 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174518729.1 protein_id gnl|my_center|LOCUS_06810 113748 114629 gene locus_tag LOCUS_06820 gene pstB 113748 114629 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_06820 114655 115383 gene locus_tag LOCUS_06830 gene phoU 114655 115383 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378397.1 protein_id gnl|my_center|LOCUS_06830 115487 116239 gene locus_tag LOCUS_06840 gene cysZ 115487 116239 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115194.1 protein_id gnl|my_center|LOCUS_06840 117566 116250 gene locus_tag LOCUS_06850 gene phoR 117566 116250 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 protein_id gnl|my_center|LOCUS_06850 118257 117568 gene locus_tag LOCUS_06860 gene phoB 118257 117568 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096653.1 protein_id gnl|my_center|LOCUS_06860 119234 118341 gene locus_tag LOCUS_06870 gene ubiA 119234 118341 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455228.1 protein_id gnl|my_center|LOCUS_06870 119818 119270 gene locus_tag LOCUS_06880 119818 119270 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114374.1 protein_id gnl|my_center|LOCUS_06880 119894 121054 gene locus_tag LOCUS_06890 119894 121054 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269384.1 protein_id gnl|my_center|LOCUS_06890 121241 121516 gene locus_tag LOCUS_06900 121241 121516 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096630.1 protein_id gnl|my_center|LOCUS_06900 121527 121943 gene locus_tag LOCUS_06910 121527 121943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 124133 122040 gene locus_tag LOCUS_06920 gene recG 124133 122040 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096624.1 protein_id gnl|my_center|LOCUS_06920 125050 124130 gene locus_tag LOCUS_06930 gene oxyR 125050 124130 CDS product oxidative stress transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096622.1 protein_id gnl|my_center|LOCUS_06930 125118 125990 gene locus_tag LOCUS_06940 125118 125990 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 protein_id gnl|my_center|LOCUS_06940 126499 125996 gene locus_tag LOCUS_06950 126499 125996 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266736.1 protein_id gnl|my_center|LOCUS_06950 127043 126528 gene locus_tag LOCUS_06960 gene thpR 127043 126528 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807724.1 protein_id gnl|my_center|LOCUS_06960 127440 127051 gene locus_tag LOCUS_06970 127440 127051 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217718.1 protein_id gnl|my_center|LOCUS_06970 129666 127531 gene locus_tag LOCUS_06980 gene spoT 129666 127531 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_06980 129993 129733 gene locus_tag LOCUS_06990 gene rpoZ 129993 129733 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096602.1 protein_id gnl|my_center|LOCUS_06990 130749 130135 gene locus_tag LOCUS_07000 gene gmk 130749 130135 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_07000 133888 130862 gene locus_tag LOCUS_07010 133888 130862 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064929.1 protein_id gnl|my_center|LOCUS_07010 135747 134104 gene locus_tag LOCUS_07020 135747 134104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 136493 135747 gene locus_tag LOCUS_07030 136493 135747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 139416 137035 gene locus_tag LOCUS_07040 139416 137035 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350101.1 protein_id gnl|my_center|LOCUS_07040 140306 139443 gene locus_tag LOCUS_07050 140306 139443 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098315.1 protein_id gnl|my_center|LOCUS_07050 140452 141189 gene locus_tag LOCUS_07060 gene rph 140452 141189 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096595.1 protein_id gnl|my_center|LOCUS_07060 142062 141295 gene locus_tag LOCUS_07070 142062 141295 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551505.1 protein_id gnl|my_center|LOCUS_07070 142156 142866 gene locus_tag LOCUS_07080 gene pyrE 142156 142866 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096586.1 protein_id gnl|my_center|LOCUS_07080 142935 143492 gene locus_tag LOCUS_07090 142935 143492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 143572 144063 gene locus_tag LOCUS_07100 gene trmL 143572 144063 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932331.1 protein_id gnl|my_center|LOCUS_07100 144060 146138 gene locus_tag LOCUS_07110 gene rep 144060 146138 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110454.1 protein_id gnl|my_center|LOCUS_07110 147088 146276 gene locus_tag LOCUS_07120 147088 146276 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216672.1 protein_id gnl|my_center|LOCUS_07120 147338 147414 gene locus_tag LOCUS_t00080 147338 147414 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 147733 147554 gene locus_tag LOCUS_07130 147733 147554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 147984 147733 gene locus_tag LOCUS_07140 147984 147733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 149278 148013 gene locus_tag LOCUS_07150 149278 148013 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815911.1 protein_id gnl|my_center|LOCUS_07150 150745 149345 gene locus_tag LOCUS_07160 150745 149345 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930606.1 protein_id gnl|my_center|LOCUS_07160 151233 150763 gene locus_tag LOCUS_07170 151233 150763 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130072.1 protein_id gnl|my_center|LOCUS_07170 152503 151235 gene locus_tag LOCUS_07180 152503 151235 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972730.1 protein_id gnl|my_center|LOCUS_07180 153789 152515 gene locus_tag LOCUS_07190 153789 152515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 154326 153805 gene locus_tag LOCUS_07200 154326 153805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 155372 154371 gene locus_tag LOCUS_07210 155372 154371 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561204.1 protein_id gnl|my_center|LOCUS_07210 156483 155506 gene locus_tag LOCUS_07220 156483 155506 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723587.1 protein_id gnl|my_center|LOCUS_07220 156714 157445 gene locus_tag LOCUS_07230 156714 157445 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727258.1 protein_id gnl|my_center|LOCUS_07230 158472 157576 gene locus_tag LOCUS_07240 158472 157576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07240 159409 160548 gene locus_tag LOCUS_07250 159409 160548 CDS product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929848.1 protein_id gnl|my_center|LOCUS_07250 160545 161600 gene locus_tag LOCUS_07260 160545 161600 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804110.1 protein_id gnl|my_center|LOCUS_07260 161711 162115 gene locus_tag LOCUS_07270 161711 162115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 162253 162816 gene locus_tag LOCUS_07280 gene ahpC 162253 162816 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206206.1 protein_id gnl|my_center|LOCUS_07280 162982 164538 gene locus_tag LOCUS_07290 gene ahpF 162982 164538 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111221.1 protein_id gnl|my_center|LOCUS_07290 164731 166428 gene locus_tag LOCUS_07300 164731 166428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 166912 166463 gene locus_tag LOCUS_07310 166912 166463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 167196 166909 gene locus_tag LOCUS_07320 167196 166909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 168033 167308 gene locus_tag LOCUS_07330 168033 167308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 168178 168591 gene locus_tag LOCUS_07340 gene flgB 168178 168591 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097139.1 protein_id gnl|my_center|LOCUS_07340 168604 169011 gene locus_tag LOCUS_07350 gene flgC 168604 169011 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367329.1 protein_id gnl|my_center|LOCUS_07350 169016 169708 gene locus_tag LOCUS_07360 gene flgD 169016 169708 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367328.1 protein_id gnl|my_center|LOCUS_07360 169744 170976 gene locus_tag LOCUS_07370 gene flgE 169744 170976 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034888230.1 protein_id gnl|my_center|LOCUS_07370 171002 171760 gene locus_tag LOCUS_07380 gene flgF 171002 171760 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349311.1 protein_id gnl|my_center|LOCUS_07380 171806 172588 gene locus_tag LOCUS_07390 gene flgG 171806 172588 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625851.1 protein_id gnl|my_center|LOCUS_07390 172614 173309 gene locus_tag LOCUS_07400 gene flgH 172614 173309 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367324.1 protein_id gnl|my_center|LOCUS_07400 173318 174448 gene locus_tag LOCUS_07410 173318 174448 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550967.1 protein_id gnl|my_center|LOCUS_07410 174450 175574 gene locus_tag LOCUS_07420 gene flgJ 174450 175574 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811877.1 protein_id gnl|my_center|LOCUS_07420 175656 177317 gene locus_tag LOCUS_07430 gene flgK 175656 177317 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704937.1 protein_id gnl|my_center|LOCUS_07430 177335 178255 gene locus_tag LOCUS_07440 gene flgL 177335 178255 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704938.1 protein_id gnl|my_center|LOCUS_07440 179173 178376 gene locus_tag LOCUS_07450 gene fliR 179173 178376 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 protein_id gnl|my_center|LOCUS_07450 179453 179184 gene locus_tag LOCUS_07460 gene fliQ 179453 179184 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160414.1 protein_id gnl|my_center|LOCUS_07460 180228 179470 gene locus_tag LOCUS_07470 gene fliP 180228 179470 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061723562.1 protein_id gnl|my_center|LOCUS_07470 180683 180225 gene locus_tag LOCUS_07480 gene fliO 180683 180225 CDS product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535869.1 protein_id gnl|my_center|LOCUS_07480 181198 180680 gene locus_tag LOCUS_07490 gene fliN 181198 180680 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063737.1 protein_id gnl|my_center|LOCUS_07490 182237 181191 gene locus_tag LOCUS_07500 gene fliM 182237 181191 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043526237.1 protein_id gnl|my_center|LOCUS_07500 182731 182252 gene locus_tag LOCUS_07510 gene fliL 182731 182252 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832480.1 protein_id gnl|my_center|LOCUS_07510 184161 182887 gene locus_tag LOCUS_07520 184161 182887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 184638 184180 gene locus_tag LOCUS_07530 184638 184180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 186026 184635 gene locus_tag LOCUS_07540 gene fliI 186026 184635 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097732.1 protein_id gnl|my_center|LOCUS_07540 186805 186023 gene locus_tag LOCUS_07550 gene fliH 186805 186023 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063740.1 protein_id gnl|my_center|LOCUS_07550 187832 186828 gene locus_tag LOCUS_07560 gene fliG 187832 186828 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067735.1 protein_id gnl|my_center|LOCUS_07560 189564 187825 gene locus_tag LOCUS_07570 gene fliF 189564 187825 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704955.1 protein_id gnl|my_center|LOCUS_07570 189816 190145 gene locus_tag LOCUS_07580 gene fliE 189816 190145 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719033.1 protein_id gnl|my_center|LOCUS_07580 190531 190163 gene locus_tag LOCUS_07590 190531 190163 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089169839.1 protein_id gnl|my_center|LOCUS_07590 192642 190672 gene locus_tag LOCUS_07600 192642 190672 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941696.1 protein_id gnl|my_center|LOCUS_07600 194598 192922 gene locus_tag LOCUS_07610 194598 192922 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063730.1 protein_id gnl|my_center|LOCUS_07610 197049 194779 gene locus_tag LOCUS_07620 197049 194779 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 protein_id gnl|my_center|LOCUS_07620 >Feature sequence05 1921 227 gene locus_tag LOCUS_07630 gene betA 1921 227 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104848.1 protein_id gnl|my_center|LOCUS_07630 3400 1931 gene locus_tag LOCUS_07640 gene betB 3400 1931 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114436.1 protein_id gnl|my_center|LOCUS_07640 4012 3413 gene locus_tag LOCUS_07650 gene betI 4012 3413 CDS product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096684.1 protein_id gnl|my_center|LOCUS_07650 4215 5177 gene locus_tag LOCUS_07660 4215 5177 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104841.1 protein_id gnl|my_center|LOCUS_07660 5281 5357 gene locus_tag LOCUS_t00090 5281 5357 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5502 5577 gene locus_tag LOCUS_t00100 5502 5577 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5611 5686 gene locus_tag LOCUS_t00110 5611 5686 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5718 5793 gene locus_tag LOCUS_t00120 5718 5793 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 8037 5983 gene locus_tag LOCUS_07670 8037 5983 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_07670 8134 9465 gene locus_tag LOCUS_07680 8134 9465 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 protein_id gnl|my_center|LOCUS_07680 9604 9528 gene locus_tag LOCUS_t00130 9604 9528 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10751 9660 gene locus_tag LOCUS_07690 gene ychF 10751 9660 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002050104.1 protein_id gnl|my_center|LOCUS_07690 11395 10808 gene locus_tag LOCUS_07700 gene pth 11395 10808 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266729.1 protein_id gnl|my_center|LOCUS_07700 12179 11532 gene locus_tag LOCUS_07710 12179 11532 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 protein_id gnl|my_center|LOCUS_07710 13221 12292 gene locus_tag LOCUS_07720 13221 12292 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099281.1 protein_id gnl|my_center|LOCUS_07720 14169 13315 gene locus_tag LOCUS_07730 gene ispE 14169 13315 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768868.1 protein_id gnl|my_center|LOCUS_07730 14796 14179 gene locus_tag LOCUS_07740 gene lolB 14796 14179 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095005.1 protein_id gnl|my_center|LOCUS_07740 16588 14828 gene locus_tag LOCUS_07750 16588 14828 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103429.1 protein_id gnl|my_center|LOCUS_07750 16788 18056 gene locus_tag LOCUS_07760 gene hemA 16788 18056 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615192.1 protein_id gnl|my_center|LOCUS_07760 18066 19157 gene locus_tag LOCUS_07770 gene prfA 18066 19157 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114692.1 protein_id gnl|my_center|LOCUS_07770 19159 20028 gene locus_tag LOCUS_07780 gene prmC 19159 20028 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117270.1 protein_id gnl|my_center|LOCUS_07780 20277 20777 gene locus_tag LOCUS_07790 gene dadR 20277 20777 CDS product transcriptional regulator DadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096535.1 protein_id gnl|my_center|LOCUS_07790 20774 21532 gene locus_tag LOCUS_07800 20774 21532 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768857.1 protein_id gnl|my_center|LOCUS_07800 21537 22496 gene locus_tag LOCUS_07810 gene bauR 21537 22496 CDS product HTH-type transcriptional activator BauR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083805.1 protein_id gnl|my_center|LOCUS_07810 22599 23885 gene locus_tag LOCUS_07820 22599 23885 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388774.1 protein_id gnl|my_center|LOCUS_07820 23922 25268 gene locus_tag LOCUS_07830 23922 25268 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084290.1 protein_id gnl|my_center|LOCUS_07830 25399 26502 gene locus_tag LOCUS_07840 25399 26502 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071489.1 protein_id gnl|my_center|LOCUS_07840 26595 27779 gene locus_tag LOCUS_07850 gene potA 26595 27779 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071490.1 protein_id gnl|my_center|LOCUS_07850 27804 28715 gene locus_tag LOCUS_07860 27804 28715 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071491.1 protein_id gnl|my_center|LOCUS_07860 28717 29553 gene locus_tag LOCUS_07870 28717 29553 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071492.1 protein_id gnl|my_center|LOCUS_07870 29700 30992 gene locus_tag LOCUS_07880 29700 30992 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114430.1 protein_id gnl|my_center|LOCUS_07880 31284 31886 gene locus_tag LOCUS_07890 31284 31886 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092848.1 protein_id gnl|my_center|LOCUS_07890 33198 31909 gene locus_tag LOCUS_07900 33198 31909 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114273.1 protein_id gnl|my_center|LOCUS_07900 34567 33191 gene locus_tag LOCUS_07910 34567 33191 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112937.1 protein_id gnl|my_center|LOCUS_07910 34808 35587 gene locus_tag LOCUS_07920 34808 35587 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112938.1 protein_id gnl|my_center|LOCUS_07920 35574 36989 gene locus_tag LOCUS_07930 35574 36989 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 protein_id gnl|my_center|LOCUS_07930 36986 38500 gene locus_tag LOCUS_07940 36986 38500 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704251.1 protein_id gnl|my_center|LOCUS_07940 39007 38567 gene locus_tag LOCUS_07950 39007 38567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 39266 39436 gene locus_tag LOCUS_07960 39266 39436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 40000 39449 gene locus_tag LOCUS_07970 40000 39449 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096513.1 protein_id gnl|my_center|LOCUS_07970 41497 40043 gene locus_tag LOCUS_07980 gene gatB 41497 40043 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112870.1 protein_id gnl|my_center|LOCUS_07980 42957 41497 gene locus_tag LOCUS_07990 gene gatA 42957 41497 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091960758.1 protein_id gnl|my_center|LOCUS_07990 43305 43018 gene locus_tag LOCUS_08000 gene gatC 43305 43018 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_08000 43479 44516 gene locus_tag LOCUS_08010 gene mreB 43479 44516 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 protein_id gnl|my_center|LOCUS_08010 44600 45469 gene locus_tag LOCUS_08020 44600 45469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08020 45469 45963 gene locus_tag LOCUS_08030 gene mreD 45469 45963 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094389.1 protein_id gnl|my_center|LOCUS_08030 45978 46592 gene locus_tag LOCUS_08040 45978 46592 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112737.1 protein_id gnl|my_center|LOCUS_08040 46626 48089 gene locus_tag LOCUS_08050 gene rng 46626 48089 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_08050 48094 51930 gene locus_tag LOCUS_08060 48094 51930 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103968156.1 protein_id gnl|my_center|LOCUS_08060 51927 53381 gene locus_tag LOCUS_08070 gene tldD 51927 53381 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819195.1 protein_id gnl|my_center|LOCUS_08070 54047 53508 gene locus_tag LOCUS_08080 gene yjgA 54047 53508 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094378.1 protein_id gnl|my_center|LOCUS_08080 54164 55504 gene locus_tag LOCUS_08090 gene pmbA 54164 55504 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112740.1 protein_id gnl|my_center|LOCUS_08090 55836 55567 gene locus_tag LOCUS_08100 55836 55567 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073703.1 protein_id gnl|my_center|LOCUS_08100 56769 55840 gene locus_tag LOCUS_08110 gene rapZ 56769 55840 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094361.1 protein_id gnl|my_center|LOCUS_08110 57278 56814 gene locus_tag LOCUS_08120 gene ptsN 57278 56814 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766506.1 protein_id gnl|my_center|LOCUS_08120 57593 57285 gene locus_tag LOCUS_08130 gene hpf 57593 57285 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_08130 59274 57859 gene locus_tag LOCUS_08140 59274 57859 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094357.1 protein_id gnl|my_center|LOCUS_08140 60164 59439 gene locus_tag LOCUS_08150 gene lptB 60164 59439 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 protein_id gnl|my_center|LOCUS_08150 60680 60174 gene locus_tag LOCUS_08160 60680 60174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 61267 60677 gene locus_tag LOCUS_08170 61267 60677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 61829 61272 gene locus_tag LOCUS_08180 61829 61272 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_08180 62853 61858 gene locus_tag LOCUS_08190 gene kdsD 62853 61858 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134758.1 protein_id gnl|my_center|LOCUS_08190 63880 62924 gene locus_tag LOCUS_08200 63880 62924 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_08200 64027 64839 gene locus_tag LOCUS_08210 64027 64839 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620333.1 protein_id gnl|my_center|LOCUS_08210 64836 65618 gene locus_tag LOCUS_08220 gene mlaE 64836 65618 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094341.1 protein_id gnl|my_center|LOCUS_08220 65701 66165 gene locus_tag LOCUS_08230 gene mlaD 65701 66165 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377572.1 protein_id gnl|my_center|LOCUS_08230 66211 66864 gene locus_tag LOCUS_08240 66211 66864 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094337.1 protein_id gnl|my_center|LOCUS_08240 66861 67196 gene locus_tag LOCUS_08250 66861 67196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 67327 67581 gene locus_tag LOCUS_08260 gene ibaG 67327 67581 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429656.1 protein_id gnl|my_center|LOCUS_08260 67595 68857 gene locus_tag LOCUS_08270 gene murA 67595 68857 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_08270 68877 69530 gene locus_tag LOCUS_08280 gene hisG 68877 69530 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098837.1 protein_id gnl|my_center|LOCUS_08280 69627 70958 gene locus_tag LOCUS_08290 gene hisD 69627 70958 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094326.1 protein_id gnl|my_center|LOCUS_08290 72304 71051 gene locus_tag LOCUS_08300 gene algW 72304 71051 CDS product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098831.1 protein_id gnl|my_center|LOCUS_08300 72407 73168 gene locus_tag LOCUS_08310 72407 73168 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094318.1 protein_id gnl|my_center|LOCUS_08310 73858 73418 gene locus_tag LOCUS_08320 73858 73418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 74065 75234 gene locus_tag LOCUS_08330 gene zapE 74065 75234 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094297.1 protein_id gnl|my_center|LOCUS_08330 75426 75854 gene locus_tag LOCUS_08340 gene rplM 75426 75854 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094164.1 protein_id gnl|my_center|LOCUS_08340 75868 76257 gene locus_tag LOCUS_08350 gene rpsI 75868 76257 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098810.1 protein_id gnl|my_center|LOCUS_08350 76645 77079 gene locus_tag LOCUS_08360 76645 77079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 77079 78338 gene locus_tag LOCUS_08370 77079 78338 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_08370 78338 79105 gene locus_tag LOCUS_08380 78338 79105 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262642.1 protein_id gnl|my_center|LOCUS_08380 79251 79877 gene locus_tag LOCUS_08390 gene sspA 79251 79877 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162411.1 protein_id gnl|my_center|LOCUS_08390 79938 80414 gene locus_tag LOCUS_08400 gene sspB 79938 80414 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458208.1 protein_id gnl|my_center|LOCUS_08400 81086 80508 gene locus_tag LOCUS_08410 81086 80508 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094151.1 protein_id gnl|my_center|LOCUS_08410 81685 81092 gene locus_tag LOCUS_08420 81685 81092 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620308.1 protein_id gnl|my_center|LOCUS_08420 82104 81736 gene locus_tag LOCUS_08430 82104 81736 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703589.1 protein_id gnl|my_center|LOCUS_08430 83848 82088 gene locus_tag LOCUS_08440 83848 82088 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268851.1 protein_id gnl|my_center|LOCUS_08440 83921 84754 gene locus_tag LOCUS_08450 gene rsmI 83921 84754 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035951.1 protein_id gnl|my_center|LOCUS_08450 85218 86174 gene locus_tag LOCUS_08460 gene rsmH 85218 86174 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110151.1 protein_id gnl|my_center|LOCUS_08460 86185 86508 gene locus_tag LOCUS_08470 86185 86508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 86505 88214 gene locus_tag LOCUS_08480 gene ftsI 86505 88214 CDS product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_08480 88267 89790 gene locus_tag LOCUS_08490 88267 89790 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112751.1 protein_id gnl|my_center|LOCUS_08490 89787 91154 gene locus_tag LOCUS_08500 89787 91154 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103103.1 protein_id gnl|my_center|LOCUS_08500 91164 92246 gene locus_tag LOCUS_08510 gene mraY 91164 92246 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_08510 92285 93664 gene locus_tag LOCUS_08520 gene murD 92285 93664 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103104.1 protein_id gnl|my_center|LOCUS_08520 93661 94884 gene locus_tag LOCUS_08530 gene ftsW 93661 94884 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094125.1 protein_id gnl|my_center|LOCUS_08530 94881 95969 gene locus_tag LOCUS_08540 gene murG 94881 95969 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103107.1 protein_id gnl|my_center|LOCUS_08540 95959 97440 gene locus_tag LOCUS_08550 gene murC 95959 97440 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 protein_id gnl|my_center|LOCUS_08550 97437 98366 gene locus_tag LOCUS_08560 97437 98366 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_08560 98363 99088 gene locus_tag LOCUS_08570 98363 99088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 99284 100576 gene locus_tag LOCUS_08580 gene ftsA 99284 100576 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364017.1 protein_id gnl|my_center|LOCUS_08580 100612 101787 gene locus_tag LOCUS_08590 gene ftsZ 100612 101787 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555041.1 protein_id gnl|my_center|LOCUS_08590 101900 102811 gene locus_tag LOCUS_08600 gene lpxC 101900 102811 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_08600 103336 102878 gene locus_tag LOCUS_08610 103336 102878 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377653.1 protein_id gnl|my_center|LOCUS_08610 103443 103814 gene locus_tag LOCUS_08620 103443 103814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 103859 106627 gene locus_tag LOCUS_08630 gene secA 103859 106627 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112752.1 protein_id gnl|my_center|LOCUS_08630 106663 107892 gene locus_tag LOCUS_08640 gene argJ 106663 107892 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110156.1 protein_id gnl|my_center|LOCUS_08640 107990 108922 gene locus_tag LOCUS_08650 107990 108922 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112754.1 protein_id gnl|my_center|LOCUS_08650 110039 109137 gene locus_tag LOCUS_08660 110039 109137 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_08660 111238 110183 gene locus_tag LOCUS_08670 111238 110183 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_08670 111404 112225 gene locus_tag LOCUS_08680 111404 112225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 112222 114483 gene locus_tag LOCUS_08690 112222 114483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 114582 115823 gene locus_tag LOCUS_08700 114582 115823 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119805.1 protein_id gnl|my_center|LOCUS_08700 115831 116577 gene locus_tag LOCUS_08710 gene lolD 115831 116577 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 protein_id gnl|my_center|LOCUS_08710 117181 116642 gene locus_tag LOCUS_08720 117181 116642 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_08720 117318 119612 gene locus_tag LOCUS_08730 117318 119612 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267142.1 protein_id gnl|my_center|LOCUS_08730 119651 120343 gene locus_tag LOCUS_08740 119651 120343 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_08740 120346 120762 gene locus_tag LOCUS_08750 120346 120762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 120759 122519 gene locus_tag LOCUS_08760 gene msbA 120759 122519 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114544.1 protein_id gnl|my_center|LOCUS_08760 122599 123636 gene locus_tag LOCUS_08770 gene lpxK 122599 123636 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018915793.1 protein_id gnl|my_center|LOCUS_08770 123665 123874 gene locus_tag LOCUS_08780 123665 123874 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211315.1 protein_id gnl|my_center|LOCUS_08780 123874 124662 gene locus_tag LOCUS_08790 gene kdsB 123874 124662 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106922.1 protein_id gnl|my_center|LOCUS_08790 124662 125138 gene locus_tag LOCUS_08800 124662 125138 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 protein_id gnl|my_center|LOCUS_08800 125135 126157 gene locus_tag LOCUS_08810 gene murB 125135 126157 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106928.1 protein_id gnl|my_center|LOCUS_08810 129560 126249 gene locus_tag LOCUS_08820 129560 126249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08820 130137 131084 gene locus_tag LOCUS_08830 gene rluC 130137 131084 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157930.1 protein_id gnl|my_center|LOCUS_08830 131112 131786 gene locus_tag LOCUS_08840 131112 131786 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_08840 131812 132888 gene locus_tag LOCUS_08850 gene sppA 131812 132888 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_08850 133606 133016 gene locus_tag LOCUS_08860 133606 133016 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137608.1 protein_id gnl|my_center|LOCUS_08860 133725 134306 gene locus_tag LOCUS_08870 gene yceD 133725 134306 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705036.1 protein_id gnl|my_center|LOCUS_08870 134340 134510 gene locus_tag LOCUS_08880 gene rpmF 134340 134510 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091143.1 protein_id gnl|my_center|LOCUS_08880 134576 135670 gene locus_tag LOCUS_08890 gene plsX 134576 135670 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054091481.1 protein_id gnl|my_center|LOCUS_08890 135676 136644 gene locus_tag LOCUS_08900 gene fabD 135676 136644 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032624.1 protein_id gnl|my_center|LOCUS_08900 136676 137419 gene locus_tag LOCUS_08910 gene fabG 136676 137419 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091137.1 protein_id gnl|my_center|LOCUS_08910 137553 137786 gene locus_tag LOCUS_08920 gene acpP 137553 137786 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091135.1 protein_id gnl|my_center|LOCUS_08920 138012 139229 gene locus_tag LOCUS_08930 gene fabF 138012 139229 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072710.1 protein_id gnl|my_center|LOCUS_08930 139226 140074 gene locus_tag LOCUS_08940 gene pabC 139226 140074 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245844.1 protein_id gnl|my_center|LOCUS_08940 140096 141103 gene locus_tag LOCUS_08950 gene mltG 140096 141103 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_08950 141114 141755 gene locus_tag LOCUS_08960 gene tmk 141114 141755 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091125.1 protein_id gnl|my_center|LOCUS_08960 141746 142774 gene locus_tag LOCUS_08970 141746 142774 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267154.1 protein_id gnl|my_center|LOCUS_08970 142791 143126 gene locus_tag LOCUS_08980 142791 143126 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036225.1 protein_id gnl|my_center|LOCUS_08980 143257 144102 gene locus_tag LOCUS_08990 143257 144102 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091117.1 protein_id gnl|my_center|LOCUS_08990 144149 144718 gene locus_tag LOCUS_09000 144149 144718 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534495.1 protein_id gnl|my_center|LOCUS_09000 144808 146916 gene locus_tag LOCUS_09010 144808 146916 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403487.1 protein_id gnl|my_center|LOCUS_09010 146913 147737 gene locus_tag LOCUS_09020 146913 147737 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109274.1 protein_id gnl|my_center|LOCUS_09020 149542 147878 gene locus_tag LOCUS_09030 149542 147878 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102932.1 protein_id gnl|my_center|LOCUS_09030 149849 150634 gene locus_tag LOCUS_09040 149849 150634 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091107.1 protein_id gnl|my_center|LOCUS_09040 150649 151587 gene locus_tag LOCUS_09050 150649 151587 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091099.1 protein_id gnl|my_center|LOCUS_09050 151869 152480 gene locus_tag LOCUS_09060 151869 152480 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098862.1 protein_id gnl|my_center|LOCUS_09060 152722 153504 gene locus_tag LOCUS_09070 152722 153504 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_09070 153528 154874 gene locus_tag LOCUS_09080 153528 154874 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707899.1 protein_id gnl|my_center|LOCUS_09080 154855 155391 gene locus_tag LOCUS_09090 154855 155391 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458945.1 protein_id gnl|my_center|LOCUS_09090 155384 155791 gene locus_tag LOCUS_09100 155384 155791 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_09100 155788 156537 gene locus_tag LOCUS_09110 155788 156537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 157768 156566 gene locus_tag LOCUS_09120 157768 156566 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926962.1 protein_id gnl|my_center|LOCUS_09120 158698 157871 gene locus_tag LOCUS_09130 gene xthA 158698 157871 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104469.1 protein_id gnl|my_center|LOCUS_09130 158943 158698 gene locus_tag LOCUS_09140 158943 158698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 159101 160378 gene locus_tag LOCUS_09150 gene rhlB 159101 160378 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119269.1 protein_id gnl|my_center|LOCUS_09150 160383 162524 gene locus_tag LOCUS_09160 gene dinG 160383 162524 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402334.1 protein_id gnl|my_center|LOCUS_09160 163685 162606 gene locus_tag LOCUS_09170 163685 162606 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315709.1 protein_id gnl|my_center|LOCUS_09170 164000 164605 gene locus_tag LOCUS_09180 gene rpoE 164000 164605 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_09180 164800 165516 gene locus_tag LOCUS_09190 164800 165516 CDS product anti sigma-E factor RseA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246812.1 protein_id gnl|my_center|LOCUS_09190 165533 166528 gene locus_tag LOCUS_09200 gene mucB 165533 166528 CDS product sigma factor AlgU regulator MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101960.1 protein_id gnl|my_center|LOCUS_09200 166705 168129 gene locus_tag LOCUS_09210 gene mucD 166705 168129 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_09210 168288 170105 gene locus_tag LOCUS_09220 gene lepA 168288 170105 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739190.1 protein_id gnl|my_center|LOCUS_09220 170148 170951 gene locus_tag LOCUS_09230 gene lepB 170148 170951 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101969.1 protein_id gnl|my_center|LOCUS_09230 171057 171761 gene locus_tag LOCUS_09240 gene rnc 171057 171761 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554906.1 protein_id gnl|my_center|LOCUS_09240 171758 172657 gene locus_tag LOCUS_09250 gene era 171758 172657 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085566.1 protein_id gnl|my_center|LOCUS_09250 172658 173359 gene locus_tag LOCUS_09260 gene recO 172658 173359 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101972.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence06 353 277 gene locus_tag LOCUS_t00140 353 277 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 499 1164 gene locus_tag LOCUS_09270 499 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 2138 1167 gene locus_tag LOCUS_09280 2138 1167 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014387.1 protein_id gnl|my_center|LOCUS_09280 3966 2131 gene locus_tag LOCUS_09290 3966 2131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_09290 4162 6339 gene locus_tag LOCUS_09300 4162 6339 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815626.1 protein_id gnl|my_center|LOCUS_09300 6518 7432 gene locus_tag LOCUS_09310 6518 7432 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153529.1 protein_id gnl|my_center|LOCUS_09310 7504 8379 gene locus_tag LOCUS_09320 7504 8379 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087746.1 protein_id gnl|my_center|LOCUS_09320 8427 9641 gene locus_tag LOCUS_09330 8427 9641 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403228.1 protein_id gnl|my_center|LOCUS_09330 9638 11125 gene locus_tag LOCUS_09340 9638 11125 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943547.1 protein_id gnl|my_center|LOCUS_09340 11122 12525 gene locus_tag LOCUS_09350 11122 12525 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_09350 13086 12721 gene locus_tag LOCUS_09360 13086 12721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 13524 13192 gene locus_tag LOCUS_09370 13524 13192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 13881 15131 gene locus_tag LOCUS_09380 13881 15131 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172728.1 protein_id gnl|my_center|LOCUS_09380 15131 15970 gene locus_tag LOCUS_09390 15131 15970 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939573.1 protein_id gnl|my_center|LOCUS_09390 16048 16920 gene locus_tag LOCUS_09400 16048 16920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09400 17175 17600 gene locus_tag LOCUS_09410 17175 17600 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088599.1 protein_id gnl|my_center|LOCUS_09410 17652 19310 gene locus_tag LOCUS_09420 17652 19310 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723553.1 protein_id gnl|my_center|LOCUS_09420 20109 19387 gene locus_tag LOCUS_09430 20109 19387 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483201.1 protein_id gnl|my_center|LOCUS_09430 22026 20113 gene locus_tag LOCUS_09440 22026 20113 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464433.1 protein_id gnl|my_center|LOCUS_09440 22558 22175 gene locus_tag LOCUS_09450 22558 22175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 22760 23800 gene locus_tag LOCUS_09460 22760 23800 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098734.1 protein_id gnl|my_center|LOCUS_09460 26738 23760 gene locus_tag LOCUS_09470 gene fdhF 26738 23760 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_09470 28467 26749 gene locus_tag LOCUS_09480 28467 26749 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_09480 29025 28627 gene locus_tag LOCUS_09490 29025 28627 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529414.1 protein_id gnl|my_center|LOCUS_09490 29819 29052 gene locus_tag LOCUS_09500 29819 29052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 31576 29816 gene locus_tag LOCUS_09510 31576 29816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975260.1 protein_id gnl|my_center|LOCUS_09510 33158 31569 gene locus_tag LOCUS_09520 33158 31569 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479897.1 protein_id gnl|my_center|LOCUS_09520 34191 33199 gene locus_tag LOCUS_09530 34191 33199 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969369.1 protein_id gnl|my_center|LOCUS_09530 35641 34202 gene locus_tag LOCUS_09540 35641 34202 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127580446.1 protein_id gnl|my_center|LOCUS_09540 35736 36641 gene locus_tag LOCUS_09550 35736 36641 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130010930.1 protein_id gnl|my_center|LOCUS_09550 37327 36623 gene locus_tag LOCUS_09560 gene mtgA 37327 36623 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023518284.1 protein_id gnl|my_center|LOCUS_09560 38305 37448 gene locus_tag LOCUS_09570 gene fghA 38305 37448 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027907389.1 protein_id gnl|my_center|LOCUS_09570 39490 38381 gene locus_tag LOCUS_09580 39490 38381 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038487.1 protein_id gnl|my_center|LOCUS_09580 39618 40565 gene locus_tag LOCUS_09590 39618 40565 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 protein_id gnl|my_center|LOCUS_09590 40611 40976 gene locus_tag LOCUS_09600 40611 40976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966733.1 protein_id gnl|my_center|LOCUS_09600 40983 41393 gene locus_tag LOCUS_09610 40983 41393 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971000.1 protein_id gnl|my_center|LOCUS_09610 42215 41409 gene locus_tag LOCUS_09620 42215 41409 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088931.1 protein_id gnl|my_center|LOCUS_09620 42973 42206 gene locus_tag LOCUS_09630 42973 42206 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528736.1 protein_id gnl|my_center|LOCUS_09630 43977 42970 gene locus_tag LOCUS_09640 43977 42970 CDS product YVTN family beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066872222.1 protein_id gnl|my_center|LOCUS_09640 45176 43965 gene locus_tag LOCUS_09650 45176 43965 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088928.1 protein_id gnl|my_center|LOCUS_09650 45904 45251 gene locus_tag LOCUS_09660 45904 45251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088932.1 protein_id gnl|my_center|LOCUS_09660 46743 45901 gene locus_tag LOCUS_09670 46743 45901 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920376.1 protein_id gnl|my_center|LOCUS_09670 47274 46795 gene locus_tag LOCUS_09680 47274 46795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 49162 47378 gene locus_tag LOCUS_09690 49162 47378 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719727.1 protein_id gnl|my_center|LOCUS_09690 49730 50659 gene locus_tag LOCUS_09700 gene pqqB 49730 50659 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113495.1 protein_id gnl|my_center|LOCUS_09700 50772 51506 gene locus_tag LOCUS_09710 gene pqqC 50772 51506 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402120.1 protein_id gnl|my_center|LOCUS_09710 51506 51793 gene locus_tag LOCUS_09720 gene pqqD 51506 51793 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366526.1 protein_id gnl|my_center|LOCUS_09720 51786 52937 gene locus_tag LOCUS_09730 gene pqqE 51786 52937 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119136.1 protein_id gnl|my_center|LOCUS_09730 52934 55486 gene locus_tag LOCUS_09740 52934 55486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 55555 56286 gene locus_tag LOCUS_09750 gene gfa 55555 56286 CDS product S-(hydroxymethyl)glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975095.1 protein_id gnl|my_center|LOCUS_09750 57364 56381 gene locus_tag LOCUS_09760 57364 56381 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391055.1 protein_id gnl|my_center|LOCUS_09760 58254 57367 gene locus_tag LOCUS_09770 58254 57367 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931547.1 protein_id gnl|my_center|LOCUS_09770 59533 58313 gene locus_tag LOCUS_09780 59533 58313 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973580.1 protein_id gnl|my_center|LOCUS_09780 60351 59605 gene locus_tag LOCUS_09790 60351 59605 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195807.1 protein_id gnl|my_center|LOCUS_09790 61121 60348 gene locus_tag LOCUS_09800 61121 60348 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195806.1 protein_id gnl|my_center|LOCUS_09800 61560 62216 gene locus_tag LOCUS_09810 61560 62216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 64170 62320 gene locus_tag LOCUS_09820 gene rpoD 64170 62320 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085035.1 protein_id gnl|my_center|LOCUS_09820 66252 64411 gene locus_tag LOCUS_09830 66252 64411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 66622 66407 gene locus_tag LOCUS_09840 gene rpsU 66622 66407 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085057.1 protein_id gnl|my_center|LOCUS_09840 66888 67916 gene locus_tag LOCUS_09850 gene tsaD 66888 67916 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109020.1 protein_id gnl|my_center|LOCUS_09850 68500 67913 gene locus_tag LOCUS_09860 gene plsY 68500 67913 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703522.1 protein_id gnl|my_center|LOCUS_09860 68683 69048 gene locus_tag LOCUS_09870 gene folB 68683 69048 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099587.1 protein_id gnl|my_center|LOCUS_09870 69048 69563 gene locus_tag LOCUS_09880 gene folK 69048 69563 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 protein_id gnl|my_center|LOCUS_09880 70872 69724 gene locus_tag LOCUS_09890 70872 69724 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113214.1 protein_id gnl|my_center|LOCUS_09890 71199 70876 gene locus_tag LOCUS_09900 gene glpE 71199 70876 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269136.1 protein_id gnl|my_center|LOCUS_09900 72053 71235 gene locus_tag LOCUS_09910 72053 71235 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110655318.1 protein_id gnl|my_center|LOCUS_09910 72483 72088 gene locus_tag LOCUS_09920 gene apaG 72483 72088 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815381.1 protein_id gnl|my_center|LOCUS_09920 73301 72480 gene locus_tag LOCUS_09930 gene rsmA 73301 72480 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_09930 74510 73461 gene locus_tag LOCUS_09940 gene pdxA 74510 73461 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109023.1 protein_id gnl|my_center|LOCUS_09940 75166 74510 gene locus_tag LOCUS_09950 75166 74510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 77649 75214 gene locus_tag LOCUS_09960 gene lptD 77649 75214 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113209.1 protein_id gnl|my_center|LOCUS_09960 77821 78837 gene locus_tag LOCUS_09970 77821 78837 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269130.1 protein_id gnl|my_center|LOCUS_09970 78834 79508 gene locus_tag LOCUS_09980 gene murU 78834 79508 CDS product N-acetylmuramate alpha-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099549.1 protein_id gnl|my_center|LOCUS_09980 79699 80118 gene locus_tag LOCUS_09990 79699 80118 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_09990 80837 80193 gene locus_tag LOCUS_10000 gene coq7 80837 80193 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085224.1 protein_id gnl|my_center|LOCUS_10000 81349 81008 gene locus_tag LOCUS_10010 81349 81008 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269102.1 protein_id gnl|my_center|LOCUS_10010 82254 81382 gene locus_tag LOCUS_10020 82254 81382 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274690.1 protein_id gnl|my_center|LOCUS_10020 82694 82254 gene locus_tag LOCUS_10030 82694 82254 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972581.1 protein_id gnl|my_center|LOCUS_10030 84032 82740 gene locus_tag LOCUS_10040 gene purD 84032 82740 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105150.1 protein_id gnl|my_center|LOCUS_10040 84646 84194 gene locus_tag LOCUS_10050 84646 84194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 84789 85502 gene locus_tag LOCUS_10060 84789 85502 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095898.1 protein_id gnl|my_center|LOCUS_10060 86086 85529 gene locus_tag LOCUS_10070 86086 85529 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706999.1 protein_id gnl|my_center|LOCUS_10070 87476 86205 gene locus_tag LOCUS_10080 87476 86205 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114332.1 protein_id gnl|my_center|LOCUS_10080 88149 87673 gene locus_tag LOCUS_10090 88149 87673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 89570 88161 gene locus_tag LOCUS_10100 89570 88161 CDS product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140837.1 protein_id gnl|my_center|LOCUS_10100 90272 89868 gene locus_tag LOCUS_10110 gene mnhG 90272 89868 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958313.1 protein_id gnl|my_center|LOCUS_10110 90534 90265 gene locus_tag LOCUS_10120 90534 90265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 91029 90556 gene locus_tag LOCUS_10130 91029 90556 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942976.1 protein_id gnl|my_center|LOCUS_10130 92600 91026 gene locus_tag LOCUS_10140 92600 91026 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942977.1 protein_id gnl|my_center|LOCUS_10140 92944 92597 gene locus_tag LOCUS_10150 92944 92597 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 protein_id gnl|my_center|LOCUS_10150 93409 92978 gene locus_tag LOCUS_10160 93409 92978 CDS product Na+/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942979.1 protein_id gnl|my_center|LOCUS_10160 95732 93402 gene locus_tag LOCUS_10170 95732 93402 CDS product putative monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404440.1 protein_id gnl|my_center|LOCUS_10170 96128 98938 gene locus_tag LOCUS_10180 96128 98938 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 protein_id gnl|my_center|LOCUS_10180 98938 99279 gene locus_tag LOCUS_10190 98938 99279 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 protein_id gnl|my_center|LOCUS_10190 99276 100817 gene locus_tag LOCUS_10200 99276 100817 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 protein_id gnl|my_center|LOCUS_10200 100814 101311 gene locus_tag LOCUS_10210 100814 101311 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 protein_id gnl|my_center|LOCUS_10210 101305 101574 gene locus_tag LOCUS_10220 101305 101574 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 protein_id gnl|my_center|LOCUS_10220 101585 102010 gene locus_tag LOCUS_10230 101585 102010 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051234295.1 protein_id gnl|my_center|LOCUS_10230 103156 102056 gene locus_tag LOCUS_10240 gene hemH 103156 102056 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161601244.1 protein_id gnl|my_center|LOCUS_10240 103272 104885 gene locus_tag LOCUS_10250 103272 104885 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267236.1 protein_id gnl|my_center|LOCUS_10250 104882 105280 gene locus_tag LOCUS_10260 104882 105280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 105614 105312 gene locus_tag LOCUS_10270 105614 105312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 106030 105737 gene locus_tag LOCUS_10280 106030 105737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 107521 106133 gene locus_tag LOCUS_10290 gene dnaB 107521 106133 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317209.1 protein_id gnl|my_center|LOCUS_10290 108164 107718 gene locus_tag LOCUS_10300 gene rplI 108164 107718 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480442.1 protein_id gnl|my_center|LOCUS_10300 109028 108180 gene locus_tag LOCUS_10310 109028 108180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095630.1 protein_id gnl|my_center|LOCUS_10310 109268 109041 gene locus_tag LOCUS_10320 gene rpsR 109268 109041 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_10320 109670 109302 gene locus_tag LOCUS_10330 gene rpsF 109670 109302 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308887.1 protein_id gnl|my_center|LOCUS_10330 110635 109841 gene locus_tag LOCUS_10340 gene rlmB 110635 109841 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704174.1 protein_id gnl|my_center|LOCUS_10340 113126 110715 gene locus_tag LOCUS_10350 gene rnr 113126 110715 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112282.1 protein_id gnl|my_center|LOCUS_10350 113359 113445 gene locus_tag LOCUS_t00150 113359 113445 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 113519 113605 gene locus_tag LOCUS_t00160 113519 113605 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 113650 113736 gene locus_tag LOCUS_t00170 113650 113736 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 114707 113838 gene locus_tag LOCUS_10360 114707 113838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 115073 114798 gene locus_tag LOCUS_10370 115073 114798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 115648 115181 gene locus_tag LOCUS_10380 115648 115181 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037783.1 protein_id gnl|my_center|LOCUS_10380 115850 116164 gene locus_tag LOCUS_10390 115850 116164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 117828 116272 gene locus_tag LOCUS_10400 117828 116272 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099581.1 protein_id gnl|my_center|LOCUS_10400 119144 117858 gene locus_tag LOCUS_10410 119144 117858 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244449.1 protein_id gnl|my_center|LOCUS_10410 121158 119236 gene locus_tag LOCUS_10420 121158 119236 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085078.1 protein_id gnl|my_center|LOCUS_10420 123419 121407 gene locus_tag LOCUS_10430 123419 121407 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031412.1 protein_id gnl|my_center|LOCUS_10430 123708 123632 gene locus_tag LOCUS_t00180 123708 123632 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 123788 123712 gene locus_tag LOCUS_t00190 123788 123712 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 123956 123880 gene locus_tag LOCUS_t00200 123956 123880 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 124061 123985 gene locus_tag LOCUS_t00210 124061 123985 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 124178 124103 gene locus_tag LOCUS_t00220 124178 124103 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 125003 124305 gene locus_tag LOCUS_10440 125003 124305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105994.1 protein_id gnl|my_center|LOCUS_10440 125185 126609 gene locus_tag LOCUS_10450 gene ccoN 125185 126609 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087306.1 protein_id gnl|my_center|LOCUS_10450 126633 127241 gene locus_tag LOCUS_10460 gene ccoO 126633 127241 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 protein_id gnl|my_center|LOCUS_10460 127244 127474 gene locus_tag LOCUS_10470 127244 127474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 127471 128400 gene locus_tag LOCUS_10480 gene ccoP 127471 128400 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268424.1 protein_id gnl|my_center|LOCUS_10480 128534 129973 gene locus_tag LOCUS_10490 gene ccoG 128534 129973 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_10490 129975 130499 gene locus_tag LOCUS_10500 129975 130499 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268427.1 protein_id gnl|my_center|LOCUS_10500 130531 133011 gene locus_tag LOCUS_10510 130531 133011 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268428.1 protein_id gnl|my_center|LOCUS_10510 133008 133238 gene locus_tag LOCUS_10520 133008 133238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 133238 133936 gene locus_tag LOCUS_10530 133238 133936 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_10530 134034 135425 gene locus_tag LOCUS_10540 gene hemN 134034 135425 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 protein_id gnl|my_center|LOCUS_10540 135527 136270 gene locus_tag LOCUS_10550 gene anr 135527 136270 CDS product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 protein_id gnl|my_center|LOCUS_10550 137214 136288 gene locus_tag LOCUS_10560 gene ttcA 137214 136288 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082462.1 protein_id gnl|my_center|LOCUS_10560 137936 137310 gene locus_tag LOCUS_10570 137936 137310 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114810.1 protein_id gnl|my_center|LOCUS_10570 139812 137992 gene locus_tag LOCUS_10580 139812 137992 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478579.1 protein_id gnl|my_center|LOCUS_10580 140528 140788 gene locus_tag LOCUS_10590 140528 140788 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720744.1 protein_id gnl|my_center|LOCUS_10590 140795 142591 gene locus_tag LOCUS_10600 140795 142591 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_10600 142685 143200 gene locus_tag LOCUS_10610 142685 143200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338329.1 protein_id gnl|my_center|LOCUS_10610 143265 146198 gene locus_tag LOCUS_10620 143265 146198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 146195 147208 gene locus_tag LOCUS_10630 146195 147208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 148003 147341 gene locus_tag LOCUS_10640 148003 147341 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039130.1 protein_id gnl|my_center|LOCUS_10640 150172 148223 gene locus_tag LOCUS_10650 gene acs 150172 148223 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_10650 150908 150348 gene locus_tag LOCUS_10660 150908 150348 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706911.1 protein_id gnl|my_center|LOCUS_10660 151025 151669 gene locus_tag LOCUS_10670 151025 151669 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083037.1 protein_id gnl|my_center|LOCUS_10670 152816 151695 gene locus_tag LOCUS_10680 152816 151695 CDS product phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246215.1 protein_id gnl|my_center|LOCUS_10680 152931 155414 gene locus_tag LOCUS_10690 gene plsB 152931 155414 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245401.1 protein_id gnl|my_center|LOCUS_10690 156179 155415 gene locus_tag LOCUS_10700 156179 155415 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113853.1 protein_id gnl|my_center|LOCUS_10700 156880 156176 gene locus_tag LOCUS_10710 gene tsaB 156880 156176 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266959.1 protein_id gnl|my_center|LOCUS_10710 157643 156987 gene locus_tag LOCUS_10720 gene adk 157643 156987 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092485.1 protein_id gnl|my_center|LOCUS_10720 159866 157878 gene locus_tag LOCUS_10730 gene aceF 159866 157878 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070783.1 protein_id gnl|my_center|LOCUS_10730 162600 159928 gene locus_tag LOCUS_10740 gene aceE 162600 159928 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 protein_id gnl|my_center|LOCUS_10740 163515 162949 gene locus_tag LOCUS_10750 gene ampD 163515 162949 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923703.1 protein_id gnl|my_center|LOCUS_10750 163629 164480 gene locus_tag LOCUS_10760 gene nadC 163629 164480 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_10760 165015 164485 gene locus_tag LOCUS_10770 165015 164485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 165118 165843 gene locus_tag LOCUS_10780 gene tsaA 165118 165843 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706829.1 protein_id gnl|my_center|LOCUS_10780 166618 165905 gene locus_tag LOCUS_10790 166618 165905 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108622.1 protein_id gnl|my_center|LOCUS_10790 167483 166677 gene locus_tag LOCUS_10800 167483 166677 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_10800 168463 167483 gene locus_tag LOCUS_10810 168463 167483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 169378 168494 gene locus_tag LOCUS_10820 gene dapA 169378 168494 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379025.1 protein_id gnl|my_center|LOCUS_10820 169590 170063 gene locus_tag LOCUS_10830 169590 170063 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317382.1 protein_id gnl|my_center|LOCUS_10830 171209 170109 gene locus_tag LOCUS_10840 171209 170109 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_10840 171535 171206 gene locus_tag LOCUS_10850 171535 171206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 171604 173070 gene locus_tag LOCUS_10860 171604 173070 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112546.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence07 1 609 gene locus_tag LOCUS_10870 1 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 748 1596 gene locus_tag LOCUS_10880 748 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1656 3122 gene locus_tag LOCUS_10890 1656 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 3249 5375 gene locus_tag LOCUS_10900 3249 5375 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922418.1 protein_id gnl|my_center|LOCUS_10900 5372 6520 gene locus_tag LOCUS_10910 5372 6520 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123229.1 protein_id gnl|my_center|LOCUS_10910 6517 7992 gene locus_tag LOCUS_10920 6517 7992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 7992 11231 gene locus_tag LOCUS_10930 7992 11231 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_10930 11762 11322 gene locus_tag LOCUS_10940 11762 11322 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028000382.1 protein_id gnl|my_center|LOCUS_10940 11920 11759 gene locus_tag LOCUS_10950 11920 11759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 12320 12003 gene locus_tag LOCUS_10960 12320 12003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 12587 12405 gene locus_tag LOCUS_10970 12587 12405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 15091 12584 gene locus_tag LOCUS_10980 15091 12584 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 protein_id gnl|my_center|LOCUS_10980 15864 15172 gene locus_tag LOCUS_10990 15864 15172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 15986 16438 gene locus_tag LOCUS_11000 15986 16438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 16508 18274 gene locus_tag LOCUS_11010 16508 18274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 18357 19220 gene locus_tag LOCUS_11020 18357 19220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683833.1 protein_id gnl|my_center|LOCUS_11020 19236 20024 gene locus_tag LOCUS_11030 gene lgt 19236 20024 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 protein_id gnl|my_center|LOCUS_11030 20021 20386 gene locus_tag LOCUS_11040 20021 20386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 20383 20937 gene locus_tag LOCUS_11050 20383 20937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 21062 22459 gene locus_tag LOCUS_11060 gene cls 21062 22459 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191365.1 protein_id gnl|my_center|LOCUS_11060 22619 23671 gene locus_tag LOCUS_11070 22619 23671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 24365 23718 gene locus_tag LOCUS_11080 24365 23718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 24832 24428 gene locus_tag LOCUS_11090 24832 24428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 25494 24829 gene locus_tag LOCUS_11100 gene bfiR 25494 24829 CDS product two-component system response regulator BfiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114717.1 protein_id gnl|my_center|LOCUS_11100 27095 25512 gene locus_tag LOCUS_11110 27095 25512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 27763 27095 gene locus_tag LOCUS_11120 27763 27095 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073392.1 protein_id gnl|my_center|LOCUS_11120 28414 27770 gene locus_tag LOCUS_11130 28414 27770 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266927.1 protein_id gnl|my_center|LOCUS_11130 28518 29075 gene locus_tag LOCUS_11140 28518 29075 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_11140 29086 30039 gene locus_tag LOCUS_11150 29086 30039 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190194.1 protein_id gnl|my_center|LOCUS_11150 30192 31508 gene locus_tag LOCUS_11160 30192 31508 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197580.1 protein_id gnl|my_center|LOCUS_11160 31577 32464 gene locus_tag LOCUS_11170 31577 32464 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267681.1 protein_id gnl|my_center|LOCUS_11170 32497 33399 gene locus_tag LOCUS_11180 32497 33399 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369336.1 protein_id gnl|my_center|LOCUS_11180 33509 34654 gene locus_tag LOCUS_11190 gene ugpC 33509 34654 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267680.1 protein_id gnl|my_center|LOCUS_11190 34664 35332 gene locus_tag LOCUS_11200 34664 35332 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189609.1 protein_id gnl|my_center|LOCUS_11200 35369 36157 gene locus_tag LOCUS_11210 35369 36157 CDS product L-iditol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189447.1 protein_id gnl|my_center|LOCUS_11210 36282 36920 gene locus_tag LOCUS_11220 36282 36920 CDS product nucleoside triphosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968604.1 protein_id gnl|my_center|LOCUS_11220 36973 38460 gene locus_tag LOCUS_11230 36973 38460 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730628.1 protein_id gnl|my_center|LOCUS_11230 38460 39950 gene locus_tag LOCUS_11240 gene xylB 38460 39950 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762617.1 protein_id gnl|my_center|LOCUS_11240 40001 40951 gene locus_tag LOCUS_11250 gene tal 40001 40951 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263519.1 protein_id gnl|my_center|LOCUS_11250 41057 42574 gene locus_tag LOCUS_11260 41057 42574 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528418.1 protein_id gnl|my_center|LOCUS_11260 42924 42529 gene locus_tag LOCUS_11270 42924 42529 CDS product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_11270 43085 43600 gene locus_tag LOCUS_11280 43085 43600 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061383.1 protein_id gnl|my_center|LOCUS_11280 43745 44590 gene locus_tag LOCUS_11290 43745 44590 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838346.1 protein_id gnl|my_center|LOCUS_11290 45035 44595 gene locus_tag LOCUS_11300 gene cynS 45035 44595 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896757.1 protein_id gnl|my_center|LOCUS_11300 45975 45028 gene locus_tag LOCUS_11310 45975 45028 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088476.1 protein_id gnl|my_center|LOCUS_11310 46851 45991 gene locus_tag LOCUS_11320 gene ntrB 46851 45991 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967199.1 protein_id gnl|my_center|LOCUS_11320 48274 46853 gene locus_tag LOCUS_11330 48274 46853 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088478.1 protein_id gnl|my_center|LOCUS_11330 48567 50495 gene locus_tag LOCUS_11340 48567 50495 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967198.1 protein_id gnl|my_center|LOCUS_11340 51420 50506 gene locus_tag LOCUS_11350 51420 50506 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038652.1 protein_id gnl|my_center|LOCUS_11350 51906 53168 gene locus_tag LOCUS_11360 51906 53168 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_11360 53168 56311 gene locus_tag LOCUS_11370 53168 56311 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 protein_id gnl|my_center|LOCUS_11370 56304 57713 gene locus_tag LOCUS_11380 56304 57713 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_11380 57836 58591 gene locus_tag LOCUS_11390 57836 58591 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815313.1 protein_id gnl|my_center|LOCUS_11390 59266 58637 gene locus_tag LOCUS_11400 gene nalD 59266 58637 CDS product efflux system transcriptional repressor NalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092152.1 protein_id gnl|my_center|LOCUS_11400 59460 60491 gene locus_tag LOCUS_11410 59460 60491 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261387.1 protein_id gnl|my_center|LOCUS_11410 61530 60517 gene locus_tag LOCUS_11420 gene dusA 61530 60517 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086515.1 protein_id gnl|my_center|LOCUS_11420 62133 61720 gene locus_tag LOCUS_11430 62133 61720 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767619.1 protein_id gnl|my_center|LOCUS_11430 62354 62172 gene locus_tag LOCUS_11440 62354 62172 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893919.1 protein_id gnl|my_center|LOCUS_11440 62770 62555 gene locus_tag LOCUS_11450 62770 62555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 62932 63180 gene locus_tag LOCUS_11460 62932 63180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 64022 63216 gene locus_tag LOCUS_11470 64022 63216 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_11470 64253 64576 gene locus_tag LOCUS_11480 64253 64576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 64684 65235 gene locus_tag LOCUS_11490 64684 65235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 65860 65270 gene locus_tag LOCUS_11500 65860 65270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 66739 65999 gene locus_tag LOCUS_11510 66739 65999 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266205.1 protein_id gnl|my_center|LOCUS_11510 66878 68359 gene locus_tag LOCUS_11520 gene gltX 66878 68359 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738107.1 protein_id gnl|my_center|LOCUS_11520 68418 68493 gene locus_tag LOCUS_t00230 68418 68493 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 68519 68594 gene locus_tag LOCUS_t00240 68519 68594 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 69983 69093 gene locus_tag LOCUS_11530 69983 69093 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028000663.1 protein_id gnl|my_center|LOCUS_11530 71361 70078 gene locus_tag LOCUS_11540 gene gltA 71361 70078 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087400.1 protein_id gnl|my_center|LOCUS_11540 71890 71654 gene locus_tag LOCUS_11550 71890 71654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 71813 72190 gene locus_tag LOCUS_11560 gene sdhC 71813 72190 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104388.1 protein_id gnl|my_center|LOCUS_11560 72184 72531 gene locus_tag LOCUS_11570 gene sdhD 72184 72531 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316551.1 protein_id gnl|my_center|LOCUS_11570 72535 74307 gene locus_tag LOCUS_11580 gene sdhA 72535 74307 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087407.1 protein_id gnl|my_center|LOCUS_11580 74334 75038 gene locus_tag LOCUS_11590 74334 75038 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087410.1 protein_id gnl|my_center|LOCUS_11590 75315 78125 gene locus_tag LOCUS_11600 75315 78125 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_11600 78165 79745 gene locus_tag LOCUS_11610 gene odhB 78165 79745 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003725.1 protein_id gnl|my_center|LOCUS_11610 79810 81249 gene locus_tag LOCUS_11620 gene lpdA 79810 81249 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087422.1 protein_id gnl|my_center|LOCUS_11620 81390 82556 gene locus_tag LOCUS_11630 gene sucC 81390 82556 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087425.1 protein_id gnl|my_center|LOCUS_11630 82556 83428 gene locus_tag LOCUS_11640 gene sucD 82556 83428 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087428.1 protein_id gnl|my_center|LOCUS_11640 84293 83511 gene locus_tag LOCUS_11650 gene siaD 84293 83511 CDS product biofilm regulation diguanylate cyclase SiaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118588.1 protein_id gnl|my_center|LOCUS_11650 84688 84290 gene locus_tag LOCUS_11660 gene siaC 84688 84290 CDS product biofilm formation regulator SiaD modulator protein SiaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083913.1 protein_id gnl|my_center|LOCUS_11660 85230 84697 gene locus_tag LOCUS_11670 gene siaB 85230 84697 CDS product biofilm formation regulator kinase SiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083916.1 protein_id gnl|my_center|LOCUS_11670 87291 85240 gene locus_tag LOCUS_11680 gene siaA 87291 85240 CDS product biofilm regulation protein phosphatase SiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112649.1 protein_id gnl|my_center|LOCUS_11680 89553 87580 gene locus_tag LOCUS_11690 gene rnb 89553 87580 CDS product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000485008.1 protein_id gnl|my_center|LOCUS_11690 90166 89723 gene locus_tag LOCUS_11700 90166 89723 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 protein_id gnl|my_center|LOCUS_11700 91311 90259 gene locus_tag LOCUS_11710 91311 90259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 92699 91308 gene locus_tag LOCUS_11720 92699 91308 CDS product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169547.1 protein_id gnl|my_center|LOCUS_11720 92911 92720 gene locus_tag LOCUS_11730 92911 92720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 92998 93549 gene locus_tag LOCUS_11740 92998 93549 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_11740 93576 93818 gene locus_tag LOCUS_11750 93576 93818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 94482 93877 gene locus_tag LOCUS_11760 94482 93877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 94741 95685 gene locus_tag LOCUS_11770 94741 95685 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336881.1 protein_id gnl|my_center|LOCUS_11770 95682 96641 gene locus_tag LOCUS_11780 95682 96641 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070810.1 protein_id gnl|my_center|LOCUS_11780 96653 97042 gene locus_tag LOCUS_11790 96653 97042 CDS product DUF1850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528643.1 protein_id gnl|my_center|LOCUS_11790 97066 98673 gene locus_tag LOCUS_11800 97066 98673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 98670 99056 gene locus_tag LOCUS_11810 98670 99056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 99053 101524 gene locus_tag LOCUS_11820 99053 101524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 102870 101578 gene locus_tag LOCUS_11830 102870 101578 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527918.1 protein_id gnl|my_center|LOCUS_11830 104349 102904 gene locus_tag LOCUS_11840 104349 102904 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387895.1 protein_id gnl|my_center|LOCUS_11840 104579 107044 gene locus_tag LOCUS_11850 104579 107044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 107306 107905 gene locus_tag LOCUS_11860 107306 107905 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005659678.1 protein_id gnl|my_center|LOCUS_11860 107917 109128 gene locus_tag LOCUS_11870 107917 109128 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705687.1 protein_id gnl|my_center|LOCUS_11870 109749 109102 gene locus_tag LOCUS_11880 gene msrA 109749 109102 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939270.1 protein_id gnl|my_center|LOCUS_11880 109903 112134 gene locus_tag LOCUS_11890 109903 112134 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_11890 112134 112751 gene locus_tag LOCUS_11900 112134 112751 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097039.1 protein_id gnl|my_center|LOCUS_11900 113323 112841 gene locus_tag LOCUS_11910 113323 112841 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207342.1 protein_id gnl|my_center|LOCUS_11910 113559 113840 gene locus_tag LOCUS_11920 113559 113840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 114472 114005 gene locus_tag LOCUS_11930 114472 114005 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996417.1 protein_id gnl|my_center|LOCUS_11930 116338 114743 gene locus_tag LOCUS_11940 116338 114743 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113373.1 protein_id gnl|my_center|LOCUS_11940 117104 116667 gene locus_tag LOCUS_11950 117104 116667 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090444.1 protein_id gnl|my_center|LOCUS_11950 118323 117148 gene locus_tag LOCUS_11960 118323 117148 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097663.1 protein_id gnl|my_center|LOCUS_11960 119714 118326 gene locus_tag LOCUS_11970 gene purB 119714 118326 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113371.1 protein_id gnl|my_center|LOCUS_11970 120393 119752 gene locus_tag LOCUS_11980 gene hflD 120393 119752 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405097.1 protein_id gnl|my_center|LOCUS_11980 121520 120390 gene locus_tag LOCUS_11990 gene mnmA 121520 120390 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007019485.1 protein_id gnl|my_center|LOCUS_11990 122042 121593 gene locus_tag LOCUS_12000 122042 121593 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037129.1 protein_id gnl|my_center|LOCUS_12000 122671 122039 gene locus_tag LOCUS_12010 122671 122039 CDS product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389692.1 protein_id gnl|my_center|LOCUS_12010 122962 125199 gene locus_tag LOCUS_12020 122962 125199 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899797.1 protein_id gnl|my_center|LOCUS_12020 125373 126629 gene locus_tag LOCUS_12030 gene icd 125373 126629 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090436.1 protein_id gnl|my_center|LOCUS_12030 126783 127136 gene locus_tag LOCUS_12040 gene clpS 126783 127136 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097649.1 protein_id gnl|my_center|LOCUS_12040 127280 129559 gene locus_tag LOCUS_12050 gene clpA 127280 129559 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_12050 129899 129681 gene locus_tag LOCUS_12060 gene infA 129899 129681 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947496.1 protein_id gnl|my_center|LOCUS_12060 130754 130017 gene locus_tag LOCUS_12070 130754 130017 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108766.1 protein_id gnl|my_center|LOCUS_12070 131512 130751 gene locus_tag LOCUS_12080 gene aat 131512 130751 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113368.1 protein_id gnl|my_center|LOCUS_12080 131667 134957 gene locus_tag LOCUS_12090 131667 134957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 135087 135716 gene locus_tag LOCUS_12100 gene lolA 135087 135716 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405079.1 protein_id gnl|my_center|LOCUS_12100 137290 135953 gene locus_tag LOCUS_12110 gene rarA 137290 135953 CDS product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704877.1 protein_id gnl|my_center|LOCUS_12110 137464 138012 gene locus_tag LOCUS_12120 137464 138012 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706927.1 protein_id gnl|my_center|LOCUS_12120 138204 138983 gene locus_tag LOCUS_12130 gene murI 138204 138983 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703959.1 protein_id gnl|my_center|LOCUS_12130 139043 140170 gene locus_tag LOCUS_12140 gene trmA 139043 140170 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480873.1 protein_id gnl|my_center|LOCUS_12140 140363 145201 gene locus_tag LOCUS_12150 gene gdhB 140363 145201 CDS product NAD-glutamate dehydrogenase GdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103491.1 protein_id gnl|my_center|LOCUS_12150 146693 145341 gene locus_tag LOCUS_12160 gene mgtE 146693 145341 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037936.1 protein_id gnl|my_center|LOCUS_12160 146870 147895 gene locus_tag LOCUS_12170 146870 147895 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103236.1 protein_id gnl|my_center|LOCUS_12170 148190 147984 gene locus_tag LOCUS_12180 148190 147984 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553055.1 protein_id gnl|my_center|LOCUS_12180 148449 150668 gene locus_tag LOCUS_12190 gene rlmKL 148449 150668 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_12190 150665 151012 gene locus_tag LOCUS_12200 150665 151012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 151419 151138 gene locus_tag LOCUS_12210 151419 151138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 151511 152674 gene locus_tag LOCUS_12220 gene pdxB 151511 152674 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112396.1 protein_id gnl|my_center|LOCUS_12220 153733 152831 gene locus_tag LOCUS_12230 gene htpX 153733 152831 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090915.1 protein_id gnl|my_center|LOCUS_12230 155071 153842 gene locus_tag LOCUS_12240 155071 153842 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090913.1 protein_id gnl|my_center|LOCUS_12240 156082 155114 gene locus_tag LOCUS_12250 gene ylqF 156082 155114 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072540.1 protein_id gnl|my_center|LOCUS_12250 156562 156161 gene locus_tag LOCUS_12260 gene msrB 156562 156161 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106032.1 protein_id gnl|my_center|LOCUS_12260 156741 156816 gene locus_tag LOCUS_t00250 156741 156816 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 156851 156925 gene locus_tag LOCUS_t00260 156851 156925 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 156967 157042 gene locus_tag LOCUS_t00270 156967 157042 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 157087 157161 gene locus_tag LOCUS_t00280 157087 157161 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 157184 157259 gene locus_tag LOCUS_t00290 157184 157259 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 157288 157362 gene locus_tag LOCUS_t00300 157288 157362 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 157563 158537 gene locus_tag LOCUS_12270 157563 158537 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_12270 158534 159307 gene locus_tag LOCUS_12280 158534 159307 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 protein_id gnl|my_center|LOCUS_12280 159304 160140 gene locus_tag LOCUS_12290 gene queF 159304 160140 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930727.1 protein_id gnl|my_center|LOCUS_12290 160222 160782 gene locus_tag LOCUS_12300 160222 160782 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_12300 160830 161333 gene locus_tag LOCUS_12310 160830 161333 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932147.1 protein_id gnl|my_center|LOCUS_12310 161429 161516 gene locus_tag LOCUS_t00310 161429 161516 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 161767 162816 gene locus_tag LOCUS_12320 161767 162816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705715.1 protein_id gnl|my_center|LOCUS_12320 163028 163444 gene locus_tag LOCUS_12330 163028 163444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 164373 163600 gene locus_tag LOCUS_12340 164373 163600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 164812 164549 gene locus_tag LOCUS_12350 164812 164549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 165248 164820 gene locus_tag LOCUS_12360 165248 164820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705863.1 protein_id gnl|my_center|LOCUS_12360 165450 165674 gene locus_tag LOCUS_12370 165450 165674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 167074 165665 gene locus_tag LOCUS_12380 167074 165665 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_12380 167495 167055 gene locus_tag LOCUS_12390 167495 167055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 168082 167465 gene locus_tag LOCUS_12400 168082 167465 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence08 114 1463 gene locus_tag LOCUS_12410 114 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1650 1471 gene locus_tag LOCUS_12420 1650 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 2226 1660 gene locus_tag LOCUS_12430 2226 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 3007 4308 gene locus_tag LOCUS_12440 3007 4308 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337713.1 protein_id gnl|my_center|LOCUS_12440 4305 4979 gene locus_tag LOCUS_12450 4305 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 5050 5241 gene locus_tag LOCUS_12460 5050 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 5234 8038 gene locus_tag LOCUS_12470 5234 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331404.1 protein_id gnl|my_center|LOCUS_12470 8441 8962 gene locus_tag LOCUS_12480 8441 8962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 9155 9448 gene locus_tag LOCUS_12490 9155 9448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 9448 10029 gene locus_tag LOCUS_12500 9448 10029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 10258 10401 gene locus_tag LOCUS_12510 10258 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 10661 10572 gene locus_tag LOCUS_t00320 10661 10572 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10779 11276 gene locus_tag LOCUS_12520 10779 11276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 11331 11999 gene locus_tag LOCUS_12530 11331 11999 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090386.1 protein_id gnl|my_center|LOCUS_12530 12073 12465 gene locus_tag LOCUS_12540 gene tusD 12073 12465 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209689.1 protein_id gnl|my_center|LOCUS_12540 12493 12876 gene locus_tag LOCUS_12550 gene tusC 12493 12876 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044900.1 protein_id gnl|my_center|LOCUS_12550 12919 13209 gene locus_tag LOCUS_12560 12919 13209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 13209 13562 gene locus_tag LOCUS_12570 13209 13562 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119979.1 protein_id gnl|my_center|LOCUS_12570 13569 14138 gene locus_tag LOCUS_12580 13569 14138 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093976.1 protein_id gnl|my_center|LOCUS_12580 15350 14142 gene locus_tag LOCUS_12590 15350 14142 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192374.1 protein_id gnl|my_center|LOCUS_12590 15852 15343 gene locus_tag LOCUS_12600 gene moaB 15852 15343 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091240.1 protein_id gnl|my_center|LOCUS_12600 16192 15866 gene locus_tag LOCUS_12610 16192 15866 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046692.1 protein_id gnl|my_center|LOCUS_12610 17349 16291 gene locus_tag LOCUS_12620 17349 16291 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625974.1 protein_id gnl|my_center|LOCUS_12620 17973 17359 gene locus_tag LOCUS_12630 gene fdh3B 17973 17359 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453840.1 protein_id gnl|my_center|LOCUS_12630 20855 18000 gene locus_tag LOCUS_12640 20855 18000 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261956.1 protein_id gnl|my_center|LOCUS_12640 21172 20882 gene locus_tag LOCUS_12650 21172 20882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 21828 21199 gene locus_tag LOCUS_12660 21828 21199 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894276.1 protein_id gnl|my_center|LOCUS_12660 23554 21833 gene locus_tag LOCUS_12670 23554 21833 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186809352.1 protein_id gnl|my_center|LOCUS_12670 23936 23637 gene locus_tag LOCUS_12680 23936 23637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 23919 24155 gene locus_tag LOCUS_12690 23919 24155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 24604 24173 gene locus_tag LOCUS_12700 24604 24173 CDS product DUF3305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396177.1 protein_id gnl|my_center|LOCUS_12700 24709 25566 gene locus_tag LOCUS_12710 24709 25566 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074122.1 protein_id gnl|my_center|LOCUS_12710 26217 25582 gene locus_tag LOCUS_12720 26217 25582 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287804.1 protein_id gnl|my_center|LOCUS_12720 27292 26357 gene locus_tag LOCUS_12730 27292 26357 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039480.1 protein_id gnl|my_center|LOCUS_12730 27408 30155 gene locus_tag LOCUS_12740 27408 30155 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016415173.1 protein_id gnl|my_center|LOCUS_12740 30889 30248 gene locus_tag LOCUS_12750 gene pdxH 30889 30248 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056186.1 protein_id gnl|my_center|LOCUS_12750 31356 31009 gene locus_tag LOCUS_12760 31356 31009 CDS product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065708.1 protein_id gnl|my_center|LOCUS_12760 32054 31353 gene locus_tag LOCUS_12770 32054 31353 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065707.1 protein_id gnl|my_center|LOCUS_12770 32178 32861 gene locus_tag LOCUS_12780 32178 32861 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_12780 33404 32931 gene locus_tag LOCUS_12790 33404 32931 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073278.1 protein_id gnl|my_center|LOCUS_12790 33890 33483 gene locus_tag LOCUS_12800 33890 33483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 34510 33887 gene locus_tag LOCUS_12810 gene wrbA 34510 33887 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115189.1 protein_id gnl|my_center|LOCUS_12810 34925 34572 gene locus_tag LOCUS_12820 gene arsC 34925 34572 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112580.1 protein_id gnl|my_center|LOCUS_12820 35442 34999 gene locus_tag LOCUS_12830 35442 34999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 35588 36181 gene locus_tag LOCUS_12840 gene smrA 35588 36181 CDS product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046824.1 protein_id gnl|my_center|LOCUS_12840 36908 36378 gene locus_tag LOCUS_12850 36908 36378 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191986.1 protein_id gnl|my_center|LOCUS_12850 38553 36901 gene locus_tag LOCUS_12860 38553 36901 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_12860 40020 38692 gene locus_tag LOCUS_12870 40020 38692 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_12870 43781 40074 gene locus_tag LOCUS_12880 gene metH 43781 40074 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113602.1 protein_id gnl|my_center|LOCUS_12880 44121 44711 gene locus_tag LOCUS_12890 gene nfuA 44121 44711 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553665.1 protein_id gnl|my_center|LOCUS_12890 45771 44740 gene locus_tag LOCUS_12900 45771 44740 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766198.1 protein_id gnl|my_center|LOCUS_12900 46010 47203 gene locus_tag LOCUS_12910 46010 47203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 47284 47709 gene locus_tag LOCUS_12920 47284 47709 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055037.1 protein_id gnl|my_center|LOCUS_12920 48086 47706 gene locus_tag LOCUS_12930 48086 47706 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973855.1 protein_id gnl|my_center|LOCUS_12930 48759 48175 gene locus_tag LOCUS_12940 48759 48175 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003499036.1 protein_id gnl|my_center|LOCUS_12940 49237 48884 gene locus_tag LOCUS_12950 49237 48884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 49679 49239 gene locus_tag LOCUS_12960 gene hisI 49679 49239 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 protein_id gnl|my_center|LOCUS_12960 50172 49720 gene locus_tag LOCUS_12970 gene zur 50172 49720 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707398.1 protein_id gnl|my_center|LOCUS_12970 51241 50252 gene locus_tag LOCUS_12980 51241 50252 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261591.1 protein_id gnl|my_center|LOCUS_12980 52752 51247 gene locus_tag LOCUS_12990 52752 51247 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705413.1 protein_id gnl|my_center|LOCUS_12990 53644 52796 gene locus_tag LOCUS_13000 53644 52796 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350202.1 protein_id gnl|my_center|LOCUS_13000 53882 56410 gene locus_tag LOCUS_13010 53882 56410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 56612 57847 gene locus_tag LOCUS_13020 56612 57847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 57920 58381 gene locus_tag LOCUS_13030 57920 58381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 58500 59093 gene locus_tag LOCUS_13040 58500 59093 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096714.1 protein_id gnl|my_center|LOCUS_13040 59546 59151 gene locus_tag LOCUS_13050 59546 59151 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464385.1 protein_id gnl|my_center|LOCUS_13050 60901 59636 gene locus_tag LOCUS_13060 gene ectB 60901 59636 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878029.1 protein_id gnl|my_center|LOCUS_13060 61561 60986 gene locus_tag LOCUS_13070 gene ectA 61561 60986 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930801.1 protein_id gnl|my_center|LOCUS_13070 63217 61838 gene locus_tag LOCUS_13080 gene gorA 63217 61838 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100366.1 protein_id gnl|my_center|LOCUS_13080 63384 64031 gene locus_tag LOCUS_13090 gene can 63384 64031 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345939.1 protein_id gnl|my_center|LOCUS_13090 64523 64035 gene locus_tag LOCUS_13100 64523 64035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 64680 65975 gene locus_tag LOCUS_13110 gene pepQ 64680 65975 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038359.1 protein_id gnl|my_center|LOCUS_13110 65983 67017 gene locus_tag LOCUS_13120 65983 67017 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261065.1 protein_id gnl|my_center|LOCUS_13120 67612 66998 gene locus_tag LOCUS_13130 gene msrA 67612 66998 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083656.1 protein_id gnl|my_center|LOCUS_13130 71657 67635 gene locus_tag LOCUS_13140 71657 67635 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154295113.1 protein_id gnl|my_center|LOCUS_13140 73498 71621 gene locus_tag LOCUS_13150 73498 71621 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046695507.1 protein_id gnl|my_center|LOCUS_13150 74448 73558 gene locus_tag LOCUS_13160 74448 73558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 74696 75274 gene locus_tag LOCUS_13170 gene sodB 74696 75274 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096926.1 protein_id gnl|my_center|LOCUS_13170 76687 75383 gene locus_tag LOCUS_13180 76687 75383 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208057.1 protein_id gnl|my_center|LOCUS_13180 77649 76693 gene locus_tag LOCUS_13190 gene galU 77649 76693 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071816.1 protein_id gnl|my_center|LOCUS_13190 77786 78511 gene locus_tag LOCUS_13200 77786 78511 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_13200 78508 79194 gene locus_tag LOCUS_13210 78508 79194 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706174.1 protein_id gnl|my_center|LOCUS_13210 79298 80122 gene locus_tag LOCUS_13220 79298 80122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 80881 80117 gene locus_tag LOCUS_13230 80881 80117 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706896.1 protein_id gnl|my_center|LOCUS_13230 81675 80899 gene locus_tag LOCUS_13240 gene ybgF 81675 80899 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004418664.1 protein_id gnl|my_center|LOCUS_13240 82262 81714 gene locus_tag LOCUS_13250 gene pal 82262 81714 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314369.1 protein_id gnl|my_center|LOCUS_13250 83602 82316 gene locus_tag LOCUS_13260 gene tolB 83602 82316 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112572.1 protein_id gnl|my_center|LOCUS_13260 84774 83602 gene locus_tag LOCUS_13270 84774 83602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 85227 84784 gene locus_tag LOCUS_13280 gene tolR 85227 84784 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086126.1 protein_id gnl|my_center|LOCUS_13280 85929 85240 gene locus_tag LOCUS_13290 gene tolQ 85929 85240 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086125.1 protein_id gnl|my_center|LOCUS_13290 86360 85941 gene locus_tag LOCUS_13300 gene ybgC 86360 85941 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814639.1 protein_id gnl|my_center|LOCUS_13300 87394 86357 gene locus_tag LOCUS_13310 gene ruvB 87394 86357 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409396.1 protein_id gnl|my_center|LOCUS_13310 88051 87443 gene locus_tag LOCUS_13320 gene ruvA 88051 87443 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_13320 88734 88195 gene locus_tag LOCUS_13330 gene ruvC 88734 88195 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298649.1 protein_id gnl|my_center|LOCUS_13330 89493 88744 gene locus_tag LOCUS_13340 89493 88744 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104813.1 protein_id gnl|my_center|LOCUS_13340 91351 89573 gene locus_tag LOCUS_13350 gene aspS 91351 89573 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123218.1 protein_id gnl|my_center|LOCUS_13350 91667 91401 gene locus_tag LOCUS_13360 91667 91401 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807023.1 protein_id gnl|my_center|LOCUS_13360 91847 92779 gene locus_tag LOCUS_13370 91847 92779 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_13370 92794 93696 gene locus_tag LOCUS_13380 92794 93696 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338796.1 protein_id gnl|my_center|LOCUS_13380 93732 94676 gene locus_tag LOCUS_13390 93732 94676 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067017.1 protein_id gnl|my_center|LOCUS_13390 94974 94702 gene locus_tag LOCUS_13400 94974 94702 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958585.1 protein_id gnl|my_center|LOCUS_13400 95215 96258 gene locus_tag LOCUS_13410 95215 96258 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388795.1 protein_id gnl|my_center|LOCUS_13410 97279 96329 gene locus_tag LOCUS_13420 97279 96329 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_13420 97415 98500 gene locus_tag LOCUS_13430 97415 98500 CDS product bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038544.1 protein_id gnl|my_center|LOCUS_13430 99434 98514 gene locus_tag LOCUS_13440 99434 98514 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418861.1 protein_id gnl|my_center|LOCUS_13440 100912 99497 gene locus_tag LOCUS_13450 gene cls 100912 99497 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191365.1 protein_id gnl|my_center|LOCUS_13450 102512 101007 gene locus_tag LOCUS_13460 102512 101007 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093938.1 protein_id gnl|my_center|LOCUS_13460 103523 102699 gene locus_tag LOCUS_13470 gene nei 103523 102699 CDS product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704766.1 protein_id gnl|my_center|LOCUS_13470 105703 103682 gene locus_tag LOCUS_13480 gene uvrB 105703 103682 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104590.1 protein_id gnl|my_center|LOCUS_13480 106184 105762 gene locus_tag LOCUS_13490 106184 105762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 106501 106184 gene locus_tag LOCUS_13500 106501 106184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 106548 107585 gene locus_tag LOCUS_13510 106548 107585 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114180.1 protein_id gnl|my_center|LOCUS_13510 108350 107586 gene locus_tag LOCUS_13520 108350 107586 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707415.1 protein_id gnl|my_center|LOCUS_13520 110136 108547 gene locus_tag LOCUS_13530 gene prfC 110136 108547 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166905.1 protein_id gnl|my_center|LOCUS_13530 110883 110242 gene locus_tag LOCUS_13540 110883 110242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 112280 110880 gene locus_tag LOCUS_13550 112280 110880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 115200 112273 gene locus_tag LOCUS_13560 115200 112273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 115990 115193 gene locus_tag LOCUS_13570 115990 115193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 116117 117391 gene locus_tag LOCUS_13580 116117 117391 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_13580 117429 117974 gene locus_tag LOCUS_13590 117429 117974 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400057.1 protein_id gnl|my_center|LOCUS_13590 118882 118109 gene locus_tag LOCUS_13600 118882 118109 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258808.1 protein_id gnl|my_center|LOCUS_13600 119418 118978 gene locus_tag LOCUS_13610 119418 118978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 119532 120365 gene locus_tag LOCUS_13620 119532 120365 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938969.1 protein_id gnl|my_center|LOCUS_13620 120618 120893 gene locus_tag LOCUS_13630 120618 120893 CDS product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072684.1 protein_id gnl|my_center|LOCUS_13630 121004 121978 gene locus_tag LOCUS_13640 121004 121978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 122062 123138 gene locus_tag LOCUS_13650 122062 123138 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338822.1 protein_id gnl|my_center|LOCUS_13650 123200 123967 gene locus_tag LOCUS_13660 123200 123967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 124834 124172 gene locus_tag LOCUS_13670 124834 124172 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088567.1 protein_id gnl|my_center|LOCUS_13670 125593 124892 gene locus_tag LOCUS_13680 125593 124892 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088566.1 protein_id gnl|my_center|LOCUS_13680 125759 126658 gene locus_tag LOCUS_13690 125759 126658 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100419.1 protein_id gnl|my_center|LOCUS_13690 126751 127620 gene locus_tag LOCUS_13700 126751 127620 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_13700 127710 128507 gene locus_tag LOCUS_13710 127710 128507 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406211.1 protein_id gnl|my_center|LOCUS_13710 128624 129784 gene locus_tag LOCUS_13720 128624 129784 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_13720 129756 130298 gene locus_tag LOCUS_13730 129756 130298 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 protein_id gnl|my_center|LOCUS_13730 130337 130957 gene locus_tag LOCUS_13740 130337 130957 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 protein_id gnl|my_center|LOCUS_13740 132206 131094 gene locus_tag LOCUS_13750 gene gcvT 132206 131094 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478448.1 protein_id gnl|my_center|LOCUS_13750 133700 132294 gene locus_tag LOCUS_13760 133700 132294 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_13760 134220 134612 gene locus_tag LOCUS_13770 gene gcvH 134220 134612 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454126.1 protein_id gnl|my_center|LOCUS_13770 134714 137608 gene locus_tag LOCUS_13780 gene gcvP 134714 137608 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071084.1 protein_id gnl|my_center|LOCUS_13780 138636 137722 gene locus_tag LOCUS_13790 138636 137722 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459241.1 protein_id gnl|my_center|LOCUS_13790 138735 140096 gene locus_tag LOCUS_13800 gene ppnN 138735 140096 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054702.1 protein_id gnl|my_center|LOCUS_13800 140649 140281 gene locus_tag LOCUS_13810 140649 140281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 141109 140651 gene locus_tag LOCUS_13820 141109 140651 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212126.1 protein_id gnl|my_center|LOCUS_13820 141283 141492 gene locus_tag LOCUS_13830 141283 141492 CDS product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093125.1 protein_id gnl|my_center|LOCUS_13830 141881 141579 gene locus_tag LOCUS_13840 gene ihfA 141881 141579 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553164.1 protein_id gnl|my_center|LOCUS_13840 144335 141954 gene locus_tag LOCUS_13850 gene pheT 144335 141954 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267471.1 protein_id gnl|my_center|LOCUS_13850 145389 144370 gene locus_tag LOCUS_13860 gene pheS 145389 144370 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367019.1 protein_id gnl|my_center|LOCUS_13860 145865 145512 gene locus_tag LOCUS_13870 gene rplT 145865 145512 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553161.1 protein_id gnl|my_center|LOCUS_13870 146095 145901 gene locus_tag LOCUS_13880 gene rpmI 146095 145901 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553160.1 protein_id gnl|my_center|LOCUS_13880 146674 146183 gene locus_tag LOCUS_13890 gene infC 146674 146183 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080374.1 protein_id gnl|my_center|LOCUS_13890 148654 146756 gene locus_tag LOCUS_13900 gene thrS 148654 146756 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267470.1 protein_id gnl|my_center|LOCUS_13900 149579 148923 gene locus_tag LOCUS_13910 149579 148923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 150299 149832 gene locus_tag LOCUS_13920 150299 149832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 151215 150379 gene locus_tag LOCUS_13930 gene cysQ 151215 150379 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038007.1 protein_id gnl|my_center|LOCUS_13930 151381 152838 gene locus_tag LOCUS_13940 151381 152838 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_13940 153846 152914 gene locus_tag LOCUS_13950 gene cyoE 153846 152914 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083746.1 protein_id gnl|my_center|LOCUS_13950 154897 153839 gene locus_tag LOCUS_13960 154897 153839 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_13960 155471 154923 gene locus_tag LOCUS_13970 155471 154923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083738.1 protein_id gnl|my_center|LOCUS_13970 156136 155468 gene locus_tag LOCUS_13980 156136 155468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 protein_id gnl|my_center|LOCUS_13980 156216 156410 gene locus_tag LOCUS_13990 156216 156410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 157299 156439 gene locus_tag LOCUS_14000 157299 156439 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115030.1 protein_id gnl|my_center|LOCUS_14000 157895 157296 gene locus_tag LOCUS_14010 157895 157296 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 protein_id gnl|my_center|LOCUS_14010 159561 157927 gene locus_tag LOCUS_14020 gene ctaD 159561 157927 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083723.1 protein_id gnl|my_center|LOCUS_14020 160749 159631 gene locus_tag LOCUS_14030 gene coxB 160749 159631 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101203.1 protein_id gnl|my_center|LOCUS_14030 161115 160942 gene locus_tag LOCUS_14040 161115 160942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 161281 161634 gene locus_tag LOCUS_14050 161281 161634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 162430 161699 gene locus_tag LOCUS_14060 162430 161699 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258956.1 protein_id gnl|my_center|LOCUS_14060 162786 162427 gene locus_tag LOCUS_14070 162786 162427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 164483 162855 gene locus_tag LOCUS_14080 164483 162855 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 protein_id gnl|my_center|LOCUS_14080 164692 164768 gene locus_tag LOCUS_t00330 164692 164768 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 164861 165526 gene locus_tag LOCUS_14090 164861 165526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 165677 165537 gene locus_tag LOCUS_14100 165677 165537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence09 249 1274 gene locus_tag LOCUS_14110 249 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 1468 2676 gene locus_tag LOCUS_14120 1468 2676 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768334.1 protein_id gnl|my_center|LOCUS_14120 2809 4488 gene locus_tag LOCUS_14130 2809 4488 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103761.1 protein_id gnl|my_center|LOCUS_14130 7337 4581 gene locus_tag LOCUS_14140 gene acnA 7337 4581 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105996.1 protein_id gnl|my_center|LOCUS_14140 7541 7750 gene locus_tag LOCUS_14150 7541 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 7813 8763 gene locus_tag LOCUS_14160 gene trxB 7813 8763 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097640.1 protein_id gnl|my_center|LOCUS_14160 9217 8972 gene locus_tag LOCUS_14170 9217 8972 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085189.1 protein_id gnl|my_center|LOCUS_14170 9313 9777 gene locus_tag LOCUS_14180 9313 9777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 10289 9888 gene locus_tag LOCUS_14190 10289 9888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082373.1 protein_id gnl|my_center|LOCUS_14190 11469 10297 gene locus_tag LOCUS_14200 gene dapE 11469 10297 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082377.1 protein_id gnl|my_center|LOCUS_14200 12481 11456 gene locus_tag LOCUS_14210 gene dapD 12481 11456 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266969.1 protein_id gnl|my_center|LOCUS_14210 12869 12525 gene locus_tag LOCUS_14220 12869 12525 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043162216.1 protein_id gnl|my_center|LOCUS_14220 14068 12869 gene locus_tag LOCUS_14230 gene dapC 14068 12869 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406264.1 protein_id gnl|my_center|LOCUS_14230 17079 14398 gene locus_tag LOCUS_14240 17079 14398 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_14240 17876 17085 gene locus_tag LOCUS_14250 gene map 17876 17085 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092395.1 protein_id gnl|my_center|LOCUS_14250 18201 18941 gene locus_tag LOCUS_14260 gene rpsB 18201 18941 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092394.1 protein_id gnl|my_center|LOCUS_14260 19108 19977 gene locus_tag LOCUS_14270 gene tsf 19108 19977 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501911.1 protein_id gnl|my_center|LOCUS_14270 20090 20872 gene locus_tag LOCUS_14280 gene pyrH 20090 20872 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092391.1 protein_id gnl|my_center|LOCUS_14280 20877 21434 gene locus_tag LOCUS_14290 gene frr 20877 21434 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092390.1 protein_id gnl|my_center|LOCUS_14290 21496 22281 gene locus_tag LOCUS_14300 gene uppS 21496 22281 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113863.1 protein_id gnl|my_center|LOCUS_14300 22274 23074 gene locus_tag LOCUS_14310 22274 23074 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103592.1 protein_id gnl|my_center|LOCUS_14310 23076 24284 gene locus_tag LOCUS_14320 gene ispC 23076 24284 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266975.1 protein_id gnl|my_center|LOCUS_14320 24326 25684 gene locus_tag LOCUS_14330 gene rseP 24326 25684 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098594.1 protein_id gnl|my_center|LOCUS_14330 25939 28281 gene locus_tag LOCUS_14340 gene bamA 25939 28281 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092382.1 protein_id gnl|my_center|LOCUS_14340 28338 28820 gene locus_tag LOCUS_14350 28338 28820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 28834 29871 gene locus_tag LOCUS_14360 gene lpxD 28834 29871 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_14360 29977 30420 gene locus_tag LOCUS_14370 gene fabZ 29977 30420 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092375.1 protein_id gnl|my_center|LOCUS_14370 30417 31184 gene locus_tag LOCUS_14380 gene lpxA 30417 31184 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092373.1 protein_id gnl|my_center|LOCUS_14380 31187 32401 gene locus_tag LOCUS_14390 gene lpxB 31187 32401 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113865.1 protein_id gnl|my_center|LOCUS_14390 32398 33024 gene locus_tag LOCUS_14400 gene rnhB 32398 33024 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569431.1 protein_id gnl|my_center|LOCUS_14400 33049 36549 gene locus_tag LOCUS_14410 gene dnaE 33049 36549 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098578.1 protein_id gnl|my_center|LOCUS_14410 36823 37776 gene locus_tag LOCUS_14420 gene accA 36823 37776 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109333.1 protein_id gnl|my_center|LOCUS_14420 37784 39082 gene locus_tag LOCUS_14430 gene tilS 37784 39082 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994173.1 protein_id gnl|my_center|LOCUS_14430 40633 39086 gene locus_tag LOCUS_14440 gene ppx 40633 39086 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621407.1 protein_id gnl|my_center|LOCUS_14440 40959 42329 gene locus_tag LOCUS_14450 gene rho 40959 42329 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096334.1 protein_id gnl|my_center|LOCUS_14450 42403 43926 gene locus_tag LOCUS_14460 gene ubiD 42403 43926 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704131.1 protein_id gnl|my_center|LOCUS_14460 44037 44723 gene locus_tag LOCUS_14470 44037 44723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 44720 45433 gene locus_tag LOCUS_14480 gene folM 44720 45433 CDS product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091895.1 protein_id gnl|my_center|LOCUS_14480 45634 45762 gene locus_tag LOCUS_14490 45634 45762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 46270 47340 gene locus_tag LOCUS_14500 46270 47340 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268074.1 protein_id gnl|my_center|LOCUS_14500 47408 47920 gene locus_tag LOCUS_14510 47408 47920 CDS product DUF3087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071687.1 protein_id gnl|my_center|LOCUS_14510 48281 47961 gene locus_tag LOCUS_14520 48281 47961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 49543 48362 gene locus_tag LOCUS_14530 49543 48362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 50559 49540 gene locus_tag LOCUS_14540 gene gspK 50559 49540 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038516.1 protein_id gnl|my_center|LOCUS_14540 51167 50562 gene locus_tag LOCUS_14550 51167 50562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 51547 51164 gene locus_tag LOCUS_14560 51547 51164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 52029 51544 gene locus_tag LOCUS_14570 52029 51544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 52469 52026 gene locus_tag LOCUS_14580 gene gspG 52469 52026 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918065.1 protein_id gnl|my_center|LOCUS_14580 53691 52489 gene locus_tag LOCUS_14590 gene gspF 53691 52489 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070565.1 protein_id gnl|my_center|LOCUS_14590 55252 53759 gene locus_tag LOCUS_14600 gene gspE 55252 53759 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208413.1 protein_id gnl|my_center|LOCUS_14600 57267 55270 gene locus_tag LOCUS_14610 gene gspD 57267 55270 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918062.1 protein_id gnl|my_center|LOCUS_14610 57772 57290 gene locus_tag LOCUS_14620 57772 57290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 59493 57769 gene locus_tag LOCUS_14630 gene soxB 59493 57769 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965224.1 protein_id gnl|my_center|LOCUS_14630 59778 61934 gene locus_tag LOCUS_14640 59778 61934 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479992.1 protein_id gnl|my_center|LOCUS_14640 64292 62064 gene locus_tag LOCUS_14650 gene ppk1 64292 62064 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099209.1 protein_id gnl|my_center|LOCUS_14650 65361 64354 gene locus_tag LOCUS_14660 gene hemB 65361 64354 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 protein_id gnl|my_center|LOCUS_14660 65574 66236 gene locus_tag LOCUS_14670 gene elbB 65574 66236 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266301.1 protein_id gnl|my_center|LOCUS_14670 67237 66473 gene locus_tag LOCUS_14680 gene tatC 67237 66473 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115041.1 protein_id gnl|my_center|LOCUS_14680 67689 67234 gene locus_tag LOCUS_14690 gene tatB 67689 67234 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266365.1 protein_id gnl|my_center|LOCUS_14690 67953 67696 gene locus_tag LOCUS_14700 gene tatA 67953 67696 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 protein_id gnl|my_center|LOCUS_14700 68351 68016 gene locus_tag LOCUS_14710 68351 68016 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 protein_id gnl|my_center|LOCUS_14710 70019 68391 gene locus_tag LOCUS_14720 gene ubiB 70019 68391 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095885.1 protein_id gnl|my_center|LOCUS_14720 70651 70016 gene locus_tag LOCUS_14730 70651 70016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 71418 70651 gene locus_tag LOCUS_14740 gene ubiE 71418 70651 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416847.1 protein_id gnl|my_center|LOCUS_14740 71900 71517 gene locus_tag LOCUS_14750 71900 71517 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463876.1 protein_id gnl|my_center|LOCUS_14750 73219 71897 gene locus_tag LOCUS_14760 gene hslU 73219 71897 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095854.1 protein_id gnl|my_center|LOCUS_14760 73749 73231 gene locus_tag LOCUS_14770 gene hslV 73749 73231 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378861.1 protein_id gnl|my_center|LOCUS_14770 74605 73886 gene locus_tag LOCUS_14780 74605 73886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 76293 74608 gene locus_tag LOCUS_14790 gene argS 76293 74608 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038936.1 protein_id gnl|my_center|LOCUS_14790 78656 76446 gene locus_tag LOCUS_14800 78656 76446 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095847.1 protein_id gnl|my_center|LOCUS_14800 78856 79071 gene locus_tag LOCUS_14810 gene rpmE 78856 79071 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457203.1 protein_id gnl|my_center|LOCUS_14810 79409 80677 gene locus_tag LOCUS_14820 79409 80677 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_14820 81523 80771 gene locus_tag LOCUS_14830 81523 80771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 84154 81626 gene locus_tag LOCUS_14840 84154 81626 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110255951.1 protein_id gnl|my_center|LOCUS_14840 84411 85481 gene locus_tag LOCUS_14850 84411 85481 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_14850 85478 86068 gene locus_tag LOCUS_14860 85478 86068 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403038.1 protein_id gnl|my_center|LOCUS_14860 86065 86688 gene locus_tag LOCUS_14870 gene pilO 86065 86688 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_14870 86685 87215 gene locus_tag LOCUS_14880 gene pilP 86685 87215 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_14880 87311 89356 gene locus_tag LOCUS_14890 87311 89356 CDS product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093473135.1 protein_id gnl|my_center|LOCUS_14890 89356 89898 gene locus_tag LOCUS_14900 gene aroK 89356 89898 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095833.1 protein_id gnl|my_center|LOCUS_14900 89904 91010 gene locus_tag LOCUS_14910 gene aroB 89904 91010 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403032.1 protein_id gnl|my_center|LOCUS_14910 91460 95911 gene locus_tag LOCUS_14920 gene gltB 91460 95911 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_14920 96068 97486 gene locus_tag LOCUS_14930 96068 97486 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621194.1 protein_id gnl|my_center|LOCUS_14930 97805 99460 gene locus_tag LOCUS_14940 97805 99460 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 protein_id gnl|my_center|LOCUS_14940 99466 100332 gene locus_tag LOCUS_14950 gene kdsA 99466 100332 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092365.1 protein_id gnl|my_center|LOCUS_14950 100369 101661 gene locus_tag LOCUS_14960 gene eno 100369 101661 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092364.1 protein_id gnl|my_center|LOCUS_14960 102482 102159 gene locus_tag LOCUS_14970 102482 102159 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 protein_id gnl|my_center|LOCUS_14970 105335 102762 gene locus_tag LOCUS_14980 gene mutS 105335 102762 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113873.1 protein_id gnl|my_center|LOCUS_14980 105442 105954 gene locus_tag LOCUS_14990 105442 105954 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092262.1 protein_id gnl|my_center|LOCUS_14990 106075 107136 gene locus_tag LOCUS_15000 gene recA 106075 107136 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092260.1 protein_id gnl|my_center|LOCUS_15000 107140 107643 gene locus_tag LOCUS_15010 107140 107643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 107777 110389 gene locus_tag LOCUS_15020 gene alaS 107777 110389 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112602.1 protein_id gnl|my_center|LOCUS_15020 110495 111745 gene locus_tag LOCUS_15030 110495 111745 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085971.1 protein_id gnl|my_center|LOCUS_15030 111959 112156 gene locus_tag LOCUS_15040 gene csrA 111959 112156 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085981.1 protein_id gnl|my_center|LOCUS_15040 112252 112344 gene locus_tag LOCUS_t00340 112252 112344 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 112366 112442 gene locus_tag LOCUS_t00350 112366 112442 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 112493 112569 gene locus_tag LOCUS_t00360 112493 112569 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 113717 112755 gene locus_tag LOCUS_15050 113717 112755 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104220.1 protein_id gnl|my_center|LOCUS_15050 113897 114148 gene locus_tag LOCUS_15060 113897 114148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 114201 116030 gene locus_tag LOCUS_15070 gene oadA 114201 116030 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_15070 116042 117364 gene locus_tag LOCUS_15080 116042 117364 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427751.1 protein_id gnl|my_center|LOCUS_15080 119060 117453 gene locus_tag LOCUS_15090 119060 117453 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 protein_id gnl|my_center|LOCUS_15090 120594 119080 gene locus_tag LOCUS_15100 120594 119080 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582707.1 protein_id gnl|my_center|LOCUS_15100 121083 120613 gene locus_tag LOCUS_15110 121083 120613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 122117 121143 gene locus_tag LOCUS_15120 122117 121143 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818532.1 protein_id gnl|my_center|LOCUS_15120 122778 122248 gene locus_tag LOCUS_15130 gene chrA 122778 122248 CDS product chromate resistance efflux protein ChrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227840.1 protein_id gnl|my_center|LOCUS_15130 123347 122775 gene locus_tag LOCUS_15140 gene chrA 123347 122775 CDS product chromate resistance efflux protein ChrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227840.1 protein_id gnl|my_center|LOCUS_15140 123506 124183 gene locus_tag LOCUS_15150 123506 124183 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528582.1 protein_id gnl|my_center|LOCUS_15150 124827 124210 gene locus_tag LOCUS_15160 124827 124210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 125312 124827 gene locus_tag LOCUS_15170 125312 124827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 125514 126173 gene locus_tag LOCUS_15180 gene ccmA 125514 126173 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705297.1 protein_id gnl|my_center|LOCUS_15180 126181 126903 gene locus_tag LOCUS_15190 gene ccmB 126181 126903 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_15190 126918 127658 gene locus_tag LOCUS_15200 126918 127658 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083135.1 protein_id gnl|my_center|LOCUS_15200 127658 127897 gene locus_tag LOCUS_15210 127658 127897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 127887 128420 gene locus_tag LOCUS_15220 gene ccmE 127887 128420 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107323.1 protein_id gnl|my_center|LOCUS_15220 128433 130451 gene locus_tag LOCUS_15230 128433 130451 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_15230 130448 130981 gene locus_tag LOCUS_15240 130448 130981 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070641.1 protein_id gnl|my_center|LOCUS_15240 130972 131445 gene locus_tag LOCUS_15250 130972 131445 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992253.1 protein_id gnl|my_center|LOCUS_15250 131442 132686 gene locus_tag LOCUS_15260 gene ccmI 131442 132686 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268399.1 protein_id gnl|my_center|LOCUS_15260 132706 136197 gene locus_tag LOCUS_15270 132706 136197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 136424 138112 gene locus_tag LOCUS_15280 136424 138112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 138236 140296 gene locus_tag LOCUS_15290 gene ligA 138236 140296 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878165.1 protein_id gnl|my_center|LOCUS_15290 140293 140562 gene locus_tag LOCUS_15300 140293 140562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 142803 140749 gene locus_tag LOCUS_15310 gene mnmC 142803 140749 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114497.1 protein_id gnl|my_center|LOCUS_15310 143263 142964 gene locus_tag LOCUS_15320 143263 142964 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091489.1 protein_id gnl|my_center|LOCUS_15320 143391 144314 gene locus_tag LOCUS_15330 143391 144314 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693963.1 protein_id gnl|my_center|LOCUS_15330 144356 144979 gene locus_tag LOCUS_15340 144356 144979 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011215625.1 protein_id gnl|my_center|LOCUS_15340 145940 145032 gene locus_tag LOCUS_15350 145940 145032 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_15350 146825 145974 gene locus_tag LOCUS_15360 146825 145974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 146930 147610 gene locus_tag LOCUS_15370 146930 147610 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_15370 147692 148957 gene locus_tag LOCUS_15380 147692 148957 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100079.1 protein_id gnl|my_center|LOCUS_15380 149094 150407 gene locus_tag LOCUS_15390 gene argA 149094 150407 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096265.1 protein_id gnl|my_center|LOCUS_15390 150465 151502 gene locus_tag LOCUS_15400 150465 151502 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190976.1 protein_id gnl|my_center|LOCUS_15400 152286 153866 gene locus_tag LOCUS_15410 152286 153866 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707724.1 protein_id gnl|my_center|LOCUS_15410 153931 154446 gene locus_tag LOCUS_15420 153931 154446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 154559 155893 gene locus_tag LOCUS_15430 gene glrR 154559 155893 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172694.1 protein_id gnl|my_center|LOCUS_15430 156657 156004 gene locus_tag LOCUS_15440 156657 156004 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385122.1 protein_id gnl|my_center|LOCUS_15440 158225 156825 gene locus_tag LOCUS_15450 gene xseA 158225 156825 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_15450 158901 158347 gene locus_tag LOCUS_15460 158901 158347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 159160 160581 gene locus_tag LOCUS_15470 gene guaB 159160 160581 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092702.1 protein_id gnl|my_center|LOCUS_15470 160664 162241 gene locus_tag LOCUS_15480 gene guaA 160664 162241 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771001.1 protein_id gnl|my_center|LOCUS_15480 162476 163237 gene locus_tag LOCUS_15490 162476 163237 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125677.1 protein_id gnl|my_center|LOCUS_15490 163240 164616 gene locus_tag LOCUS_15500 163240 164616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 164715 165521 gene locus_tag LOCUS_15510 164715 165521 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704603.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence10 <1 612 gene locus_tag LOCUS_15520 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812141.1:TRAP transporter large permease 793 1197 gene locus_tag LOCUS_15530 793 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 3378 1336 gene locus_tag LOCUS_15540 gene paaZ 3378 1336 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705614.1 protein_id gnl|my_center|LOCUS_15540 4588 3491 gene locus_tag LOCUS_15550 gene paaK 4588 3491 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813290.1 protein_id gnl|my_center|LOCUS_15550 5118 4597 gene locus_tag LOCUS_15560 gene paaJ 5118 4597 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_15560 5922 5158 gene locus_tag LOCUS_15570 gene paaC 5922 5158 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965788.1 protein_id gnl|my_center|LOCUS_15570 6229 5942 gene locus_tag LOCUS_15580 gene paaB 6229 5942 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857353.1 protein_id gnl|my_center|LOCUS_15580 7156 6242 gene locus_tag LOCUS_15590 gene paaA 7156 6242 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 protein_id gnl|my_center|LOCUS_15590 8638 7325 gene locus_tag LOCUS_15600 gene paaF 8638 7325 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527791.1 protein_id gnl|my_center|LOCUS_15600 9884 8679 gene locus_tag LOCUS_15610 gene pcaF 9884 8679 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075194926.1 protein_id gnl|my_center|LOCUS_15610 10348 9881 gene locus_tag LOCUS_15620 gene paaI 10348 9881 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 protein_id gnl|my_center|LOCUS_15620 11888 10341 gene locus_tag LOCUS_15630 11888 10341 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029259.1 protein_id gnl|my_center|LOCUS_15630 12764 11973 gene locus_tag LOCUS_15640 gene paaG 12764 11973 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969790.1 protein_id gnl|my_center|LOCUS_15640 13554 12781 gene locus_tag LOCUS_15650 13554 12781 CDS product 2,3-dehydroadipyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292353.1 protein_id gnl|my_center|LOCUS_15650 13951 15627 gene locus_tag LOCUS_15660 gene paaN 13951 15627 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813288.1 protein_id gnl|my_center|LOCUS_15660 15639 16253 gene locus_tag LOCUS_15670 gene paaY 15639 16253 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705605.1 protein_id gnl|my_center|LOCUS_15670 17297 16371 gene locus_tag LOCUS_15680 gene paaX 17297 16371 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026612287.1 protein_id gnl|my_center|LOCUS_15680 17950 17441 gene locus_tag LOCUS_15690 17950 17441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 18789 17947 gene locus_tag LOCUS_15700 gene iclR 18789 17947 CDS product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174577.1 protein_id gnl|my_center|LOCUS_15700 19680 18895 gene locus_tag LOCUS_15710 19680 18895 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551489.1 protein_id gnl|my_center|LOCUS_15710 21094 19844 gene locus_tag LOCUS_15720 gene serA 21094 19844 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 protein_id gnl|my_center|LOCUS_15720 21220 21618 gene locus_tag LOCUS_15730 21220 21618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 21608 22492 gene locus_tag LOCUS_15740 21608 22492 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407877.1 protein_id gnl|my_center|LOCUS_15740 22510 24435 gene locus_tag LOCUS_15750 gene dxs 22510 24435 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102816.1 protein_id gnl|my_center|LOCUS_15750 25186 24515 gene locus_tag LOCUS_15760 25186 24515 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136894.1 protein_id gnl|my_center|LOCUS_15760 25875 25240 gene locus_tag LOCUS_15770 gene ribA 25875 25240 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412070.1 protein_id gnl|my_center|LOCUS_15770 26034 27110 gene locus_tag LOCUS_15780 gene hemE 26034 27110 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114569.1 protein_id gnl|my_center|LOCUS_15780 27103 27489 gene locus_tag LOCUS_15790 27103 27489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 27783 28808 gene locus_tag LOCUS_15800 27783 28808 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215949.1 protein_id gnl|my_center|LOCUS_15800 28920 30110 gene locus_tag LOCUS_15810 28920 30110 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481996.1 protein_id gnl|my_center|LOCUS_15810 30121 31221 gene locus_tag LOCUS_15820 30121 31221 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105885.1 protein_id gnl|my_center|LOCUS_15820 31256 32029 gene locus_tag LOCUS_15830 31256 32029 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388756.1 protein_id gnl|my_center|LOCUS_15830 32560 32066 gene locus_tag LOCUS_15840 32560 32066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 32786 33214 gene locus_tag LOCUS_15850 32786 33214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 34231 33305 gene locus_tag LOCUS_15860 34231 33305 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091833.1 protein_id gnl|my_center|LOCUS_15860 34393 35169 gene locus_tag LOCUS_15870 gene fpr 34393 35169 CDS product ferredoxin-NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091832.1 protein_id gnl|my_center|LOCUS_15870 35742 35404 gene locus_tag LOCUS_15880 gene glnK 35742 35404 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_15880 37146 35896 gene locus_tag LOCUS_15890 37146 35896 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 protein_id gnl|my_center|LOCUS_15890 37514 37176 gene locus_tag LOCUS_15900 gene glnK 37514 37176 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_15900 37797 38150 gene locus_tag LOCUS_15910 gene ubiK 37797 38150 CDS product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001357687.1 protein_id gnl|my_center|LOCUS_15910 38217 39719 gene locus_tag LOCUS_15920 38217 39719 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 protein_id gnl|my_center|LOCUS_15920 40209 39721 gene locus_tag LOCUS_15930 40209 39721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 41192 40206 gene locus_tag LOCUS_15940 41192 40206 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_15940 41428 43602 gene locus_tag LOCUS_15950 41428 43602 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925701.1 protein_id gnl|my_center|LOCUS_15950 43806 43642 gene locus_tag LOCUS_15960 43806 43642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 43781 44194 gene locus_tag LOCUS_15970 43781 44194 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104529.1 protein_id gnl|my_center|LOCUS_15970 44596 44207 gene locus_tag LOCUS_15980 44596 44207 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_15980 44883 45095 gene locus_tag LOCUS_15990 gene thiS 44883 45095 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379876.1 protein_id gnl|my_center|LOCUS_15990 45138 45935 gene locus_tag LOCUS_16000 45138 45935 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154366.1 protein_id gnl|my_center|LOCUS_16000 46003 46746 gene locus_tag LOCUS_16010 gene trmB 46003 46746 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118800.1 protein_id gnl|my_center|LOCUS_16010 48050 47049 gene locus_tag LOCUS_16020 48050 47049 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096914.1 protein_id gnl|my_center|LOCUS_16020 48084 48596 gene locus_tag LOCUS_16030 48084 48596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 48593 49180 gene locus_tag LOCUS_16040 48593 49180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 50242 49199 gene locus_tag LOCUS_16050 50242 49199 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527120.1 protein_id gnl|my_center|LOCUS_16050 50936 50250 gene locus_tag LOCUS_16060 gene mip 50936 50250 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_16060 51505 51062 gene locus_tag LOCUS_16070 51505 51062 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_16070 52807 51524 gene locus_tag LOCUS_16080 52807 51524 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461221.1 protein_id gnl|my_center|LOCUS_16080 53416 52829 gene locus_tag LOCUS_16090 53416 52829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 54657 53641 gene locus_tag LOCUS_16100 54657 53641 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969404.1 protein_id gnl|my_center|LOCUS_16100 55284 54748 gene locus_tag LOCUS_16110 55284 54748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 55338 57293 gene locus_tag LOCUS_16120 55338 57293 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_16120 57727 57290 gene locus_tag LOCUS_16130 gene dtd 57727 57290 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103447.1 protein_id gnl|my_center|LOCUS_16130 58398 57796 gene locus_tag LOCUS_16140 58398 57796 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942957.1 protein_id gnl|my_center|LOCUS_16140 59317 58472 gene locus_tag LOCUS_16150 59317 58472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 60236 59424 gene locus_tag LOCUS_16160 gene thiD 60236 59424 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534771.1 protein_id gnl|my_center|LOCUS_16160 60282 60713 gene locus_tag LOCUS_16170 60282 60713 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337356.1 protein_id gnl|my_center|LOCUS_16170 62133 60718 gene locus_tag LOCUS_16180 62133 60718 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925918.1 protein_id gnl|my_center|LOCUS_16180 62681 62133 gene locus_tag LOCUS_16190 62681 62133 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_16190 63597 62773 gene locus_tag LOCUS_16200 63597 62773 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266288.1 protein_id gnl|my_center|LOCUS_16200 64232 63600 gene locus_tag LOCUS_16210 64232 63600 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403888.1 protein_id gnl|my_center|LOCUS_16210 65016 64396 gene locus_tag LOCUS_16220 65016 64396 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 protein_id gnl|my_center|LOCUS_16220 65266 65871 gene locus_tag LOCUS_16230 gene yihA 65266 65871 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096980.1 protein_id gnl|my_center|LOCUS_16230 66792 66025 gene locus_tag LOCUS_16240 66792 66025 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114346.1 protein_id gnl|my_center|LOCUS_16240 67727 66789 gene locus_tag LOCUS_16250 gene xerC 67727 66789 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114345.1 protein_id gnl|my_center|LOCUS_16250 68439 67720 gene locus_tag LOCUS_16260 68439 67720 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266243.1 protein_id gnl|my_center|LOCUS_16260 69322 68489 gene locus_tag LOCUS_16270 gene dapF 69322 68489 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114344.1 protein_id gnl|my_center|LOCUS_16270 70593 69322 gene locus_tag LOCUS_16280 gene lysA 70593 69322 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 protein_id gnl|my_center|LOCUS_16280 69627 69706 gene locus_tag LOCUS_t00370 69627 69706 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 70781 70596 gene locus_tag LOCUS_16290 70781 70596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 72199 70781 gene locus_tag LOCUS_16300 gene argH 72199 70781 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 protein_id gnl|my_center|LOCUS_16300 72487 73428 gene locus_tag LOCUS_16310 gene hemC 72487 73428 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703979.1 protein_id gnl|my_center|LOCUS_16310 73428 74225 gene locus_tag LOCUS_16320 73428 74225 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114032.1 protein_id gnl|my_center|LOCUS_16320 74232 75785 gene locus_tag LOCUS_16330 74232 75785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 75782 77071 gene locus_tag LOCUS_16340 75782 77071 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103004.1 protein_id gnl|my_center|LOCUS_16340 79686 77371 gene locus_tag LOCUS_16350 gene ybiO 79686 77371 CDS product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704820.1 protein_id gnl|my_center|LOCUS_16350 79969 80358 gene locus_tag LOCUS_16360 79969 80358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 80355 80753 gene locus_tag LOCUS_16370 80355 80753 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085424.1 protein_id gnl|my_center|LOCUS_16370 81242 80763 gene locus_tag LOCUS_16380 gene mgsA 81242 80763 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367424.1 protein_id gnl|my_center|LOCUS_16380 82703 81246 gene locus_tag LOCUS_16390 gene pyk 82703 81246 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814419.1 protein_id gnl|my_center|LOCUS_16390 83054 84076 gene locus_tag LOCUS_16400 gene gap 83054 84076 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114837.1 protein_id gnl|my_center|LOCUS_16400 85113 84181 gene locus_tag LOCUS_16410 85113 84181 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550164.1 protein_id gnl|my_center|LOCUS_16410 86500 85208 gene locus_tag LOCUS_16420 86500 85208 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129252674.1 protein_id gnl|my_center|LOCUS_16420 86667 87395 gene locus_tag LOCUS_16430 gene phnF 86667 87395 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368695.1 protein_id gnl|my_center|LOCUS_16430 87446 88387 gene locus_tag LOCUS_16440 87446 88387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 88472 89278 gene locus_tag LOCUS_16450 gene phnC 88472 89278 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_16450 89289 90314 gene locus_tag LOCUS_16460 89289 90314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 90351 90818 gene locus_tag LOCUS_16470 90351 90818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 90811 91395 gene locus_tag LOCUS_16480 90811 91395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 91395 92516 gene locus_tag LOCUS_16490 91395 92516 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258836.1 protein_id gnl|my_center|LOCUS_16490 92513 93418 gene locus_tag LOCUS_16500 gene phnJ 92513 93418 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002271.1 protein_id gnl|my_center|LOCUS_16500 93415 94245 gene locus_tag LOCUS_16510 93415 94245 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435860.1 protein_id gnl|my_center|LOCUS_16510 94256 94981 gene locus_tag LOCUS_16520 gene phnL 94256 94981 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529517.1 protein_id gnl|my_center|LOCUS_16520 94978 96132 gene locus_tag LOCUS_16530 94978 96132 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258832.1 protein_id gnl|my_center|LOCUS_16530 96144 96731 gene locus_tag LOCUS_16540 gene phnN 96144 96731 CDS product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194016.1 protein_id gnl|my_center|LOCUS_16540 96722 97489 gene locus_tag LOCUS_16550 gene phnP 96722 97489 CDS product phosphonate metabolism protein PhnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113125.1 protein_id gnl|my_center|LOCUS_16550 97486 98334 gene locus_tag LOCUS_16560 97486 98334 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390999.1 protein_id gnl|my_center|LOCUS_16560 99565 98399 gene locus_tag LOCUS_16570 gene nspC 99565 98399 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_16570 100768 99569 gene locus_tag LOCUS_16580 100768 99569 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 protein_id gnl|my_center|LOCUS_16580 101471 101091 gene locus_tag LOCUS_tm00010 101471 101091 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 102003 101512 gene locus_tag LOCUS_16590 gene smpB 102003 101512 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100496.1 protein_id gnl|my_center|LOCUS_16590 102133 102567 gene locus_tag LOCUS_16600 102133 102567 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420637.1 protein_id gnl|my_center|LOCUS_16600 102572 102871 gene locus_tag LOCUS_16610 102572 102871 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095218.1 protein_id gnl|my_center|LOCUS_16610 103385 102921 gene locus_tag LOCUS_16620 103385 102921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 103458 103904 gene locus_tag LOCUS_16630 gene fur 103458 103904 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095216.1 protein_id gnl|my_center|LOCUS_16630 105681 104008 gene locus_tag LOCUS_16640 gene recN 105681 104008 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105025.1 protein_id gnl|my_center|LOCUS_16640 105943 106560 gene locus_tag LOCUS_16650 105943 106560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 106690 108621 gene locus_tag LOCUS_16660 gene dnaK 106690 108621 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095212.1 protein_id gnl|my_center|LOCUS_16660 108713 109864 gene locus_tag LOCUS_16670 gene dnaJ 108713 109864 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706780.1 protein_id gnl|my_center|LOCUS_16670 110908 109952 gene locus_tag LOCUS_16680 110908 109952 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942015.1 protein_id gnl|my_center|LOCUS_16680 111053 111331 gene locus_tag LOCUS_16690 111053 111331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 111328 112242 gene locus_tag LOCUS_16700 111328 112242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 112303 113106 gene locus_tag LOCUS_16710 gene dapB 112303 113106 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 protein_id gnl|my_center|LOCUS_16710 113543 114688 gene locus_tag LOCUS_16720 gene carA 113543 114688 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095209.1 protein_id gnl|my_center|LOCUS_16720 114741 117986 gene locus_tag LOCUS_16730 gene carB 114741 117986 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095207.1 protein_id gnl|my_center|LOCUS_16730 117983 118459 gene locus_tag LOCUS_16740 gene greA 117983 118459 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148008.1 protein_id gnl|my_center|LOCUS_16740 118986 118666 gene locus_tag LOCUS_16750 gene yhbY 118986 118666 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095204.1 protein_id gnl|my_center|LOCUS_16750 119707 119791 gene locus_tag LOCUS_t00380 119707 119791 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 120059 122047 gene locus_tag LOCUS_16760 gene ftsH 120059 122047 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095200.1 protein_id gnl|my_center|LOCUS_16760 122135 122986 gene locus_tag LOCUS_16770 gene folP 122135 122986 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113907.1 protein_id gnl|my_center|LOCUS_16770 122986 124341 gene locus_tag LOCUS_16780 gene glmM 122986 124341 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_16780 124408 125157 gene locus_tag LOCUS_16790 gene tpiA 124408 125157 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100513.1 protein_id gnl|my_center|LOCUS_16790 125162 125521 gene locus_tag LOCUS_16800 125162 125521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 125553 125639 gene locus_tag LOCUS_t00390 125553 125639 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 125759 125835 gene locus_tag LOCUS_t00400 125759 125835 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 126066 126527 gene locus_tag LOCUS_16810 gene rimP 126066 126527 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_16810 126593 128083 gene locus_tag LOCUS_16820 gene nusA 126593 128083 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 protein_id gnl|my_center|LOCUS_16820 128206 130713 gene locus_tag LOCUS_16830 gene infB 128206 130713 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268881.1 protein_id gnl|my_center|LOCUS_16830 130732 131157 gene locus_tag LOCUS_16840 gene rbfA 130732 131157 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268880.1 protein_id gnl|my_center|LOCUS_16840 131157 132074 gene locus_tag LOCUS_16850 gene truB 131157 132074 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_16850 132154 132423 gene locus_tag LOCUS_16860 gene rpsO 132154 132423 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095184.1 protein_id gnl|my_center|LOCUS_16860 132769 134904 gene locus_tag LOCUS_16870 gene pnp 132769 134904 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095181.1 protein_id gnl|my_center|LOCUS_16870 136299 135124 gene locus_tag LOCUS_16880 136299 135124 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113500.1 protein_id gnl|my_center|LOCUS_16880 136901 136521 gene locus_tag LOCUS_16890 136901 136521 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113912.1 protein_id gnl|my_center|LOCUS_16890 137786 136938 gene locus_tag LOCUS_16900 gene panC 137786 136938 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266657.1 protein_id gnl|my_center|LOCUS_16900 138593 137802 gene locus_tag LOCUS_16910 gene panB 138593 137802 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 protein_id gnl|my_center|LOCUS_16910 139206 138712 gene locus_tag LOCUS_16920 gene folK 139206 138712 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095144.1 protein_id gnl|my_center|LOCUS_16920 140600 139203 gene locus_tag LOCUS_16930 140600 139203 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095142.1 protein_id gnl|my_center|LOCUS_16930 142834 141437 gene locus_tag LOCUS_16940 gene cbrB 142834 141437 CDS product two-component system response regulator CbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_16940 145770 142831 gene locus_tag LOCUS_16950 gene cbrA 145770 142831 CDS product two-component system sensor histidine kinase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113915.1 protein_id gnl|my_center|LOCUS_16950 145936 145760 gene locus_tag LOCUS_16960 145936 145760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095129.1 protein_id gnl|my_center|LOCUS_16960 146847 145945 gene locus_tag LOCUS_16970 gene gluQRS 146847 145945 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115557.1 protein_id gnl|my_center|LOCUS_16970 147375 146938 gene locus_tag LOCUS_16980 gene dksA 147375 146938 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 protein_id gnl|my_center|LOCUS_16980 147603 148763 gene locus_tag LOCUS_16990 147603 148763 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038595.1 protein_id gnl|my_center|LOCUS_16990 148772 149545 gene locus_tag LOCUS_17000 gene sfsA 148772 149545 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071164.1 protein_id gnl|my_center|LOCUS_17000 150021 149566 gene locus_tag LOCUS_17010 150021 149566 CDS product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261212.1 protein_id gnl|my_center|LOCUS_17010 150647 150051 gene locus_tag LOCUS_17020 gene metW 150647 150051 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_17020 151801 150644 gene locus_tag LOCUS_17030 151801 150644 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084535.1 protein_id gnl|my_center|LOCUS_17030 152438 151845 gene locus_tag LOCUS_17040 152438 151845 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_17040 153320 152499 gene locus_tag LOCUS_17050 gene proC 153320 152499 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_17050 154090 153383 gene locus_tag LOCUS_17060 154090 153383 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084549.1 protein_id gnl|my_center|LOCUS_17060 154153 155187 gene locus_tag LOCUS_17070 gene pilT 154153 155187 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 protein_id gnl|my_center|LOCUS_17070 155232 156374 gene locus_tag LOCUS_17080 gene pilU 155232 156374 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_17080 157521 156382 gene locus_tag LOCUS_17090 157521 156382 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113168.1 protein_id gnl|my_center|LOCUS_17090 157638 158837 gene locus_tag LOCUS_17100 gene tyrS 157638 158837 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113167.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence11 1792 611 gene locus_tag LOCUS_17110 1792 611 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 protein_id gnl|my_center|LOCUS_17110 3318 1936 gene locus_tag LOCUS_17120 3318 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390314.1 protein_id gnl|my_center|LOCUS_17120 3746 3315 gene locus_tag LOCUS_17130 3746 3315 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096359.1 protein_id gnl|my_center|LOCUS_17130 5344 3743 gene locus_tag LOCUS_17140 5344 3743 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190045.1 protein_id gnl|my_center|LOCUS_17140 6495 5344 gene locus_tag LOCUS_17150 6495 5344 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097850.1 protein_id gnl|my_center|LOCUS_17150 6705 8252 gene locus_tag LOCUS_17160 6705 8252 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114595.1 protein_id gnl|my_center|LOCUS_17160 8266 9474 gene locus_tag LOCUS_17170 8266 9474 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206435.1 protein_id gnl|my_center|LOCUS_17170 9661 10476 gene locus_tag LOCUS_17180 9661 10476 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181512989.1 protein_id gnl|my_center|LOCUS_17180 10516 11652 gene locus_tag LOCUS_17190 10516 11652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114824.1 protein_id gnl|my_center|LOCUS_17190 11649 12440 gene locus_tag LOCUS_17200 11649 12440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114823.1 protein_id gnl|my_center|LOCUS_17200 12440 13378 gene locus_tag LOCUS_17210 12440 13378 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114822.1 protein_id gnl|my_center|LOCUS_17210 13375 13974 gene locus_tag LOCUS_17220 13375 13974 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109195.1 protein_id gnl|my_center|LOCUS_17220 15178 13982 gene locus_tag LOCUS_17230 gene lhgO 15178 13982 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271983.1 protein_id gnl|my_center|LOCUS_17230 15344 16030 gene locus_tag LOCUS_17240 gene csiR 15344 16030 CDS product DNA-binding transcriptional regulator CsiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126152.1 protein_id gnl|my_center|LOCUS_17240 16351 16031 gene locus_tag LOCUS_17250 gene sugE 16351 16031 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941368.1 protein_id gnl|my_center|LOCUS_17250 16569 16781 gene locus_tag LOCUS_17260 16569 16781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 17769 16810 gene locus_tag LOCUS_17270 17769 16810 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147543.1 protein_id gnl|my_center|LOCUS_17270 18476 17766 gene locus_tag LOCUS_17280 18476 17766 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113622.1 protein_id gnl|my_center|LOCUS_17280 19246 18491 gene locus_tag LOCUS_17290 19246 18491 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113623.1 protein_id gnl|my_center|LOCUS_17290 20470 19298 gene locus_tag LOCUS_17300 20470 19298 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143817.1 protein_id gnl|my_center|LOCUS_17300 21325 20513 gene locus_tag LOCUS_17310 21325 20513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 22010 21333 gene locus_tag LOCUS_17320 22010 21333 CDS product DUF2848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085745.1 protein_id gnl|my_center|LOCUS_17320 23393 22110 gene locus_tag LOCUS_17330 23393 22110 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383447.1 protein_id gnl|my_center|LOCUS_17330 23986 23390 gene locus_tag LOCUS_17340 23986 23390 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811059.1 protein_id gnl|my_center|LOCUS_17340 25113 24049 gene locus_tag LOCUS_17350 25113 24049 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926712.1 protein_id gnl|my_center|LOCUS_17350 25946 25143 gene locus_tag LOCUS_17360 25946 25143 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816500.1 protein_id gnl|my_center|LOCUS_17360 26916 26041 gene locus_tag LOCUS_17370 26916 26041 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085704.1 protein_id gnl|my_center|LOCUS_17370 27211 28200 gene locus_tag LOCUS_17380 27211 28200 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811098.1 protein_id gnl|my_center|LOCUS_17380 28259 28822 gene locus_tag LOCUS_17390 28259 28822 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811094.1 protein_id gnl|my_center|LOCUS_17390 28848 30152 gene locus_tag LOCUS_17400 28848 30152 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926703.1 protein_id gnl|my_center|LOCUS_17400 32005 30149 gene locus_tag LOCUS_17410 32005 30149 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070916.1 protein_id gnl|my_center|LOCUS_17410 33638 32010 gene locus_tag LOCUS_17420 33638 32010 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072332.1 protein_id gnl|my_center|LOCUS_17420 34665 33688 gene locus_tag LOCUS_17430 34665 33688 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072331.1 protein_id gnl|my_center|LOCUS_17430 35881 34667 gene locus_tag LOCUS_17440 35881 34667 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072330.1 protein_id gnl|my_center|LOCUS_17440 36821 36057 gene locus_tag LOCUS_17450 36821 36057 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097933.1 protein_id gnl|my_center|LOCUS_17450 37758 36814 gene locus_tag LOCUS_17460 37758 36814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210802.1 protein_id gnl|my_center|LOCUS_17460 38945 37755 gene locus_tag LOCUS_17470 38945 37755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 39864 38953 gene locus_tag LOCUS_17480 39864 38953 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368464.1 protein_id gnl|my_center|LOCUS_17480 39963 40940 gene locus_tag LOCUS_17490 39963 40940 CDS product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113939.1 protein_id gnl|my_center|LOCUS_17490 41352 41047 gene locus_tag LOCUS_17500 41352 41047 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172486.1 protein_id gnl|my_center|LOCUS_17500 42695 41349 gene locus_tag LOCUS_17510 42695 41349 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626009.1 protein_id gnl|my_center|LOCUS_17510 44334 42895 gene locus_tag LOCUS_17520 gene cysS 44334 42895 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113587.1 protein_id gnl|my_center|LOCUS_17520 46025 44331 gene locus_tag LOCUS_17530 46025 44331 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267206.1 protein_id gnl|my_center|LOCUS_17530 46156 46653 gene locus_tag LOCUS_17540 46156 46653 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087890.1 protein_id gnl|my_center|LOCUS_17540 46741 47505 gene locus_tag LOCUS_17550 gene lpxH 46741 47505 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113585.1 protein_id gnl|my_center|LOCUS_17550 48537 47494 gene locus_tag LOCUS_17560 48537 47494 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334803.1 protein_id gnl|my_center|LOCUS_17560 50549 48732 gene locus_tag LOCUS_17570 gene ppiD 50549 48732 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071919.1 protein_id gnl|my_center|LOCUS_17570 51020 50748 gene locus_tag LOCUS_17580 gene hupB 51020 50748 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087931.1 protein_id gnl|my_center|LOCUS_17580 53603 51198 gene locus_tag LOCUS_17590 gene lon 53603 51198 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087926.1 protein_id gnl|my_center|LOCUS_17590 55089 53806 gene locus_tag LOCUS_17600 gene clpX 55089 53806 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552735.1 protein_id gnl|my_center|LOCUS_17600 55834 55214 gene locus_tag LOCUS_17610 gene clpP 55834 55214 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552734.1 protein_id gnl|my_center|LOCUS_17610 57275 55923 gene locus_tag LOCUS_17620 gene tig 57275 55923 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460612.1 protein_id gnl|my_center|LOCUS_17620 57629 57555 gene locus_tag LOCUS_t00410 57629 57555 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 57735 57661 gene locus_tag LOCUS_t00420 57735 57661 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 57855 57779 gene locus_tag LOCUS_t00430 57855 57779 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 58000 57924 gene locus_tag LOCUS_t00440 58000 57924 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 58215 59078 gene locus_tag LOCUS_17630 gene folD 58215 59078 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087898.1 protein_id gnl|my_center|LOCUS_17630 59337 60083 gene locus_tag LOCUS_17640 gene mtnN 59337 60083 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217024.1 protein_id gnl|my_center|LOCUS_17640 60115 61026 gene locus_tag LOCUS_17650 60115 61026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 61950 61033 gene locus_tag LOCUS_17660 61950 61033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 63129 62023 gene locus_tag LOCUS_17670 gene pyrC 63129 62023 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_17670 63206 64096 gene locus_tag LOCUS_17680 63206 64096 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483368.1 protein_id gnl|my_center|LOCUS_17680 64137 64559 gene locus_tag LOCUS_17690 64137 64559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 65816 64575 gene locus_tag LOCUS_17700 65816 64575 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087074.1 protein_id gnl|my_center|LOCUS_17700 67292 65913 gene locus_tag LOCUS_17710 gene bauA 67292 65913 CDS product beta-alanine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083801.1 protein_id gnl|my_center|LOCUS_17710 67881 67426 gene locus_tag LOCUS_17720 67881 67426 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454910.1 protein_id gnl|my_center|LOCUS_17720 69230 68016 gene locus_tag LOCUS_17730 69230 68016 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462475.1 protein_id gnl|my_center|LOCUS_17730 69949 69275 gene locus_tag LOCUS_17740 gene wlbG 69949 69275 CDS product O-antigen biosynthesis protein WlbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038693.1 protein_id gnl|my_center|LOCUS_17740 71159 69951 gene locus_tag LOCUS_17750 71159 69951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 72601 71474 gene locus_tag LOCUS_17760 72601 71474 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221887.1 protein_id gnl|my_center|LOCUS_17760 73846 72647 gene locus_tag LOCUS_17770 73846 72647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 74955 73939 gene locus_tag LOCUS_17780 gene galE 74955 73939 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705040.1 protein_id gnl|my_center|LOCUS_17780 76077 75145 gene locus_tag LOCUS_17790 76077 75145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 76662 76249 gene locus_tag LOCUS_17800 76662 76249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 77564 77103 gene locus_tag LOCUS_17810 gene tagD 77564 77103 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880882.1 protein_id gnl|my_center|LOCUS_17810 79580 77703 gene locus_tag LOCUS_17820 79580 77703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046859776.1 protein_id gnl|my_center|LOCUS_17820 80542 79628 gene locus_tag LOCUS_17830 80542 79628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 81934 80699 gene locus_tag LOCUS_17840 81934 80699 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060798.1 protein_id gnl|my_center|LOCUS_17840 83017 82055 gene locus_tag LOCUS_17850 83017 82055 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963967.1 protein_id gnl|my_center|LOCUS_17850 84770 83055 gene locus_tag LOCUS_17860 84770 83055 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838546.1 protein_id gnl|my_center|LOCUS_17860 86864 84879 gene locus_tag LOCUS_17870 86864 84879 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 protein_id gnl|my_center|LOCUS_17870 87861 86866 gene locus_tag LOCUS_17880 87861 86866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 89200 88064 gene locus_tag LOCUS_17890 89200 88064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 91523 89256 gene locus_tag LOCUS_17900 91523 89256 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261021.1 protein_id gnl|my_center|LOCUS_17900 92672 91533 gene locus_tag LOCUS_17910 92672 91533 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014170829.1 protein_id gnl|my_center|LOCUS_17910 93629 93171 gene locus_tag LOCUS_17920 93629 93171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 94504 93713 gene locus_tag LOCUS_17930 94504 93713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 96917 94494 gene locus_tag LOCUS_17940 96917 94494 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_17940 97111 97257 gene locus_tag LOCUS_17950 97111 97257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 97841 97413 gene locus_tag LOCUS_17960 97841 97413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 99198 98065 gene locus_tag LOCUS_17970 99198 98065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 99677 99195 gene locus_tag LOCUS_17980 99677 99195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 101204 99876 gene locus_tag LOCUS_17990 101204 99876 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 protein_id gnl|my_center|LOCUS_17990 101719 101201 gene locus_tag LOCUS_18000 101719 101201 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243030.1 protein_id gnl|my_center|LOCUS_18000 102910 101849 gene locus_tag LOCUS_18010 102910 101849 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_18010 103729 103190 gene locus_tag LOCUS_18020 103729 103190 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198796.1 protein_id gnl|my_center|LOCUS_18020 105664 103748 gene locus_tag LOCUS_18030 105664 103748 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_18030 106692 105709 gene locus_tag LOCUS_18040 106692 105709 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114147.1 protein_id gnl|my_center|LOCUS_18040 107716 106805 gene locus_tag LOCUS_18050 107716 106805 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064007.1 protein_id gnl|my_center|LOCUS_18050 107812 108723 gene locus_tag LOCUS_18060 107812 108723 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096988.1 protein_id gnl|my_center|LOCUS_18060 110089 108818 gene locus_tag LOCUS_18070 110089 108818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 110365 111336 gene locus_tag LOCUS_18080 110365 111336 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089272.1 protein_id gnl|my_center|LOCUS_18080 111367 112347 gene locus_tag LOCUS_18090 111367 112347 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113741.1 protein_id gnl|my_center|LOCUS_18090 112344 113096 gene locus_tag LOCUS_18100 gene kduD 112344 113096 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_18100 114606 113140 gene locus_tag LOCUS_18110 114606 113140 CDS product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437132.1 protein_id gnl|my_center|LOCUS_18110 116472 114667 gene locus_tag LOCUS_18120 116472 114667 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528004.1 protein_id gnl|my_center|LOCUS_18120 116615 118183 gene locus_tag LOCUS_18130 116615 118183 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038347.1 protein_id gnl|my_center|LOCUS_18130 118391 119140 gene locus_tag LOCUS_18140 118391 119140 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703673.1 protein_id gnl|my_center|LOCUS_18140 119234 120085 gene locus_tag LOCUS_18150 119234 120085 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269057.1 protein_id gnl|my_center|LOCUS_18150 120098 121168 gene locus_tag LOCUS_18160 120098 121168 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972587.1 protein_id gnl|my_center|LOCUS_18160 121146 122786 gene locus_tag LOCUS_18170 121146 122786 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 protein_id gnl|my_center|LOCUS_18170 122880 123155 gene locus_tag LOCUS_18180 122880 123155 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626377.1 protein_id gnl|my_center|LOCUS_18180 123172 123477 gene locus_tag LOCUS_18190 123172 123477 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188824681.1 protein_id gnl|my_center|LOCUS_18190 123972 123661 gene locus_tag LOCUS_18200 123972 123661 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210705.1 protein_id gnl|my_center|LOCUS_18200 124907 124188 gene locus_tag LOCUS_18210 gene nanR 124907 124188 CDS product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525327.1 protein_id gnl|my_center|LOCUS_18210 126065 124974 gene locus_tag LOCUS_18220 126065 124974 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257444.1 protein_id gnl|my_center|LOCUS_18220 127469 126090 gene locus_tag LOCUS_18230 127469 126090 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975184.1 protein_id gnl|my_center|LOCUS_18230 128050 127517 gene locus_tag LOCUS_18240 128050 127517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 129113 128118 gene locus_tag LOCUS_18250 129113 128118 CDS product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965680.1 protein_id gnl|my_center|LOCUS_18250 130408 129212 gene locus_tag LOCUS_18260 130408 129212 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311090.1 protein_id gnl|my_center|LOCUS_18260 131403 130405 gene locus_tag LOCUS_18270 gene pdxA 131403 130405 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532057.1 protein_id gnl|my_center|LOCUS_18270 132164 131400 gene locus_tag LOCUS_18280 132164 131400 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529934.1 protein_id gnl|my_center|LOCUS_18280 132361 133524 gene locus_tag LOCUS_18290 132361 133524 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205727.1 protein_id gnl|my_center|LOCUS_18290 133552 134853 gene locus_tag LOCUS_18300 133552 134853 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211917.1 protein_id gnl|my_center|LOCUS_18300 134855 136288 gene locus_tag LOCUS_18310 134855 136288 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111807168.1 protein_id gnl|my_center|LOCUS_18310 137250 136351 gene locus_tag LOCUS_18320 137250 136351 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089063.1 protein_id gnl|my_center|LOCUS_18320 138177 137413 gene locus_tag LOCUS_18330 gene hpaI 138177 137413 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113007.1 protein_id gnl|my_center|LOCUS_18330 138353 139501 gene locus_tag LOCUS_18340 gene dgoD 138353 139501 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528179.1 protein_id gnl|my_center|LOCUS_18340 139495 140547 gene locus_tag LOCUS_18350 139495 140547 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338915.1 protein_id gnl|my_center|LOCUS_18350 140544 141167 gene locus_tag LOCUS_18360 140544 141167 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918669.1 protein_id gnl|my_center|LOCUS_18360 142401 141235 gene locus_tag LOCUS_18370 142401 141235 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_18370 142905 142447 gene locus_tag LOCUS_18380 gene etp 142905 142447 CDS product protein-tyrosine-phosphatase Etp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057871.1 protein_id gnl|my_center|LOCUS_18380 144690 143251 gene locus_tag LOCUS_18390 144690 143251 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766752.1 protein_id gnl|my_center|LOCUS_18390 145184 144930 gene locus_tag LOCUS_18400 145184 144930 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_18400 145435 145181 gene locus_tag LOCUS_18410 gene yefM 145435 145181 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259255.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence12 125 520 gene locus_tag LOCUS_18420 125 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 561 1250 gene locus_tag LOCUS_18430 561 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 1241 2065 gene locus_tag LOCUS_18440 1241 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2062 4200 gene locus_tag LOCUS_18450 2062 4200 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226013994.1 protein_id gnl|my_center|LOCUS_18450 8289 4375 gene locus_tag LOCUS_18460 8289 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 8961 8323 gene locus_tag LOCUS_18470 8961 8323 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122839.1 protein_id gnl|my_center|LOCUS_18470 9462 8980 gene locus_tag LOCUS_18480 9462 8980 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245200.1 protein_id gnl|my_center|LOCUS_18480 9785 12388 gene locus_tag LOCUS_18490 gene acnB 9785 12388 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087875.1 protein_id gnl|my_center|LOCUS_18490 13479 13724 gene locus_tag LOCUS_18500 13479 13724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 14812 13820 gene locus_tag LOCUS_18510 14812 13820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 15664 14849 gene locus_tag LOCUS_18520 gene rsbQ 15664 14849 CDS product sigma factor SigB/phosphatase RsbP regulator RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228292.1 protein_id gnl|my_center|LOCUS_18520 15816 16304 gene locus_tag LOCUS_18530 gene rraA 15816 16304 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765718.1 protein_id gnl|my_center|LOCUS_18530 16401 18284 gene locus_tag LOCUS_18540 16401 18284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 18287 18595 gene locus_tag LOCUS_18550 18287 18595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 20530 18698 gene locus_tag LOCUS_18560 gene ggt 20530 18698 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706842.1 protein_id gnl|my_center|LOCUS_18560 23187 20815 gene locus_tag LOCUS_18570 gene ppsA 23187 20815 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103934.1 protein_id gnl|my_center|LOCUS_18570 23459 24292 gene locus_tag LOCUS_18580 23459 24292 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382474.1 protein_id gnl|my_center|LOCUS_18580 25644 24439 gene locus_tag LOCUS_18590 25644 24439 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 protein_id gnl|my_center|LOCUS_18590 26998 25817 gene locus_tag LOCUS_18600 26998 25817 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038935.1 protein_id gnl|my_center|LOCUS_18600 28466 27096 gene locus_tag LOCUS_18610 28466 27096 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_18610 29431 28535 gene locus_tag LOCUS_18620 gene mmsB 29431 28535 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113890.1 protein_id gnl|my_center|LOCUS_18620 30623 29469 gene locus_tag LOCUS_18630 30623 29469 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114169.1 protein_id gnl|my_center|LOCUS_18630 31822 30656 gene locus_tag LOCUS_18640 31822 30656 CDS product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085499.1 protein_id gnl|my_center|LOCUS_18640 32052 32504 gene locus_tag LOCUS_18650 32052 32504 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350830.1 protein_id gnl|my_center|LOCUS_18650 32629 34320 gene locus_tag LOCUS_18660 32629 34320 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113337.1 protein_id gnl|my_center|LOCUS_18660 35319 34741 gene locus_tag LOCUS_18670 35319 34741 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099341.1 protein_id gnl|my_center|LOCUS_18670 36396 35380 gene locus_tag LOCUS_18680 gene nagZ 36396 35380 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118092.1 protein_id gnl|my_center|LOCUS_18680 36989 36471 gene locus_tag LOCUS_18690 36989 36471 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_18690 37654 36989 gene locus_tag LOCUS_18700 gene psrA 37654 36989 CDS product transcriptional regulator PsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403692.1 protein_id gnl|my_center|LOCUS_18700 37859 38515 gene locus_tag LOCUS_18710 gene lexA 37859 38515 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091196.1 protein_id gnl|my_center|LOCUS_18710 38496 39560 gene locus_tag LOCUS_18720 gene dinB 38496 39560 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191702.1 protein_id gnl|my_center|LOCUS_18720 40306 39635 gene locus_tag LOCUS_18730 40306 39635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 41184 40330 gene locus_tag LOCUS_18740 gene purU 41184 40330 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101174.1 protein_id gnl|my_center|LOCUS_18740 41328 43019 gene locus_tag LOCUS_18750 41328 43019 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919800.1 protein_id gnl|my_center|LOCUS_18750 43403 43113 gene locus_tag LOCUS_18760 43403 43113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 44600 43602 gene locus_tag LOCUS_18770 gene moaA 44600 43602 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059643243.1 protein_id gnl|my_center|LOCUS_18770 45066 44617 gene locus_tag LOCUS_18780 gene moaE 45066 44617 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736458.1 protein_id gnl|my_center|LOCUS_18780 45899 45069 gene locus_tag LOCUS_18790 45899 45069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 47175 45910 gene locus_tag LOCUS_18800 47175 45910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18800 47768 47172 gene locus_tag LOCUS_18810 47768 47172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18810 48370 47765 gene locus_tag LOCUS_18820 gene mobA 48370 47765 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706868.1 protein_id gnl|my_center|LOCUS_18820 48554 49138 gene locus_tag LOCUS_18830 48554 49138 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071486.1 protein_id gnl|my_center|LOCUS_18830 50386 49142 gene locus_tag LOCUS_18840 50386 49142 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457676.1 protein_id gnl|my_center|LOCUS_18840 52104 50461 gene locus_tag LOCUS_18850 gene glpD 52104 50461 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226258.1 protein_id gnl|my_center|LOCUS_18850 53983 52259 gene locus_tag LOCUS_18860 53983 52259 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267212.1 protein_id gnl|my_center|LOCUS_18860 54336 54064 gene locus_tag LOCUS_18870 54336 54064 CDS product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267211.1 protein_id gnl|my_center|LOCUS_18870 55243 54350 gene locus_tag LOCUS_18880 55243 54350 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267210.1 protein_id gnl|my_center|LOCUS_18880 56132 55245 gene locus_tag LOCUS_18890 56132 55245 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552729.1 protein_id gnl|my_center|LOCUS_18890 57225 56125 gene locus_tag LOCUS_18900 57225 56125 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104697.1 protein_id gnl|my_center|LOCUS_18900 58315 57227 gene locus_tag LOCUS_18910 58315 57227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409725.1 protein_id gnl|my_center|LOCUS_18910 59259 58630 gene locus_tag LOCUS_18920 gene upp 59259 58630 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652947.1 protein_id gnl|my_center|LOCUS_18920 60058 59375 gene locus_tag LOCUS_18930 gene ung 60058 59375 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972337.1 protein_id gnl|my_center|LOCUS_18930 60558 60079 gene locus_tag LOCUS_18940 gene gpt 60558 60079 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938365.1 protein_id gnl|my_center|LOCUS_18940 61106 60561 gene locus_tag LOCUS_18950 61106 60561 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446416.1 protein_id gnl|my_center|LOCUS_18950 62444 61143 gene locus_tag LOCUS_18960 62444 61143 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396212.1 protein_id gnl|my_center|LOCUS_18960 63289 62660 gene locus_tag LOCUS_18970 63289 62660 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366888.1 protein_id gnl|my_center|LOCUS_18970 63723 64808 gene locus_tag LOCUS_18980 gene metN 63723 64808 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594016.1 protein_id gnl|my_center|LOCUS_18980 64789 65442 gene locus_tag LOCUS_18990 64789 65442 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704854.1 protein_id gnl|my_center|LOCUS_18990 65681 66475 gene locus_tag LOCUS_19000 gene metQ 65681 66475 CDS product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704853.1 protein_id gnl|my_center|LOCUS_19000 66548 67015 gene locus_tag LOCUS_19010 66548 67015 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766803.1 protein_id gnl|my_center|LOCUS_19010 67166 67090 gene locus_tag LOCUS_t00450 67166 67090 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 67264 67188 gene locus_tag LOCUS_t00460 67264 67188 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 68833 67346 gene locus_tag LOCUS_19020 gene glpK 68833 67346 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113887.1 protein_id gnl|my_center|LOCUS_19020 69005 69766 gene locus_tag LOCUS_19030 69005 69766 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705542.1 protein_id gnl|my_center|LOCUS_19030 69905 71434 gene locus_tag LOCUS_19040 gene glpD 69905 71434 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098460.1 protein_id gnl|my_center|LOCUS_19040 70268 70357 gene locus_tag LOCUS_t00470 70268 70357 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 71638 72672 gene locus_tag LOCUS_19050 gene phnD 71638 72672 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939223.1 protein_id gnl|my_center|LOCUS_19050 72736 73554 gene locus_tag LOCUS_19060 gene phnC 72736 73554 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_19060 73541 74353 gene locus_tag LOCUS_19070 gene phnE 73541 74353 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808587.1 protein_id gnl|my_center|LOCUS_19070 74347 75156 gene locus_tag LOCUS_19080 gene phnE 74347 75156 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931496.1 protein_id gnl|my_center|LOCUS_19080 75228 76292 gene locus_tag LOCUS_19090 75228 76292 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_19090 77675 76296 gene locus_tag LOCUS_19100 gene fumC 77675 76296 CDS product class II fumarate hydratase FumC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112741.1 protein_id gnl|my_center|LOCUS_19100 77948 78334 gene locus_tag LOCUS_19110 77948 78334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 78496 79050 gene locus_tag LOCUS_19120 78496 79050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 79758 79057 gene locus_tag LOCUS_19130 gene hda 79758 79057 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102398.1 protein_id gnl|my_center|LOCUS_19130 80846 79755 gene locus_tag LOCUS_19140 80846 79755 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616381.1 protein_id gnl|my_center|LOCUS_19140 81001 82068 gene locus_tag LOCUS_19150 gene purM 81001 82068 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381585.1 protein_id gnl|my_center|LOCUS_19150 82065 82796 gene locus_tag LOCUS_19160 gene purN 82065 82796 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766657.1 protein_id gnl|my_center|LOCUS_19160 83710 83144 gene locus_tag LOCUS_19170 gene dcd 83710 83144 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092017.1 protein_id gnl|my_center|LOCUS_19170 84620 83814 gene locus_tag LOCUS_19180 84620 83814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 85788 84769 gene locus_tag LOCUS_19190 85788 84769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 86634 85924 gene locus_tag LOCUS_19200 86634 85924 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112501.1 protein_id gnl|my_center|LOCUS_19200 87074 86631 gene locus_tag LOCUS_19210 gene arfB 87074 86631 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_19210 87800 87126 gene locus_tag LOCUS_19220 87800 87126 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328012.1 protein_id gnl|my_center|LOCUS_19220 87915 88958 gene locus_tag LOCUS_19230 87915 88958 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389005.1 protein_id gnl|my_center|LOCUS_19230 90380 88959 gene locus_tag LOCUS_19240 90380 88959 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_19240 91501 90377 gene locus_tag LOCUS_19250 91501 90377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 92285 91491 gene locus_tag LOCUS_19260 92285 91491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 92674 92285 gene locus_tag LOCUS_19270 92674 92285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 94212 92671 gene locus_tag LOCUS_19280 94212 92671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19280 94479 95372 gene locus_tag LOCUS_19290 94479 95372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 95617 95387 gene locus_tag LOCUS_19300 95617 95387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 97140 95686 gene locus_tag LOCUS_19310 97140 95686 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 protein_id gnl|my_center|LOCUS_19310 97425 97270 gene locus_tag LOCUS_19320 97425 97270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 98218 97550 gene locus_tag LOCUS_19330 gene ureG 98218 97550 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368915.1 protein_id gnl|my_center|LOCUS_19330 98967 98260 gene locus_tag LOCUS_19340 98967 98260 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057205.1 protein_id gnl|my_center|LOCUS_19340 99481 98945 gene locus_tag LOCUS_19350 gene ureE 99481 98945 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095526.1 protein_id gnl|my_center|LOCUS_19350 101265 99550 gene locus_tag LOCUS_19360 gene ureC 101265 99550 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763096.1 protein_id gnl|my_center|LOCUS_19360 101588 101262 gene locus_tag LOCUS_19370 101588 101262 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066609.1 protein_id gnl|my_center|LOCUS_19370 101901 101599 gene locus_tag LOCUS_19380 gene ureA 101901 101599 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418034.1 protein_id gnl|my_center|LOCUS_19380 102822 101929 gene locus_tag LOCUS_19390 102822 101929 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763106.1 protein_id gnl|my_center|LOCUS_19390 103801 103103 gene locus_tag LOCUS_19400 gene urtE 103801 103103 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149319367.1 protein_id gnl|my_center|LOCUS_19400 104637 103801 gene locus_tag LOCUS_19410 gene urtD 104637 103801 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376420.1 protein_id gnl|my_center|LOCUS_19410 105779 104634 gene locus_tag LOCUS_19420 gene urtC 105779 104634 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969813.1 protein_id gnl|my_center|LOCUS_19420 107381 105783 gene locus_tag LOCUS_19430 gene urtB 107381 105783 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398880.1 protein_id gnl|my_center|LOCUS_19430 108806 107463 gene locus_tag LOCUS_19440 gene urtA 108806 107463 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529436.1 protein_id gnl|my_center|LOCUS_19440 110654 109164 gene locus_tag LOCUS_19450 110654 109164 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706285.1 protein_id gnl|my_center|LOCUS_19450 111158 110676 gene locus_tag LOCUS_19460 111158 110676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 112284 111268 gene locus_tag LOCUS_19470 112284 111268 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869089.1 protein_id gnl|my_center|LOCUS_19470 113181 112414 gene locus_tag LOCUS_19480 113181 112414 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857631.1 protein_id gnl|my_center|LOCUS_19480 114926 113232 gene locus_tag LOCUS_19490 114926 113232 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669463.1 protein_id gnl|my_center|LOCUS_19490 115774 114989 gene locus_tag LOCUS_19500 115774 114989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 117461 116001 gene locus_tag LOCUS_19510 117461 116001 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 protein_id gnl|my_center|LOCUS_19510 118745 117642 gene locus_tag LOCUS_19520 gene hppD 118745 117642 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106569.1 protein_id gnl|my_center|LOCUS_19520 119318 119007 gene locus_tag LOCUS_19530 119318 119007 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942208.1 protein_id gnl|my_center|LOCUS_19530 119488 120639 gene locus_tag LOCUS_19540 gene cfa 119488 120639 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096932.1 protein_id gnl|my_center|LOCUS_19540 120924 121805 gene locus_tag LOCUS_19550 120924 121805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 122470 121802 gene locus_tag LOCUS_19560 122470 121802 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522757.1 protein_id gnl|my_center|LOCUS_19560 122624 124594 gene locus_tag LOCUS_19570 122624 124594 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236934.1 protein_id gnl|my_center|LOCUS_19570 126781 124583 gene locus_tag LOCUS_19580 126781 124583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 126971 127309 gene locus_tag LOCUS_19590 126971 127309 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085898.1 protein_id gnl|my_center|LOCUS_19590 127310 128497 gene locus_tag LOCUS_19600 127310 128497 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114240.1 protein_id gnl|my_center|LOCUS_19600 128711 129271 gene locus_tag LOCUS_19610 128711 129271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 129305 129796 gene locus_tag LOCUS_19620 129305 129796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence13 233 556 gene locus_tag LOCUS_19630 gene trxA 233 556 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_19630 1733 618 gene locus_tag LOCUS_19640 1733 618 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_19640 3170 1893 gene locus_tag LOCUS_19650 gene serS 3170 1893 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211336.1 protein_id gnl|my_center|LOCUS_19650 3366 6587 gene locus_tag LOCUS_19660 3366 6587 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267753.1 protein_id gnl|my_center|LOCUS_19660 6674 6874 gene locus_tag LOCUS_19670 6674 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 6963 8216 gene locus_tag LOCUS_19680 6963 8216 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_19680 8222 8842 gene locus_tag LOCUS_19690 8222 8842 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083419.1 protein_id gnl|my_center|LOCUS_19690 9167 10450 gene locus_tag LOCUS_19700 9167 10450 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229955.1 protein_id gnl|my_center|LOCUS_19700 10545 10862 gene locus_tag LOCUS_19710 10545 10862 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488964.1 protein_id gnl|my_center|LOCUS_19710 11796 10987 gene locus_tag LOCUS_19720 gene trpC 11796 10987 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767891.1 protein_id gnl|my_center|LOCUS_19720 12842 11823 gene locus_tag LOCUS_19730 gene trpD 12842 11823 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085203.1 protein_id gnl|my_center|LOCUS_19730 13431 12859 gene locus_tag LOCUS_19740 13431 12859 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_19740 14959 13460 gene locus_tag LOCUS_19750 gene trpE 14959 13460 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_19750 15999 15190 gene locus_tag LOCUS_19760 15999 15190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 16307 15984 gene locus_tag LOCUS_19770 16307 15984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 17037 16312 gene locus_tag LOCUS_19780 gene rpe 17037 16312 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304938.1 protein_id gnl|my_center|LOCUS_19780 17198 18208 gene locus_tag LOCUS_19790 gene cysP 17198 18208 CDS product thiosulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079835.1 protein_id gnl|my_center|LOCUS_19790 18241 19104 gene locus_tag LOCUS_19800 gene cysT 18241 19104 CDS product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073418.1 protein_id gnl|my_center|LOCUS_19800 19104 19931 gene locus_tag LOCUS_19810 gene cysW 19104 19931 CDS product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172255.1 protein_id gnl|my_center|LOCUS_19810 19928 21037 gene locus_tag LOCUS_19820 19928 21037 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073420.1 protein_id gnl|my_center|LOCUS_19820 21481 21056 gene locus_tag LOCUS_19830 21481 21056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 21637 22227 gene locus_tag LOCUS_19840 21637 22227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 22950 22309 gene locus_tag LOCUS_19850 22950 22309 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036586.1 protein_id gnl|my_center|LOCUS_19850 23591 22965 gene locus_tag LOCUS_19860 23591 22965 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104779.1 protein_id gnl|my_center|LOCUS_19860 24141 23812 gene locus_tag LOCUS_19870 24141 23812 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_19870 24287 25630 gene locus_tag LOCUS_19880 gene miaB 24287 25630 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093158.1 protein_id gnl|my_center|LOCUS_19880 25781 26875 gene locus_tag LOCUS_19890 25781 26875 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763270.1 protein_id gnl|my_center|LOCUS_19890 26872 27384 gene locus_tag LOCUS_19900 gene ybeY 26872 27384 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707018.1 protein_id gnl|my_center|LOCUS_19900 27381 28250 gene locus_tag LOCUS_19910 27381 28250 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_19910 28274 29755 gene locus_tag LOCUS_19920 gene lnt 28274 29755 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268977.1 protein_id gnl|my_center|LOCUS_19920 31788 29968 gene locus_tag LOCUS_19930 31788 29968 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486234.1 protein_id gnl|my_center|LOCUS_19930 32354 31920 gene locus_tag LOCUS_19940 32354 31920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 32916 32479 gene locus_tag LOCUS_19950 32916 32479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 34084 32999 gene locus_tag LOCUS_19960 gene aroC 34084 32999 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405788.1 protein_id gnl|my_center|LOCUS_19960 35069 34119 gene locus_tag LOCUS_19970 gene prmB 35069 34119 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087648.1 protein_id gnl|my_center|LOCUS_19970 35183 35758 gene locus_tag LOCUS_19980 35183 35758 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378641.1 protein_id gnl|my_center|LOCUS_19980 36839 35766 gene locus_tag LOCUS_19990 36839 35766 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087542.1 protein_id gnl|my_center|LOCUS_19990 37726 36836 gene locus_tag LOCUS_20000 37726 36836 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_20000 38538 37723 gene locus_tag LOCUS_20010 38538 37723 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087496.1 protein_id gnl|my_center|LOCUS_20010 38773 39720 gene locus_tag LOCUS_20020 38773 39720 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418432.1 protein_id gnl|my_center|LOCUS_20020 40363 39875 gene locus_tag LOCUS_20030 gene sixA 40363 39875 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114250.1 protein_id gnl|my_center|LOCUS_20030 41423 40356 gene locus_tag LOCUS_20040 41423 40356 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109958.1 protein_id gnl|my_center|LOCUS_20040 43021 41579 gene locus_tag LOCUS_20050 43021 41579 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163901150.1 protein_id gnl|my_center|LOCUS_20050 44609 43038 gene locus_tag LOCUS_20060 44609 43038 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720404.1 protein_id gnl|my_center|LOCUS_20060 46757 44853 gene locus_tag LOCUS_20070 gene htpG 46757 44853 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087446.1 protein_id gnl|my_center|LOCUS_20070 47327 46842 gene locus_tag LOCUS_20080 47327 46842 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_20080 47817 47320 gene locus_tag LOCUS_20090 47817 47320 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072666.1 protein_id gnl|my_center|LOCUS_20090 48006 49976 gene locus_tag LOCUS_20100 48006 49976 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705455.1 protein_id gnl|my_center|LOCUS_20100 50699 50055 gene locus_tag LOCUS_20110 50699 50055 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236662.1 protein_id gnl|my_center|LOCUS_20110 51000 51206 gene locus_tag LOCUS_20120 51000 51206 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196837.1 protein_id gnl|my_center|LOCUS_20120 51974 51312 gene locus_tag LOCUS_20130 51974 51312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 52498 52070 gene locus_tag LOCUS_20140 52498 52070 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522995.1 protein_id gnl|my_center|LOCUS_20140 54497 52557 gene locus_tag LOCUS_20150 54497 52557 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_20150 55107 54511 gene locus_tag LOCUS_20160 55107 54511 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_20160 55226 56824 gene locus_tag LOCUS_20170 55226 56824 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 protein_id gnl|my_center|LOCUS_20170 56936 58432 gene locus_tag LOCUS_20180 56936 58432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 58429 58779 gene locus_tag LOCUS_20190 58429 58779 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_20190 58806 59192 gene locus_tag LOCUS_20200 58806 59192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 59212 59499 gene locus_tag LOCUS_20210 59212 59499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113255.1 protein_id gnl|my_center|LOCUS_20210 62197 59564 gene locus_tag LOCUS_20220 gene pepN 62197 59564 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_20220 62657 62277 gene locus_tag LOCUS_20230 62657 62277 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038593.1 protein_id gnl|my_center|LOCUS_20230 63266 62781 gene locus_tag LOCUS_20240 63266 62781 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809252.1 protein_id gnl|my_center|LOCUS_20240 63797 63306 gene locus_tag LOCUS_20250 gene rimI 63797 63306 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905268.1 protein_id gnl|my_center|LOCUS_20250 63967 65463 gene locus_tag LOCUS_20260 63967 65463 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 protein_id gnl|my_center|LOCUS_20260 65532 66131 gene locus_tag LOCUS_20270 gene cobO 65532 66131 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278887.1 protein_id gnl|my_center|LOCUS_20270 66490 67836 gene locus_tag LOCUS_20280 66490 67836 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036689.1 protein_id gnl|my_center|LOCUS_20280 67846 69783 gene locus_tag LOCUS_20290 67846 69783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 69801 71315 gene locus_tag LOCUS_20300 69801 71315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 71379 72272 gene locus_tag LOCUS_20310 71379 72272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 72305 73588 gene locus_tag LOCUS_20320 72305 73588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 73626 76304 gene locus_tag LOCUS_20330 73626 76304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 77711 76416 gene locus_tag LOCUS_20340 77711 76416 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_20340 78987 77812 gene locus_tag LOCUS_20350 78987 77812 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095644.1 protein_id gnl|my_center|LOCUS_20350 80001 79120 gene locus_tag LOCUS_20360 gene hflC 80001 79120 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366315.1 protein_id gnl|my_center|LOCUS_20360 81234 80002 gene locus_tag LOCUS_20370 gene hflK 81234 80002 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105238.1 protein_id gnl|my_center|LOCUS_20370 81409 81221 gene locus_tag LOCUS_20380 81409 81221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 82722 81406 gene locus_tag LOCUS_20390 gene hflX 82722 81406 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113930.1 protein_id gnl|my_center|LOCUS_20390 82979 82731 gene locus_tag LOCUS_20400 gene hfq 82979 82731 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095657.1 protein_id gnl|my_center|LOCUS_20400 84037 83099 gene locus_tag LOCUS_20410 gene miaA 84037 83099 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266496.1 protein_id gnl|my_center|LOCUS_20410 86039 84042 gene locus_tag LOCUS_20420 gene mutL 86039 84042 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 protein_id gnl|my_center|LOCUS_20420 87498 86050 gene locus_tag LOCUS_20430 gene amiB 87498 86050 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_20430 88013 87495 gene locus_tag LOCUS_20440 gene tsaE 88013 87495 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704166.1 protein_id gnl|my_center|LOCUS_20440 89523 87994 gene locus_tag LOCUS_20450 89523 87994 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148264.1 protein_id gnl|my_center|LOCUS_20450 89636 90739 gene locus_tag LOCUS_20460 gene queG 89636 90739 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_20460 91512 90919 gene locus_tag LOCUS_20470 gene orn 91512 90919 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815420.1 protein_id gnl|my_center|LOCUS_20470 91603 92637 gene locus_tag LOCUS_20480 gene rsgA 91603 92637 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366295.1 protein_id gnl|my_center|LOCUS_20480 92648 93478 gene locus_tag LOCUS_20490 gene rhdA 92648 93478 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113925.1 protein_id gnl|my_center|LOCUS_20490 93506 94372 gene locus_tag LOCUS_20500 gene asd 93506 94372 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113924.1 protein_id gnl|my_center|LOCUS_20500 95532 94543 gene locus_tag LOCUS_20510 gene epmA 95532 94543 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648321.1 protein_id gnl|my_center|LOCUS_20510 96276 95710 gene locus_tag LOCUS_20520 gene efp 96276 95710 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772139.1 protein_id gnl|my_center|LOCUS_20520 96397 97431 gene locus_tag LOCUS_20530 gene epmB 96397 97431 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815416.1 protein_id gnl|my_center|LOCUS_20530 99264 97558 gene locus_tag LOCUS_20540 gene leuA 99264 97558 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113805.1 protein_id gnl|my_center|LOCUS_20540 100443 99613 gene locus_tag LOCUS_20550 100443 99613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 101669 100440 gene locus_tag LOCUS_20560 gene serB 101669 100440 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 protein_id gnl|my_center|LOCUS_20560 104083 101819 gene locus_tag LOCUS_20570 gene parC 104083 101819 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_20570 106156 104276 gene locus_tag LOCUS_20580 gene parE 106156 104276 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817213.1 protein_id gnl|my_center|LOCUS_20580 106834 106199 gene locus_tag LOCUS_20590 106834 106199 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113918.1 protein_id gnl|my_center|LOCUS_20590 108536 106866 gene locus_tag LOCUS_20600 gene pgi 108536 106866 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208058.1 protein_id gnl|my_center|LOCUS_20600 108622 109392 gene locus_tag LOCUS_20610 gene cmoA 108622 109392 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261594.1 protein_id gnl|my_center|LOCUS_20610 109394 110386 gene locus_tag LOCUS_20620 gene cmoB 109394 110386 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365980.1 protein_id gnl|my_center|LOCUS_20620 112005 110554 gene locus_tag LOCUS_20630 gene cysN 112005 110554 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454657.1 protein_id gnl|my_center|LOCUS_20630 113141 112170 gene locus_tag LOCUS_20640 gene cysD 113141 112170 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_20640 114008 113271 gene locus_tag LOCUS_20650 gene cpdA 114008 113271 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262651.1 protein_id gnl|my_center|LOCUS_20650 114549 114103 gene locus_tag LOCUS_20660 114549 114103 CDS product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377111.1 protein_id gnl|my_center|LOCUS_20660 115192 114551 gene locus_tag LOCUS_20670 115192 114551 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095694.1 protein_id gnl|my_center|LOCUS_20670 115073 115336 gene locus_tag LOCUS_20680 115073 115336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 116077 115418 gene locus_tag LOCUS_20690 116077 115418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 116230 116769 gene locus_tag LOCUS_20700 gene greB 116230 116769 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174758.1 protein_id gnl|my_center|LOCUS_20700 116780 117037 gene locus_tag LOCUS_20710 116780 117037 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933584.1 protein_id gnl|my_center|LOCUS_20710 117006 117260 gene locus_tag LOCUS_20720 117006 117260 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517660.1 protein_id gnl|my_center|LOCUS_20720 118313 117261 gene locus_tag LOCUS_20730 118313 117261 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099371.1 protein_id gnl|my_center|LOCUS_20730 119152 118310 gene locus_tag LOCUS_20740 119152 118310 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111303.1 protein_id gnl|my_center|LOCUS_20740 120685 119183 gene locus_tag LOCUS_20750 120685 119183 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_20750 123871 120734 gene locus_tag LOCUS_20760 123871 120734 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403109.1 protein_id gnl|my_center|LOCUS_20760 125121 123868 gene locus_tag LOCUS_20770 125121 123868 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061301.1 protein_id gnl|my_center|LOCUS_20770 125281 125357 gene locus_tag LOCUS_t00480 125281 125357 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 125498 126583 gene locus_tag LOCUS_20780 125498 126583 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943820.1 protein_id gnl|my_center|LOCUS_20780 126661 128193 gene locus_tag LOCUS_20790 126661 128193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 128190 128669 gene locus_tag LOCUS_20800 128190 128669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 >Feature sequence14 294 833 gene locus_tag LOCUS_20810 294 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 1518 715 gene locus_tag LOCUS_20820 gene istB 1518 715 CDS product IS21-like element IS21 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544830.1 protein_id gnl|my_center|LOCUS_20820 2699 1518 gene locus_tag LOCUS_20830 gene istA 2699 1518 CDS product IS21-like element IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952372.1 protein_id gnl|my_center|LOCUS_20830 2741 3097 gene locus_tag LOCUS_20840 2741 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 3177 3629 gene locus_tag LOCUS_20850 3177 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 4207 3689 gene locus_tag LOCUS_20860 4207 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 5271 4309 gene locus_tag LOCUS_20870 5271 4309 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074187.1 protein_id gnl|my_center|LOCUS_20870 5349 5909 gene locus_tag LOCUS_20880 5349 5909 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103735.1 protein_id gnl|my_center|LOCUS_20880 6621 5932 gene locus_tag LOCUS_20890 6621 5932 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_20890 7593 6664 gene locus_tag LOCUS_20900 7593 6664 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036777.1 protein_id gnl|my_center|LOCUS_20900 7757 8029 gene locus_tag LOCUS_20910 7757 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 9930 8233 gene locus_tag LOCUS_20920 9930 8233 CDS product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929446.1 protein_id gnl|my_center|LOCUS_20920 10492 9968 gene locus_tag LOCUS_20930 gene luxS 10492 9968 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462534.1 protein_id gnl|my_center|LOCUS_20930 10972 10661 gene locus_tag LOCUS_20940 10972 10661 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212668.1 protein_id gnl|my_center|LOCUS_20940 12799 11066 gene locus_tag LOCUS_20950 12799 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 14193 12904 gene locus_tag LOCUS_20960 14193 12904 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390627.1 protein_id gnl|my_center|LOCUS_20960 14322 15065 gene locus_tag LOCUS_20970 14322 15065 CDS product DUF533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106298.1 protein_id gnl|my_center|LOCUS_20970 15065 15538 gene locus_tag LOCUS_20980 gene pgpA 15065 15538 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816908.1 protein_id gnl|my_center|LOCUS_20980 17460 15523 gene locus_tag LOCUS_20990 17460 15523 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115754.1 protein_id gnl|my_center|LOCUS_20990 18150 17563 gene locus_tag LOCUS_21000 18150 17563 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337380.1 protein_id gnl|my_center|LOCUS_21000 18263 18829 gene locus_tag LOCUS_21010 18263 18829 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551457.1 protein_id gnl|my_center|LOCUS_21010 19024 20181 gene locus_tag LOCUS_21020 19024 20181 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141359.1 protein_id gnl|my_center|LOCUS_21020 20242 21366 gene locus_tag LOCUS_21030 20242 21366 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106181.1 protein_id gnl|my_center|LOCUS_21030 21359 22246 gene locus_tag LOCUS_21040 21359 22246 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315839.1 protein_id gnl|my_center|LOCUS_21040 22260 23066 gene locus_tag LOCUS_21050 22260 23066 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530807.1 protein_id gnl|my_center|LOCUS_21050 23845 23057 gene locus_tag LOCUS_21060 23845 23057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 24822 23914 gene locus_tag LOCUS_21070 24822 23914 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556010.1 protein_id gnl|my_center|LOCUS_21070 25002 26513 gene locus_tag LOCUS_21080 25002 26513 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808433.1 protein_id gnl|my_center|LOCUS_21080 26762 28411 gene locus_tag LOCUS_21090 26762 28411 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393021.1 protein_id gnl|my_center|LOCUS_21090 28614 28820 gene locus_tag LOCUS_21100 28614 28820 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217533.1 protein_id gnl|my_center|LOCUS_21100 29038 30807 gene locus_tag LOCUS_21110 29038 30807 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_21110 30887 31555 gene locus_tag LOCUS_21120 30887 31555 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105021.1 protein_id gnl|my_center|LOCUS_21120 31671 32873 gene locus_tag LOCUS_21130 gene trpB 31671 32873 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206663.1 protein_id gnl|my_center|LOCUS_21130 32980 34335 gene locus_tag LOCUS_21140 32980 34335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 34430 34654 gene locus_tag LOCUS_21150 34430 34654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 34662 35333 gene locus_tag LOCUS_21160 34662 35333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 35330 36802 gene locus_tag LOCUS_21170 35330 36802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 36799 38304 gene locus_tag LOCUS_21180 36799 38304 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389324.1 protein_id gnl|my_center|LOCUS_21180 38301 40115 gene locus_tag LOCUS_21190 38301 40115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 41555 40155 gene locus_tag LOCUS_21200 41555 40155 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206399.1 protein_id gnl|my_center|LOCUS_21200 42845 41811 gene locus_tag LOCUS_21210 42845 41811 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388793.1 protein_id gnl|my_center|LOCUS_21210 43681 42938 gene locus_tag LOCUS_21220 43681 42938 CDS product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036974.1 protein_id gnl|my_center|LOCUS_21220 43827 45443 gene locus_tag LOCUS_21230 43827 45443 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986802.1 protein_id gnl|my_center|LOCUS_21230 47319 45463 gene locus_tag LOCUS_21240 47319 45463 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267570.1 protein_id gnl|my_center|LOCUS_21240 49110 47410 gene locus_tag LOCUS_21250 49110 47410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 50193 49345 gene locus_tag LOCUS_21260 50193 49345 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770654.1 protein_id gnl|my_center|LOCUS_21260 50295 51212 gene locus_tag LOCUS_21270 50295 51212 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 protein_id gnl|my_center|LOCUS_21270 51309 52313 gene locus_tag LOCUS_21280 51309 52313 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767387.1 protein_id gnl|my_center|LOCUS_21280 53363 52914 gene locus_tag LOCUS_21290 53363 52914 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708225.1 protein_id gnl|my_center|LOCUS_21290 53799 55508 gene locus_tag LOCUS_21300 53799 55508 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037772.1 protein_id gnl|my_center|LOCUS_21300 56411 55686 gene locus_tag LOCUS_21310 56411 55686 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502010.1 protein_id gnl|my_center|LOCUS_21310 57596 56445 gene locus_tag LOCUS_21320 gene argE 57596 56445 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921458.1 protein_id gnl|my_center|LOCUS_21320 57796 58914 gene locus_tag LOCUS_21330 57796 58914 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114006.1 protein_id gnl|my_center|LOCUS_21330 59122 60132 gene locus_tag LOCUS_21340 gene rhuM 59122 60132 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_21340 60247 60423 gene locus_tag LOCUS_21350 60247 60423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 60416 61312 gene locus_tag LOCUS_21360 60416 61312 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986681.1 protein_id gnl|my_center|LOCUS_21360 61309 61773 gene locus_tag LOCUS_21370 61309 61773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 62120 61803 gene locus_tag LOCUS_21380 62120 61803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 62407 62120 gene locus_tag LOCUS_21390 62407 62120 CDS product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817080.1 protein_id gnl|my_center|LOCUS_21390 63015 62437 gene locus_tag LOCUS_21400 63015 62437 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346204.1 protein_id gnl|my_center|LOCUS_21400 63375 64508 gene locus_tag LOCUS_21410 63375 64508 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114006.1 protein_id gnl|my_center|LOCUS_21410 64789 65265 gene locus_tag LOCUS_21420 64789 65265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 66545 65262 gene locus_tag LOCUS_21430 66545 65262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 66862 66581 gene locus_tag LOCUS_21440 66862 66581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 67012 68430 gene locus_tag LOCUS_21450 67012 68430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 68531 69574 gene locus_tag LOCUS_21460 68531 69574 CDS product nucleoside monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121910.1 protein_id gnl|my_center|LOCUS_21460 69876 70118 gene locus_tag LOCUS_21470 69876 70118 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976578.1 protein_id gnl|my_center|LOCUS_21470 70115 70378 gene locus_tag LOCUS_21480 70115 70378 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_21480 70538 70395 gene locus_tag LOCUS_21490 70538 70395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 70655 71485 gene locus_tag LOCUS_21500 70655 71485 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089202.1 protein_id gnl|my_center|LOCUS_21500 72428 71511 gene locus_tag LOCUS_21510 72428 71511 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_21510 72592 73035 gene locus_tag LOCUS_21520 72592 73035 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073195.1 protein_id gnl|my_center|LOCUS_21520 73118 74065 gene locus_tag LOCUS_21530 73118 74065 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339057.1 protein_id gnl|my_center|LOCUS_21530 74161 75105 gene locus_tag LOCUS_21540 74161 75105 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112455.1 protein_id gnl|my_center|LOCUS_21540 75142 75492 gene locus_tag LOCUS_21550 75142 75492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 75572 75865 gene locus_tag LOCUS_21560 75572 75865 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_21560 75858 76205 gene locus_tag LOCUS_21570 75858 76205 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_21570 79521 76195 gene locus_tag LOCUS_21580 79521 76195 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104711.1 protein_id gnl|my_center|LOCUS_21580 80852 79518 gene locus_tag LOCUS_21590 80852 79518 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406534.1 protein_id gnl|my_center|LOCUS_21590 80778 80969 gene locus_tag LOCUS_21600 80778 80969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 81871 80966 gene locus_tag LOCUS_21610 gene ampR 81871 80966 CDS product LysR family transcriptional regulator AmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101291.1 protein_id gnl|my_center|LOCUS_21610 81989 82795 gene locus_tag LOCUS_21620 gene blaOXA 81989 82795 CDS product OXA-48 family carbapenem-hydrolyzing class D beta-lactamase OXA-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071128.1 protein_id gnl|my_center|LOCUS_21620 82818 83504 gene locus_tag LOCUS_21630 gene nfi 82818 83504 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258210.1 protein_id gnl|my_center|LOCUS_21630 84406 83501 gene locus_tag LOCUS_21640 84406 83501 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843742.1 protein_id gnl|my_center|LOCUS_21640 84499 85068 gene locus_tag LOCUS_21650 84499 85068 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071856.1 protein_id gnl|my_center|LOCUS_21650 85141 85656 gene locus_tag LOCUS_21660 gene tpx 85141 85656 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089950.1 protein_id gnl|my_center|LOCUS_21660 85784 86218 gene locus_tag LOCUS_21670 85784 86218 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 protein_id gnl|my_center|LOCUS_21670 86997 86296 gene locus_tag LOCUS_21680 86997 86296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 88001 86994 gene locus_tag LOCUS_21690 88001 86994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 88114 90459 gene locus_tag LOCUS_21700 88114 90459 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111156.1 protein_id gnl|my_center|LOCUS_21700 90456 91997 gene locus_tag LOCUS_21710 90456 91997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 92450 92013 gene locus_tag LOCUS_21720 92450 92013 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970669.1 protein_id gnl|my_center|LOCUS_21720 93181 92447 gene locus_tag LOCUS_21730 gene deoD 93181 92447 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166923.1 protein_id gnl|my_center|LOCUS_21730 94422 93181 gene locus_tag LOCUS_21740 94422 93181 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071448.1 protein_id gnl|my_center|LOCUS_21740 95774 94419 gene locus_tag LOCUS_21750 gene deoA 95774 94419 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707412.1 protein_id gnl|my_center|LOCUS_21750 96550 95774 gene locus_tag LOCUS_21760 gene deoC 96550 95774 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071446.1 protein_id gnl|my_center|LOCUS_21760 97907 96636 gene locus_tag LOCUS_21770 97907 96636 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707414.1 protein_id gnl|my_center|LOCUS_21770 98032 98814 gene locus_tag LOCUS_21780 98032 98814 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391591.1 protein_id gnl|my_center|LOCUS_21780 98968 99651 gene locus_tag LOCUS_21790 98968 99651 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087416.1 protein_id gnl|my_center|LOCUS_21790 100937 99783 gene locus_tag LOCUS_21800 100937 99783 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889090.1 protein_id gnl|my_center|LOCUS_21800 101202 102317 gene locus_tag LOCUS_21810 gene potA 101202 102317 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085109.1 protein_id gnl|my_center|LOCUS_21810 102373 103440 gene locus_tag LOCUS_21820 102373 103440 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101898.1 protein_id gnl|my_center|LOCUS_21820 103529 104785 gene locus_tag LOCUS_21830 103529 104785 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196172.1 protein_id gnl|my_center|LOCUS_21830 104804 105634 gene locus_tag LOCUS_21840 104804 105634 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099535.1 protein_id gnl|my_center|LOCUS_21840 107818 105644 gene locus_tag LOCUS_21850 gene pta 107818 105644 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114221.1 protein_id gnl|my_center|LOCUS_21850 108999 107815 gene locus_tag LOCUS_21860 108999 107815 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208325.1 protein_id gnl|my_center|LOCUS_21860 109167 110066 gene locus_tag LOCUS_21870 109167 110066 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266700.1 protein_id gnl|my_center|LOCUS_21870 110215 110715 gene locus_tag LOCUS_21880 110215 110715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 111072 111992 gene locus_tag LOCUS_21890 111072 111992 CDS product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491523.1 protein_id gnl|my_center|LOCUS_21890 111989 113209 gene locus_tag LOCUS_21900 111989 113209 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_21900 115049 113268 gene locus_tag LOCUS_21910 115049 113268 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_21910 117092 115185 gene locus_tag LOCUS_21920 gene thiC 117092 115185 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_21920 117820 117152 gene locus_tag LOCUS_21930 117820 117152 CDS product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389778.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence15 <1 849 gene locus_tag LOCUS_21940 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091099.1:FAD-binding protein 861 2378 gene locus_tag LOCUS_21950 861 2378 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114595.1 protein_id gnl|my_center|LOCUS_21950 2030 2126 gene locus_tag LOCUS_t00490 2030 2126 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2392 3219 gene locus_tag LOCUS_21960 2392 3219 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195806.1 protein_id gnl|my_center|LOCUS_21960 3216 3962 gene locus_tag LOCUS_21970 3216 3962 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195807.1 protein_id gnl|my_center|LOCUS_21970 3989 4876 gene locus_tag LOCUS_21980 3989 4876 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931547.1 protein_id gnl|my_center|LOCUS_21980 4879 5862 gene locus_tag LOCUS_21990 4879 5862 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391055.1 protein_id gnl|my_center|LOCUS_21990 5890 7092 gene locus_tag LOCUS_22000 gene pcaF 5890 7092 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705263.1 protein_id gnl|my_center|LOCUS_22000 7095 8147 gene locus_tag LOCUS_22010 7095 8147 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903331.1 protein_id gnl|my_center|LOCUS_22010 8682 9656 gene locus_tag LOCUS_22020 gene catA 8682 9656 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705528.1 protein_id gnl|my_center|LOCUS_22020 9839 11206 gene locus_tag LOCUS_22030 9839 11206 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705527.1 protein_id gnl|my_center|LOCUS_22030 11238 11726 gene locus_tag LOCUS_22040 gene benB 11238 11726 CDS product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366457.1 protein_id gnl|my_center|LOCUS_22040 11804 12976 gene locus_tag LOCUS_22050 11804 12976 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966696.1 protein_id gnl|my_center|LOCUS_22050 13043 13903 gene locus_tag LOCUS_22060 13043 13903 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_22060 13916 14995 gene locus_tag LOCUS_22070 13916 14995 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_22070 14999 15808 gene locus_tag LOCUS_22080 14999 15808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815010.1 protein_id gnl|my_center|LOCUS_22080 15805 16566 gene locus_tag LOCUS_22090 15805 16566 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_22090 16598 17809 gene locus_tag LOCUS_22100 gene benE 16598 17809 CDS product benzoate/H(+) symporter BenE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206210.1 protein_id gnl|my_center|LOCUS_22100 17880 18701 gene locus_tag LOCUS_22110 17880 18701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 19688 18795 gene locus_tag LOCUS_22120 19688 18795 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_22120 19846 20058 gene locus_tag LOCUS_22130 19846 20058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 20051 21508 gene locus_tag LOCUS_22140 20051 21508 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404732.1 protein_id gnl|my_center|LOCUS_22140 21526 22827 gene locus_tag LOCUS_22150 21526 22827 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224442.1 protein_id gnl|my_center|LOCUS_22150 23266 22832 gene locus_tag LOCUS_22160 23266 22832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 23680 23366 gene locus_tag LOCUS_22170 23680 23366 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460963.1 protein_id gnl|my_center|LOCUS_22170 24390 23677 gene locus_tag LOCUS_22180 24390 23677 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480275.1 protein_id gnl|my_center|LOCUS_22180 25382 24387 gene locus_tag LOCUS_22190 25382 24387 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113297.1 protein_id gnl|my_center|LOCUS_22190 25547 27181 gene locus_tag LOCUS_22200 25547 27181 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002495210.1 protein_id gnl|my_center|LOCUS_22200 27553 28497 gene locus_tag LOCUS_22210 27553 28497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 28562 29764 gene locus_tag LOCUS_22220 28562 29764 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022426.1 protein_id gnl|my_center|LOCUS_22220 29761 31131 gene locus_tag LOCUS_22230 29761 31131 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065115.1 protein_id gnl|my_center|LOCUS_22230 31341 33290 gene locus_tag LOCUS_22240 31341 33290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 33303 33812 gene locus_tag LOCUS_22250 33303 33812 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_22250 33812 34684 gene locus_tag LOCUS_22260 33812 34684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 35513 35968 gene locus_tag LOCUS_22270 35513 35968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 35968 36960 gene locus_tag LOCUS_22280 35968 36960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 36957 38255 gene locus_tag LOCUS_22290 36957 38255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 38252 38563 gene locus_tag LOCUS_22300 38252 38563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 38560 39216 gene locus_tag LOCUS_22310 38560 39216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 39265 39552 gene locus_tag LOCUS_22320 39265 39552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 39555 40661 gene locus_tag LOCUS_22330 39555 40661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 40690 41508 gene locus_tag LOCUS_22340 40690 41508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 41559 41951 gene locus_tag LOCUS_22350 41559 41951 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258036.1 protein_id gnl|my_center|LOCUS_22350 41944 43086 gene locus_tag LOCUS_22360 41944 43086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 43083 45929 gene locus_tag LOCUS_22370 43083 45929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 45926 47482 gene locus_tag LOCUS_22380 45926 47482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 47513 49960 gene locus_tag LOCUS_22390 47513 49960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 49988 52126 gene locus_tag LOCUS_22400 49988 52126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 52208 52954 gene locus_tag LOCUS_22410 52208 52954 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530562.1 protein_id gnl|my_center|LOCUS_22410 54193 52976 gene locus_tag LOCUS_22420 54193 52976 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167609.1 protein_id gnl|my_center|LOCUS_22420 54312 54836 gene locus_tag LOCUS_22430 54312 54836 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054081306.1 protein_id gnl|my_center|LOCUS_22430 54845 55885 gene locus_tag LOCUS_22440 54845 55885 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090209.1 protein_id gnl|my_center|LOCUS_22440 55882 56952 gene locus_tag LOCUS_22450 55882 56952 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070823.1 protein_id gnl|my_center|LOCUS_22450 57097 58857 gene locus_tag LOCUS_22460 gene fan1 57097 58857 CDS product nuclease Fan1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113615.1 protein_id gnl|my_center|LOCUS_22460 58854 61232 gene locus_tag LOCUS_22470 58854 61232 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113616.1 protein_id gnl|my_center|LOCUS_22470 61260 61925 gene locus_tag LOCUS_22480 61260 61925 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_22480 62058 62237 gene locus_tag LOCUS_22490 62058 62237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 62506 62291 gene locus_tag LOCUS_22500 62506 62291 CDS product DUF3565 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922503.1 protein_id gnl|my_center|LOCUS_22500 62712 62515 gene locus_tag LOCUS_22510 62712 62515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 63079 62777 gene locus_tag LOCUS_22520 63079 62777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 64536 63286 gene locus_tag LOCUS_22530 64536 63286 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005007934.1 protein_id gnl|my_center|LOCUS_22530 67680 64681 gene locus_tag LOCUS_22540 67680 64681 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082358.1 protein_id gnl|my_center|LOCUS_22540 67964 68677 gene locus_tag LOCUS_22550 67964 68677 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082360.1 protein_id gnl|my_center|LOCUS_22550 68681 70324 gene locus_tag LOCUS_22560 68681 70324 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463925.1 protein_id gnl|my_center|LOCUS_22560 71225 70311 gene locus_tag LOCUS_22570 gene metR 71225 70311 CDS product transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092181.1 protein_id gnl|my_center|LOCUS_22570 71329 73629 gene locus_tag LOCUS_22580 gene metE 71329 73629 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926372.1 protein_id gnl|my_center|LOCUS_22580 73739 74449 gene locus_tag LOCUS_22590 73739 74449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 74712 75317 gene locus_tag LOCUS_22600 74712 75317 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549943.1 protein_id gnl|my_center|LOCUS_22600 76475 75408 gene locus_tag LOCUS_22610 76475 75408 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448174.1 protein_id gnl|my_center|LOCUS_22610 77220 76684 gene locus_tag LOCUS_22620 77220 76684 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037880.1 protein_id gnl|my_center|LOCUS_22620 77333 77773 gene locus_tag LOCUS_22630 77333 77773 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403905.1 protein_id gnl|my_center|LOCUS_22630 77860 78300 gene locus_tag LOCUS_22640 77860 78300 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975605.1 protein_id gnl|my_center|LOCUS_22640 78336 78782 gene locus_tag LOCUS_22650 78336 78782 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092827608.1 protein_id gnl|my_center|LOCUS_22650 79684 78950 gene locus_tag LOCUS_22660 79684 78950 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171423.1 protein_id gnl|my_center|LOCUS_22660 82833 79861 gene locus_tag LOCUS_22670 82833 79861 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073282.1 protein_id gnl|my_center|LOCUS_22670 83540 83082 gene locus_tag LOCUS_22680 83540 83082 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552284.1 protein_id gnl|my_center|LOCUS_22680 84834 83734 gene locus_tag LOCUS_22690 84834 83734 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036086.1 protein_id gnl|my_center|LOCUS_22690 86499 84979 gene locus_tag LOCUS_22700 86499 84979 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522572.1 protein_id gnl|my_center|LOCUS_22700 86636 87718 gene locus_tag LOCUS_22710 gene lptF 86636 87718 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316899.1 protein_id gnl|my_center|LOCUS_22710 87715 88779 gene locus_tag LOCUS_22720 gene lptG 87715 88779 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764084.1 protein_id gnl|my_center|LOCUS_22720 88795 89271 gene locus_tag LOCUS_22730 88795 89271 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104962.1 protein_id gnl|my_center|LOCUS_22730 89336 89590 gene locus_tag LOCUS_22740 89336 89590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 89767 90249 gene locus_tag LOCUS_22750 gene bfrB 89767 90249 CDS product bacterioferritin BfrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092078.1 protein_id gnl|my_center|LOCUS_22750 90514 91569 gene locus_tag LOCUS_22760 90514 91569 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 protein_id gnl|my_center|LOCUS_22760 91572 92363 gene locus_tag LOCUS_22770 91572 92363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687942.1 protein_id gnl|my_center|LOCUS_22770 92360 93127 gene locus_tag LOCUS_22780 92360 93127 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971358.1 protein_id gnl|my_center|LOCUS_22780 93358 93134 gene locus_tag LOCUS_22790 93358 93134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 94249 93395 gene locus_tag LOCUS_22800 gene tcdA 94249 93395 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103587.1 protein_id gnl|my_center|LOCUS_22800 95028 94261 gene locus_tag LOCUS_22810 gene truC 95028 94261 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063386.1 protein_id gnl|my_center|LOCUS_22810 96256 95093 gene locus_tag LOCUS_22820 96256 95093 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958179.1 protein_id gnl|my_center|LOCUS_22820 97220 96375 gene locus_tag LOCUS_22830 97220 96375 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815929.1 protein_id gnl|my_center|LOCUS_22830 98104 97217 gene locus_tag LOCUS_22840 98104 97217 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815927.1 protein_id gnl|my_center|LOCUS_22840 99469 98186 gene locus_tag LOCUS_22850 99469 98186 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940420.1 protein_id gnl|my_center|LOCUS_22850 100655 99486 gene locus_tag LOCUS_22860 100655 99486 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940419.1 protein_id gnl|my_center|LOCUS_22860 100879 101553 gene locus_tag LOCUS_22870 100879 101553 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124862.1 protein_id gnl|my_center|LOCUS_22870 101680 102891 gene locus_tag LOCUS_22880 101680 102891 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382995.1 protein_id gnl|my_center|LOCUS_22880 103530 102898 gene locus_tag LOCUS_22890 103530 102898 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766688.1 protein_id gnl|my_center|LOCUS_22890 104355 103540 gene locus_tag LOCUS_22900 gene phnE 104355 103540 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104070585.1 protein_id gnl|my_center|LOCUS_22900 105183 104374 gene locus_tag LOCUS_22910 gene phnE 105183 104374 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 protein_id gnl|my_center|LOCUS_22910 106025 105180 gene locus_tag LOCUS_22920 gene phnC 106025 105180 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_22920 107097 106132 gene locus_tag LOCUS_22930 gene phnD 107097 106132 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538257.1 protein_id gnl|my_center|LOCUS_22930 108639 107263 gene locus_tag LOCUS_22940 108639 107263 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 protein_id gnl|my_center|LOCUS_22940 108767 109186 gene locus_tag LOCUS_22950 108767 109186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 109287 111032 gene locus_tag LOCUS_22960 gene aceK 109287 111032 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112397.1 protein_id gnl|my_center|LOCUS_22960 111050 111787 gene locus_tag LOCUS_22970 111050 111787 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_22970 111842 112612 gene locus_tag LOCUS_22980 111842 112612 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406193.1 protein_id gnl|my_center|LOCUS_22980 114009 112765 gene locus_tag LOCUS_22990 114009 112765 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994037.1 protein_id gnl|my_center|LOCUS_22990 115523 114075 gene locus_tag LOCUS_23000 115523 114075 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260910.1 protein_id gnl|my_center|LOCUS_23000 115673 115551 gene locus_tag LOCUS_23010 115673 115551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 >Feature sequence16 165 566 gene locus_tag LOCUS_23020 165 566 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765145.1 protein_id gnl|my_center|LOCUS_23020 1189 665 gene locus_tag LOCUS_23030 1189 665 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524734.1 protein_id gnl|my_center|LOCUS_23030 4276 1280 gene locus_tag LOCUS_23040 4276 1280 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088782.1 protein_id gnl|my_center|LOCUS_23040 5518 4313 gene locus_tag LOCUS_23050 5518 4313 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815469.1 protein_id gnl|my_center|LOCUS_23050 6745 5558 gene locus_tag LOCUS_23060 6745 5558 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064263.1 protein_id gnl|my_center|LOCUS_23060 7581 6796 gene locus_tag LOCUS_23070 7581 6796 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088777.1 protein_id gnl|my_center|LOCUS_23070 8986 7703 gene locus_tag LOCUS_23080 8986 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 9570 8983 gene locus_tag LOCUS_23090 9570 8983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 10632 9658 gene locus_tag LOCUS_23100 10632 9658 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969404.1 protein_id gnl|my_center|LOCUS_23100 11313 10852 gene locus_tag LOCUS_23110 11313 10852 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529227.1 protein_id gnl|my_center|LOCUS_23110 11490 12158 gene locus_tag LOCUS_23120 11490 12158 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966997.1 protein_id gnl|my_center|LOCUS_23120 12253 13170 gene locus_tag LOCUS_23130 12253 13170 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065040.1 protein_id gnl|my_center|LOCUS_23130 14381 13152 gene locus_tag LOCUS_23140 14381 13152 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102844.1 protein_id gnl|my_center|LOCUS_23140 14510 16081 gene locus_tag LOCUS_23150 14510 16081 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464264.1 protein_id gnl|my_center|LOCUS_23150 16101 16940 gene locus_tag LOCUS_23160 16101 16940 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266523.1 protein_id gnl|my_center|LOCUS_23160 16974 17981 gene locus_tag LOCUS_23170 gene ltaE 16974 17981 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529784.1 protein_id gnl|my_center|LOCUS_23170 18846 17971 gene locus_tag LOCUS_23180 18846 17971 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531042.1 protein_id gnl|my_center|LOCUS_23180 18961 20133 gene locus_tag LOCUS_23190 18961 20133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 20217 21158 gene locus_tag LOCUS_23200 20217 21158 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463665.1 protein_id gnl|my_center|LOCUS_23200 22088 21159 gene locus_tag LOCUS_23210 22088 21159 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562685.1 protein_id gnl|my_center|LOCUS_23210 22192 23265 gene locus_tag LOCUS_23220 22192 23265 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728063.1 protein_id gnl|my_center|LOCUS_23220 23529 24923 gene locus_tag LOCUS_23230 23529 24923 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390060.1 protein_id gnl|my_center|LOCUS_23230 24936 25295 gene locus_tag LOCUS_23240 24936 25295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 26221 25364 gene locus_tag LOCUS_23250 26221 25364 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528258.1 protein_id gnl|my_center|LOCUS_23250 26348 26896 gene locus_tag LOCUS_23260 gene blc 26348 26896 CDS product outer membrane lipoprotein Blc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175561.1 protein_id gnl|my_center|LOCUS_23260 27059 27874 gene locus_tag LOCUS_23270 27059 27874 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706954.1 protein_id gnl|my_center|LOCUS_23270 27883 28881 gene locus_tag LOCUS_23280 gene astE 27883 28881 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112605.1 protein_id gnl|my_center|LOCUS_23280 29098 29868 gene locus_tag LOCUS_23290 29098 29868 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133012.1 protein_id gnl|my_center|LOCUS_23290 29921 30622 gene locus_tag LOCUS_23300 29921 30622 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262156.1 protein_id gnl|my_center|LOCUS_23300 30624 31349 gene locus_tag LOCUS_23310 30624 31349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347798.1 protein_id gnl|my_center|LOCUS_23310 31484 32251 gene locus_tag LOCUS_23320 31484 32251 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419848.1 protein_id gnl|my_center|LOCUS_23320 32511 33407 gene locus_tag LOCUS_23330 32511 33407 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419848.1 protein_id gnl|my_center|LOCUS_23330 33500 34648 gene locus_tag LOCUS_23340 gene iadA 33500 34648 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705572.1 protein_id gnl|my_center|LOCUS_23340 34729 36945 gene locus_tag LOCUS_23350 34729 36945 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895660.1 protein_id gnl|my_center|LOCUS_23350 37048 37854 gene locus_tag LOCUS_23360 37048 37854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 38722 37862 gene locus_tag LOCUS_23370 38722 37862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 40011 38719 gene locus_tag LOCUS_23380 40011 38719 CDS product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027856.1 protein_id gnl|my_center|LOCUS_23380 40183 41577 gene locus_tag LOCUS_23390 40183 41577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 41574 42122 gene locus_tag LOCUS_23400 41574 42122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 43341 42205 gene locus_tag LOCUS_23410 43341 42205 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227994.1 protein_id gnl|my_center|LOCUS_23410 43873 43352 gene locus_tag LOCUS_23420 gene purE 43873 43352 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215768.1 protein_id gnl|my_center|LOCUS_23420 46035 44011 gene locus_tag LOCUS_23430 46035 44011 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261721.1 protein_id gnl|my_center|LOCUS_23430 46549 46046 gene locus_tag LOCUS_23440 46549 46046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 47531 46572 gene locus_tag LOCUS_23450 47531 46572 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_23450 48891 47695 gene locus_tag LOCUS_23460 gene lhgO 48891 47695 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271983.1 protein_id gnl|my_center|LOCUS_23460 49957 48977 gene locus_tag LOCUS_23470 gene glaH 49957 48977 CDS product glutarate dioxygenase GlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993126.1 protein_id gnl|my_center|LOCUS_23470 51558 50119 gene locus_tag LOCUS_23480 51558 50119 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 protein_id gnl|my_center|LOCUS_23480 52064 52243 gene locus_tag LOCUS_23490 52064 52243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 52586 53365 gene locus_tag LOCUS_23500 52586 53365 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809144.1 protein_id gnl|my_center|LOCUS_23500 53346 54542 gene locus_tag LOCUS_23510 gene nrfD 53346 54542 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707058.1 protein_id gnl|my_center|LOCUS_23510 54535 57645 gene locus_tag LOCUS_23520 54535 57645 CDS product tetrathionate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457967.1 protein_id gnl|my_center|LOCUS_23520 59431 57743 gene locus_tag LOCUS_23530 gene ilvD 59431 57743 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 protein_id gnl|my_center|LOCUS_23530 59561 59923 gene locus_tag LOCUS_23540 59561 59923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 60685 59990 gene locus_tag LOCUS_23550 60685 59990 CDS product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993682.1 protein_id gnl|my_center|LOCUS_23550 62088 60682 gene locus_tag LOCUS_23560 62088 60682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 62306 62980 gene locus_tag LOCUS_23570 62306 62980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 63735 62977 gene locus_tag LOCUS_23580 63735 62977 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175245.1 protein_id gnl|my_center|LOCUS_23580 64385 63798 gene locus_tag LOCUS_23590 64385 63798 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086598.1 protein_id gnl|my_center|LOCUS_23590 67602 64486 gene locus_tag LOCUS_23600 67602 64486 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942010.1 protein_id gnl|my_center|LOCUS_23600 69270 67771 gene locus_tag LOCUS_23610 69270 67771 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813760.1 protein_id gnl|my_center|LOCUS_23610 69491 70432 gene locus_tag LOCUS_23620 69491 70432 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821371.1 protein_id gnl|my_center|LOCUS_23620 70681 72861 gene locus_tag LOCUS_23630 gene katG 70681 72861 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479257.1 protein_id gnl|my_center|LOCUS_23630 74452 72962 gene locus_tag LOCUS_23640 74452 72962 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327689.1 protein_id gnl|my_center|LOCUS_23640 75438 74569 gene locus_tag LOCUS_23650 75438 74569 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327465.1 protein_id gnl|my_center|LOCUS_23650 75553 76437 gene locus_tag LOCUS_23660 75553 76437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 77710 76445 gene locus_tag LOCUS_23670 77710 76445 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969451.1 protein_id gnl|my_center|LOCUS_23670 78273 77707 gene locus_tag LOCUS_23680 78273 77707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 79272 78289 gene locus_tag LOCUS_23690 79272 78289 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087196.1 protein_id gnl|my_center|LOCUS_23690 80088 79405 gene locus_tag LOCUS_23700 80088 79405 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243931.1 protein_id gnl|my_center|LOCUS_23700 80357 81703 gene locus_tag LOCUS_23710 80357 81703 CDS product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879035.1 protein_id gnl|my_center|LOCUS_23710 81941 82948 gene locus_tag LOCUS_23720 gene dctP 81941 82948 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967084.1 protein_id gnl|my_center|LOCUS_23720 83019 83540 gene locus_tag LOCUS_23730 83019 83540 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967083.1 protein_id gnl|my_center|LOCUS_23730 83543 84877 gene locus_tag LOCUS_23740 83543 84877 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970023.1 protein_id gnl|my_center|LOCUS_23740 84891 86258 gene locus_tag LOCUS_23750 84891 86258 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089468.1 protein_id gnl|my_center|LOCUS_23750 86255 87772 gene locus_tag LOCUS_23760 86255 87772 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970025.1 protein_id gnl|my_center|LOCUS_23760 87793 88389 gene locus_tag LOCUS_23770 87793 88389 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809123.1 protein_id gnl|my_center|LOCUS_23770 90396 88414 gene locus_tag LOCUS_23780 90396 88414 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804218.1 protein_id gnl|my_center|LOCUS_23780 91146 90457 gene locus_tag LOCUS_23790 91146 90457 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210025486.1 protein_id gnl|my_center|LOCUS_23790 91357 92112 gene locus_tag LOCUS_23800 91357 92112 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087136.1 protein_id gnl|my_center|LOCUS_23800 92128 93027 gene locus_tag LOCUS_23810 92128 93027 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083249.1 protein_id gnl|my_center|LOCUS_23810 93318 94310 gene locus_tag LOCUS_23820 93318 94310 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975180.1 protein_id gnl|my_center|LOCUS_23820 94408 96366 gene locus_tag LOCUS_23830 94408 96366 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_23830 96363 97310 gene locus_tag LOCUS_23840 96363 97310 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525849.1 protein_id gnl|my_center|LOCUS_23840 97368 97769 gene locus_tag LOCUS_23850 97368 97769 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065002.1 protein_id gnl|my_center|LOCUS_23850 97831 98808 gene locus_tag LOCUS_23860 97831 98808 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063973.1 protein_id gnl|my_center|LOCUS_23860 99495 98842 gene locus_tag LOCUS_23870 99495 98842 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097831.1 protein_id gnl|my_center|LOCUS_23870 99780 100067 gene locus_tag LOCUS_23880 99780 100067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 100359 100856 gene locus_tag LOCUS_23890 100359 100856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 100968 104639 gene locus_tag LOCUS_23900 gene recC 100968 104639 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793829.1 protein_id gnl|my_center|LOCUS_23900 104636 108766 gene locus_tag LOCUS_23910 gene recB 104636 108766 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266564.1 protein_id gnl|my_center|LOCUS_23910 108784 111042 gene locus_tag LOCUS_23920 gene recD 108784 111042 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114993.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence17 754 26 gene locus_tag LOCUS_23930 754 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2270 1467 gene locus_tag LOCUS_23940 gene iolB 2270 1467 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640197.1 protein_id gnl|my_center|LOCUS_23940 3283 2288 gene locus_tag LOCUS_23950 gene iolG 3283 2288 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919173.1 protein_id gnl|my_center|LOCUS_23950 4180 3317 gene locus_tag LOCUS_23960 4180 3317 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368536.1 protein_id gnl|my_center|LOCUS_23960 4390 5328 gene locus_tag LOCUS_23970 4390 5328 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223780.1 protein_id gnl|my_center|LOCUS_23970 5502 6506 gene locus_tag LOCUS_23980 5502 6506 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192697.1 protein_id gnl|my_center|LOCUS_23980 6508 7368 gene locus_tag LOCUS_23990 6508 7368 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223778.1 protein_id gnl|my_center|LOCUS_23990 7463 8260 gene locus_tag LOCUS_24000 7463 8260 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764492.1 protein_id gnl|my_center|LOCUS_24000 8350 10296 gene locus_tag LOCUS_24010 gene iolC 8350 10296 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098252.1 protein_id gnl|my_center|LOCUS_24010 10298 12145 gene locus_tag LOCUS_24020 gene iolD 10298 12145 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528372.1 protein_id gnl|my_center|LOCUS_24020 12225 13127 gene locus_tag LOCUS_24030 gene iolE 12225 13127 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098251.1 protein_id gnl|my_center|LOCUS_24030 13163 14665 gene locus_tag LOCUS_24040 13163 14665 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704254.1 protein_id gnl|my_center|LOCUS_24040 14740 15864 gene locus_tag LOCUS_24050 14740 15864 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098253.1 protein_id gnl|my_center|LOCUS_24050 16124 16957 gene locus_tag LOCUS_24060 16124 16957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 17686 17036 gene locus_tag LOCUS_24070 17686 17036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 17910 17692 gene locus_tag LOCUS_24080 17910 17692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 18306 18731 gene locus_tag LOCUS_24090 18306 18731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 21913 18800 gene locus_tag LOCUS_24100 21913 18800 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_24100 23016 21913 gene locus_tag LOCUS_24110 23016 21913 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071990.1 protein_id gnl|my_center|LOCUS_24110 23302 24492 gene locus_tag LOCUS_24120 23302 24492 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919352.1 protein_id gnl|my_center|LOCUS_24120 25243 24509 gene locus_tag LOCUS_24130 25243 24509 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_24130 25443 26099 gene locus_tag LOCUS_24140 25443 26099 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946869.1 protein_id gnl|my_center|LOCUS_24140 26545 26090 gene locus_tag LOCUS_24150 26545 26090 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082024.1 protein_id gnl|my_center|LOCUS_24150 26885 26577 gene locus_tag LOCUS_24160 26885 26577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 27295 26882 gene locus_tag LOCUS_24170 27295 26882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 27627 27295 gene locus_tag LOCUS_24180 27627 27295 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164648.1 protein_id gnl|my_center|LOCUS_24180 28775 27735 gene locus_tag LOCUS_24190 28775 27735 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036611.1 protein_id gnl|my_center|LOCUS_24190 29001 32396 gene locus_tag LOCUS_24200 gene mscK 29001 32396 CDS product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103675.1 protein_id gnl|my_center|LOCUS_24200 33179 32403 gene locus_tag LOCUS_24210 33179 32403 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327569.1 protein_id gnl|my_center|LOCUS_24210 35222 33186 gene locus_tag LOCUS_24220 35222 33186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 36492 35269 gene locus_tag LOCUS_24230 36492 35269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 36473 36706 gene locus_tag LOCUS_24240 36473 36706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 37388 36933 gene locus_tag LOCUS_24250 37388 36933 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_24250 38247 37447 gene locus_tag LOCUS_24260 38247 37447 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532097.1 protein_id gnl|my_center|LOCUS_24260 38926 38273 gene locus_tag LOCUS_24270 38926 38273 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532096.1 protein_id gnl|my_center|LOCUS_24270 39616 38960 gene locus_tag LOCUS_24280 39616 38960 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532095.1 protein_id gnl|my_center|LOCUS_24280 40512 39709 gene locus_tag LOCUS_24290 40512 39709 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532094.1 protein_id gnl|my_center|LOCUS_24290 41865 40675 gene locus_tag LOCUS_24300 41865 40675 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878528.1 protein_id gnl|my_center|LOCUS_24300 43145 41862 gene locus_tag LOCUS_24310 43145 41862 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173608.1 protein_id gnl|my_center|LOCUS_24310 43798 43145 gene locus_tag LOCUS_24320 43798 43145 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031118.1 protein_id gnl|my_center|LOCUS_24320 44489 43788 gene locus_tag LOCUS_24330 44489 43788 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929696.1 protein_id gnl|my_center|LOCUS_24330 45856 44486 gene locus_tag LOCUS_24340 45856 44486 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532099.1 protein_id gnl|my_center|LOCUS_24340 45969 46889 gene locus_tag LOCUS_24350 45969 46889 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807871.1 protein_id gnl|my_center|LOCUS_24350 47092 48021 gene locus_tag LOCUS_24360 gene aphA 47092 48021 CDS product acetylpolyamine amidohydrolase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112424.1 protein_id gnl|my_center|LOCUS_24360 49008 48058 gene locus_tag LOCUS_24370 49008 48058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 49272 51542 gene locus_tag LOCUS_24380 49272 51542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 51636 53645 gene locus_tag LOCUS_24390 51636 53645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 53741 54052 gene locus_tag LOCUS_24400 53741 54052 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706069.1 protein_id gnl|my_center|LOCUS_24400 54055 54675 gene locus_tag LOCUS_24410 gene recR 54055 54675 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087237.1 protein_id gnl|my_center|LOCUS_24410 54710 55837 gene locus_tag LOCUS_24420 gene rnd 54710 55837 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895548.1 protein_id gnl|my_center|LOCUS_24420 55834 56145 gene locus_tag LOCUS_24430 55834 56145 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100122.1 protein_id gnl|my_center|LOCUS_24430 56332 56778 gene locus_tag LOCUS_24440 56332 56778 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082662.1 protein_id gnl|my_center|LOCUS_24440 58904 56799 gene locus_tag LOCUS_24450 58904 56799 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104778.1 protein_id gnl|my_center|LOCUS_24450 58935 59387 gene locus_tag LOCUS_24460 58935 59387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 59398 61245 gene locus_tag LOCUS_24470 59398 61245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 61238 62035 gene locus_tag LOCUS_24480 61238 62035 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160484.1 protein_id gnl|my_center|LOCUS_24480 62200 63882 gene locus_tag LOCUS_24490 gene fadD1 62200 63882 CDS product long-chain-fatty-acid--CoA ligase FadD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091643.1 protein_id gnl|my_center|LOCUS_24490 64032 68066 gene locus_tag LOCUS_24500 gene hrpA 64032 68066 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_24500 68143 69264 gene locus_tag LOCUS_24510 68143 69264 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 protein_id gnl|my_center|LOCUS_24510 69257 70096 gene locus_tag LOCUS_24520 69257 70096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 70108 71301 gene locus_tag LOCUS_24530 70108 71301 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114778.1 protein_id gnl|my_center|LOCUS_24530 71288 71794 gene locus_tag LOCUS_24540 71288 71794 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104052.1 protein_id gnl|my_center|LOCUS_24540 72800 71862 gene locus_tag LOCUS_24550 gene tal 72800 71862 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095515.1 protein_id gnl|my_center|LOCUS_24550 72964 74148 gene locus_tag LOCUS_24560 72964 74148 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706371.1 protein_id gnl|my_center|LOCUS_24560 74141 74875 gene locus_tag LOCUS_24570 74141 74875 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073771.1 protein_id gnl|my_center|LOCUS_24570 74987 76003 gene locus_tag LOCUS_24580 74987 76003 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_24580 76101 77354 gene locus_tag LOCUS_24590 76101 77354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 77373 78539 gene locus_tag LOCUS_24600 gene pstA 77373 78539 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388358.1 protein_id gnl|my_center|LOCUS_24600 78568 79413 gene locus_tag LOCUS_24610 gene pstB 78568 79413 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918181.1 protein_id gnl|my_center|LOCUS_24610 79559 79966 gene locus_tag LOCUS_24620 79559 79966 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112098.1 protein_id gnl|my_center|LOCUS_24620 80031 80396 gene locus_tag LOCUS_24630 80031 80396 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017131138.1 protein_id gnl|my_center|LOCUS_24630 81809 80625 gene locus_tag LOCUS_24640 81809 80625 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192518.1 protein_id gnl|my_center|LOCUS_24640 83114 81912 gene locus_tag LOCUS_24650 83114 81912 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275363.1 protein_id gnl|my_center|LOCUS_24650 84002 83199 gene locus_tag LOCUS_24660 84002 83199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 84300 84007 gene locus_tag LOCUS_24670 84300 84007 CDS product CC/Se motif family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405174.1 protein_id gnl|my_center|LOCUS_24670 85389 84304 gene locus_tag LOCUS_24680 gene arsB 85389 84304 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421624.1 protein_id gnl|my_center|LOCUS_24680 85515 86138 gene locus_tag LOCUS_24690 85515 86138 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382896.1 protein_id gnl|my_center|LOCUS_24690 86129 86932 gene locus_tag LOCUS_24700 gene fetB 86129 86932 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_24700 87706 86933 gene locus_tag LOCUS_24710 87706 86933 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936067.1 protein_id gnl|my_center|LOCUS_24710 88893 87706 gene locus_tag LOCUS_24720 88893 87706 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_24720 89042 89620 gene locus_tag LOCUS_24730 89042 89620 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812436.1 protein_id gnl|my_center|LOCUS_24730 89835 91550 gene locus_tag LOCUS_24740 89835 91550 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 protein_id gnl|my_center|LOCUS_24740 91566 92333 gene locus_tag LOCUS_24750 91566 92333 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537945.1 protein_id gnl|my_center|LOCUS_24750 92557 94434 gene locus_tag LOCUS_24760 92557 94434 CDS product phenylacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084842.1 protein_id gnl|my_center|LOCUS_24760 94472 96622 gene locus_tag LOCUS_24770 94472 96622 CDS product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244147.1 protein_id gnl|my_center|LOCUS_24770 96750 98006 gene locus_tag LOCUS_24780 96750 98006 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815911.1 protein_id gnl|my_center|LOCUS_24780 98136 99101 gene locus_tag LOCUS_24790 98136 99101 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368513.1 protein_id gnl|my_center|LOCUS_24790 99175 100026 gene locus_tag LOCUS_24800 99175 100026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 100038 100847 gene locus_tag LOCUS_24810 100038 100847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 100844 101980 gene locus_tag LOCUS_24820 100844 101980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 102061 102921 gene locus_tag LOCUS_24830 102061 102921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 103414 102938 gene locus_tag LOCUS_24840 103414 102938 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971886.1 protein_id gnl|my_center|LOCUS_24840 103883 104419 gene locus_tag LOCUS_24850 103883 104419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 104612 105076 gene locus_tag LOCUS_24860 104612 105076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence18 <1 549 gene locus_tag LOCUS_24870 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009563288.1:ABC transporter substrate-binding protein 666 1676 gene locus_tag LOCUS_24880 666 1676 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530262.1 protein_id gnl|my_center|LOCUS_24880 1693 2652 gene locus_tag LOCUS_24890 gene rbsC 1693 2652 CDS product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 protein_id gnl|my_center|LOCUS_24890 2649 4208 gene locus_tag LOCUS_24900 2649 4208 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968715.1 protein_id gnl|my_center|LOCUS_24900 4275 5354 gene locus_tag LOCUS_24910 4275 5354 CDS product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085467.1 protein_id gnl|my_center|LOCUS_24910 5351 6715 gene locus_tag LOCUS_24920 5351 6715 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085466.1 protein_id gnl|my_center|LOCUS_24920 6712 7629 gene locus_tag LOCUS_24930 6712 7629 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085465.1 protein_id gnl|my_center|LOCUS_24930 7634 8497 gene locus_tag LOCUS_24940 7634 8497 CDS product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085464.1 protein_id gnl|my_center|LOCUS_24940 8553 9143 gene locus_tag LOCUS_24950 8553 9143 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195469.1 protein_id gnl|my_center|LOCUS_24950 9273 10010 gene locus_tag LOCUS_24960 9273 10010 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529133.1 protein_id gnl|my_center|LOCUS_24960 10092 11864 gene locus_tag LOCUS_24970 10092 11864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 12696 11890 gene locus_tag LOCUS_24980 12696 11890 CDS product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469273.1 protein_id gnl|my_center|LOCUS_24980 13621 12959 gene locus_tag LOCUS_24990 13621 12959 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937645.1 protein_id gnl|my_center|LOCUS_24990 15227 13725 gene locus_tag LOCUS_25000 15227 13725 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368539.1 protein_id gnl|my_center|LOCUS_25000 15737 15243 gene locus_tag LOCUS_25010 15737 15243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 16779 15778 gene locus_tag LOCUS_25020 16779 15778 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339285.1 protein_id gnl|my_center|LOCUS_25020 17220 19064 gene locus_tag LOCUS_25030 17220 19064 CDS product sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083873.1 protein_id gnl|my_center|LOCUS_25030 19127 19990 gene locus_tag LOCUS_25040 19127 19990 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382871.1 protein_id gnl|my_center|LOCUS_25040 19990 20436 gene locus_tag LOCUS_25050 gene aroQ 19990 20436 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339256.1 protein_id gnl|my_center|LOCUS_25050 21439 20546 gene locus_tag LOCUS_25060 21439 20546 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 protein_id gnl|my_center|LOCUS_25060 22343 21516 gene locus_tag LOCUS_25070 22343 21516 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084082.1 protein_id gnl|my_center|LOCUS_25070 24081 22336 gene locus_tag LOCUS_25080 24081 22336 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113725.1 protein_id gnl|my_center|LOCUS_25080 25147 24191 gene locus_tag LOCUS_25090 25147 24191 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721044.1 protein_id gnl|my_center|LOCUS_25090 26002 25223 gene locus_tag LOCUS_25100 26002 25223 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101874.1 protein_id gnl|my_center|LOCUS_25100 26864 26073 gene locus_tag LOCUS_25110 26864 26073 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402690.1 protein_id gnl|my_center|LOCUS_25110 26989 28332 gene locus_tag LOCUS_25120 26989 28332 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765672.1 protein_id gnl|my_center|LOCUS_25120 28508 29338 gene locus_tag LOCUS_25130 28508 29338 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768681.1 protein_id gnl|my_center|LOCUS_25130 29338 30111 gene locus_tag LOCUS_25140 29338 30111 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402699.1 protein_id gnl|my_center|LOCUS_25140 30148 31350 gene locus_tag LOCUS_25150 gene pcaF 30148 31350 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101891.1 protein_id gnl|my_center|LOCUS_25150 31364 32539 gene locus_tag LOCUS_25160 gene pcaD 31364 32539 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284957.1 protein_id gnl|my_center|LOCUS_25160 32610 33533 gene locus_tag LOCUS_25170 gene pcaQ 32610 33533 CDS product pca operon transcription factor PcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765677.1 protein_id gnl|my_center|LOCUS_25170 33652 34374 gene locus_tag LOCUS_25180 gene pcaH 33652 34374 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102187.1 protein_id gnl|my_center|LOCUS_25180 34388 35020 gene locus_tag LOCUS_25190 gene pcaG 34388 35020 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112645.1 protein_id gnl|my_center|LOCUS_25190 35169 36002 gene locus_tag LOCUS_25200 35169 36002 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088209.1 protein_id gnl|my_center|LOCUS_25200 36084 36491 gene locus_tag LOCUS_25210 36084 36491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 38278 36533 gene locus_tag LOCUS_25220 38278 36533 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206221.1 protein_id gnl|my_center|LOCUS_25220 38593 38967 gene locus_tag LOCUS_25230 38593 38967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 38972 39511 gene locus_tag LOCUS_25240 38972 39511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 39543 41093 gene locus_tag LOCUS_25250 39543 41093 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227986.1 protein_id gnl|my_center|LOCUS_25250 41131 42597 gene locus_tag LOCUS_25260 41131 42597 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107137.1 protein_id gnl|my_center|LOCUS_25260 42664 43755 gene locus_tag LOCUS_25270 42664 43755 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705577.1 protein_id gnl|my_center|LOCUS_25270 44213 43812 gene locus_tag LOCUS_25280 44213 43812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25280 44408 44223 gene locus_tag LOCUS_25290 44408 44223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25290 44874 46127 gene locus_tag LOCUS_25300 44874 46127 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436542.1 protein_id gnl|my_center|LOCUS_25300 46190 46387 gene locus_tag LOCUS_25310 46190 46387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 46345 46605 gene locus_tag LOCUS_25320 46345 46605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25320 46786 48099 gene locus_tag LOCUS_25330 46786 48099 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083760.1 protein_id gnl|my_center|LOCUS_25330 48182 49174 gene locus_tag LOCUS_25340 48182 49174 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807628.1 protein_id gnl|my_center|LOCUS_25340 49305 50276 gene locus_tag LOCUS_25350 49305 50276 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925213.1 protein_id gnl|my_center|LOCUS_25350 50313 52229 gene locus_tag LOCUS_25360 50313 52229 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869125.1 protein_id gnl|my_center|LOCUS_25360 52587 53216 gene locus_tag LOCUS_25370 52587 53216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 53247 54095 gene locus_tag LOCUS_25380 gene nadC 53247 54095 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104915.1 protein_id gnl|my_center|LOCUS_25380 54546 54181 gene locus_tag LOCUS_25390 54546 54181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 54625 54894 gene locus_tag LOCUS_25400 54625 54894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 55477 54992 gene locus_tag LOCUS_25410 55477 54992 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214523.1 protein_id gnl|my_center|LOCUS_25410 56724 55543 gene locus_tag LOCUS_25420 56724 55543 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040700.1 protein_id gnl|my_center|LOCUS_25420 57730 56753 gene locus_tag LOCUS_25430 57730 56753 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927097.1 protein_id gnl|my_center|LOCUS_25430 58184 58627 gene locus_tag LOCUS_25440 58184 58627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 59952 58843 gene locus_tag LOCUS_25450 59952 58843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 60797 59928 gene locus_tag LOCUS_25460 gene istB 60797 59928 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064816995.1 protein_id gnl|my_center|LOCUS_25460 61171 60794 gene locus_tag LOCUS_25470 61171 60794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25470 62112 61114 gene locus_tag LOCUS_25480 62112 61114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25480 62610 62305 gene locus_tag LOCUS_25490 62610 62305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 63232 62705 gene locus_tag LOCUS_25500 63232 62705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 64565 63306 gene locus_tag LOCUS_25510 64565 63306 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975203.1 protein_id gnl|my_center|LOCUS_25510 65088 64570 gene locus_tag LOCUS_25520 65088 64570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 66141 65134 gene locus_tag LOCUS_25530 66141 65134 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975202.1 protein_id gnl|my_center|LOCUS_25530 66381 68270 gene locus_tag LOCUS_25540 66381 68270 CDS product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966821.1 protein_id gnl|my_center|LOCUS_25540 68703 69734 gene locus_tag LOCUS_25550 68703 69734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 69741 70268 gene locus_tag LOCUS_25560 69741 70268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 70258 71547 gene locus_tag LOCUS_25570 70258 71547 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_25570 72511 71582 gene locus_tag LOCUS_25580 72511 71582 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268470.1 protein_id gnl|my_center|LOCUS_25580 72682 73866 gene locus_tag LOCUS_25590 gene pobA 72682 73866 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112685.1 protein_id gnl|my_center|LOCUS_25590 74087 75202 gene locus_tag LOCUS_25600 gene gcvT 74087 75202 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478448.1 protein_id gnl|my_center|LOCUS_25600 75309 76688 gene locus_tag LOCUS_25610 75309 76688 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111339.1 protein_id gnl|my_center|LOCUS_25610 77600 76698 gene locus_tag LOCUS_25620 77600 76698 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089870.1 protein_id gnl|my_center|LOCUS_25620 77705 78823 gene locus_tag LOCUS_25630 77705 78823 CDS product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162708822.1 protein_id gnl|my_center|LOCUS_25630 78855 79145 gene locus_tag LOCUS_25640 gene catC 78855 79145 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366454.1 protein_id gnl|my_center|LOCUS_25640 79212 80186 gene locus_tag LOCUS_25650 gene catA 79212 80186 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705528.1 protein_id gnl|my_center|LOCUS_25650 80272 81639 gene locus_tag LOCUS_25660 80272 81639 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705527.1 protein_id gnl|my_center|LOCUS_25660 81654 82142 gene locus_tag LOCUS_25670 gene benB 81654 82142 CDS product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366457.1 protein_id gnl|my_center|LOCUS_25670 82176 83201 gene locus_tag LOCUS_25680 gene benC 82176 83201 CDS product benzoate 1,2-dioxygenase electron transfer component BenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705526.1 protein_id gnl|my_center|LOCUS_25680 83198 83980 gene locus_tag LOCUS_25690 83198 83980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25690 84076 85326 gene locus_tag LOCUS_25700 84076 85326 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393273.1 protein_id gnl|my_center|LOCUS_25700 86752 85523 gene locus_tag LOCUS_25710 86752 85523 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040237.1 protein_id gnl|my_center|LOCUS_25710 87341 86844 gene locus_tag LOCUS_25720 87341 86844 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815617.1 protein_id gnl|my_center|LOCUS_25720 88552 87413 gene locus_tag LOCUS_25730 88552 87413 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 protein_id gnl|my_center|LOCUS_25730 89455 88664 gene locus_tag LOCUS_25740 gene menB 89455 88664 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 protein_id gnl|my_center|LOCUS_25740 90269 89502 gene locus_tag LOCUS_25750 90269 89502 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 protein_id gnl|my_center|LOCUS_25750 91955 90312 gene locus_tag LOCUS_25760 gene fadK 91955 90312 CDS product medium-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302824.1 protein_id gnl|my_center|LOCUS_25760 92198 92971 gene locus_tag LOCUS_25770 92198 92971 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 protein_id gnl|my_center|LOCUS_25770 93016 93912 gene locus_tag LOCUS_25780 93016 93912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 93909 95105 gene locus_tag LOCUS_25790 93909 95105 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936116.1 protein_id gnl|my_center|LOCUS_25790 95115 96257 gene locus_tag LOCUS_25800 95115 96257 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198292.1 protein_id gnl|my_center|LOCUS_25800 >Feature sequence19 146 256 gene locus_tag LOCUS_r00010 146 256 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2133 781 gene locus_tag LOCUS_25810 gene gdhA 2133 781 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289187.1 protein_id gnl|my_center|LOCUS_25810 2439 2879 gene locus_tag LOCUS_25820 2439 2879 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_25820 2876 3943 gene locus_tag LOCUS_25830 gene rlmM 2876 3943 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268413.1 protein_id gnl|my_center|LOCUS_25830 4261 3971 gene locus_tag LOCUS_25840 4261 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 4304 4570 gene locus_tag LOCUS_25850 gene tusA 4304 4570 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105999.1 protein_id gnl|my_center|LOCUS_25850 5310 4597 gene locus_tag LOCUS_25860 5310 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 6481 5426 gene locus_tag LOCUS_25870 6481 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 7901 6453 gene locus_tag LOCUS_25880 7901 6453 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705975.1 protein_id gnl|my_center|LOCUS_25880 8024 8590 gene locus_tag LOCUS_25890 gene epmC 8024 8590 CDS product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089227.1 protein_id gnl|my_center|LOCUS_25890 8655 10850 gene locus_tag LOCUS_25900 8655 10850 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338854.1 protein_id gnl|my_center|LOCUS_25900 11349 10864 gene locus_tag LOCUS_25910 11349 10864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 12253 11351 gene locus_tag LOCUS_25920 12253 11351 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 protein_id gnl|my_center|LOCUS_25920 12400 14355 gene locus_tag LOCUS_25930 12400 14355 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_25930 14850 14398 gene locus_tag LOCUS_25940 14850 14398 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091210.1 protein_id gnl|my_center|LOCUS_25940 14971 15501 gene locus_tag LOCUS_25950 14971 15501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 15954 15511 gene locus_tag LOCUS_25960 gene slyA 15954 15511 CDS product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078997.1 protein_id gnl|my_center|LOCUS_25960 17343 16021 gene locus_tag LOCUS_25970 17343 16021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 17536 19713 gene locus_tag LOCUS_25980 gene fadB 17536 19713 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091204.1 protein_id gnl|my_center|LOCUS_25980 19745 20923 gene locus_tag LOCUS_25990 gene fadA 19745 20923 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065826.1 protein_id gnl|my_center|LOCUS_25990 21994 21014 gene locus_tag LOCUS_26000 21994 21014 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723317.1 protein_id gnl|my_center|LOCUS_26000 22722 22258 gene locus_tag LOCUS_26010 22722 22258 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 protein_id gnl|my_center|LOCUS_26010 22796 23272 gene locus_tag LOCUS_26020 22796 23272 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880795.1 protein_id gnl|my_center|LOCUS_26020 23292 23663 gene locus_tag LOCUS_26030 23292 23663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 24098 23676 gene locus_tag LOCUS_26040 24098 23676 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096441.1 protein_id gnl|my_center|LOCUS_26040 25075 24134 gene locus_tag LOCUS_26050 25075 24134 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259194.1 protein_id gnl|my_center|LOCUS_26050 25269 26849 gene locus_tag LOCUS_26060 25269 26849 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085901.1 protein_id gnl|my_center|LOCUS_26060 26849 27742 gene locus_tag LOCUS_26070 26849 27742 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965715.1 protein_id gnl|my_center|LOCUS_26070 29049 27802 gene locus_tag LOCUS_26080 29049 27802 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257883.1 protein_id gnl|my_center|LOCUS_26080 29235 29753 gene locus_tag LOCUS_26090 29235 29753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 30272 29823 gene locus_tag LOCUS_26100 30272 29823 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136622812.1 protein_id gnl|my_center|LOCUS_26100 30504 31262 gene locus_tag LOCUS_26110 30504 31262 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444475.1 protein_id gnl|my_center|LOCUS_26110 31549 32061 gene locus_tag LOCUS_26120 31549 32061 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 protein_id gnl|my_center|LOCUS_26120 32128 32592 gene locus_tag LOCUS_26130 32128 32592 CDS product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535926.1 protein_id gnl|my_center|LOCUS_26130 33837 32680 gene locus_tag LOCUS_26140 33837 32680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 34544 33906 gene locus_tag LOCUS_26150 34544 33906 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268645.1 protein_id gnl|my_center|LOCUS_26150 35495 34593 gene locus_tag LOCUS_26160 35495 34593 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528195.1 protein_id gnl|my_center|LOCUS_26160 35643 35984 gene locus_tag LOCUS_26170 35643 35984 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944048.1 protein_id gnl|my_center|LOCUS_26170 36205 36669 gene locus_tag LOCUS_26180 36205 36669 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141369.1 protein_id gnl|my_center|LOCUS_26180 36735 38177 gene locus_tag LOCUS_26190 gene sufB 36735 38177 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_26190 38209 38961 gene locus_tag LOCUS_26200 gene sufC 38209 38961 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_26200 38958 40304 gene locus_tag LOCUS_26210 gene sufD 38958 40304 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 protein_id gnl|my_center|LOCUS_26210 40341 41600 gene locus_tag LOCUS_26220 40341 41600 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_26220 41635 42207 gene locus_tag LOCUS_26230 gene sufT 41635 42207 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_26230 42241 42963 gene locus_tag LOCUS_26240 gene sanA 42241 42963 CDS product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365714.1 protein_id gnl|my_center|LOCUS_26240 43425 42979 gene locus_tag LOCUS_26250 43425 42979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 44447 43539 gene locus_tag LOCUS_26260 gene rimK 44447 43539 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096254.1 protein_id gnl|my_center|LOCUS_26260 44912 44475 gene locus_tag LOCUS_26270 44912 44475 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 protein_id gnl|my_center|LOCUS_26270 45961 44915 gene locus_tag LOCUS_26280 45961 44915 CDS product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261355.1 protein_id gnl|my_center|LOCUS_26280 46257 46589 gene locus_tag LOCUS_26290 46257 46589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 50306 46641 gene locus_tag LOCUS_26300 gene putA 50306 46641 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531234.1 protein_id gnl|my_center|LOCUS_26300 51898 50408 gene locus_tag LOCUS_26310 gene opuE 51898 50408 CDS product proline transporter OpuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242814.1 protein_id gnl|my_center|LOCUS_26310 53167 52505 gene locus_tag LOCUS_26320 gene oprG 53167 52505 CDS product outer membrane protein OprG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093337.1 protein_id gnl|my_center|LOCUS_26320 54007 53414 gene locus_tag LOCUS_26330 54007 53414 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707635.1 protein_id gnl|my_center|LOCUS_26330 54829 54215 gene locus_tag LOCUS_26340 54829 54215 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064801.1 protein_id gnl|my_center|LOCUS_26340 55129 55425 gene locus_tag LOCUS_26350 55129 55425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 57001 55523 gene locus_tag LOCUS_26360 gene putP 57001 55523 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_26360 60236 57045 gene locus_tag LOCUS_26370 gene putA 60236 57045 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704727.1 protein_id gnl|my_center|LOCUS_26370 61262 60465 gene locus_tag LOCUS_26380 61262 60465 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741188.1 protein_id gnl|my_center|LOCUS_26380 61695 61321 gene locus_tag LOCUS_26390 61695 61321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 61847 61774 gene locus_tag LOCUS_t00500 61847 61774 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 62622 62215 gene locus_tag LOCUS_26400 62622 62215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 62823 63329 gene locus_tag LOCUS_26410 62823 63329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 63408 64277 gene locus_tag LOCUS_26420 63408 64277 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467602.1 protein_id gnl|my_center|LOCUS_26420 64341 65258 gene locus_tag LOCUS_26430 64341 65258 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091343.1 protein_id gnl|my_center|LOCUS_26430 65260 66264 gene locus_tag LOCUS_26440 65260 66264 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406489.1 protein_id gnl|my_center|LOCUS_26440 66431 67291 gene locus_tag LOCUS_26450 66431 67291 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104987.1 protein_id gnl|my_center|LOCUS_26450 67320 67604 gene locus_tag LOCUS_26460 67320 67604 CDS product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104989.1 protein_id gnl|my_center|LOCUS_26460 67597 68448 gene locus_tag LOCUS_26470 67597 68448 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 protein_id gnl|my_center|LOCUS_26470 68511 69509 gene locus_tag LOCUS_26480 68511 69509 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_26480 70642 69554 gene locus_tag LOCUS_26490 70642 69554 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083628.1 protein_id gnl|my_center|LOCUS_26490 71106 70786 gene locus_tag LOCUS_26500 71106 70786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 71125 73002 gene locus_tag LOCUS_26510 gene btuB 71125 73002 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_26510 73049 73912 gene locus_tag LOCUS_26520 73049 73912 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_26520 73899 74903 gene locus_tag LOCUS_26530 73899 74903 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_26530 74981 75751 gene locus_tag LOCUS_26540 74981 75751 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192006.1 protein_id gnl|my_center|LOCUS_26540 76088 77503 gene locus_tag LOCUS_26550 76088 77503 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_26550 78344 77586 gene locus_tag LOCUS_26560 78344 77586 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391533.1 protein_id gnl|my_center|LOCUS_26560 78511 79074 gene locus_tag LOCUS_26570 78511 79074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 79151 80128 gene locus_tag LOCUS_26580 79151 80128 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111202.1 protein_id gnl|my_center|LOCUS_26580 >Feature sequence20 735 214 gene locus_tag LOCUS_26590 gene fkpB 735 214 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102613.1 protein_id gnl|my_center|LOCUS_26590 1346 858 gene locus_tag LOCUS_26600 gene lspA 1346 858 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210508.1 protein_id gnl|my_center|LOCUS_26600 4245 1396 gene locus_tag LOCUS_26610 gene ileS 4245 1396 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112822.1 protein_id gnl|my_center|LOCUS_26610 5410 4256 gene locus_tag LOCUS_26620 gene ribF 5410 4256 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769259.1 protein_id gnl|my_center|LOCUS_26620 7284 5683 gene locus_tag LOCUS_26630 gene murJ 7284 5683 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102622.1 protein_id gnl|my_center|LOCUS_26630 7860 7594 gene locus_tag LOCUS_26640 gene rpsT 7860 7594 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117906.1 protein_id gnl|my_center|LOCUS_26640 9219 8062 gene locus_tag LOCUS_26650 gene proB 9219 8062 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 protein_id gnl|my_center|LOCUS_26650 10453 9266 gene locus_tag LOCUS_26660 gene cgtA 10453 9266 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094758.1 protein_id gnl|my_center|LOCUS_26660 10796 10539 gene locus_tag LOCUS_26670 gene rpmA 10796 10539 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940599.1 protein_id gnl|my_center|LOCUS_26670 11139 10828 gene locus_tag LOCUS_26680 gene rplU 11139 10828 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094761.1 protein_id gnl|my_center|LOCUS_26680 11442 12443 gene locus_tag LOCUS_26690 11442 12443 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094763.1 protein_id gnl|my_center|LOCUS_26690 12526 12602 gene locus_tag LOCUS_t00510 12526 12602 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13164 12712 gene locus_tag LOCUS_26700 13164 12712 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 protein_id gnl|my_center|LOCUS_26700 14776 13259 gene locus_tag LOCUS_26710 14776 13259 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_26710 16386 14809 gene locus_tag LOCUS_26720 16386 14809 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895701.1 protein_id gnl|my_center|LOCUS_26720 16609 16373 gene locus_tag LOCUS_26730 16609 16373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 16766 17566 gene locus_tag LOCUS_26740 16766 17566 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172934.1 protein_id gnl|my_center|LOCUS_26740 17806 20754 gene locus_tag LOCUS_26750 gene rapA 17806 20754 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119658.1 protein_id gnl|my_center|LOCUS_26750 21656 20751 gene locus_tag LOCUS_26760 21656 20751 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707235.1 protein_id gnl|my_center|LOCUS_26760 21743 22792 gene locus_tag LOCUS_26770 21743 22792 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114698.1 protein_id gnl|my_center|LOCUS_26770 22957 23871 gene locus_tag LOCUS_26780 22957 23871 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768834.1 protein_id gnl|my_center|LOCUS_26780 23884 25299 gene locus_tag LOCUS_26790 gene phrB 23884 25299 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114697.1 protein_id gnl|my_center|LOCUS_26790 25329 25769 gene locus_tag LOCUS_26800 25329 25769 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383062.1 protein_id gnl|my_center|LOCUS_26800 25831 26625 gene locus_tag LOCUS_26810 25831 26625 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768839.1 protein_id gnl|my_center|LOCUS_26810 26622 27980 gene locus_tag LOCUS_26820 26622 27980 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_26820 27977 28756 gene locus_tag LOCUS_26830 27977 28756 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096718.1 protein_id gnl|my_center|LOCUS_26830 28753 30024 gene locus_tag LOCUS_26840 28753 30024 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036521.1 protein_id gnl|my_center|LOCUS_26840 30036 30572 gene locus_tag LOCUS_26850 30036 30572 CDS product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266738.1 protein_id gnl|my_center|LOCUS_26850 32390 30519 gene locus_tag LOCUS_26860 32390 30519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 32607 33122 gene locus_tag LOCUS_26870 gene fabA 32607 33122 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379759.1 protein_id gnl|my_center|LOCUS_26870 33136 34353 gene locus_tag LOCUS_26880 gene fabB 33136 34353 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_26880 35188 34427 gene locus_tag LOCUS_26890 35188 34427 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_26890 36078 35185 gene locus_tag LOCUS_26900 36078 35185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 36748 36125 gene locus_tag LOCUS_26910 36748 36125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 38224 36833 gene locus_tag LOCUS_26920 38224 36833 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_26920 38386 41247 gene locus_tag LOCUS_26930 gene uvrA 38386 41247 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 protein_id gnl|my_center|LOCUS_26930 41871 41479 gene locus_tag LOCUS_26940 gene rplQ 41871 41479 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397026.1 protein_id gnl|my_center|LOCUS_26940 42909 41911 gene locus_tag LOCUS_26950 gene rpoA 42909 41911 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093675.1 protein_id gnl|my_center|LOCUS_26950 43616 42996 gene locus_tag LOCUS_26960 gene rpsD 43616 42996 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093678.1 protein_id gnl|my_center|LOCUS_26960 44015 43629 gene locus_tag LOCUS_26970 gene rpsK 44015 43629 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093689.1 protein_id gnl|my_center|LOCUS_26970 44411 44055 gene locus_tag LOCUS_26980 gene rpsM 44411 44055 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093692.1 protein_id gnl|my_center|LOCUS_26980 46032 44728 gene locus_tag LOCUS_26990 gene secY 46032 44728 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093694.1 protein_id gnl|my_center|LOCUS_26990 46494 46060 gene locus_tag LOCUS_27000 gene rplO 46494 46060 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450562.1 protein_id gnl|my_center|LOCUS_27000 46680 46498 gene locus_tag LOCUS_27010 gene rpmD 46680 46498 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307985.1 protein_id gnl|my_center|LOCUS_27010 47186 46686 gene locus_tag LOCUS_27020 gene rpsE 47186 46686 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093697.1 protein_id gnl|my_center|LOCUS_27020 47549 47199 gene locus_tag LOCUS_27030 gene rplR 47549 47199 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093698.1 protein_id gnl|my_center|LOCUS_27030 48089 47559 gene locus_tag LOCUS_27040 gene rplF 48089 47559 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_27040 48491 48099 gene locus_tag LOCUS_27050 gene rpsH 48491 48099 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093700.1 protein_id gnl|my_center|LOCUS_27050 48829 48524 gene locus_tag LOCUS_27060 gene rpsN 48829 48524 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555476.1 protein_id gnl|my_center|LOCUS_27060 49370 48840 gene locus_tag LOCUS_27070 gene rplE 49370 48840 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096208.1 protein_id gnl|my_center|LOCUS_27070 49715 49398 gene locus_tag LOCUS_27080 gene rplX 49715 49398 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093711.1 protein_id gnl|my_center|LOCUS_27080 50101 49730 gene locus_tag LOCUS_27090 gene rplN 50101 49730 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613954.1 protein_id gnl|my_center|LOCUS_27090 50423 50154 gene locus_tag LOCUS_27100 gene rpsQ 50423 50154 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093717.1 protein_id gnl|my_center|LOCUS_27100 50607 50416 gene locus_tag LOCUS_27110 gene rpmC 50607 50416 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644741.1 protein_id gnl|my_center|LOCUS_27110 51020 50607 gene locus_tag LOCUS_27120 gene rplP 51020 50607 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093723.1 protein_id gnl|my_center|LOCUS_27120 51734 51036 gene locus_tag LOCUS_27130 gene rpsC 51734 51036 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093727.1 protein_id gnl|my_center|LOCUS_27130 52078 51746 gene locus_tag LOCUS_27140 gene rplV 52078 51746 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555485.1 protein_id gnl|my_center|LOCUS_27140 52372 52097 gene locus_tag LOCUS_27150 gene rpsS 52372 52097 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093734.1 protein_id gnl|my_center|LOCUS_27150 53222 52395 gene locus_tag LOCUS_27160 gene rplB 53222 52395 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103878.1 protein_id gnl|my_center|LOCUS_27160 53536 53240 gene locus_tag LOCUS_27170 gene rplW 53536 53240 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093736.1 protein_id gnl|my_center|LOCUS_27170 54138 53533 gene locus_tag LOCUS_27180 gene rplD 54138 53533 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417226.1 protein_id gnl|my_center|LOCUS_27180 54758 54153 gene locus_tag LOCUS_27190 gene rplC 54758 54153 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456132.1 protein_id gnl|my_center|LOCUS_27190 55252 54941 gene locus_tag LOCUS_27200 gene rpsJ 55252 54941 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 protein_id gnl|my_center|LOCUS_27200 56608 55415 gene locus_tag LOCUS_27210 gene tuf 56608 55415 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115146.1 protein_id gnl|my_center|LOCUS_27210 58758 56638 gene locus_tag LOCUS_27220 gene fusA 58758 56638 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003028885.1 protein_id gnl|my_center|LOCUS_27220 59271 58801 gene locus_tag LOCUS_27230 gene rpsG 59271 58801 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397077.1 protein_id gnl|my_center|LOCUS_27230 59765 59391 gene locus_tag LOCUS_27240 gene rpsL 59765 59391 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093744.1 protein_id gnl|my_center|LOCUS_27240 64145 59925 gene locus_tag LOCUS_27250 gene rpoC 64145 59925 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 protein_id gnl|my_center|LOCUS_27250 68307 64228 gene locus_tag LOCUS_27260 gene rpoB 68307 64228 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 protein_id gnl|my_center|LOCUS_27260 68916 68545 gene locus_tag LOCUS_27270 gene rplL 68916 68545 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093747.1 protein_id gnl|my_center|LOCUS_27270 69509 69006 gene locus_tag LOCUS_27280 gene rplJ 69509 69006 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707703.1 protein_id gnl|my_center|LOCUS_27280 70478 69786 gene locus_tag LOCUS_27290 gene rplA 70478 69786 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093749.1 protein_id gnl|my_center|LOCUS_27290 70912 70481 gene locus_tag LOCUS_27300 gene rplK 70912 70481 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093751.1 protein_id gnl|my_center|LOCUS_27300 71535 71002 gene locus_tag LOCUS_27310 gene nusG 71535 71002 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108028.1 protein_id gnl|my_center|LOCUS_27310 71912 71544 gene locus_tag LOCUS_27320 gene secE 71912 71544 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768918.1 protein_id gnl|my_center|LOCUS_27320 72060 71985 gene locus_tag LOCUS_t00520 72060 71985 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 72282 72208 gene locus_tag LOCUS_t00530 72282 72208 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 72379 72306 gene locus_tag LOCUS_t00540 72379 72306 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 72512 72429 gene locus_tag LOCUS_t00550 72512 72429 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 73474 72635 gene locus_tag LOCUS_27330 73474 72635 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093768.1 protein_id gnl|my_center|LOCUS_27330 74454 73471 gene locus_tag LOCUS_27340 gene birA 74454 73471 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707707.1 protein_id gnl|my_center|LOCUS_27340 >Feature sequence21 226 2457 gene locus_tag LOCUS_27350 226 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 2454 3596 gene locus_tag LOCUS_27360 2454 3596 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544422.1 protein_id gnl|my_center|LOCUS_27360 3593 6796 gene locus_tag LOCUS_27370 3593 6796 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261805.1 protein_id gnl|my_center|LOCUS_27370 6826 7299 gene locus_tag LOCUS_27380 6826 7299 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418921.1 protein_id gnl|my_center|LOCUS_27380 7427 7891 gene locus_tag LOCUS_27390 7427 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 7902 8333 gene locus_tag LOCUS_27400 7902 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 8648 10240 gene locus_tag LOCUS_27410 8648 10240 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088336.1 protein_id gnl|my_center|LOCUS_27410 10350 10772 gene locus_tag LOCUS_27420 10350 10772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 11263 10805 gene locus_tag LOCUS_27430 11263 10805 CDS product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929265.1 protein_id gnl|my_center|LOCUS_27430 11372 12358 gene locus_tag LOCUS_27440 gene coxB 11372 12358 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525141.1 protein_id gnl|my_center|LOCUS_27440 12355 14883 gene locus_tag LOCUS_27450 gene ctaD 12355 14883 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339037.1 protein_id gnl|my_center|LOCUS_27450 14880 15236 gene locus_tag LOCUS_27460 14880 15236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 15247 17526 gene locus_tag LOCUS_27470 15247 17526 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156406754.1 protein_id gnl|my_center|LOCUS_27470 17571 18827 gene locus_tag LOCUS_27480 17571 18827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 21259 18845 gene locus_tag LOCUS_27490 21259 18845 CDS product phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113876.1 protein_id gnl|my_center|LOCUS_27490 21491 22105 gene locus_tag LOCUS_27500 21491 22105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 22283 22546 gene locus_tag LOCUS_27510 22283 22546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 23684 22653 gene locus_tag LOCUS_27520 23684 22653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 27338 23844 gene locus_tag LOCUS_27530 gene mfd 27338 23844 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113980.1 protein_id gnl|my_center|LOCUS_27530 27524 28987 gene locus_tag LOCUS_27540 27524 28987 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315085.1 protein_id gnl|my_center|LOCUS_27540 29403 30752 gene locus_tag LOCUS_27550 29403 30752 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113983.1 protein_id gnl|my_center|LOCUS_27550 30755 31978 gene locus_tag LOCUS_27560 30755 31978 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_27560 31978 32793 gene locus_tag LOCUS_27570 31978 32793 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208715.1 protein_id gnl|my_center|LOCUS_27570 32796 33464 gene locus_tag LOCUS_27580 32796 33464 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208714.1 protein_id gnl|my_center|LOCUS_27580 33466 34083 gene locus_tag LOCUS_27590 gene nqrE 33466 34083 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_27590 34156 35388 gene locus_tag LOCUS_27600 gene nqrF 34156 35388 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113984.1 protein_id gnl|my_center|LOCUS_27600 35385 36152 gene locus_tag LOCUS_27610 35385 36152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 36169 36423 gene locus_tag LOCUS_27620 gene nqrM 36169 36423 CDS product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091178.1 protein_id gnl|my_center|LOCUS_27620 36673 38064 gene locus_tag LOCUS_27630 gene sthA 36673 38064 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091177.1 protein_id gnl|my_center|LOCUS_27630 38576 38154 gene locus_tag LOCUS_27640 38576 38154 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895538.1 protein_id gnl|my_center|LOCUS_27640 39481 38579 gene locus_tag LOCUS_27650 39481 38579 CDS product PA2778 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 protein_id gnl|my_center|LOCUS_27650 39949 39551 gene locus_tag LOCUS_27660 39949 39551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 41160 40102 gene locus_tag LOCUS_27670 gene holA 41160 40102 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 protein_id gnl|my_center|LOCUS_27670 41879 41391 gene locus_tag LOCUS_27680 41879 41391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 44512 41906 gene locus_tag LOCUS_27690 gene leuS 44512 41906 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100324.1 protein_id gnl|my_center|LOCUS_27690 44729 45244 gene locus_tag LOCUS_27700 44729 45244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 46579 45323 gene locus_tag LOCUS_27710 46579 45323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704211.1 protein_id gnl|my_center|LOCUS_27710 47616 46711 gene locus_tag LOCUS_27720 47616 46711 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 protein_id gnl|my_center|LOCUS_27720 47846 49489 gene locus_tag LOCUS_27730 gene leuC 47846 49489 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091399.1 protein_id gnl|my_center|LOCUS_27730 49493 50146 gene locus_tag LOCUS_27740 gene leuD 49493 50146 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114814.1 protein_id gnl|my_center|LOCUS_27740 50303 51382 gene locus_tag LOCUS_27750 gene leuB 50303 51382 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091395.1 protein_id gnl|my_center|LOCUS_27750 51498 52610 gene locus_tag LOCUS_27760 gene asd 51498 52610 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263690.1 protein_id gnl|my_center|LOCUS_27760 52861 55620 gene locus_tag LOCUS_27770 52861 55620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 55628 56560 gene locus_tag LOCUS_27780 gene truA 55628 56560 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283590.1 protein_id gnl|my_center|LOCUS_27780 56557 57195 gene locus_tag LOCUS_27790 56557 57195 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_27790 57238 58503 gene locus_tag LOCUS_27800 gene trpB 57238 58503 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116129.1 protein_id gnl|my_center|LOCUS_27800 58513 59328 gene locus_tag LOCUS_27810 gene trpA 58513 59328 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 protein_id gnl|my_center|LOCUS_27810 59408 60460 gene locus_tag LOCUS_27820 gene accD 59408 60460 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104199.1 protein_id gnl|my_center|LOCUS_27820 60469 61743 gene locus_tag LOCUS_27830 gene folC 60469 61743 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104737.1 protein_id gnl|my_center|LOCUS_27830 61740 62435 gene locus_tag LOCUS_27840 61740 62435 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147893.1 protein_id gnl|my_center|LOCUS_27840 62438 63007 gene locus_tag LOCUS_27850 62438 63007 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_27850 63082 64605 gene locus_tag LOCUS_27860 gene purF 63082 64605 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381064.1 protein_id gnl|my_center|LOCUS_27860 64616 65812 gene locus_tag LOCUS_27870 64616 65812 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_27870 65946 66632 gene locus_tag LOCUS_27880 65946 66632 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 protein_id gnl|my_center|LOCUS_27880 66779 67333 gene locus_tag LOCUS_27890 66779 67333 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106133.1 protein_id gnl|my_center|LOCUS_27890 67417 68001 gene locus_tag LOCUS_27900 67417 68001 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084626.1 protein_id gnl|my_center|LOCUS_27900 68145 68792 gene locus_tag LOCUS_27910 68145 68792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 68776 70128 gene locus_tag LOCUS_27920 68776 70128 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195076.1 protein_id gnl|my_center|LOCUS_27920 70517 71341 gene locus_tag LOCUS_27930 70517 71341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 72427 71426 gene locus_tag LOCUS_27940 72427 71426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence22 1285 170 gene locus_tag LOCUS_27950 gene ald 1285 170 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704256.1 protein_id gnl|my_center|LOCUS_27950 1814 1497 gene locus_tag LOCUS_27960 1814 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 3010 1817 gene locus_tag LOCUS_27970 3010 1817 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084438.1 protein_id gnl|my_center|LOCUS_27970 3869 3045 gene locus_tag LOCUS_27980 gene mutM 3869 3045 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372546.1 protein_id gnl|my_center|LOCUS_27980 4115 3960 gene locus_tag LOCUS_27990 gene rpmG 4115 3960 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551515.1 protein_id gnl|my_center|LOCUS_27990 4406 4170 gene locus_tag LOCUS_28000 gene rpmB 4406 4170 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014822.1 protein_id gnl|my_center|LOCUS_28000 5430 4756 gene locus_tag LOCUS_28010 gene radC 5430 4756 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_28010 5544 6842 gene locus_tag LOCUS_28020 gene coaBC 5544 6842 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_28020 6870 7349 gene locus_tag LOCUS_28030 gene dut 6870 7349 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186718.1 protein_id gnl|my_center|LOCUS_28030 7387 8781 gene locus_tag LOCUS_28040 7387 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 8862 9770 gene locus_tag LOCUS_28050 gene argB 8862 9770 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551508.1 protein_id gnl|my_center|LOCUS_28050 9848 10459 gene locus_tag LOCUS_28060 gene slmA 9848 10459 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704178.1 protein_id gnl|my_center|LOCUS_28060 11516 10650 gene locus_tag LOCUS_28070 gene rpoH 11516 10650 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084510.1 protein_id gnl|my_center|LOCUS_28070 12615 11638 gene locus_tag LOCUS_28080 gene ftsX 12615 11638 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_28080 13280 12612 gene locus_tag LOCUS_28090 gene ftsE 13280 12612 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555631.1 protein_id gnl|my_center|LOCUS_28090 14110 13277 gene locus_tag LOCUS_28100 14110 13277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28100 14265 14360 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14848 15519 gene locus_tag LOCUS_28110 gene rsmD 14848 15519 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211502.1 protein_id gnl|my_center|LOCUS_28110 15620 15811 gene locus_tag LOCUS_28120 15620 15811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 16348 15833 gene locus_tag LOCUS_28130 16348 15833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 17162 16338 gene locus_tag LOCUS_28140 17162 16338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 17503 17159 gene locus_tag LOCUS_28150 17503 17159 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613859.1 protein_id gnl|my_center|LOCUS_28150 18931 17513 gene locus_tag LOCUS_28160 18931 17513 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096576.1 protein_id gnl|my_center|LOCUS_28160 19456 19010 gene locus_tag LOCUS_28170 19456 19010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 21022 19457 gene locus_tag LOCUS_28180 gene lysS 21022 19457 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113846.1 protein_id gnl|my_center|LOCUS_28180 21860 21027 gene locus_tag LOCUS_28190 gene prfB 21860 21027 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895661.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28190 23655 22324 gene locus_tag LOCUS_28200 23655 22324 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054987912.1 protein_id gnl|my_center|LOCUS_28200 23964 24428 gene locus_tag LOCUS_28210 23964 24428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 24425 27187 gene locus_tag LOCUS_28220 gene copA 24425 27187 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083954.1 protein_id gnl|my_center|LOCUS_28220 27865 27248 gene locus_tag LOCUS_28230 27865 27248 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397340.1 protein_id gnl|my_center|LOCUS_28230 29681 27870 gene locus_tag LOCUS_28240 gene recJ 29681 27870 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020281.1 protein_id gnl|my_center|LOCUS_28240 31355 29967 gene locus_tag LOCUS_28250 gene thrC 31355 29967 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113831.1 protein_id gnl|my_center|LOCUS_28250 32675 31359 gene locus_tag LOCUS_28260 32675 31359 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222944447.1 protein_id gnl|my_center|LOCUS_28260 33526 32786 gene locus_tag LOCUS_28270 gene dsbC 33526 32786 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092626.1 protein_id gnl|my_center|LOCUS_28270 34432 33530 gene locus_tag LOCUS_28280 gene xerD 34432 33530 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_28280 34923 34567 gene locus_tag LOCUS_28290 gene rplS 34923 34567 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092637.1 protein_id gnl|my_center|LOCUS_28290 35867 35070 gene locus_tag LOCUS_28300 gene trmD 35867 35070 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502493.1 protein_id gnl|my_center|LOCUS_28300 36394 35882 gene locus_tag LOCUS_28310 gene rimM 36394 35882 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113830.1 protein_id gnl|my_center|LOCUS_28310 36719 36471 gene locus_tag LOCUS_28320 gene rpsP 36719 36471 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166006.1 protein_id gnl|my_center|LOCUS_28320 38311 36902 gene locus_tag LOCUS_28330 gene ffh 38311 36902 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462720.1 protein_id gnl|my_center|LOCUS_28330 38546 39346 gene locus_tag LOCUS_28340 gene ccsA 38546 39346 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187598607.1 protein_id gnl|my_center|LOCUS_28340 39425 40696 gene locus_tag LOCUS_28350 39425 40696 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340990.1 protein_id gnl|my_center|LOCUS_28350 41429 40707 gene locus_tag LOCUS_28360 41429 40707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 42043 41426 gene locus_tag LOCUS_28370 42043 41426 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113995.1 protein_id gnl|my_center|LOCUS_28370 42244 42918 gene locus_tag LOCUS_28380 42244 42918 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_28380 42942 45809 gene locus_tag LOCUS_28390 42942 45809 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705867.1 protein_id gnl|my_center|LOCUS_28390 47492 46005 gene locus_tag LOCUS_28400 gene sbcB 47492 46005 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072723.1 protein_id gnl|my_center|LOCUS_28400 47821 47570 gene locus_tag LOCUS_28410 gene minE 47821 47570 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091581.1 protein_id gnl|my_center|LOCUS_28410 48636 47818 gene locus_tag LOCUS_28420 gene minD 48636 47818 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091579.1 protein_id gnl|my_center|LOCUS_28420 49389 48700 gene locus_tag LOCUS_28430 gene minC 49389 48700 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114802.1 protein_id gnl|my_center|LOCUS_28430 49706 52492 gene locus_tag LOCUS_28440 49706 52492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 53356 52610 gene locus_tag LOCUS_28450 53356 52610 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507974.1 protein_id gnl|my_center|LOCUS_28450 53547 53623 gene locus_tag LOCUS_t00560 53547 53623 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 54467 53685 gene locus_tag LOCUS_28460 54467 53685 CDS product DUF3750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391328.1 protein_id gnl|my_center|LOCUS_28460 54549 55484 gene locus_tag LOCUS_28470 gene trxA 54549 55484 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105274.1 protein_id gnl|my_center|LOCUS_28470 56736 55561 gene locus_tag LOCUS_28480 56736 55561 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_28480 56779 57225 gene locus_tag LOCUS_28490 56779 57225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 57576 57238 gene locus_tag LOCUS_28500 57576 57238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480013.1 protein_id gnl|my_center|LOCUS_28500 57626 58438 gene locus_tag LOCUS_28510 57626 58438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 58510 58917 gene locus_tag LOCUS_28520 58510 58917 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 protein_id gnl|my_center|LOCUS_28520 58914 59384 gene locus_tag LOCUS_28530 gene ybaK 58914 59384 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 protein_id gnl|my_center|LOCUS_28530 59467 59793 gene locus_tag LOCUS_28540 59467 59793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 59765 60286 gene locus_tag LOCUS_28550 59765 60286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 60333 60455 gene locus_tag LOCUS_28560 60333 60455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 60596 61150 gene locus_tag LOCUS_28570 60596 61150 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_28570 61684 61184 gene locus_tag LOCUS_28580 61684 61184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 62276 61755 gene locus_tag LOCUS_28590 62276 61755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 62501 63532 gene locus_tag LOCUS_28600 62501 63532 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104034.1 protein_id gnl|my_center|LOCUS_28600 63629 64408 gene locus_tag LOCUS_28610 gene yaaA 63629 64408 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092094.1 protein_id gnl|my_center|LOCUS_28610 64990 64415 gene locus_tag LOCUS_28620 64990 64415 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 protein_id gnl|my_center|LOCUS_28620 65047 65925 gene locus_tag LOCUS_28630 65047 65925 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495957.1 protein_id gnl|my_center|LOCUS_28630 66211 66017 gene locus_tag LOCUS_28640 66211 66017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 >Feature sequence23 650 351 gene locus_tag LOCUS_28650 650 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 881 1291 gene locus_tag LOCUS_28660 881 1291 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532202.1 protein_id gnl|my_center|LOCUS_28660 1357 2034 gene locus_tag LOCUS_28670 1357 2034 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083803.1 protein_id gnl|my_center|LOCUS_28670 3325 2084 gene locus_tag LOCUS_28680 3325 2084 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974548.1 protein_id gnl|my_center|LOCUS_28680 4535 3537 gene locus_tag LOCUS_28690 4535 3537 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707351.1 protein_id gnl|my_center|LOCUS_28690 4887 4741 gene locus_tag LOCUS_28700 4887 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 5085 5960 gene locus_tag LOCUS_28710 gene yghU 5085 5960 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530630.1 protein_id gnl|my_center|LOCUS_28710 6914 6045 gene locus_tag LOCUS_28720 6914 6045 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120877.1 protein_id gnl|my_center|LOCUS_28720 7045 7662 gene locus_tag LOCUS_28730 7045 7662 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405944.1 protein_id gnl|my_center|LOCUS_28730 8052 7666 gene locus_tag LOCUS_28740 8052 7666 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003307318.1 protein_id gnl|my_center|LOCUS_28740 8529 8254 gene locus_tag LOCUS_28750 8529 8254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 9015 8695 gene locus_tag LOCUS_28760 9015 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 9172 9564 gene locus_tag LOCUS_28770 9172 9564 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403876.1 protein_id gnl|my_center|LOCUS_28770 9630 10295 gene locus_tag LOCUS_28780 9630 10295 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261307.1 protein_id gnl|my_center|LOCUS_28780 11721 10327 gene locus_tag LOCUS_28790 gene mltF 11721 10327 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266923.1 protein_id gnl|my_center|LOCUS_28790 11871 12437 gene locus_tag LOCUS_28800 11871 12437 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086339.1 protein_id gnl|my_center|LOCUS_28800 12830 12486 gene locus_tag LOCUS_28810 12830 12486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 13850 12888 gene locus_tag LOCUS_28820 13850 12888 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532353.1 protein_id gnl|my_center|LOCUS_28820 13994 15925 gene locus_tag LOCUS_28830 gene ftsH 13994 15925 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_28830 17449 15983 gene locus_tag LOCUS_28840 17449 15983 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809405.1 protein_id gnl|my_center|LOCUS_28840 18178 17561 gene locus_tag LOCUS_28850 18178 17561 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112856.1 protein_id gnl|my_center|LOCUS_28850 18326 18841 gene locus_tag LOCUS_28860 18326 18841 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112855.1 protein_id gnl|my_center|LOCUS_28860 19058 20461 gene locus_tag LOCUS_28870 gene dbpA 19058 20461 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071179.1 protein_id gnl|my_center|LOCUS_28870 20490 21392 gene locus_tag LOCUS_28880 20490 21392 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095255.1 protein_id gnl|my_center|LOCUS_28880 21477 22223 gene locus_tag LOCUS_28890 21477 22223 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390008.1 protein_id gnl|my_center|LOCUS_28890 22324 22515 gene locus_tag LOCUS_28900 22324 22515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 22649 23095 gene locus_tag LOCUS_28910 22649 23095 CDS product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 protein_id gnl|my_center|LOCUS_28910 24085 23192 gene locus_tag LOCUS_28920 24085 23192 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 protein_id gnl|my_center|LOCUS_28920 24181 25068 gene locus_tag LOCUS_28930 24181 25068 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072012.1 protein_id gnl|my_center|LOCUS_28930 25110 25952 gene locus_tag LOCUS_28940 25110 25952 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_28940 26192 26779 gene locus_tag LOCUS_28950 26192 26779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457970.1 protein_id gnl|my_center|LOCUS_28950 27579 26863 gene locus_tag LOCUS_28960 27579 26863 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073261.1 protein_id gnl|my_center|LOCUS_28960 27762 28952 gene locus_tag LOCUS_28970 27762 28952 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339317.1 protein_id gnl|my_center|LOCUS_28970 28995 29996 gene locus_tag LOCUS_28980 28995 29996 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815405.1 protein_id gnl|my_center|LOCUS_28980 30327 30070 gene locus_tag LOCUS_28990 30327 30070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 31535 30315 gene locus_tag LOCUS_29000 31535 30315 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064873.1 protein_id gnl|my_center|LOCUS_29000 32536 31532 gene locus_tag LOCUS_29010 32536 31532 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_29010 33546 32533 gene locus_tag LOCUS_29020 gene pdhA 33546 32533 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_29020 35297 33546 gene locus_tag LOCUS_29030 gene acsA 35297 33546 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862049.1 protein_id gnl|my_center|LOCUS_29030 35479 37359 gene locus_tag LOCUS_29040 35479 37359 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064650.1 protein_id gnl|my_center|LOCUS_29040 37979 37377 gene locus_tag LOCUS_29050 37979 37377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 39597 38158 gene locus_tag LOCUS_29060 39597 38158 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483346.1 protein_id gnl|my_center|LOCUS_29060 39793 40815 gene locus_tag LOCUS_29070 39793 40815 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109658674.1 protein_id gnl|my_center|LOCUS_29070 42319 40940 gene locus_tag LOCUS_29080 42319 40940 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 protein_id gnl|my_center|LOCUS_29080 42445 42912 gene locus_tag LOCUS_29090 42445 42912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 43167 46256 gene locus_tag LOCUS_29100 43167 46256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 48248 46266 gene locus_tag LOCUS_29110 48248 46266 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_29110 48407 48865 gene locus_tag LOCUS_29120 gene umuD 48407 48865 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219995814.1 protein_id gnl|my_center|LOCUS_29120 48862 50139 gene locus_tag LOCUS_29130 48862 50139 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705677.1 protein_id gnl|my_center|LOCUS_29130 50335 51204 gene locus_tag LOCUS_29140 50335 51204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 51264 51650 gene locus_tag LOCUS_29150 51264 51650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 51880 53178 gene locus_tag LOCUS_29160 51880 53178 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_29160 53376 53301 gene locus_tag LOCUS_t00570 53376 53301 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 54236 53412 gene locus_tag LOCUS_29170 gene tesB 54236 53412 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268943.1 protein_id gnl|my_center|LOCUS_29170 54296 54781 gene locus_tag LOCUS_29180 gene tadA 54296 54781 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092697.1 protein_id gnl|my_center|LOCUS_29180 56429 54783 gene locus_tag LOCUS_29190 56429 54783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 >Feature sequence24 332 3829 gene locus_tag LOCUS_29200 332 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 3971 4288 gene locus_tag LOCUS_29210 3971 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 4374 4652 gene locus_tag LOCUS_29220 4374 4652 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553340.1 protein_id gnl|my_center|LOCUS_29220 4782 4988 gene locus_tag LOCUS_29230 4782 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 4981 5922 gene locus_tag LOCUS_29240 4981 5922 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921202.1 protein_id gnl|my_center|LOCUS_29240 5919 6680 gene locus_tag LOCUS_29250 5919 6680 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810400.1 protein_id gnl|my_center|LOCUS_29250 6747 7772 gene locus_tag LOCUS_29260 gene yejK 6747 7772 CDS product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113787.1 protein_id gnl|my_center|LOCUS_29260 8033 9364 gene locus_tag LOCUS_29270 8033 9364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 9716 9279 gene locus_tag LOCUS_29280 gene trxC 9716 9279 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_29280 9873 11678 gene locus_tag LOCUS_29290 gene hcuC 9873 11678 CDS product hydrophobic compound transporter HcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112499.1 protein_id gnl|my_center|LOCUS_29290 14066 11691 gene locus_tag LOCUS_29300 14066 11691 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895586.1 protein_id gnl|my_center|LOCUS_29300 14374 14072 gene locus_tag LOCUS_29310 14374 14072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 15141 14371 gene locus_tag LOCUS_29320 15141 14371 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101593.1 protein_id gnl|my_center|LOCUS_29320 15606 15199 gene locus_tag LOCUS_29330 15606 15199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 15942 15628 gene locus_tag LOCUS_29340 15942 15628 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482886.1 protein_id gnl|my_center|LOCUS_29340 17043 16291 gene locus_tag LOCUS_29350 17043 16291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973986.1 protein_id gnl|my_center|LOCUS_29350 18524 17040 gene locus_tag LOCUS_29360 18524 17040 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 protein_id gnl|my_center|LOCUS_29360 21380 18717 gene locus_tag LOCUS_29370 21380 18717 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 protein_id gnl|my_center|LOCUS_29370 21658 22539 gene locus_tag LOCUS_29380 21658 22539 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 protein_id gnl|my_center|LOCUS_29380 22605 22871 gene locus_tag LOCUS_29390 22605 22871 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_29390 22858 23088 gene locus_tag LOCUS_29400 22858 23088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_29400 23283 24137 gene locus_tag LOCUS_29410 23283 24137 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 protein_id gnl|my_center|LOCUS_29410 24141 25331 gene locus_tag LOCUS_29420 24141 25331 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267108.1 protein_id gnl|my_center|LOCUS_29420 25587 26228 gene locus_tag LOCUS_29430 25587 26228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 26225 26983 gene locus_tag LOCUS_29440 26225 26983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 27457 27005 gene locus_tag LOCUS_29450 27457 27005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 27703 29424 gene locus_tag LOCUS_29460 27703 29424 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102377.1 protein_id gnl|my_center|LOCUS_29460 29438 30091 gene locus_tag LOCUS_29470 29438 30091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 31281 30094 gene locus_tag LOCUS_29480 31281 30094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 31613 31290 gene locus_tag LOCUS_29490 31613 31290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 31645 31839 gene locus_tag LOCUS_29500 31645 31839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 32600 32094 gene locus_tag LOCUS_29510 32600 32094 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036503.1 protein_id gnl|my_center|LOCUS_29510 33196 32660 gene locus_tag LOCUS_29520 gene rfaH 33196 32660 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005760598.1 protein_id gnl|my_center|LOCUS_29520 33387 34754 gene locus_tag LOCUS_29530 33387 34754 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_29530 36623 34794 gene locus_tag LOCUS_29540 36623 34794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 37931 36687 gene locus_tag LOCUS_29550 37931 36687 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_29550 38063 40003 gene locus_tag LOCUS_29560 38063 40003 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707714.1 protein_id gnl|my_center|LOCUS_29560 40000 40950 gene locus_tag LOCUS_29570 40000 40950 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103683318.1 protein_id gnl|my_center|LOCUS_29570 41027 41593 gene locus_tag LOCUS_29580 41027 41593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 44473 41825 gene locus_tag LOCUS_29590 gene ppc 44473 41825 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113850.1 protein_id gnl|my_center|LOCUS_29590 45375 44470 gene locus_tag LOCUS_29600 gene mazG 45375 44470 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268591.1 protein_id gnl|my_center|LOCUS_29600 47648 45372 gene locus_tag LOCUS_29610 gene relA 47648 45372 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_29610 49089 47641 gene locus_tag LOCUS_29620 gene rlmD 49089 47641 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102417.1 protein_id gnl|my_center|LOCUS_29620 49987 49091 gene locus_tag LOCUS_29630 gene cysM 49987 49091 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554618.1 protein_id gnl|my_center|LOCUS_29630 50104 52821 gene locus_tag LOCUS_29640 gene gacS 50104 52821 CDS product two-component system sensor histidine kinase GacS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102426.1 protein_id gnl|my_center|LOCUS_29640 53138 52761 gene locus_tag LOCUS_29650 gene acpS 53138 52761 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460687.1 protein_id gnl|my_center|LOCUS_29650 53930 53142 gene locus_tag LOCUS_29660 gene pdxJ 53930 53142 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101974.1 protein_id gnl|my_center|LOCUS_29660 >Feature sequence25 305 979 gene locus_tag LOCUS_29670 305 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 1136 1549 gene locus_tag LOCUS_29680 1136 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 2002 1682 gene locus_tag LOCUS_29690 2002 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 2126 2713 gene locus_tag LOCUS_29700 2126 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 3777 2710 gene locus_tag LOCUS_29710 3777 2710 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728149.1 protein_id gnl|my_center|LOCUS_29710 4556 3780 gene locus_tag LOCUS_29720 4556 3780 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_29720 4740 5945 gene locus_tag LOCUS_29730 4740 5945 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_29730 7552 6242 gene locus_tag LOCUS_29740 7552 6242 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537682.1 protein_id gnl|my_center|LOCUS_29740 8556 7552 gene locus_tag LOCUS_29750 8556 7552 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 protein_id gnl|my_center|LOCUS_29750 9287 8583 gene locus_tag LOCUS_29760 9287 8583 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_29760 10152 9382 gene locus_tag LOCUS_29770 10152 9382 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720081.1 protein_id gnl|my_center|LOCUS_29770 11669 10224 gene locus_tag LOCUS_29780 11669 10224 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243715.1 protein_id gnl|my_center|LOCUS_29780 12129 11797 gene locus_tag LOCUS_29790 12129 11797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 14086 12260 gene locus_tag LOCUS_29800 gene typA 14086 12260 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096009.1 protein_id gnl|my_center|LOCUS_29800 14762 14217 gene locus_tag LOCUS_29810 14762 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 15320 16726 gene locus_tag LOCUS_29820 gene glnA 15320 16726 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096016.1 protein_id gnl|my_center|LOCUS_29820 16903 17475 gene locus_tag LOCUS_29830 16903 17475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 17933 18964 gene locus_tag LOCUS_29840 gene ntrB 17933 18964 CDS product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_29840 18957 20369 gene locus_tag LOCUS_29850 gene ntrC 18957 20369 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_29850 21058 20738 gene locus_tag LOCUS_29860 21058 20738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 21330 21061 gene locus_tag LOCUS_29870 21330 21061 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888120.1 protein_id gnl|my_center|LOCUS_29870 21476 22825 gene locus_tag LOCUS_29880 21476 22825 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091265.1 protein_id gnl|my_center|LOCUS_29880 23780 22875 gene locus_tag LOCUS_29890 23780 22875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 23893 24783 gene locus_tag LOCUS_29900 23893 24783 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089916.1 protein_id gnl|my_center|LOCUS_29900 25130 24756 gene locus_tag LOCUS_29910 25130 24756 CDS product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313912.1 protein_id gnl|my_center|LOCUS_29910 25906 25217 gene locus_tag LOCUS_29920 gene yieH 25906 25217 CDS product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175148.1 protein_id gnl|my_center|LOCUS_29920 26302 26601 gene locus_tag LOCUS_29930 26302 26601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 27801 26737 gene locus_tag LOCUS_29940 gene fba 27801 26737 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084964.1 protein_id gnl|my_center|LOCUS_29940 29059 27893 gene locus_tag LOCUS_29950 gene pgk 29059 27893 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209963.1 protein_id gnl|my_center|LOCUS_29950 30171 29113 gene locus_tag LOCUS_29960 gene epd 30171 29113 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084958.1 protein_id gnl|my_center|LOCUS_29960 30939 30223 gene locus_tag LOCUS_29970 30939 30223 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 protein_id gnl|my_center|LOCUS_29970 31285 30932 gene locus_tag LOCUS_29980 31285 30932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 31519 32571 gene locus_tag LOCUS_29990 gene fbaB 31519 32571 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365768.1 protein_id gnl|my_center|LOCUS_29990 34667 32673 gene locus_tag LOCUS_30000 gene tkt 34667 32673 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244559.1 protein_id gnl|my_center|LOCUS_30000 34897 36117 gene locus_tag LOCUS_30010 gene metK 34897 36117 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084948.1 protein_id gnl|my_center|LOCUS_30010 36213 37910 gene locus_tag LOCUS_30020 gene ligB 36213 37910 CDS product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269232.1 protein_id gnl|my_center|LOCUS_30020 37978 39387 gene locus_tag LOCUS_30030 gene ahcY 37978 39387 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099900.1 protein_id gnl|my_center|LOCUS_30030 40522 39563 gene locus_tag LOCUS_30040 40522 39563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 40651 41493 gene locus_tag LOCUS_30050 gene metF 40651 41493 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118821.1 protein_id gnl|my_center|LOCUS_30050 43922 41721 gene locus_tag LOCUS_30060 43922 41721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 44997 44014 gene locus_tag LOCUS_30070 44997 44014 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_30070 46987 45281 gene locus_tag LOCUS_30080 46987 45281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 47235 46990 gene locus_tag LOCUS_30090 47235 46990 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083624.1 protein_id gnl|my_center|LOCUS_30090 49362 47284 gene locus_tag LOCUS_30100 gene prlC 49362 47284 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369266.1 protein_id gnl|my_center|LOCUS_30100 49498 50838 gene locus_tag LOCUS_30110 49498 50838 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 protein_id gnl|my_center|LOCUS_30110 50859 51410 gene locus_tag LOCUS_30120 50859 51410 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083618.1 protein_id gnl|my_center|LOCUS_30120 51450 51614 gene locus_tag LOCUS_30130 51450 51614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 51720 52385 gene locus_tag LOCUS_30140 51720 52385 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110705.1 protein_id gnl|my_center|LOCUS_30140 >Feature sequence26 635 171 gene locus_tag LOCUS_30150 635 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 3271 632 gene locus_tag LOCUS_30160 gene topA 3271 632 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268332.1 protein_id gnl|my_center|LOCUS_30160 6088 3530 gene locus_tag LOCUS_30170 6088 3530 CDS product DUF3141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064308.1 protein_id gnl|my_center|LOCUS_30170 7169 6216 gene locus_tag LOCUS_30180 7169 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30180 7316 8299 gene locus_tag LOCUS_30190 gene pycR 7316 8299 CDS product LysR family transcriptional regulator PycR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_30190 8502 9554 gene locus_tag LOCUS_30200 gene lipA 8502 9554 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946482.1 protein_id gnl|my_center|LOCUS_30200 10266 9589 gene locus_tag LOCUS_30210 gene lipB 10266 9589 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707033.1 protein_id gnl|my_center|LOCUS_30210 10577 10266 gene locus_tag LOCUS_30220 10577 10266 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100311.1 protein_id gnl|my_center|LOCUS_30220 11910 10702 gene locus_tag LOCUS_30230 11910 10702 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_30230 13004 11955 gene locus_tag LOCUS_30240 13004 11955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 14083 13001 gene locus_tag LOCUS_30250 gene mltB 14083 13001 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_30250 15274 14120 gene locus_tag LOCUS_30260 gene rodA 15274 14120 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_30260 17191 15284 gene locus_tag LOCUS_30270 gene mrdA 17191 15284 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_30270 17686 17219 gene locus_tag LOCUS_30280 gene rlmH 17686 17219 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298242.1 protein_id gnl|my_center|LOCUS_30280 18060 17683 gene locus_tag LOCUS_30290 gene rsfS 18060 17683 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098046.1 protein_id gnl|my_center|LOCUS_30290 18816 18190 gene locus_tag LOCUS_30300 gene nadD 18816 18190 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093199.1 protein_id gnl|my_center|LOCUS_30300 20189 18879 gene locus_tag LOCUS_30310 20189 18879 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_30310 20296 21165 gene locus_tag LOCUS_30320 20296 21165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 21158 22084 gene locus_tag LOCUS_30330 21158 22084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 22113 23516 gene locus_tag LOCUS_30340 22113 23516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 24152 23529 gene locus_tag LOCUS_30350 24152 23529 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106442.1 protein_id gnl|my_center|LOCUS_30350 24838 24209 gene locus_tag LOCUS_30360 gene ubiX 24838 24209 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 protein_id gnl|my_center|LOCUS_30360 26222 24831 gene locus_tag LOCUS_30370 gene mpl 26222 24831 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093229.1 protein_id gnl|my_center|LOCUS_30370 26448 27707 gene locus_tag LOCUS_30380 26448 27707 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_30380 29587 27866 gene locus_tag LOCUS_30390 29587 27866 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463440.1 protein_id gnl|my_center|LOCUS_30390 29839 30369 gene locus_tag LOCUS_30400 gene ppa 29839 30369 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093248.1 protein_id gnl|my_center|LOCUS_30400 31630 30452 gene locus_tag LOCUS_30410 31630 30452 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_30410 31845 33698 gene locus_tag LOCUS_30420 31845 33698 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112327.1 protein_id gnl|my_center|LOCUS_30420 33941 34405 gene locus_tag LOCUS_30430 gene accB 33941 34405 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 protein_id gnl|my_center|LOCUS_30430 34449 35792 gene locus_tag LOCUS_30440 gene accC 34449 35792 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095391.1 protein_id gnl|my_center|LOCUS_30440 36031 36945 gene locus_tag LOCUS_30450 gene prmA 36031 36945 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112237.1 protein_id gnl|my_center|LOCUS_30450 37075 36923 gene locus_tag LOCUS_30460 37075 36923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 37074 38132 gene locus_tag LOCUS_30470 gene dusB 37074 38132 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095402.1 protein_id gnl|my_center|LOCUS_30470 38129 38455 gene locus_tag LOCUS_30480 38129 38455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 38563 40143 gene locus_tag LOCUS_30490 gene purH 38563 40143 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456445.1 protein_id gnl|my_center|LOCUS_30490 41848 40391 gene locus_tag LOCUS_30500 gene gabD 41848 40391 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 protein_id gnl|my_center|LOCUS_30500 42233 41916 gene locus_tag LOCUS_30510 42233 41916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 42748 42344 gene locus_tag LOCUS_30520 gene folX 42748 42344 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316983.1 protein_id gnl|my_center|LOCUS_30520 43330 42773 gene locus_tag LOCUS_30530 gene folE 43330 42773 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091896.1 protein_id gnl|my_center|LOCUS_30530 43643 44203 gene locus_tag LOCUS_30540 43643 44203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 45275 44289 gene locus_tag LOCUS_30550 45275 44289 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763737.1 protein_id gnl|my_center|LOCUS_30550 46043 45327 gene locus_tag LOCUS_30560 46043 45327 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944939.1 protein_id gnl|my_center|LOCUS_30560 46114 47268 gene locus_tag LOCUS_30570 gene bioB 46114 47268 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372416.1 protein_id gnl|my_center|LOCUS_30570 47283 48449 gene locus_tag LOCUS_30580 gene bioF 47283 48449 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103160.1 protein_id gnl|my_center|LOCUS_30580 48446 49180 gene locus_tag LOCUS_30590 48446 49180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 49177 49986 gene locus_tag LOCUS_30600 gene bioC 49177 49986 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113247.1 protein_id gnl|my_center|LOCUS_30600 >Feature sequence27 316 5 gene locus_tag LOCUS_30610 316 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 630 824 gene locus_tag LOCUS_30620 630 824 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_30620 817 1641 gene locus_tag LOCUS_30630 817 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 1628 2179 gene locus_tag LOCUS_30640 1628 2179 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_30640 2230 5664 gene locus_tag LOCUS_30650 gene brxC 2230 5664 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393725.1 protein_id gnl|my_center|LOCUS_30650 5681 7357 gene locus_tag LOCUS_30660 5681 7357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 7470 10898 gene locus_tag LOCUS_30670 7470 10898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 10891 11904 gene locus_tag LOCUS_30680 10891 11904 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939306.1 protein_id gnl|my_center|LOCUS_30680 11901 12440 gene locus_tag LOCUS_30690 11901 12440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 12444 14777 gene locus_tag LOCUS_30700 gene pglZ 12444 14777 CDS product BREX-1 system phosphatase PglZ type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 protein_id gnl|my_center|LOCUS_30700 14821 16881 gene locus_tag LOCUS_30710 gene brxL 14821 16881 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948297.1 protein_id gnl|my_center|LOCUS_30710 17057 16890 gene locus_tag LOCUS_30720 17057 16890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 17452 17844 gene locus_tag LOCUS_30730 17452 17844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 19386 17854 gene locus_tag LOCUS_30740 19386 17854 CDS product conjugal transfer protein TraG N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066267399.1 protein_id gnl|my_center|LOCUS_30740 19766 19386 gene locus_tag LOCUS_30750 19766 19386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 21250 19766 gene locus_tag LOCUS_30760 21250 19766 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066267402.1 protein_id gnl|my_center|LOCUS_30760 22214 21264 gene locus_tag LOCUS_30770 22214 21264 CDS product TIGR03756 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024483820.1 protein_id gnl|my_center|LOCUS_30770 22645 22211 gene locus_tag LOCUS_30780 22645 22211 CDS product TIGR03757 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821941.1 protein_id gnl|my_center|LOCUS_30780 22880 23254 gene locus_tag LOCUS_30790 gene mvaT 22880 23254 CDS product transcriptional regulator MvaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093888.1 protein_id gnl|my_center|LOCUS_30790 25563 24148 gene locus_tag LOCUS_30800 25563 24148 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363717.1 protein_id gnl|my_center|LOCUS_30800 26646 25672 gene locus_tag LOCUS_30810 26646 25672 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_30810 27185 26688 gene locus_tag LOCUS_30820 27185 26688 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706999.1 protein_id gnl|my_center|LOCUS_30820 27441 28799 gene locus_tag LOCUS_30830 27441 28799 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 protein_id gnl|my_center|LOCUS_30830 29895 28858 gene locus_tag LOCUS_30840 29895 28858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 31857 29947 gene locus_tag LOCUS_30850 31857 29947 CDS product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925712.1 protein_id gnl|my_center|LOCUS_30850 32926 31880 gene locus_tag LOCUS_30860 32926 31880 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036181.1 protein_id gnl|my_center|LOCUS_30860 35025 32944 gene locus_tag LOCUS_30870 35025 32944 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460617.1 protein_id gnl|my_center|LOCUS_30870 36678 35062 gene locus_tag LOCUS_30880 36678 35062 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225531.1 protein_id gnl|my_center|LOCUS_30880 37050 36739 gene locus_tag LOCUS_30890 37050 36739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 37287 37054 gene locus_tag LOCUS_30900 37287 37054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 38023 37541 gene locus_tag LOCUS_30910 38023 37541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 38371 38030 gene locus_tag LOCUS_30920 38371 38030 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_30920 38963 38496 gene locus_tag LOCUS_30930 38963 38496 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723733.1 protein_id gnl|my_center|LOCUS_30930 39371 39024 gene locus_tag LOCUS_30940 39371 39024 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261433.1 protein_id gnl|my_center|LOCUS_30940 40616 39396 gene locus_tag LOCUS_30950 gene metK 40616 39396 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084948.1 protein_id gnl|my_center|LOCUS_30950 41808 40651 gene locus_tag LOCUS_30960 gene cfa 41808 40651 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816380.1 protein_id gnl|my_center|LOCUS_30960 42860 42006 gene locus_tag LOCUS_30970 42860 42006 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813546.1 protein_id gnl|my_center|LOCUS_30970 44448 42946 gene locus_tag LOCUS_30980 gene nhaB 44448 42946 CDS product sodium/proton antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113594.1 protein_id gnl|my_center|LOCUS_30980 46144 44654 gene locus_tag LOCUS_30990 46144 44654 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_30990 48148 46694 gene locus_tag LOCUS_31000 48148 46694 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_31000 >Feature sequence28 2874 73 gene locus_tag LOCUS_31010 2874 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 4139 2919 gene locus_tag LOCUS_31020 4139 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943169.1 protein_id gnl|my_center|LOCUS_31020 4542 4108 gene locus_tag LOCUS_31030 4542 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 6319 4898 gene locus_tag LOCUS_31040 gene nhaD 6319 4898 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_31040 9909 6535 gene locus_tag LOCUS_31050 9909 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 10117 10830 gene locus_tag LOCUS_31060 10117 10830 CDS product DUF3581 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261825.1 protein_id gnl|my_center|LOCUS_31060 10869 12584 gene locus_tag LOCUS_31070 10869 12584 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219893520.1 protein_id gnl|my_center|LOCUS_31070 13501 12608 gene locus_tag LOCUS_31080 13501 12608 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404480.1 protein_id gnl|my_center|LOCUS_31080 14614 13598 gene locus_tag LOCUS_31090 14614 13598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 14730 15680 gene locus_tag LOCUS_31100 14730 15680 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202665.1 protein_id gnl|my_center|LOCUS_31100 16833 15691 gene locus_tag LOCUS_31110 gene chrA 16833 15691 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972738.1 protein_id gnl|my_center|LOCUS_31110 17012 17980 gene locus_tag LOCUS_31120 gene corA 17012 17980 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233650.1 protein_id gnl|my_center|LOCUS_31120 18081 19313 gene locus_tag LOCUS_31130 18081 19313 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089683.1 protein_id gnl|my_center|LOCUS_31130 20471 19317 gene locus_tag LOCUS_31140 20471 19317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 22160 20541 gene locus_tag LOCUS_31150 22160 20541 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463528.1 protein_id gnl|my_center|LOCUS_31150 22897 22157 gene locus_tag LOCUS_31160 22897 22157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206816.1 protein_id gnl|my_center|LOCUS_31160 23997 22894 gene locus_tag LOCUS_31170 23997 22894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 25367 23994 gene locus_tag LOCUS_31180 25367 23994 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_31180 26287 25364 gene locus_tag LOCUS_31190 26287 25364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31190 26814 26263 gene locus_tag LOCUS_31200 26814 26263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31200 27012 28331 gene locus_tag LOCUS_31210 27012 28331 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223158.1 protein_id gnl|my_center|LOCUS_31210 28537 28328 gene locus_tag LOCUS_31220 28537 28328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 28773 28540 gene locus_tag LOCUS_31230 28773 28540 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764045.1 protein_id gnl|my_center|LOCUS_31230 29161 28955 gene locus_tag LOCUS_31240 29161 28955 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003488188.1 protein_id gnl|my_center|LOCUS_31240 30358 29558 gene locus_tag LOCUS_31250 30358 29558 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390684.1 protein_id gnl|my_center|LOCUS_31250 31244 30480 gene locus_tag LOCUS_31260 31244 30480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 31367 32131 gene locus_tag LOCUS_31270 31367 32131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 32242 32973 gene locus_tag LOCUS_31280 gene nfsA 32242 32973 CDS product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705684.1 protein_id gnl|my_center|LOCUS_31280 32984 33559 gene locus_tag LOCUS_31290 32984 33559 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172525.1 protein_id gnl|my_center|LOCUS_31290 33540 34061 gene locus_tag LOCUS_31300 33540 34061 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993958.1 protein_id gnl|my_center|LOCUS_31300 34106 34384 gene locus_tag LOCUS_31310 34106 34384 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605676.1 protein_id gnl|my_center|LOCUS_31310 34384 34677 gene locus_tag LOCUS_31320 34384 34677 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_31320 35617 34724 gene locus_tag LOCUS_31330 35617 34724 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705975.1 protein_id gnl|my_center|LOCUS_31330 35755 36102 gene locus_tag LOCUS_31340 35755 36102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 37156 36155 gene locus_tag LOCUS_31350 37156 36155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838772.1 protein_id gnl|my_center|LOCUS_31350 38154 37198 gene locus_tag LOCUS_31360 38154 37198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 38845 38198 gene locus_tag LOCUS_31370 38845 38198 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530372.1 protein_id gnl|my_center|LOCUS_31370 39141 38854 gene locus_tag LOCUS_31380 39141 38854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 39473 39138 gene locus_tag LOCUS_31390 39473 39138 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008544592.1 protein_id gnl|my_center|LOCUS_31390 39750 41036 gene locus_tag LOCUS_31400 39750 41036 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091313186.1 protein_id gnl|my_center|LOCUS_31400 41164 41496 gene locus_tag LOCUS_31410 41164 41496 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973508.1 protein_id gnl|my_center|LOCUS_31410 43349 41628 gene locus_tag LOCUS_31420 43349 41628 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929046.1 protein_id gnl|my_center|LOCUS_31420 44672 43539 gene locus_tag LOCUS_31430 44672 43539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 >Feature sequence29 584 60 gene locus_tag LOCUS_31440 584 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 3863 882 gene locus_tag LOCUS_31450 gene glnE 3863 882 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 protein_id gnl|my_center|LOCUS_31450 4310 3939 gene locus_tag LOCUS_31460 4310 3939 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706544.1 protein_id gnl|my_center|LOCUS_31460 5756 4320 gene locus_tag LOCUS_31470 gene dacB 5756 4320 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217314.1 protein_id gnl|my_center|LOCUS_31470 6126 5797 gene locus_tag LOCUS_31480 6126 5797 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191709.1 protein_id gnl|my_center|LOCUS_31480 6827 6126 gene locus_tag LOCUS_31490 6827 6126 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208259.1 protein_id gnl|my_center|LOCUS_31490 7162 9069 gene locus_tag LOCUS_31500 gene fabY 7162 9069 CDS product beta-ketoacyl-ACP synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114068.1 protein_id gnl|my_center|LOCUS_31500 9075 9554 gene locus_tag LOCUS_31510 gene coaD 9075 9554 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704185.1 protein_id gnl|my_center|LOCUS_31510 9643 9891 gene locus_tag LOCUS_31520 9643 9891 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 protein_id gnl|my_center|LOCUS_31520 10285 9971 gene locus_tag LOCUS_31530 10285 9971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084452.1 protein_id gnl|my_center|LOCUS_31530 10498 11118 gene locus_tag LOCUS_31540 10498 11118 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483028.1 protein_id gnl|my_center|LOCUS_31540 11222 12595 gene locus_tag LOCUS_31550 gene dinF 11222 12595 CDS product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819117.1 protein_id gnl|my_center|LOCUS_31550 12705 14015 gene locus_tag LOCUS_31560 12705 14015 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_31560 14101 14490 gene locus_tag LOCUS_31570 14101 14490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 14516 15019 gene locus_tag LOCUS_31580 14516 15019 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815410.1 protein_id gnl|my_center|LOCUS_31580 15349 15026 gene locus_tag LOCUS_31590 15349 15026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 15556 15425 gene locus_tag LOCUS_31600 15556 15425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 16414 15629 gene locus_tag LOCUS_31610 16414 15629 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_31610 16500 16949 gene locus_tag LOCUS_31620 16500 16949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 17968 16931 gene locus_tag LOCUS_31630 17968 16931 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703174.1 protein_id gnl|my_center|LOCUS_31630 18627 17959 gene locus_tag LOCUS_31640 18627 17959 CDS product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703175.1 protein_id gnl|my_center|LOCUS_31640 19039 18680 gene locus_tag LOCUS_31650 19039 18680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 19587 19036 gene locus_tag LOCUS_31660 19587 19036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 19712 20848 gene locus_tag LOCUS_31670 19712 20848 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104473.1 protein_id gnl|my_center|LOCUS_31670 20984 21457 gene locus_tag LOCUS_31680 20984 21457 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 protein_id gnl|my_center|LOCUS_31680 21666 22022 gene locus_tag LOCUS_31690 21666 22022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 23648 22161 gene locus_tag LOCUS_31700 23648 22161 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707191.1 protein_id gnl|my_center|LOCUS_31700 26008 23822 gene locus_tag LOCUS_31710 26008 23822 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707540.1 protein_id gnl|my_center|LOCUS_31710 26367 27470 gene locus_tag LOCUS_31720 26367 27470 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_31720 27537 28040 gene locus_tag LOCUS_31730 27537 28040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 28037 29368 gene locus_tag LOCUS_31740 28037 29368 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_31740 29530 31215 gene locus_tag LOCUS_31750 29530 31215 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_31750 32304 31129 gene locus_tag LOCUS_31760 32304 31129 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388525.1 protein_id gnl|my_center|LOCUS_31760 32518 33546 gene locus_tag LOCUS_31770 32518 33546 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_31770 36372 33607 gene locus_tag LOCUS_31780 gene polA 36372 33607 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114123.1 protein_id gnl|my_center|LOCUS_31780 36546 36833 gene locus_tag LOCUS_31790 36546 36833 CDS product DUF2782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096984.1 protein_id gnl|my_center|LOCUS_31790 36920 37879 gene locus_tag LOCUS_31800 36920 37879 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114124.1 protein_id gnl|my_center|LOCUS_31800 37876 39798 gene locus_tag LOCUS_31810 gene speA 37876 39798 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071982.1 protein_id gnl|my_center|LOCUS_31810 >Feature sequence30 1318 62 gene locus_tag LOCUS_31820 1318 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 1518 2063 gene locus_tag LOCUS_31830 1518 2063 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197759.1 protein_id gnl|my_center|LOCUS_31830 3791 2085 gene locus_tag LOCUS_31840 3791 2085 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114562.1 protein_id gnl|my_center|LOCUS_31840 3944 5182 gene locus_tag LOCUS_31850 3944 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 5182 6567 gene locus_tag LOCUS_31860 5182 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 7352 6564 gene locus_tag LOCUS_31870 7352 6564 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 protein_id gnl|my_center|LOCUS_31870 8061 7378 gene locus_tag LOCUS_31880 8061 7378 CDS product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074301.1 protein_id gnl|my_center|LOCUS_31880 10135 8225 gene locus_tag LOCUS_31890 10135 8225 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477696.1 protein_id gnl|my_center|LOCUS_31890 10470 10799 gene locus_tag LOCUS_31900 10470 10799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 11845 10808 gene locus_tag LOCUS_31910 gene sohB 11845 10808 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087997.1 protein_id gnl|my_center|LOCUS_31910 11970 12281 gene locus_tag LOCUS_31920 11970 12281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 13109 12339 gene locus_tag LOCUS_31930 13109 12339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 13978 13109 gene locus_tag LOCUS_31940 gene dnaQ 13978 13109 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267225.1 protein_id gnl|my_center|LOCUS_31940 14402 13932 gene locus_tag LOCUS_31950 gene rnhA 14402 13932 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814734.1 protein_id gnl|my_center|LOCUS_31950 15177 14395 gene locus_tag LOCUS_31960 15177 14395 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072515.1 protein_id gnl|my_center|LOCUS_31960 15246 16013 gene locus_tag LOCUS_31970 gene gloB 15246 16013 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770768.1 protein_id gnl|my_center|LOCUS_31970 16089 17282 gene locus_tag LOCUS_31980 16089 17282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 17396 19243 gene locus_tag LOCUS_31990 17396 19243 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098136.1 protein_id gnl|my_center|LOCUS_31990 19288 20361 gene locus_tag LOCUS_32000 19288 20361 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098134.1 protein_id gnl|my_center|LOCUS_32000 20366 21463 gene locus_tag LOCUS_32010 20366 21463 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_32010 21456 23063 gene locus_tag LOCUS_32020 21456 23063 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527943.1 protein_id gnl|my_center|LOCUS_32020 23298 25034 gene locus_tag LOCUS_32030 23298 25034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 25739 25041 gene locus_tag LOCUS_32040 gene rsuA 25739 25041 CDS product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073606.1 protein_id gnl|my_center|LOCUS_32040 26554 25739 gene locus_tag LOCUS_32050 26554 25739 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 protein_id gnl|my_center|LOCUS_32050 26688 27611 gene locus_tag LOCUS_32060 gene rarD 26688 27611 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044965.1 protein_id gnl|my_center|LOCUS_32060 27654 28808 gene locus_tag LOCUS_32070 27654 28808 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941964.1 protein_id gnl|my_center|LOCUS_32070 30134 28860 gene locus_tag LOCUS_32080 30134 28860 CDS product bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114564.1 protein_id gnl|my_center|LOCUS_32080 30241 31962 gene locus_tag LOCUS_32090 30241 31962 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_32090 32196 33356 gene locus_tag LOCUS_32100 32196 33356 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086714.1 protein_id gnl|my_center|LOCUS_32100 33402 35411 gene locus_tag LOCUS_32110 33402 35411 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086713.1 protein_id gnl|my_center|LOCUS_32110 35456 36895 gene locus_tag LOCUS_32120 35456 36895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 36892 38088 gene locus_tag LOCUS_32130 36892 38088 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936116.1 protein_id gnl|my_center|LOCUS_32130 38121 39242 gene locus_tag LOCUS_32140 gene pimD 38121 39242 CDS product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 protein_id gnl|my_center|LOCUS_32140 >Feature sequence31 993 226 gene locus_tag LOCUS_32150 gene dsbG 993 226 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089790.1 protein_id gnl|my_center|LOCUS_32150 1871 1050 gene locus_tag LOCUS_32160 1871 1050 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089792.1 protein_id gnl|my_center|LOCUS_32160 1752 2030 gene locus_tag LOCUS_32170 1752 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 2089 2592 gene locus_tag LOCUS_32180 2089 2592 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423235.1 protein_id gnl|my_center|LOCUS_32180 2669 3151 gene locus_tag LOCUS_32190 gene nrdR 2669 3151 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 protein_id gnl|my_center|LOCUS_32190 3177 4322 gene locus_tag LOCUS_32200 gene ribD 3177 4322 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113051.1 protein_id gnl|my_center|LOCUS_32200 4692 5870 gene locus_tag LOCUS_32210 gene ribBA 4692 5870 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093313.1 protein_id gnl|my_center|LOCUS_32210 5948 6442 gene locus_tag LOCUS_32220 gene ribE 5948 6442 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 protein_id gnl|my_center|LOCUS_32220 6439 6942 gene locus_tag LOCUS_32230 gene nusB 6439 6942 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_32230 6956 7930 gene locus_tag LOCUS_32240 gene thiL 6956 7930 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035938.1 protein_id gnl|my_center|LOCUS_32240 7927 8400 gene locus_tag LOCUS_32250 7927 8400 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113053.1 protein_id gnl|my_center|LOCUS_32250 8459 9694 gene locus_tag LOCUS_32260 8459 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 9808 12264 gene locus_tag LOCUS_32270 gene lon 9808 12264 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101982.1 protein_id gnl|my_center|LOCUS_32270 12557 14401 gene locus_tag LOCUS_32280 gene ilvD 12557 14401 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084436.1 protein_id gnl|my_center|LOCUS_32280 14461 15540 gene locus_tag LOCUS_32290 14461 15540 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210585.1 protein_id gnl|my_center|LOCUS_32290 16125 15544 gene locus_tag LOCUS_32300 gene nudE 16125 15544 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114066.1 protein_id gnl|my_center|LOCUS_32300 16240 16944 gene locus_tag LOCUS_32310 gene yrfG 16240 16944 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_32310 16937 17323 gene locus_tag LOCUS_32320 gene hslR 16937 17323 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159667.1 protein_id gnl|my_center|LOCUS_32320 17336 18211 gene locus_tag LOCUS_32330 gene hslO 17336 18211 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096245.1 protein_id gnl|my_center|LOCUS_32330 18494 20050 gene locus_tag LOCUS_32340 18494 20050 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100068.1 protein_id gnl|my_center|LOCUS_32340 20152 20649 gene locus_tag LOCUS_32350 gene msrB 20152 20649 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124170.1 protein_id gnl|my_center|LOCUS_32350 20979 23360 gene locus_tag LOCUS_32360 20979 23360 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100071.1 protein_id gnl|my_center|LOCUS_32360 23491 25101 gene locus_tag LOCUS_32370 gene gshA 23491 25101 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 protein_id gnl|my_center|LOCUS_32370 25098 25616 gene locus_tag LOCUS_32380 25098 25616 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 protein_id gnl|my_center|LOCUS_32380 25724 26230 gene locus_tag LOCUS_32390 gene rsd 25724 26230 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120370.1 protein_id gnl|my_center|LOCUS_32390 29335 26249 gene locus_tag LOCUS_32400 gene vexF 29335 26249 CDS product multidrug efflux RND transporter permease subunit VexF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494544.1 protein_id gnl|my_center|LOCUS_32400 30488 29337 gene locus_tag LOCUS_32410 30488 29337 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038277.1 protein_id gnl|my_center|LOCUS_32410 30676 31653 gene locus_tag LOCUS_32420 30676 31653 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 protein_id gnl|my_center|LOCUS_32420 32524 31868 gene locus_tag LOCUS_32430 32524 31868 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_32430 32730 33221 gene locus_tag LOCUS_32440 32730 33221 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084400.1 protein_id gnl|my_center|LOCUS_32440 33347 35605 gene locus_tag LOCUS_32450 gene ptsP 33347 35605 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_32450 36580 35798 gene locus_tag LOCUS_32460 36580 35798 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 protein_id gnl|my_center|LOCUS_32460 36683 37720 gene locus_tag LOCUS_32470 36683 37720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 37770 38558 gene locus_tag LOCUS_32480 gene lgt 37770 38558 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 protein_id gnl|my_center|LOCUS_32480 38585 38884 gene locus_tag LOCUS_32490 38585 38884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 >Feature sequence32 767 561 gene locus_tag LOCUS_32500 767 561 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097345.1 protein_id gnl|my_center|LOCUS_32500 2179 815 gene locus_tag LOCUS_32510 gene rsmB 2179 815 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 protein_id gnl|my_center|LOCUS_32510 3180 2176 gene locus_tag LOCUS_32520 gene fmt 3180 2176 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114642.1 protein_id gnl|my_center|LOCUS_32520 3802 3290 gene locus_tag LOCUS_32530 gene def 3802 3290 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401459.1 protein_id gnl|my_center|LOCUS_32530 3972 5081 gene locus_tag LOCUS_32540 3972 5081 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_32540 5109 6215 gene locus_tag LOCUS_32550 gene dprA 5109 6215 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114641.1 protein_id gnl|my_center|LOCUS_32550 6269 6826 gene locus_tag LOCUS_32560 6269 6826 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038838.1 protein_id gnl|my_center|LOCUS_32560 6867 7793 gene locus_tag LOCUS_32570 gene hemF 6867 7793 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097311.1 protein_id gnl|my_center|LOCUS_32570 7790 8602 gene locus_tag LOCUS_32580 gene aroE 7790 8602 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111201.1 protein_id gnl|my_center|LOCUS_32580 8972 8715 gene locus_tag LOCUS_32590 8972 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 9829 9026 gene locus_tag LOCUS_32600 9829 9026 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455384.1 protein_id gnl|my_center|LOCUS_32600 9963 10829 gene locus_tag LOCUS_32610 9963 10829 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098802.1 protein_id gnl|my_center|LOCUS_32610 11681 11058 gene locus_tag LOCUS_32620 11681 11058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 13278 11875 gene locus_tag LOCUS_32630 gene der 13278 11875 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092786.1 protein_id gnl|my_center|LOCUS_32630 14423 13275 gene locus_tag LOCUS_32640 gene bamB 14423 13275 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 protein_id gnl|my_center|LOCUS_32640 15079 14420 gene locus_tag LOCUS_32650 15079 14420 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073186.1 protein_id gnl|my_center|LOCUS_32650 16493 15168 gene locus_tag LOCUS_32660 gene hisS 16493 15168 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417932.1 protein_id gnl|my_center|LOCUS_32660 17649 16534 gene locus_tag LOCUS_32670 gene ispG 17649 16534 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092800.1 protein_id gnl|my_center|LOCUS_32670 18655 17660 gene locus_tag LOCUS_32680 gene rodZ 18655 17660 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091139.1 protein_id gnl|my_center|LOCUS_32680 19435 18686 gene locus_tag LOCUS_32690 19435 18686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 20685 19558 gene locus_tag LOCUS_32700 gene rlmN 20685 19558 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771021.1 protein_id gnl|my_center|LOCUS_32700 21181 20756 gene locus_tag LOCUS_32710 gene ndk 21181 20756 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092811.1 protein_id gnl|my_center|LOCUS_32710 21811 21485 gene locus_tag LOCUS_32720 gene iscA 21811 21485 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380604.1 protein_id gnl|my_center|LOCUS_32720 23014 21857 gene locus_tag LOCUS_32730 gene iscS 23014 21857 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775265.1 protein_id gnl|my_center|LOCUS_32730 23519 23049 gene locus_tag LOCUS_32740 gene iscR 23519 23049 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552474.1 protein_id gnl|my_center|LOCUS_32740 24508 23633 gene locus_tag LOCUS_32750 gene cysE 24508 23633 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_32750 25412 24654 gene locus_tag LOCUS_32760 gene trmJ 25412 24654 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 protein_id gnl|my_center|LOCUS_32760 25627 26421 gene locus_tag LOCUS_32770 gene suhB 25627 26421 CDS product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092845.1 protein_id gnl|my_center|LOCUS_32770 27522 26596 gene locus_tag LOCUS_32780 gene secF 27522 26596 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666079.1 protein_id gnl|my_center|LOCUS_32780 29382 27532 gene locus_tag LOCUS_32790 gene secD 29382 27532 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100609.1 protein_id gnl|my_center|LOCUS_32790 29855 29523 gene locus_tag LOCUS_32800 gene yajC 29855 29523 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552468.1 protein_id gnl|my_center|LOCUS_32800 31108 29972 gene locus_tag LOCUS_32810 gene tgt 31108 29972 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100607.1 protein_id gnl|my_center|LOCUS_32810 32138 31101 gene locus_tag LOCUS_32820 gene queA 32138 31101 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266902.1 protein_id gnl|my_center|LOCUS_32820 >Feature sequence33 178 348 gene locus_tag LOCUS_32830 178 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 437 1114 gene locus_tag LOCUS_32840 437 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 2707 1121 gene locus_tag LOCUS_32850 2707 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 3050 2814 gene locus_tag LOCUS_32860 3050 2814 CDS product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397146.1 protein_id gnl|my_center|LOCUS_32860 4216 3155 gene locus_tag LOCUS_32870 gene ansA 4216 3155 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023329.1 protein_id gnl|my_center|LOCUS_32870 4655 4365 gene locus_tag LOCUS_32880 4655 4365 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071641.1 protein_id gnl|my_center|LOCUS_32880 4939 4643 gene locus_tag LOCUS_32890 4939 4643 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071642.1 protein_id gnl|my_center|LOCUS_32890 5834 5058 gene locus_tag LOCUS_32900 5834 5058 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728822.1 protein_id gnl|my_center|LOCUS_32900 5933 6910 gene locus_tag LOCUS_32910 5933 6910 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810884.1 protein_id gnl|my_center|LOCUS_32910 7002 8771 gene locus_tag LOCUS_32920 7002 8771 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271912.1 protein_id gnl|my_center|LOCUS_32920 9341 8796 gene locus_tag LOCUS_32930 9341 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 10616 9408 gene locus_tag LOCUS_32940 10616 9408 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_32940 13086 10723 gene locus_tag LOCUS_32950 13086 10723 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_32950 13836 13105 gene locus_tag LOCUS_32960 13836 13105 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445444.1 protein_id gnl|my_center|LOCUS_32960 14090 16807 gene locus_tag LOCUS_32970 gene gyrA 14090 16807 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766744.1 protein_id gnl|my_center|LOCUS_32970 16823 17926 gene locus_tag LOCUS_32980 gene serC 16823 17926 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207406.1 protein_id gnl|my_center|LOCUS_32980 17982 19073 gene locus_tag LOCUS_32990 gene pheA 17982 19073 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091446.1 protein_id gnl|my_center|LOCUS_32990 19089 21371 gene locus_tag LOCUS_33000 19089 21371 CDS product bifunctional prephenate dehydrogenase/3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207213.1 protein_id gnl|my_center|LOCUS_33000 21368 22066 gene locus_tag LOCUS_33010 gene cmk 21368 22066 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554563.1 protein_id gnl|my_center|LOCUS_33010 22249 23925 gene locus_tag LOCUS_33020 gene rpsA 22249 23925 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_33020 24367 24744 gene locus_tag LOCUS_33030 gene mvaT 24367 24744 CDS product transcriptional regulator MvaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093888.1 protein_id gnl|my_center|LOCUS_33030 25663 24839 gene locus_tag LOCUS_33040 25663 24839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 26050 26319 gene locus_tag LOCUS_33050 26050 26319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 26590 26327 gene locus_tag LOCUS_33060 26590 26327 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087397.1 protein_id gnl|my_center|LOCUS_33060 27465 26620 gene locus_tag LOCUS_33070 27465 26620 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042007654.1 protein_id gnl|my_center|LOCUS_33070 28163 27462 gene locus_tag LOCUS_33080 gene queC 28163 27462 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242065.1 protein_id gnl|my_center|LOCUS_33080 >Feature sequence34 186 272 gene locus_tag LOCUS_t00580 186 272 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 396 551 gene locus_tag LOCUS_33090 396 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 690 1103 gene locus_tag LOCUS_33100 gene rnk 690 1103 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210103.1 protein_id gnl|my_center|LOCUS_33100 1113 1739 gene locus_tag LOCUS_33110 1113 1739 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073456.1 protein_id gnl|my_center|LOCUS_33110 1975 3201 gene locus_tag LOCUS_33120 1975 3201 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391241.1 protein_id gnl|my_center|LOCUS_33120 4865 3141 gene locus_tag LOCUS_33130 4865 3141 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030655.1 protein_id gnl|my_center|LOCUS_33130 4901 5527 gene locus_tag LOCUS_33140 4901 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 5524 6450 gene locus_tag LOCUS_33150 5524 6450 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_33150 6453 7379 gene locus_tag LOCUS_33160 6453 7379 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_33160 7376 9493 gene locus_tag LOCUS_33170 gene tgpA 7376 9493 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_33170 9534 10049 gene locus_tag LOCUS_33180 9534 10049 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919598.1 protein_id gnl|my_center|LOCUS_33180 10492 10103 gene locus_tag LOCUS_33190 10492 10103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 10655 11851 gene locus_tag LOCUS_33200 gene fabV 10655 11851 CDS product enoyl-[acyl-carrier-protein] reductase FabV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035373.1 protein_id gnl|my_center|LOCUS_33200 11905 12117 gene locus_tag LOCUS_33210 11905 12117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 12400 13368 gene locus_tag LOCUS_33220 12400 13368 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524362.1 protein_id gnl|my_center|LOCUS_33220 13365 14255 gene locus_tag LOCUS_33230 13365 14255 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529161.1 protein_id gnl|my_center|LOCUS_33230 14900 14277 gene locus_tag LOCUS_33240 14900 14277 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405053.1 protein_id gnl|my_center|LOCUS_33240 15076 16290 gene locus_tag LOCUS_33250 15076 16290 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705769.1 protein_id gnl|my_center|LOCUS_33250 16332 17405 gene locus_tag LOCUS_33260 gene aruF 16332 17405 CDS product arginine/ornithine succinyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085950.1 protein_id gnl|my_center|LOCUS_33260 17405 18448 gene locus_tag LOCUS_33270 gene astA 17405 18448 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989429.1 protein_id gnl|my_center|LOCUS_33270 18448 19917 gene locus_tag LOCUS_33280 gene astD 18448 19917 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177206.1 protein_id gnl|my_center|LOCUS_33280 19914 21287 gene locus_tag LOCUS_33290 gene astB 19914 21287 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268513.1 protein_id gnl|my_center|LOCUS_33290 21295 21780 gene locus_tag LOCUS_33300 21295 21780 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074117.1 protein_id gnl|my_center|LOCUS_33300 22875 21826 gene locus_tag LOCUS_33310 22875 21826 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250267.1 protein_id gnl|my_center|LOCUS_33310 23379 22882 gene locus_tag LOCUS_33320 23379 22882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 23580 24602 gene locus_tag LOCUS_33330 23580 24602 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021661.1 protein_id gnl|my_center|LOCUS_33330 24289 24382 gene locus_tag LOCUS_t00590 24289 24382 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 24672 25421 gene locus_tag LOCUS_33340 24672 25421 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705587.1 protein_id gnl|my_center|LOCUS_33340 25418 26482 gene locus_tag LOCUS_33350 25418 26482 CDS product DUF3541 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081816742.1 protein_id gnl|my_center|LOCUS_33350 27229 26477 gene locus_tag LOCUS_33360 27229 26477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 >Feature sequence35 311 72 gene locus_tag LOCUS_33370 311 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 1735 308 gene locus_tag LOCUS_33380 1735 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 2694 1774 gene locus_tag LOCUS_33390 2694 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 3278 3087 gene locus_tag LOCUS_33400 3278 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 4538 3372 gene locus_tag LOCUS_33410 4538 3372 CDS product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211152.1 protein_id gnl|my_center|LOCUS_33410 6236 4839 gene locus_tag LOCUS_33420 gene fliD 6236 4839 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146764.1 protein_id gnl|my_center|LOCUS_33420 7791 6388 gene locus_tag LOCUS_33430 gene fliD 7791 6388 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146784.1 protein_id gnl|my_center|LOCUS_33430 9089 7860 gene locus_tag LOCUS_33440 9089 7860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 9616 9918 gene locus_tag LOCUS_33450 9616 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 9918 10388 gene locus_tag LOCUS_33460 9918 10388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 12937 10409 gene locus_tag LOCUS_33470 12937 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 14726 13008 gene locus_tag LOCUS_33480 14726 13008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 16093 14723 gene locus_tag LOCUS_33490 16093 14723 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095143.1 protein_id gnl|my_center|LOCUS_33490 18430 16400 gene locus_tag LOCUS_33500 18430 16400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 18708 19550 gene locus_tag LOCUS_33510 18708 19550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 19547 20890 gene locus_tag LOCUS_33520 19547 20890 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102481.1 protein_id gnl|my_center|LOCUS_33520 20922 25562 gene locus_tag LOCUS_33530 20922 25562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 >Feature sequence36 1340 285 gene locus_tag LOCUS_33540 gene hisC 1340 285 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268858.1 protein_id gnl|my_center|LOCUS_33540 1477 2373 gene locus_tag LOCUS_33550 1477 2373 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706015.1 protein_id gnl|my_center|LOCUS_33550 2484 2933 gene locus_tag LOCUS_33560 2484 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 3032 4408 gene locus_tag LOCUS_33570 gene radA 3032 4408 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707405.1 protein_id gnl|my_center|LOCUS_33570 4472 5509 gene locus_tag LOCUS_33580 gene selD 4472 5509 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706081.1 protein_id gnl|my_center|LOCUS_33580 5506 6657 gene locus_tag LOCUS_33590 gene mnmH 5506 6657 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706080.1 protein_id gnl|my_center|LOCUS_33590 7470 6775 gene locus_tag LOCUS_33600 7470 6775 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084901.1 protein_id gnl|my_center|LOCUS_33600 7520 7813 gene locus_tag LOCUS_33610 7520 7813 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728026.1 protein_id gnl|my_center|LOCUS_33610 7839 8417 gene locus_tag LOCUS_33620 7839 8417 CDS product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940102.1 protein_id gnl|my_center|LOCUS_33620 8954 8424 gene locus_tag LOCUS_33630 8954 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 9748 8975 gene locus_tag LOCUS_33640 gene hisF 9748 8975 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106334.1 protein_id gnl|my_center|LOCUS_33640 10509 9751 gene locus_tag LOCUS_33650 gene hisA 10509 9751 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106336.1 protein_id gnl|my_center|LOCUS_33650 11245 10604 gene locus_tag LOCUS_33660 gene hisH 11245 10604 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318304.1 protein_id gnl|my_center|LOCUS_33660 11870 11277 gene locus_tag LOCUS_33670 gene hisB 11870 11277 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_33670 12065 12517 gene locus_tag LOCUS_33680 12065 12517 CDS product acetyl-CoA sensor PanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112623.1 protein_id gnl|my_center|LOCUS_33680 12514 14868 gene locus_tag LOCUS_33690 12514 14868 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112620.1 protein_id gnl|my_center|LOCUS_33690 14944 16032 gene locus_tag LOCUS_33700 gene mutY 14944 16032 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110600.1 protein_id gnl|my_center|LOCUS_33700 16059 16331 gene locus_tag LOCUS_33710 16059 16331 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089995.1 protein_id gnl|my_center|LOCUS_33710 16423 16498 gene locus_tag LOCUS_t00600 16423 16498 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 16505 16579 gene locus_tag LOCUS_t00610 16505 16579 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 16676 16751 gene locus_tag LOCUS_t00620 16676 16751 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 16890 17756 gene locus_tag LOCUS_33720 16890 17756 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895559.1 protein_id gnl|my_center|LOCUS_33720 17743 19146 gene locus_tag LOCUS_33730 gene dnaB 17743 19146 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112283.1 protein_id gnl|my_center|LOCUS_33730 19143 19523 gene locus_tag LOCUS_33740 19143 19523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 19516 19752 gene locus_tag LOCUS_33750 19516 19752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 19801 21690 gene locus_tag LOCUS_33760 19801 21690 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267075.1 protein_id gnl|my_center|LOCUS_33760 21687 22289 gene locus_tag LOCUS_33770 21687 22289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 22289 23650 gene locus_tag LOCUS_33780 22289 23650 CDS product STY4528 family pathogenicity island replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161469396.1 protein_id gnl|my_center|LOCUS_33780 23733 24461 gene locus_tag LOCUS_33790 23733 24461 CDS product TIGR03761 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038897.1 protein_id gnl|my_center|LOCUS_33790 >Feature sequence37 475 1590 gene locus_tag LOCUS_33800 475 1590 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706680.1 protein_id gnl|my_center|LOCUS_33800 1590 2027 gene locus_tag LOCUS_33810 gene etp 1590 2027 CDS product protein-tyrosine-phosphatase Etp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057871.1 protein_id gnl|my_center|LOCUS_33810 2097 4313 gene locus_tag LOCUS_33820 2097 4313 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706678.1 protein_id gnl|my_center|LOCUS_33820 4563 5762 gene locus_tag LOCUS_33830 4563 5762 CDS product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112588.1 protein_id gnl|my_center|LOCUS_33830 5935 5714 gene locus_tag LOCUS_33840 5935 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 6295 7806 gene locus_tag LOCUS_33850 6295 7806 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015922925.1 protein_id gnl|my_center|LOCUS_33850 7803 9224 gene locus_tag LOCUS_33860 7803 9224 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033043268.1 protein_id gnl|my_center|LOCUS_33860 9397 10893 gene locus_tag LOCUS_33870 9397 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 10926 12002 gene locus_tag LOCUS_33880 10926 12002 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202469.1 protein_id gnl|my_center|LOCUS_33880 14229 15293 gene locus_tag LOCUS_33890 14229 15293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 15404 15204 gene locus_tag LOCUS_33900 15404 15204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 15532 16686 gene locus_tag LOCUS_33910 gene vpsA 15532 16686 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) VpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756756.1 protein_id gnl|my_center|LOCUS_33910 16690 17979 gene locus_tag LOCUS_33920 gene wecC 16690 17979 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211985.1 protein_id gnl|my_center|LOCUS_33920 18043 19773 gene locus_tag LOCUS_33930 18043 19773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 19818 21041 gene locus_tag LOCUS_33940 19818 21041 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_33940 21133 21954 gene locus_tag LOCUS_33950 21133 21954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 >Feature sequence38 168 1121 gene locus_tag LOCUS_33960 gene ispH 168 1121 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112824.1 protein_id gnl|my_center|LOCUS_33960 1260 1535 gene locus_tag LOCUS_33970 1260 1535 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213585.1 protein_id gnl|my_center|LOCUS_33970 1513 1782 gene locus_tag LOCUS_33980 1513 1782 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225230.1 protein_id gnl|my_center|LOCUS_33980 2020 1901 gene locus_tag LOCUS_33990 2020 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 3147 2032 gene locus_tag LOCUS_34000 3147 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 3549 3361 gene locus_tag LOCUS_34010 3549 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 3921 4439 gene locus_tag LOCUS_34020 3921 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 4432 4860 gene locus_tag LOCUS_34030 4432 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 4934 5443 gene locus_tag LOCUS_34040 4934 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 5461 7395 gene locus_tag LOCUS_34050 5461 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 7519 8190 gene locus_tag LOCUS_34060 7519 8190 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 protein_id gnl|my_center|LOCUS_34060 9548 8166 gene locus_tag LOCUS_34070 9548 8166 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332950.1 protein_id gnl|my_center|LOCUS_34070 11466 9541 gene locus_tag LOCUS_34080 11466 9541 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384288.1 protein_id gnl|my_center|LOCUS_34080 12248 11463 gene locus_tag LOCUS_34090 12248 11463 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 protein_id gnl|my_center|LOCUS_34090 12550 13305 gene locus_tag LOCUS_34100 12550 13305 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389167.1 protein_id gnl|my_center|LOCUS_34100 13302 14753 gene locus_tag LOCUS_34110 13302 14753 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706379.1 protein_id gnl|my_center|LOCUS_34110 14831 15433 gene locus_tag LOCUS_34120 14831 15433 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389165.1 protein_id gnl|my_center|LOCUS_34120 15426 18281 gene locus_tag LOCUS_34130 15426 18281 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123510.1 protein_id gnl|my_center|LOCUS_34130 >Feature sequence39 182 1030 gene locus_tag LOCUS_34140 182 1030 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 protein_id gnl|my_center|LOCUS_34140 1066 2046 gene locus_tag LOCUS_34150 1066 2046 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 protein_id gnl|my_center|LOCUS_34150 2155 2928 gene locus_tag LOCUS_34160 2155 2928 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_34160 4845 3049 gene locus_tag LOCUS_34170 4845 3049 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974115.1 protein_id gnl|my_center|LOCUS_34170 5215 7176 gene locus_tag LOCUS_34180 5215 7176 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974117.1 protein_id gnl|my_center|LOCUS_34180 8096 7209 gene locus_tag LOCUS_34190 8096 7209 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807047.1 protein_id gnl|my_center|LOCUS_34190 9382 8318 gene locus_tag LOCUS_34200 9382 8318 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244776.1 protein_id gnl|my_center|LOCUS_34200 9678 9442 gene locus_tag LOCUS_34210 9678 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 9707 10786 gene locus_tag LOCUS_34220 9707 10786 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113628.1 protein_id gnl|my_center|LOCUS_34220 10848 11198 gene locus_tag LOCUS_34230 10848 11198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 11256 12110 gene locus_tag LOCUS_34240 11256 12110 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_34240 12198 12638 gene locus_tag LOCUS_34250 12198 12638 CDS product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 protein_id gnl|my_center|LOCUS_34250 12770 14272 gene locus_tag LOCUS_34260 12770 14272 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103710.1 protein_id gnl|my_center|LOCUS_34260 14305 16275 gene locus_tag LOCUS_34270 14305 16275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 16265 17002 gene locus_tag LOCUS_34280 16265 17002 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103914.1 protein_id gnl|my_center|LOCUS_34280 >Feature sequence40 1222 203 gene locus_tag LOCUS_34290 gene nadA 1222 203 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112547.1 protein_id gnl|my_center|LOCUS_34290 1579 1504 gene locus_tag LOCUS_t00630 1579 1504 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1685 1610 gene locus_tag LOCUS_t00640 1685 1610 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2641 1790 gene locus_tag LOCUS_34300 2641 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34300 3513 2638 gene locus_tag LOCUS_34310 3513 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 4451 3510 gene locus_tag LOCUS_34320 4451 3510 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404131.1 protein_id gnl|my_center|LOCUS_34320 5186 4530 gene locus_tag LOCUS_34330 5186 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 7003 5213 gene locus_tag LOCUS_34340 7003 5213 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578046.1 protein_id gnl|my_center|LOCUS_34340 7915 7067 gene locus_tag LOCUS_34350 7915 7067 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_34350 8148 8648 gene locus_tag LOCUS_34360 8148 8648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 12734 8727 gene locus_tag LOCUS_34370 gene purL 12734 8727 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113821.1 protein_id gnl|my_center|LOCUS_34370 12889 14355 gene locus_tag LOCUS_34380 gene mltF 12889 14355 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104806.1 protein_id gnl|my_center|LOCUS_34380 14324 14581 gene locus_tag LOCUS_34390 14324 14581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 >Feature sequence41 1696 65 gene locus_tag LOCUS_34400 1696 65 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093598.1 protein_id gnl|my_center|LOCUS_34400 3561 1768 gene locus_tag LOCUS_34410 3561 1768 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_34410 5074 3659 gene locus_tag LOCUS_34420 5074 3659 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705619.1 protein_id gnl|my_center|LOCUS_34420 5945 5310 gene locus_tag LOCUS_34430 5945 5310 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478721.1 protein_id gnl|my_center|LOCUS_34430 5989 6399 gene locus_tag LOCUS_34440 5989 6399 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085915.1 protein_id gnl|my_center|LOCUS_34440 6476 6865 gene locus_tag LOCUS_34450 6476 6865 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327476.1 protein_id gnl|my_center|LOCUS_34450 6869 7792 gene locus_tag LOCUS_34460 6869 7792 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 protein_id gnl|my_center|LOCUS_34460 9175 7805 gene locus_tag LOCUS_34470 gene cpsB 9175 7805 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605946.1 protein_id gnl|my_center|LOCUS_34470 10776 9208 gene locus_tag LOCUS_34480 10776 9208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 11001 12563 gene locus_tag LOCUS_34490 11001 12563 CDS product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921572.1 protein_id gnl|my_center|LOCUS_34490 >Feature sequence42 1965 484 gene locus_tag LOCUS_34500 gene prpD 1965 484 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103059.1 protein_id gnl|my_center|LOCUS_34500 3289 2099 gene locus_tag LOCUS_34510 gene prpF 3289 2099 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187247.1 protein_id gnl|my_center|LOCUS_34510 6147 3532 gene locus_tag LOCUS_34520 gene acnD 6147 3532 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477783.1 protein_id gnl|my_center|LOCUS_34520 7360 6233 gene locus_tag LOCUS_34530 gene prpC 7360 6233 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070709.1 protein_id gnl|my_center|LOCUS_34530 8292 7402 gene locus_tag LOCUS_34540 gene prpB 8292 7402 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070710.1 protein_id gnl|my_center|LOCUS_34540 9034 8324 gene locus_tag LOCUS_34550 9034 8324 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463438.1 protein_id gnl|my_center|LOCUS_34550 9263 10648 gene locus_tag LOCUS_34560 gene pabB 9263 10648 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267422.1 protein_id gnl|my_center|LOCUS_34560 10759 11490 gene locus_tag LOCUS_34570 10759 11490 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895583.1 protein_id gnl|my_center|LOCUS_34570 12524 11553 gene locus_tag LOCUS_34580 gene cysB 12524 11553 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_34580 >Feature sequence43 917 96 gene locus_tag LOCUS_34590 917 96 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769279.1 protein_id gnl|my_center|LOCUS_34590 1059 2018 gene locus_tag LOCUS_34600 gene rluD 1059 2018 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266591.1 protein_id gnl|my_center|LOCUS_34600 2043 2798 gene locus_tag LOCUS_34610 gene pgeF 2043 2798 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 protein_id gnl|my_center|LOCUS_34610 3111 5693 gene locus_tag LOCUS_34620 gene clpB 3111 5693 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094682.1 protein_id gnl|my_center|LOCUS_34620 6210 7910 gene locus_tag LOCUS_34630 6210 7910 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246092.1 protein_id gnl|my_center|LOCUS_34630 7910 8401 gene locus_tag LOCUS_34640 gene ilvN 7910 8401 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095069.1 protein_id gnl|my_center|LOCUS_34640 9392 8505 gene locus_tag LOCUS_34650 gene ilvY 9392 8505 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 protein_id gnl|my_center|LOCUS_34650 9567 10583 gene locus_tag LOCUS_34660 gene ilvC 9567 10583 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 protein_id gnl|my_center|LOCUS_34660 10748 11629 gene locus_tag LOCUS_34670 gene pssA 10748 11629 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_34670 >Feature sequence44 188 1624 gene locus_tag LOCUS_34680 gene yegQ 188 1624 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211023.1 protein_id gnl|my_center|LOCUS_34680 1685 2329 gene locus_tag LOCUS_34690 1685 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 2437 2877 gene locus_tag LOCUS_34700 2437 2877 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036240.1 protein_id gnl|my_center|LOCUS_34700 4738 3851 gene locus_tag LOCUS_34710 4738 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 4976 4746 gene locus_tag LOCUS_34720 4976 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 5675 5064 gene locus_tag LOCUS_34730 gene coaE 5675 5064 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815573.1 protein_id gnl|my_center|LOCUS_34730 6546 5695 gene locus_tag LOCUS_34740 6546 5695 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 protein_id gnl|my_center|LOCUS_34740 8044 6809 gene locus_tag LOCUS_34750 8044 6809 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_34750 9892 8111 gene locus_tag LOCUS_34760 gene pilB 9892 8111 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_34760 10344 10802 gene locus_tag LOCUS_34770 gene pilA 10344 10802 CDS product type 4a pilus biogenesis protein PilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112842.1 protein_id gnl|my_center|LOCUS_34770 11292 10963 gene locus_tag LOCUS_34780 11292 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 >Feature sequence45 538 128 gene locus_tag LOCUS_34790 538 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 795 568 gene locus_tag LOCUS_34800 795 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 1197 925 gene locus_tag LOCUS_34810 1197 925 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170383.1 protein_id gnl|my_center|LOCUS_34810 1454 1197 gene locus_tag LOCUS_34820 1454 1197 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967242.1 protein_id gnl|my_center|LOCUS_34820 1828 1589 gene locus_tag LOCUS_34830 1828 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 2037 3314 gene locus_tag LOCUS_34840 gene rimO 2037 3314 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086001.1 protein_id gnl|my_center|LOCUS_34840 3427 5304 gene locus_tag LOCUS_34850 3427 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 5347 6918 gene locus_tag LOCUS_34860 5347 6918 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107814.1 protein_id gnl|my_center|LOCUS_34860 7231 8034 gene locus_tag LOCUS_34870 7231 8034 CDS product glycosyltransferase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064624.1 protein_id gnl|my_center|LOCUS_34870 9245 8031 gene locus_tag LOCUS_34880 9245 8031 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060349.1 protein_id gnl|my_center|LOCUS_34880 9795 9316 gene locus_tag LOCUS_34890 9795 9316 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064620.1 protein_id gnl|my_center|LOCUS_34890 <11244 10405 gene locus_tag LOCUS_34900 <11244 10405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368514.1:Fic family protein >Feature sequence46 207 291 gene locus_tag LOCUS_t00650 207 291 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 393 1688 gene locus_tag LOCUS_34910 gene bioA 393 1688 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819662.1 protein_id gnl|my_center|LOCUS_34910 1717 2022 gene locus_tag LOCUS_34920 1717 2022 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705368.1 protein_id gnl|my_center|LOCUS_34920 2019 3050 gene locus_tag LOCUS_34930 2019 3050 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387829.1 protein_id gnl|my_center|LOCUS_34930 4457 3078 gene locus_tag LOCUS_34940 gene rmuC 4457 3078 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704261.1 protein_id gnl|my_center|LOCUS_34940 4605 5612 gene locus_tag LOCUS_34950 4605 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 5739 7970 gene locus_tag LOCUS_34960 5739 7970 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 protein_id gnl|my_center|LOCUS_34960 8044 8451 gene locus_tag LOCUS_34970 8044 8451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 8679 9281 gene locus_tag LOCUS_34980 8679 9281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 9706 9347 gene locus_tag LOCUS_34990 9706 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 9869 10018 gene locus_tag LOCUS_35000 9869 10018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 10957 10421 gene locus_tag LOCUS_35010 10957 10421 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751961.1 protein_id gnl|my_center|LOCUS_35010 >Feature sequence47 343 2790 gene locus_tag LOCUS_35020 gene fadE 343 2790 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095726.1 protein_id gnl|my_center|LOCUS_35020 4908 2992 gene locus_tag LOCUS_35030 4908 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 5854 5036 gene locus_tag LOCUS_35040 5854 5036 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925927.1 protein_id gnl|my_center|LOCUS_35040 8055 5851 gene locus_tag LOCUS_35050 8055 5851 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_35050 8979 8185 gene locus_tag LOCUS_35060 8979 8185 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_35060 9258 10184 gene locus_tag LOCUS_35070 9258 10184 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537869.1 protein_id gnl|my_center|LOCUS_35070 >Feature sequence48 927 157 gene locus_tag LOCUS_35080 927 157 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230080.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35080 1144 2130 gene locus_tag LOCUS_35090 1144 2130 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485699.1 protein_id gnl|my_center|LOCUS_35090 2161 2559 gene locus_tag LOCUS_35100 2161 2559 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031076.1 protein_id gnl|my_center|LOCUS_35100 2559 3665 gene locus_tag LOCUS_35110 2559 3665 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230077.1 protein_id gnl|my_center|LOCUS_35110 3662 4585 gene locus_tag LOCUS_35120 3662 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 4588 6462 gene locus_tag LOCUS_35130 4588 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 6449 7579 gene locus_tag LOCUS_35140 gene ribA 6449 7579 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391384.1 protein_id gnl|my_center|LOCUS_35140 8421 7597 gene locus_tag LOCUS_35150 8421 7597 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 protein_id gnl|my_center|LOCUS_35150 9230 8418 gene locus_tag LOCUS_35160 9230 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 >Feature sequence49 <1 950 gene locus_tag LOCUS_35170 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808831.1:aliphatic sulfonate ABC transporter substrate-binding protein 947 1711 gene locus_tag LOCUS_35180 gene ssuC 947 1711 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191980.1 protein_id gnl|my_center|LOCUS_35180 1708 2478 gene locus_tag LOCUS_35190 1708 2478 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113103.1 protein_id gnl|my_center|LOCUS_35190 2516 2815 gene locus_tag LOCUS_35200 2516 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063654.1 protein_id gnl|my_center|LOCUS_35200 3404 3030 gene locus_tag LOCUS_35210 gene mvaT 3404 3030 CDS product transcriptional regulator MvaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093888.1 protein_id gnl|my_center|LOCUS_35210 3639 4073 gene locus_tag LOCUS_35220 3639 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 4070 5020 gene locus_tag LOCUS_35230 4070 5020 CDS product TIGR03756 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024483820.1 protein_id gnl|my_center|LOCUS_35230 5034 6515 gene locus_tag LOCUS_35240 5034 6515 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066267402.1 protein_id gnl|my_center|LOCUS_35240 6515 6895 gene locus_tag LOCUS_35250 6515 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 >Feature sequence50 103 333 gene locus_tag LOCUS_35260 103 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 378 1199 gene locus_tag LOCUS_35270 378 1199 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 protein_id gnl|my_center|LOCUS_35270 1213 1779 gene locus_tag LOCUS_35280 1213 1779 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402228.1 protein_id gnl|my_center|LOCUS_35280 1858 2913 gene locus_tag LOCUS_35290 1858 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 3332 4429 gene locus_tag LOCUS_35300 3332 4429 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524076.1 protein_id gnl|my_center|LOCUS_35300 4670 5404 gene locus_tag LOCUS_35310 gene anr 4670 5404 CDS product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 protein_id gnl|my_center|LOCUS_35310 5531 7435 gene locus_tag LOCUS_35320 5531 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 >Feature sequence51 1858 587 gene locus_tag LOCUS_35330 gene ltrA 1858 587 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393716.1 protein_id gnl|my_center|LOCUS_35330 2548 3927 gene locus_tag LOCUS_35340 2548 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 4686 4264 gene locus_tag LOCUS_35350 gene mscL 4686 4264 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932912.1 protein_id gnl|my_center|LOCUS_35350 5289 4843 gene locus_tag LOCUS_35360 5289 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 5540 5983 gene locus_tag LOCUS_35370 5540 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 >Feature sequence52 970 125 gene locus_tag LOCUS_35380 970 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 1077 1985 gene locus_tag LOCUS_35390 1077 1985 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703863.1 protein_id gnl|my_center|LOCUS_35390 2705 2001 gene locus_tag LOCUS_35400 2705 2001 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460538.1 protein_id gnl|my_center|LOCUS_35400 4179 2773 gene locus_tag LOCUS_35410 gene merA 4179 2773 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281123.1 protein_id gnl|my_center|LOCUS_35410 4435 4172 gene locus_tag LOCUS_35420 gene merF 4435 4172 CDS product mercury resistance system transport protein MerF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654684.1 protein_id gnl|my_center|LOCUS_35420 4728 4432 gene locus_tag LOCUS_35430 gene merP 4728 4432 CDS product mercury resistance system periplasmic binding protein MerP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732292.1 protein_id gnl|my_center|LOCUS_35430 5093 4743 gene locus_tag LOCUS_35440 gene merT 5093 4743 CDS product mercuric ion transporter MerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294667.1 protein_id gnl|my_center|LOCUS_35440 5166 5585 gene locus_tag LOCUS_35450 gene merR 5166 5585 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429836.1 protein_id gnl|my_center|LOCUS_35450 >Feature sequence53 246 28 gene locus_tag LOCUS_35460 246 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 652 4785 gene locus_tag LOCUS_35470 652 4785 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074836736.1 protein_id gnl|my_center|LOCUS_35470 5486 4953 gene locus_tag LOCUS_35480 5486 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 >Feature sequence54 583 17 gene locus_tag LOCUS_35490 583 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 3390 583 gene locus_tag LOCUS_35500 3390 583 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546856.1 protein_id gnl|my_center|LOCUS_35500 3836 4228 gene locus_tag LOCUS_35510 3836 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 5182 4241 gene locus_tag LOCUS_35520 5182 4241 CDS product IS1595-like element ISXca4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037261.1 protein_id gnl|my_center|LOCUS_35520 5482 5285 gene locus_tag LOCUS_35530 5482 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 >Feature sequence55 455 213 gene locus_tag LOCUS_35540 455 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 728 558 gene locus_tag LOCUS_35550 728 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 3280 887 gene locus_tag LOCUS_35560 3280 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 3645 3277 gene locus_tag LOCUS_35570 3645 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 3870 3658 gene locus_tag LOCUS_35580 3870 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 4691 4137 gene locus_tag LOCUS_35590 4691 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 >Feature sequence56 1962 331 gene locus_tag LOCUS_35600 1962 331 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 protein_id gnl|my_center|LOCUS_35600 2064 2330 gene locus_tag LOCUS_35610 2064 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 3431 2340 gene locus_tag LOCUS_35620 gene thiO 3431 2340 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895678.1 protein_id gnl|my_center|LOCUS_35620 3527 4117 gene locus_tag LOCUS_35630 3527 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 >Feature sequence57 <1 690 gene locus_tag LOCUS_35640 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084592.1:IS66-like element ISBj7 family transposase 734 1018 gene locus_tag LOCUS_35650 734 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 1401 2327 gene locus_tag LOCUS_35660 1401 2327 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_35660 3711 2431 gene locus_tag LOCUS_35670 3711 2431 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289498.1 protein_id gnl|my_center|LOCUS_35670 4116 3766 gene locus_tag LOCUS_35680 4116 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 >Feature sequence58 169 3793 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttctatccgcgcgccccgtgcggggcgcgac >Feature sequence59 129 3051 gene locus_tag LOCUS_r00020 129 3051 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1265 1360 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence60 402 608 gene locus_tag LOCUS_35690 402 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 605 1252 gene locus_tag LOCUS_35700 605 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 1249 2076 gene locus_tag LOCUS_35710 1249 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 2114 2518 gene locus_tag LOCUS_35720 2114 2518 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144317.1 protein_id gnl|my_center|LOCUS_35720 2701 2850 gene locus_tag LOCUS_35730 2701 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 >Feature sequence61 130 1188 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttctatccgcgcgccccgtgcggggcgcgac 1668 1378 gene locus_tag LOCUS_35740 gene cas2 1668 1378 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384683.1 protein_id gnl|my_center|LOCUS_35740 2733 1693 gene locus_tag LOCUS_35750 gene cas1c 2733 1693 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388588.1 protein_id gnl|my_center|LOCUS_35750 >Feature sequence62 134 1657 gene locus_tag LOCUS_35760 gene istA 134 1657 CDS product IS21-like element ISBf2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203618.1 protein_id gnl|my_center|LOCUS_35760 1644 2384 gene locus_tag LOCUS_35770 gene istB 1644 2384 CDS product IS21-like element ISMac3 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021079.1 protein_id gnl|my_center|LOCUS_35770 >Feature sequence63 1 192 gene locus_tag LOCUS_35780 1 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 229 735 gene locus_tag LOCUS_35790 229 735 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532319.1 protein_id gnl|my_center|LOCUS_35790 1144 2202 gene locus_tag LOCUS_35800 1144 2202 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 protein_id gnl|my_center|LOCUS_35800 >Feature sequence64 132 1388 gene locus_tag LOCUS_35810 gene istA 132 1388 CDS product IS21-like element ISSme2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970474.1 protein_id gnl|my_center|LOCUS_35810 1388 2185 gene locus_tag LOCUS_35820 gene istB 1388 2185 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050382252.1 protein_id gnl|my_center|LOCUS_35820 >Feature sequence65 1654 374 gene locus_tag LOCUS_35830 1654 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 >Feature sequence66 674 48 gene locus_tag LOCUS_35840 674 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 576 776 gene locus_tag LOCUS_35850 576 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 1520 768 gene locus_tag LOCUS_35860 1520 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 >Feature sequence67 459 1415 gene locus_tag LOCUS_35870 459 1415 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523004.1 protein_id gnl|my_center|LOCUS_35870 >Feature sequence68 1476 274 gene locus_tag LOCUS_35880 1476 274 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970928.1 protein_id gnl|my_center|LOCUS_35880 >Feature sequence69 1343 993 gene locus_tag LOCUS_35890 gene tnpB 1343 993 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612591.1 protein_id gnl|my_center|LOCUS_35890 >Feature sequence70 1320 286 gene locus_tag LOCUS_35900 1320 286 CDS product IS110-like element ISPsy7 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010213088.1 protein_id gnl|my_center|LOCUS_35900 >Feature sequence71 1121 765 gene locus_tag LOCUS_35910 gene tnpB 1121 765 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005747908.1 protein_id gnl|my_center|LOCUS_35910 1327 1118 gene locus_tag LOCUS_35920 1327 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 >Feature sequence72 >Feature sequence73 844 32 gene locus_tag LOCUS_35930 844 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35930 1176 883 gene locus_tag LOCUS_35940 1176 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35940 >Feature sequence74 1135 137 gene locus_tag LOCUS_35950 1135 137 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010213957.1 protein_id gnl|my_center|LOCUS_35950 >Feature sequence75 682 134 gene locus_tag LOCUS_35960 682 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 872 1105 gene locus_tag LOCUS_35970 872 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 >Feature sequence76 760 41 gene locus_tag LOCUS_35980 760 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 >Feature sequence77 897 31 gene locus_tag LOCUS_35990 897 31 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878218.1 protein_id gnl|my_center|LOCUS_35990